sort by

197 publications mentioning mmu-mir-221 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-221. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 534
Yet, although levels of p27 [Kip1] in miR-221 overexpressing fibroblasts were very low, the individual knockdown of this protein led to a phenotype that somewhat resembled the phenotype of p27 [Kip1]- deleted fibroblasts, but did not resemble in any way the phenotype of miR-221 overexpressing cells, suggesting that miR-221 target regulation is more complex then the downregulation of one predominant target. [score:14]
Our array analysis showed that the transcriptomes of miR-221 -overexpressing cells differed by the expression of 740 genes compared to the controls, and the Sylamer analysis indicated that many of the downregulated genes in mast cells were likely to be directly affected by miR-221 expression, suggesting that the effect of this miRNA goes through the fine modulation of a multitude of targets. [score:12]
Some of the targets that were up- or downregulated were also confirmed at protein level; among others, we selected two of the already known targets for miR-221, Kit and Cdkn1b [8], [24], [31], as well as one upregulated gene (Il2Ra) that is particularly relevant in mast cell biology as a marker for systemic mastocytosis [32], [33]. [score:11]
To better understand how miR-221 could regulate gene expression specifically in mast cells, we therefore performed a Sylamer analysis [19] on the complete gene list from the arrays, which was ranked from most downregulated to most upregulated (left to right in the graph in Figure 3C). [score:10]
As for targets, our arrays data and bioinformatics analysis showed that expression of miR-221 led to the downregulation of 343 genes, many of which are likely to be primary targets, containing the miR-221 seed-complementary sequence in their 3′UTR. [score:10]
We observed an inverse relation between Plzf and miR-221 expression during mast cell differentiation, and ectopic expression of PLZF in mast cells diminished miR-221 expression in response to acute stimulation, suggesting that PLZF is able to repress miR-221-222 induction either directly or indirectly, and possibly through PLZF -binding regulatory elements in the miR-221-222 locus [8]. [score:10]
As a result of binding of the overexpressed miRNAs to their cognate sites in the 3′ UTR of the GFP reporter mRNA expressed from the miRT, GFP expression was strongly reduced specifically in cells expressing miR-221 but not the mutant miR-221m. [score:9]
In our hands, p27 [Kip1] was a striking example of this phenomenon, as while it was downregulated very strongly upon miR-221 expression, its knockdown did not recapitulate the complex effect of miR-221 expression. [score:9]
The pAPM/pAGM vectors were used to overexpress miR-221 or miR-222; as control, we used a mutant version of miR-221 (miR-221m), containing mutations in the seed region to abrogate target recognition, as well as a vector expressing an irrelevant hairpin (shLuc) (Figure 1B). [score:8]
Analyzing the data from our transcriptome profiling, we found that in the ‘cytoskeleton’ group of downregulated genes, the top candidate, most downregulated gene was Cdkn1b (p27 [Kip1]), and specifically the one splice variant that can be regulated by miR-221/-222 (as we previously described in [8]). [score:8]
B) Comparison between significantly downregulated genes and genes predicted to be miR-221 targets by microCosm and Targetscan. [score:8]
Despite such strong downregulation of the cell-cycle inhibitor p27 [Kip1], 3T3 cells overexpressing miR-221 showed the same reduced proliferation that we previously described for mast cells (Figure 6C) [8]. [score:8]
Although some of the targets for miR-221 were individually confirmed, our arrays experiments and Sylamer analysis indicated that miR-221 determines the downregulation of more than 200 primary targets and the subsequent secondary alterations of many genes in the transcriptome. [score:8]
Moreover, 3T3 cells overexpressing miR-221 showed overall altered morphology, with odd, elongated and/or irregular shapes (Figure 6D), as well as a slightly increased content of F-actin (Figure 6E), indicating that the miR-221 -dependent effects on the cytoskeleton and cell cycle observed in resting mast cells are likely to be due to the dysregulation of targets that are ubiquitously expressed and are therefore cell type-independent. [score:8]
Out of ∼42.000 transcripts analyzed, we found 397 significantly upregulated genes in miR-221 -expressing BMMCs, as well as 343 significantly downregulated genes as compared to cells transduced with miR-221m (Figure 3A). [score:8]
However, since we did not perform knockdown of every individual potential target, the possibility remains that the effect of miR-221 in mast cells and fibroblasts might be mediated by the downregulation of one or few predominant genes that we were so far unable to identify. [score:7]
In this case, the upper left portion of the plot represents an influence of miRNAs on downregulated genes (Figure 3C), indicating a specific influence of miR-221 on a subset of downregulated genes. [score:7]
While we were able to show that at least some of these effects may be linked to a miR-221 -dependent regulation of the actin cytoskeleton in mast cells, this miRNA may have both ‘housekeeping’ functions, active in different cell types, like the regulation of the cytoskeleton and cell cycle, but also cell-specific effects on targets such as KIT and CD25 that are expressed by mast cells but not fibroblasts. [score:7]
KIT is a target for miR-221 [24], therefore, to understand whether the reduced migration was due to an intrinsic feature of cells overexpressing miR-221, or to a reduced ability to ‘sense’ SCF in the environment due to lowered expression of KIT, we repeated the same experiment sensitizing BMMCs with IgE-anti-DNP prior inducing migration towards DNP-HSA (Figure 2C, left panel ). [score:7]
As we previously described for acute stimulation of mast cells [8], BMMCs stimulated with IgE-antigen complexes upregulated miR-221 expression (Figure 1A). [score:6]
Since miR-221 is expressed at basal level in mast cells, but it is also inducible upon stimulation, we propose a mo del in which miR-221 has a dual roles in these cells: at resting state, it contributes to the regulation of the cell cycle and cytoskeleton, a housekeeping effect that can be observed also in different cell types expressing this miRNA. [score:6]
Most importantly, the knockdown of p27 [Kip1] did not recapitulate the phenotype we observed in miR-221 overexpressing 3T3 cells, as cell cycle and cellular shape were either unaltered or completely different from what we observed in miR-221-transduced cells, suggesting (as indeed indicated by our Sylamer analysis), that the effect of this miRNA is composite and goes through the down-modulation of multiple targets. [score:6]
Since miR-221 overexpression was sufficient by itself to increase adherence, our data indicate that endogenous miR-221/-222 upregulation upon cell activation may contribute to the increased adherence of mast cells observed upon stimulation. [score:6]
Importantly, the known miR-221 targets Cdkn1b (p27 [Kip1]) and Kit were found to be downregulated with a mean fold-change repression of -3.2 and -2.0, respectively. [score:6]
0026133.g007 Figure 7Knockdown of the miR-221 target p27 [Kip1] does not recapitulate the composite effects of miR-221 expression. [score:6]
Knockdown of the miR-221 target p27 [Kip1] does not recapitulate the composite effects of miR-221 expression. [score:6]
However, ectopic expression of PLZF in differentiated mast cells had no effect on the basal levels of endogenous miR-221, indicating that other factors regulate basal expression of this miRNA in mast cells. [score:6]
To assess whether miR-221 -dependent down-regulation of p27 [Kip1] may have a role in regulating 3T3 and mast cells shape and cytoskeleton, we therefore performed a knockdown of p27 [Kip1] in 3T3 cells using siRNAs (Figure 7). [score:6]
While stimulation -dependent upregulation of this miRNA could be favored by SCF co-stimulation, SCF alone had no effect on miR-221 expression (not shown). [score:6]
Along the line of a possible role of these miRNAs in mast cell-related diseases, we showed that miR-221 and miR-222 regulate levels of KIT expression in mast cells. [score:6]
Compared to untransduced, unstimulated cells (expression set to 1 in Figures 1C and 1D), transduction of primary mast cells with pAGM/pAPM-miR-221 increased miR-221 expression by ∼60-fold, whereas transduction with miRT-221 decreased expression by ∼10-fold (Figure 1D). [score:6]
To assess whether miR-221/-222 may have a direct role in regulating the differentiation process in mast cells, we transduced bone marrow-derived hematopoietic progenitors with lentiviruses to either overexpress (pAPM) or ablate (miRT) miR-221 and/or miR-222 early during mast cell differentiation (Supplementary Figure S1). [score:5]
Transcriptional profiling and bioinformatics analysis using the Sylamer algorithm [10], indicated that miR-221 effects in mast cells were mediated by the alterations of the level of expression of many primary and secondary targets. [score:5]
MiR-221 overexpression in 3T3 cells led to a strong downregulation of endogenous p27 [Kip1], even more remarkable than the one observed in mast cells (Figure 6B). [score:5]
Indeed, we found that alteration of miR-221 expression in mast cells and fibroblasts led not only to a reduction in cell proliferation similar to what we previously described using a different expression system, but also to an alteration of actin content and overall cellular shape in both cell types. [score:5]
MiR-221 is upregulated upon mast cell activation and its expression levels can be altered using lentivirus -based systems. [score:5]
In this context, it is important to highlight that miR-221 overexpression did not alter surface expression of FcεRI (see below). [score:5]
3T3 cells expressed low levels of endogenous miR-221 that were increased ∼20-folds upon transduction with a miR-221 expressing vector (Figure 6A). [score:5]
The mean fluorescence intensity (MFI) for KIT expression in miR-221- (red) and shLuc- (black) expressing cells is also indicated. [score:5]
Strikingly, not only miR-221 -overexpressing cells showed increased numbers of adherent cells (as shown also in Figure 2D), but while the actin ring underneath the plasma membrane was barely visible in control cells, cells overexpressing miR-221 (or miR-222, not shown) showed the presence of a much thicker ring (Figure 5A). [score:5]
To assess the functional effects of miRNA overexpression/ablation, the mast cell line MC/9 was transduced to overexpress miR-221 or the mutant miR-221m. [score:5]
MiR-221 and -222 share the same seed sequence (Figure 1B), and should recognize the same targets [9]; although most of the experiments shown here were performed primarily with miR-221, we also performed experiments using miR-222 -expressing vectors, which always gave results similar to miR-221, both in mast cells and in fibroblasts (not shown). [score:5]
The discernible, albeit modest, migration of control-transduced cells towards the antigen was significantly impaired if miR-221 was overexpressed, indicating that the reduced migration was due to effects of miR-221 on targets other than KIT. [score:5]
The mean fold increase for Il2Ra from the arrays was 2.1, which strongly correlated with the increased surface expression of this marker in cells overexpressing miR-221 (Figure 4C). [score:5]
D) BMMCs were transduced with miRT-221 (depleting) or miR-221 (overexpressing) vectors, and miR-221 expression levels were assessed by TaqMan qRT-PCR. [score:5]
The horizontal dotted line was added as a reference to appreciate the expected KIT dowregulation in miR-221 expressing cells. [score:4]
Importantly, such miR-221 -mediated alterations of the cell phenotype could not be recapitulated by knockdown of one of the most prominent target for miR-221, suggesting that the observed effect of miR-221 in resting mast cells and fibroblasts is likely to be composite, due to the alteration of many genes. [score:4]
Although such higher levels of degranulation and cytokine production are usually considered to be the result of increased levels of FcεRI, the fact that miR-221 -expressing cells showed no perturbation of FcεRI expression and at the same time increased adherence (even in the absence of stimulation), increased degranulation as well as cytokine production suggests that miR-221 may contribute to such intensified cellular response upon secondary challenge. [score:4]
To investigate the role of miR-221 in regulating primary mast cell functions, we developed a lentiviral system to manipulate miRNA expression in primary BMMC and used it to alter miR-221 expression. [score:4]
In resting conditions, cells did not degranulate, regardless of miRNA expression (Figure 2A, top panel) but, upon stimulation with IgE and antigen, BMMCs overexpressing miR-221 degranulated more compared to the controls (Figure 2A, lower panel), although they also showed a slightly reduced content of β-hexosaminidase in the granules to begin with (Figure 2A, top panel). [score:4]
At resting state, basal levels of miR-221 expression would regulate homeostatic mechanisms such as the cell cycle and cytoskeleton. [score:4]
Identification of genes dysregulated upon miR-221 overexpression in BMMCs. [score:4]
Specifically, miR-221 may have a ‘housekeeping’ function in resting mast cells, where it is expressed at low, basal levels, and contributes to the regulation of the cell cycle and cytoskeleton. [score:4]
To gain insight into the mechanisms underlying such pleiotropic effects of miR-221 in mast cells, we performed a microarray analysis of BMMCs overexpressing miR-221 or miR-221m, as it has been reported that indeed the impact of a miRNA on protein production can be closely approximated using mRNA arrays [27]. [score:3]
0026133.g001 Figure 1 A) Differentiated BMMCs were either left resting or were stimulated with 1.5 µg/mL IgE anti-DNP, 0.2 µg/mL DNP-HSA and 20ng/mL SCF prior analysis of miR-221 expression by TaqMan qRT-PCR. [score:3]
Cells transduced with shLuc and miR-221 vectors were selected with 2 µg/mL puromycin, while cells transduced with the miRT vectors (empty, T-221 and T-221-222) were FACS-sorted for GFP expression. [score:3]
Initial experiments were performed using a vector (Tween) that induced only modest overexpression (∼4-fold), similar to the levels of endogenous miR-221 observed upon cell stimulation (Figure 1A) [8]. [score:3]
To further confirm these results and to assess the effect of different conditions of stimulation (namely IgE crosslinking with or without SCF co-stimulation), we assessed degranulation of cells overexpressing miR-221 or controls by using a staining with annexin V. This staining takes advantage of the fact that mast cells do not die upon stimulation (which is instead a survival factor [26]) and that during the membrane fusion process of degranulation, annexin V binding occurs at sites of secretory granule exposure to the cell surface [16], [17]. [score:3]
SnoRNA202 was used as endogenous control; for comparison, levels of miR-221 expression in the shLuc-transduced sample were set to one. [score:3]
The ‘miRNA target’ (miRT) vectors contain four miRNA binding sites (miR-bs) cloned downstream a GFP reporter gene, and they were used to functionally ablate miR-221/-222 [12]. [score:3]
However, compared to the controls (shLuc and miR-221m) miR-221 overexpression increased degranulation in response to IgE, as shown already by β-hexosaminidase assay, but miR-221 -overexpressing cells did not further degranulate in response to the combination of both SCF and IgE crosslinking (middle panel). [score:3]
Degranulation, migration and adherence of cells overexpressing miR-221. [score:3]
The red shading in the figure indicates the difference between IgE versus IgE+SCF stimulation in control cell, which is reduced in miR-221 -expressing cells). [score:3]
D) Total RNA was extracted from cells treated as in C) at the end of the differentiation period (percentage of FcεRIα+ KIT+ cells was greater than 90%), and expression of miR-221 was assessed by TaqMan qRT-PCR. [score:3]
However, in miR-221 -expressing cells, in addition to increased degranulation (Figure 2, panels A and B), we also observed increased cytokine production (IL-6 and TNFα) in response to IgE crosslinking, but not to LPS (Supplementary Figure S2 and data not shown). [score:3]
After selection with 2 µg/mL puromycin for 48h, miR-221 expression levels were assessed by TaqMan qRT-PCR. [score:3]
The miRNA target (miRT) vectors containing four sequences fully complementary to miR-221 and/or miR-222, were provided by Bernhard Gentner and Luigi Naldini [12]. [score:3]
In this perspective, it is important to highlight that although transcription of pri-miR-221-222 starts early upon IgE stimulation, mature miR-221 accumulation occurs with a ‘slow’ kinetic (the peak of mature miRNA expression is reached at ∼24h after initial stimulation) [8]. [score:3]
0026133.g006 Figure 6 A) 3T3 cells were transduced with lentiviral vectors to express either miR-221 or controls shLuc and miR-221m. [score:3]
Figure S1 MiR-221 expression can be regulated by the transcriptional repressor PLZF, but it has no role in BMMC differentiation. [score:3]
Specifically, at basal levels, in resting conditions, these effects are likely to be linked, at least in part, to the regulation of the actin cytoskeleton and cell cycle, two features that are regulated by miR-221 independently of the cell type. [score:3]
Differentiated BMMCs were lentivirally transduced to force expression of miR-221, followed by analysis of the effects on mast cell degranulation, migration and adherence (Figure 2). [score:3]
C) Lin– cells were transduced with the indicated vectors to either force (pAPM) or ablate (miRT) miR-221 expression, and were cultured for three weeks in the presence of IL-3 to allow mast cell differentiation. [score:3]
In all conditions and time-points tested, there was no significant difference in ERK phosphorylation in cells overexpressing miR-221 compared to the controls, suggesting that miR-221 might not affect directly the signaling cascade from the FcεRI. [score:3]
Transduction efficiency and levels of miR-221 expression or depletion are representative of tens of experiments, including all the experiments shown hereafter. [score:3]
As assessed by surface staining, levels of KIT, but not of FcεRI, were significantly diminished (∼2-fold) in BMMCs overexpressing miR-221 (Figure 4A). [score:3]
0026133.g003 Figure 3 A) Double-log scatter plot comparing the differential expression of mRNAs in BMMCs transduced with the miR-221 and miR-221m. [score:3]
A) Double-log scatter plot comparing the differential expression of mRNAs in BMMCs transduced with the miR-221 and miR-221m. [score:3]
To assess whether miR-221 expression could affect the cytoskeleton, we stained transduced BMMCs with phalloidin (Figure 5A). [score:3]
These effects are not necessarily cell type-specific, as they can be active also in fibroblasts, which also express miR-221. [score:3]
This observation may indicate that miR-221 expression favors mast cell activation in response to IgE-antigen complexes, however in a way that doesn't seem to grossly affect ERK phosphorylation. [score:3]
To address the possible relation between PLZF and miR-221, we analyzed expression of both Plzf mRNA and miR-221 during mast cell differentiation (Supplementary Figure S1). [score:3]
Our lab identified miR-221/-222 as a family of miRNAs that is transcriptionally induced upon mast cell activation, and we showed that expression of miR-221 and/or miR-222 to levels similar to the endogenous of activated mast cells, led to reduced mast cell proliferation [8]. [score:3]
A) Differentiated BMMCs were either left resting or were stimulated with 1.5 µg/mL IgE anti-DNP, 0.2 µg/mL DNP-HSA and 20ng/mL SCF prior analysis of miR-221 expression by TaqMan qRT-PCR. [score:3]
A) 3T3 cells were transduced with lentiviral vectors to express either miR-221 or controls shLuc and miR-221m. [score:3]
Specifically, we found that although miR-221 does not seem to affect mast cell differentiation, it has important roles in regulating multiple processes in differentiated mast cells, such as degranulation, adhesion and migration, some of which may be linked to a dysregulation in the actin cytoskeleton. [score:3]
Point mutations in the seed sequence of miR-221 were introduced using the Quick Change Site-Directed Mutagenesis kit (Stratagene) and the following primers (mutations underlined): miR-221mFW: 5′-GTTTGTTAGGCAACA TC GCGATTGTCTGCTGGGTTTCAGG; miR-221mRV: 5′- CCTGAAACCCAGCAGACAAT CGCG ATGTTGCCTAACAAAC. [score:3]
B) Schematic representation of the lentiviral vectors used to stably overexpress or functionally ablate miR-221 and miR-222 in BMMCs. [score:3]
Total RNA from Lin– derived mast cells was used to assess Plzf mRNA expression (upper panel) and miR-221 (lower panel). [score:3]
After puromycin selection for 48h, cells were either left untreated or were stimulated with 20nM PMA and 1 µM ionomycin for 24h, prior RNA extraction and analysis of Plzf and miR-221 expression. [score:3]
Cells transduced with shLuc, miR-221 and miR-221m vectors were selected with 2 µg/mL puromycin, while cells transduced with the miRT vectors (empty, T-221 and T-221-222) were FACS-sorted for GFP expression. [score:3]
MiR-221 and miR-222 derive from the same primary transcript and share the same seed sequence, implying that they should recognize the same targets [9]. [score:3]
After selection with 2 µg/mL for at least 2 days, total RNA was extracted and levels of miR-221 expression were assessed by TaqMan qRT-PCR. [score:3]
This could be due to the fact that the SCF receptor KIT is expressed at lower levels on these cells (see below), or to the fact that in the presence of miR-221 cells are activated more strongly upon IgE crosslinking, and cannot be further activated by the combination of IgE and SCF. [score:3]
SnoRNA202 was used as endogenous control, with levels of miR-221 expression set to one in the shLuc-transduced sample. [score:3]
Therefore, to gain insights into the function of the genes that showed altered expression in the presence of miR-221, we performed functional grouping and gene ontology (GO) analysis, and found that many basic biological processes were affected (Table 1). [score:3]
We therefore used both validated systems (overexpression and ablation) to study mast cell differentiation in the presence or absence of miR-221. [score:3]
This finding may suggest that in resting, unstimulated cells, miR-221/-222 regulate basic metabolic processes that are common to many different cell types and/or species, and correlates with the fact that these miRNAs belong to a family very conserved in evolution, down to at least zebrafish [8]. [score:2]
Figure S3 MiR-221 expression favors mast cell survival in response to withdrawal of essential cytokines. [score:2]
While miR-221/-222 were already implicated in various human cancers for their effect on proliferation, we show here for the first time that these miRNAs also regulate mast cell adhesion, migration, and survival, all processes that may have implications in mastocytosis. [score:2]
Although the mechanisms underlying the role of miR-221 specifically in mast cells in both resting and stimulated conditions will require further investigation and will be the subject of future work, our data show that the effect of this miRNA goes through the alteration of the levels of many targets in the mast cell transcriptome, that it has important roles in regulating mast cell physiology, and finally that at least some of its biologic effects in resting cells may be explained by alterations in the actin cytoskeleton of mast cells. [score:2]
However, in response to stimulation through IgE-antigen complexes, miR-221 effects are mast cell-specific and activation -dependent, contributing to the regulation of degranulation, cytokine production and cell adherence. [score:2]
Vice versa, miR-221 is also transcriptionally activated upon stimulation, and in this case it would contribute to the regulation of cell-type specific, FcεRI -dependent mechanisms, such as cytokine production, degranulation and cell adhesion. [score:2]
On the other hand, miR-221 also influenced many other features of differentiated mast cells, including cytokine production, migration, adhesion and survival upon withdrawal of essential cytokines (Supplementary Figure S3), all mechanisms that may be involved in regulating tissue accumulation and resolution of hyperplasia upon eradication of inflammation in vivo. [score:2]
Since mature mast cells do not normally circulate in vivo, but reside in tissues, we explored whether miR-221 had any role in regulating cell adherence and migration, as these are essential processes not only under normal homeostatic conditions, but also during inflammation and tumorigenesis. [score:2]
Moreover, when we quantified the overall cellular amount of F-actin in cells depleted for miR-221 (using the miRT-depleting vectors), we observed a small but reproducible decrease in the amount of F-actin present in these cells (Figure 5B), further indicating that these miRNAs might be important regulators of the actin organization in mast cells. [score:2]
Increased adherence is a normal process observed upon stimulation of mast cells with IgE and antigen, however, BMMCs expressing miR-221 adhered at a higher percentage compared to the controls even in resting, unstimulated conditions. [score:2]
In this context, it will be interesting to assess whether miR-221/-222 could be part of a molecular mechanism involved in KIT regulation specifically in mastocytosis. [score:2]
These results may point towards a role for miR-221 in regulating the signaling cascade originating from the FcεRI. [score:2]
We found that cells overexpressing miR-221 migrated significantly less towards SCF as compared to the controls (Figure 2C, right panel ). [score:2]
Although clearly able to regulate some general cellular features, such as cell cycle and cytoskeleton in resting mast cell, we speculate that miR-221/-222 may also be part of a mechanism that contribute to mediate many of the changes that occur in mast cells upon stimulation. [score:2]
MiR-221 primary and secondary targets are altered also at protein level. [score:2]
Figure S2 MiR-221 expression does not significantly alter ERK phosphorylation in mast cells, but favors cytokine production. [score:2]
Although still speculative, we propose a mo del in which miR-221 would have two different roles in mast cells: in resting cells, it contributes to normal cell homeostasis through the regulation of the cell cycle and cytoskeleton, while upon induction following acute stimulation, it contributes to increase the strength of the response to antigenic challenge. [score:2]
However, upon mast cell stimulation, miR-221 may have some more cell type-specific, activation -dependent effects, influencing the extent of degranulation, adherence and cytokine production in response to IgE-antigen complexes. [score:1]
C) Sylamer plot analysis for the Seed Complementary Region (SCR) words corresponding to the seed of miR-221 (red) and its one-nucleotide shifted sequence (orange). [score:1]
MiR-221/-222 as well as the transcriptional repressor PLZF are both known important regulators of hematopoietic cell differentiation [23], [24], [25]. [score:1]
In summary, although miR-221 doesn't seem to affect mast cell differentiation, it influences many features of the biology of differentiated cells. [score:1]
Overall, our work provides new insights into previously unknown effects of miR-221 in mast cell biology, and may have important implications for our understanding of the molecular mechanisms underlying normal and pathologic mast cell conditions. [score:1]
MiR-221 is a likely candidate as a regulator of mast cell functions: we previously showed that it is transcriptionally induced upon mast cell activation, and that it contributes to the modulation of proliferation in unstimulated mast cells [8]. [score:1]
Figure S4 A ‘dual’ role for miR-221 in mast cells. [score:1]
Cells transduced with miR-221 were selected with 2 µg/mL puromycin for 48h prior analysis, while cells transduced with miRT-221 were sorted to >90% GFP+ prior RNA extraction. [score:1]
MiR-221 regulates degranulation, migration and adherence in differentiated BMMCs. [score:1]
Moreover, we also observed mast cell-specific, activation -dependent effects of miR-221. [score:1]
We now showed that miR-221 may have more ubiquitous effects to fine-tune proliferation and actin cytoskeleton in cells as different as resting mast cells and fibroblasts. [score:1]
About 400bp of the mouse miR-221 or miR-222 genomic sequences were cloned into the pAPM lentiviral vector [11]. [score:1]
We therefore speculate that the slow kinetic of accumulation of the mature form of miR-221 may actually contribute to a resting, but ‘activation-ready’ cellular state, that favors increased degranulation, adherence and cytokine production upon challenge (Supplementary Figure S4). [score:1]
It will be therefore interesting to assess what is the role of miR-221/-222 in vivo in mouse mo dels, both in terms of cell homeostasis at steady-state or upon sensitization and challenge with an antigen or with a pathogen, and this will be the subject of future work. [score:1]
Indeed, as in the case of miR-221 and -222, miRNAs are frequently present as families of redundant genes. [score:1]
However, FcεRI stimulation led to mast cell-specific (or at least not present in fibroblasts) effects of miR-221, with increased degranulation and cytokine production. [score:1]
C) BMMCs were transduced with the control vector shLuc, miR-221 or miR-221-mutant. [score:1]
Speculative mo del of the possible roles of miR-221 in mast cells. [score:1]
E) MC/9 cells were transduced with miR-221 (upper panels) or miR-221m (lower panels) and selected with 1 µg/mL puromycin prior a second transduction with the indicated miRT vectors (miRT-empty or miRT-221). [score:1]
The peak of accumulation of mature miR-221 is instead a ‘late’ event upon cell stimulation, and we speculate that it may contribute to the strength of the response upon secondary challenge, with increased degranulation, cytokine production and cell adherence. [score:1]
Sequences corresponding to the mature murine miR-221, miR-222 and miR-221m are also shown. [score:1]
Microarray analysis identified genes affected by miR-221. [score:1]
Since there was no effect of miR-221 in mast cell differentiation, we set out to investigate its role in mast cell functions, especially the ones connected to signaling through the FcεRI, given that miR-221 expression is inducible upon stimulation. [score:1]
For this reason, we think that the effect of miR-221 in resting mast cells may be composite and due to small alterations of many genes in the transcriptome. [score:1]
The miRT vectors contain 4 sequences fully complementary to miR-221 and/or miR-222 cloned downstream the reporter gene. [score:1]
[1 to 20 of 139 sentences]
2
[+] score: 425
Other miRNAs from this paper: hsa-mir-221, hsa-mir-222, mmu-mir-222, mmu-mir-1928
Importantly, the down-regulation of canonic miR-221 targets in tumors excised from treated animals confirms the successful tumor-uptake of miRNA inhibitors at concentrations sufficient to produce up-regulation of target mRNAs and proteins that in turn translates in anti-tumor effects. [score:15]
Notably, inhibition of miR-221/222 significantly reduced the phosphorylation of AKT, a down-stream target of PTEN and key mediator of tumor cell survival (Fig. 7E), suggesting that the in vivo anti-MM activity of miR-221 inhibitors is related to PTEN up-regulation and impairment of AKT activation within tumors. [score:10]
A further important oncosuppressor gene target identified is the p57Kip2 that is reported as miR-221/222 direct target in the liver, whose suppression is involved, with an oncogenic function, in hepato-carcinogenesis [48]. [score:10]
In vitro enforced expression of miR-221/222 inhibitors in MM cellsTo investigate the anti-tumor potential of miR-221/222 inhibitors, we transfected OPM2 and NCI-H929 cells, which respectively express moderate -high to high levels of miR-221/222, with miR-221/222 inhibitors. [score:9]
The animal treatment was initiated after the detection of palpable tumors, approximately 2 weeks following MM cells injection with 1mg/kg per mouse of miR-221 inhibitor or miR-222 inhibitor, or both miR-221/222 inhibitors, or NC as control (mirVana custom inhibitor, Life Technologies). [score:9]
In conclusion, the anti-tumor activity of miR-221 inhibitors in clinically relevant mouse mo dels, together with the specific modulation of canonic miR-221/222 targets, provide a robust framework for clinical development of synthetic miR-221 inhibitors as novel therapeutics in MM. [score:8]
In fact, it has been recently shown that up-regulation of miR-221/222 expression, confers resistance to TRAIL -induced cell death and enhances proliferation and cell survival of lung and liver cancer cells by targeting PTEN and TIMP3 [37]. [score:8]
The red bars represent mature miR-221 expression (vertical axis on right side) and the spots represent target gene (p27Kip1 mRNA) expression (vertical axis on left side). [score:7]
More recently, it has been reported that the treatment with LNA -modified miR-221 inhibitors reduces the growth of liver cancer cells over -expressing miR-221/222 in vitro by targeting a DNA damage-inducible transcript 4 (DDIT4), a modulator of the mTOR pathway [39]. [score:7]
EHF is a member of ETS homologus transcription factor and it was recently reported that re -expression of ESE3/EHF inhibited tumorigenic potential of prostate cancer [51], while MMP1 a cell surface metallopeptidase is a miR-221/222 and miR-1928 families target [52]. [score:7]
Among the most important miR-221/222 gene targets, the tumor suppressor PTEN was observed to negatively regulate glioma cell migration [49]. [score:6]
Finally, by q-RT-PCR and Western blotting, we demonstrated up-regulation of p27Kip1 and PTEN validated miR-221/222 targets at mRNA (Fig. 7C) and protein (Fig. 7D) level, respectively. [score:6]
Importantly, by q-RT-PCR analysis of tumor tissues retrieved from animals treated with miR-221 inhibitors, we found a >60% knocking down of both miR-221 and miR-222 expression (Fig. 7A), confirming the in vivo interaction between miR-221 and miR-222. [score:6]
An important target of miR-221/222 is the CDK inhibitors p27Kip1, one of the most important cell cycle regulator, which has relevant impact on the proliferation and cell cycle control in a variety of human malignancies, including prostate carcinoma [40], glioblastomas [35], thyroid carcinomas [44], breast cancer [45], hepatocellular carcinoma [46], and lung cancer [47]. [score:6]
Subcutaneous OPM2 xenografts were treated every 2 days with 20 μg of formulated(NLE)-miR-221/222 inhibitors or unformulated-miR221/222 inhibitors. [score:5]
Gene expression profiles were obtained from OPM2 cells after transfection with miR-221/222 inhibitors or NC in 3 parallel experiments. [score:5]
Figure 6 In vivo anti-tumor activity of miR-221/222 inhibitors in MM xenografted SCID/NOD miceA) Effects of formulated or unformulated miR-221/222 inhibitors. [score:5]
Figure 3 In vitro anti-proliferative activity of miR-221 and miR-222 inhibitors on MM cell lines A-B) Cell growth analysis of OPM2 (A) and NCI-H929 (B) cells transfected with miR-221/222 inhibitors or scrambled oligonucleotides (NC). [score:5]
Subcutaneous OPM2 xenografts were repeatedly treated every 2 days, with 20 μg of NLE-miR-221 inhibitors, or NLE-miR-222 inhibitors, or NLE-NC. [score:5]
Over -expression of miR-221/222 has been observed in a number of advanced solid tumors indicating that miR-221/222 could be potential therapeutic targets also for hematopoietic malignancies. [score:5]
In our experimental setting, MM cells, 24 hours after transfection with miR-221/222 mimics with low/moderate basal miR-221/222 expression, significantly increase the S-phase that conversely decreases after miR-221/222 inhibitor treatment. [score:5]
To investigate the anti-tumor potential of miR-221/222 inhibitors, we transfected OPM2 and NCI-H929 cells, which respectively express moderate -high to high levels of miR-221/222, with miR-221/222 inhibitors. [score:5]
A) Hierarchical clustering of differentially expressed genes between miR-221/222 inhibitors or NC treated OPM2 cells by Gene 1.0 ST array chip (Affymetrix) and DChip software. [score:5]
In vitro enforced expression of miR-221/222 inhibitors in MM cells. [score:5]
All together these results demonstrate that synthetic miR-221/222 inhibitors exert significant anti-tumor effects in vitro and this activity involves modulation of several validated targets of miR-221/222. [score:5]
B) q-RT-PCR of p27Kip1, PUMA, PTEN and p57Kip2 mRNA expression 24 hours after transfection with miR-221/222 inhibitors or NC in OPM2 cells. [score:5]
We then compared the activity of single inhibitors and we observed higher anti-tumor activity of miR-221 inhibitors as compared to miR-222 inhibitors (Fig. 6B). [score:5]
These findings led to the identification of pathways involved in anti-tumor mechanisms of miR-221/222 inhibitors suggesting novel opportunities for the rational design of combinatory strategies with signaling inhibitors. [score:5]
miR-221/222 act as oncogenic miRNAs that facilitate cell proliferation via down-regulation of p27Kip1 and/or p57Kip2 [34- 36], which negatively regulate cell cycle progression from G1- to S-phase. [score:5]
Conversely, we selected OPM2 and NCI-H929 cells, both t(4;14), which respectively express moderate and high levels of miR-221/222 to explore the anti-tumor activity of miR-221 and/or miR-222 inhibitors. [score:5]
Figure 5 A) Hierarchical clustering of differentially expressed genes between miR-221/222 inhibitors or NC treated OPM2 cells by Gene 1.0 ST array chip (Affymetrix) and DChip software. [score:5]
In vitro transfection of MM cells by synthetic miR-221/222 mimics or inhibitorsMM cell transfection has been performed, by the Neon® Transfection System (Life Technologies) at 100 nM of pre-miRNAs or miRNAs inhibitors concentrations (Life Technologies). [score:5]
Clustering and fold change (FC) analysis were done using the dChip software [57] comparing relative gene expression of scrambled-oligonucleotide versus miR-221/222 inhibitors transfected cells. [score:5]
miR-221/222 are highly homologous miRNAs encoded in tandem on the X chromosome, whose up-regulation has been recently described in several types of human tumors. [score:4]
Whole Gene Expression Profiles of MM cells after miR-221/222 knockdown. [score:4]
Genome wide mRNA expression after miR-221/222 knockdown identified modulation of canonic pathways involved in cell proliferation signals and activation of immune response. [score:4]
Our results support the development of miR-221/222 inhibitors as novel agents for the treatment of MM. [score:4]
In this report, we show that miR-221/222 is significantly up-regulated in a subset of MM patients that by translocation and cyclin (TC) molecular classification mostly include TC2, TC4 and a subpopulation of patients within TC3 group, overall accounting for >50% of all MM. [score:4]
To analyze higher-order influences on biological networks regulated by miR-221/222 inhibitors, we focused on gene list obtained after fold change analysis and results underwent Ingenuity Pathway Analysis (IPA). [score:4]
Moreover, it has been demonstrated that miR-221/222 regulate radiosensitivity, cell growth and invasion of gastric cells by modulation of PTEN expression [38]. [score:4]
Among miRNAs significantly deregulated in human cancer, miR-221/222 are of major interest as potential targets for therapeutic applications. [score:4]
The increase of PTEN mRNA level detected after miR-221/222 inhibitor transfection leads us to speculate that the major anti-proliferative effect on MM cells is mediated by cell cycle regulation. [score:4]
At protein level, we found increase of p27Kip1 and PTEN proteins 24 and 48 hours after transfection with miR-221/222 inhibitors. [score:3]
In vitro transfection of MM cells by synthetic miR-221/222 mimics or inhibitors. [score:3]
In vitro enforced expression of synthetic miR-221/222 mimics in MM cells. [score:3]
Biological effects induced by transient expression of miR-221/222 in MM cell lines. [score:3]
Figure 4 A) miR-221 and miR-222 q-RT-PCR 24 hours after transfection with miR-221/222 inhibitors and NC in OPM2 cells. [score:3]
An additional important achievement of our work is the successful delivery of both lipid -based formulated [43] or unformulated miR-221/222 inhibitors against MM xenografts. [score:3]
A) Cell cycle perturbation in U266 cells induced by transient pre-miR221/222 enforced expression. [score:3]
miR-221 and miR-222 expression in primary CD138+ normal plasma cells, primary MM and PCL cells and established MM cell lines. [score:3]
C-D) Western blot analysis of p27Kip1 and PTEN in OPM2 cells 24 and 48 hours after transfection with miR-221/222 inhibitors and NC. [score:3]
B) Differential expression of miR-221 and miR-222 in 16 MM cell lines by Affymetrix GeneChip® miRNA 1.0 Array. [score:3]
In the light of translation of our findings in a therapeutic mo del, we investigated the effect of miR-221 and/or miR-222 inhibitors against MM xenografts in CB-17 severe combined immunodeficient non-obese diabetic (SCID/NOD) mice. [score:3]
Figure 7 A) q-RT-PCR of miR-221 and miR-222 in retrieved tumors treated with unformulated-miR-221 inhibitors or unformulated-NC. [score:3]
In vivo anti-tumor activity of miR-221/222 inhibitors in MM xenografted SCID/NOD mice. [score:3]
Taken together, these results demonstrate the therapeutic potential of miR-221 inhibitors in validated preclinical in vivo mo dels and provide important molecular insights. [score:3]
We next investigated the effect induced by miR-221/222 inhibition on OPM2 cells at trascriptome level by performing gene expression analysis. [score:3]
B) Effects of treatments with formulated miR-221 or miR-222 individual inhibitors. [score:3]
Interestingly, the inhibition of miR-221/222 in vivo considerably also reduced the p-ERK1/2 levels, while total ERK1/2 was unaffected. [score:3]
The in vivo immunohistochemical analysis of apoptosis in retrieved miR-221 inhibitor -treated tumors indicates however activation of caspase-3. This observation suggests that other players, for istance perturbation of angiogenesis, trigger the apoptotic cascade in vivo. [score:3]
On these findings, we further studied the activity of miR-221 inhibitors even as unformulated agents confirming their relevant anti-MM potential in xenografted mice (Fig. 6C). [score:3]
C) Effects of unformulated-miR-221 inhibitors or NC. [score:3]
Figure 1 A) Differential expression of miR-221 and miR-222 in immunoselected CD138+ cells from 3 healthy donors, 38 MM and 2 PCL, by microarray analysis. [score:3]
A) miR-221 and miR-222 q-RT-PCR 24 hours after transfection with miR-221/222 inhibitors and NC in OPM2 cells. [score:3]
A) q-RT-PCR of miR-221 and miR-222 in retrieved tumors treated with unformulated-miR-221 inhibitors or unformulated-NC. [score:3]
C-D) BrdU incorporation after transfection of synthetic miR-221 and/or miR-222 inhibitors or NC in OPM2 (C) and NCI-H929 (D) cells. [score:3]
Targeting of p27Kip1 protein by miR-221/222 was also evaluated in RPMI-8226 cells, expressing moderate levels of these miRNAs. [score:3]
A) Differential expression of miR-221 and miR-222 in immunoselected CD138+ cells from 3 healthy donors, 38 MM and 2 PCL, by microarray analysis. [score:3]
Expression of miR-221/222 in MM and PCL patients, and in MM cell lines. [score:3]
B) Pathways modulated by miR-221/222 inhibitors in OPM2 MM cells are shown. [score:3]
To this end, we transfected U266 and RPMI-8226 cells, that constitutively express very low levels of the miRNA-cluster, with miR-221/222 mimics or scrambled oligonucleotides. [score:3]
In addition, other authors recently showed that miR-221/222 antisense oligonucleotides reduce tumor growth by increasing intra-tumor p27Kip1 protein expression [40]. [score:3]
Subcutaneous OPM2 xenografts were repeatedly treated every 2 days with 20 μg of unformulated-miR-221 inhibitors, or unformulated-NC. [score:3]
Among different TC (Translocation/Cyclin) classified MM samples, we found significantly higher miR-221/222 expression in TC2, TC4 and in a subgroup of TC3 MM, as assessed by SAM multi-class analysis, (q-value=0) (Fig. 1A). [score:3]
When OPM2 MM tumors became palpable, animals were randomized and treated with miR-221 and/or miR-222 inhibitors or controls. [score:3]
To our knowledge, this is the first experimental evidence of anti-tumor activity of miR-221/222 inhibitors against MM cells. [score:3]
D-E) Western blot analysis of total AKT and p-AKT (D) and total ERK and p-ERK (E) in retrieved tumors from mice treated with miR-221 inhibitors or NC. [score:3]
In addition, we found that miR-221 triggered apoptosis in MM xenografts in vivo with increased cleaved caspase-3 and also reduced Ki-67 expression (Fig. 7B). [score:3]
In a first series of experiments, by both delivery strategies, we found a significant (P<0.05) anti-tumor activity of miR-221/222 inhibitors against MM xenografts (Fig. 6A). [score:3]
This evidence together with the minor changes of BBC3/PUMA mRNA, a p53 modulator of apoptosis and validated target of miR-221/222, provides additional support to our hypothesis. [score:3]
miR-221 and miR-222 are reported as raw expression values. [score:3]
A-B) Cell growth analysis of OPM2 (A) and NCI-H929 (B) cells transfected with miR-221/222 inhibitors or scrambled oligonucleotides (NC). [score:3]
Effects of miR-221/222 inhibition on the whole cell transcriptome. [score:3]
Molecular effects induced by miR-221/222 inhibitors in MM cells. [score:3]
D) Western blot analysis of p27Kip1 and PTEN protein in retrieved tumors from mice treated with miR-221 inhibitors or NC. [score:3]
Moreover, by histologic and immunohistochemical analysis or retrieved tumors, we observed large areas of necrosis with abundant nuclear debris (“dustlike” nuclear fragments) in xenografts treated with miR-221 inhibitors. [score:3]
miR-221 activity and targets silencing in retrieved MM xenografted tumors. [score:3]
Figure 2 A) Cell cycle perturbation in U266 cells induced by transient pre-miR221/222 enforced expression. [score:3]
In vivo anti-tumor activity of miRNA-221/222 against MM xenograftsIn the light of translation of our findings in a therapeutic mo del, we investigated the effect of miR-221 and/or miR-222 inhibitors against MM xenografts in CB-17 severe combined immunodeficient non-obese diabetic (SCID/NOD) mice. [score:3]
Histogram bars indicate miR-221 or miR-222 expression values normalized by miRNA QC Tool (Affymetrix). [score:3]
In vitro enforced expression of synthetic miR-221/222 mimics in MM cellsWe first investigated the growth promoting activity of miR-221/222 by enforced expression of their synthetic mimics in MM cells. [score:3]
A) Effects of formulated or unformulated miR-221/222 inhibitors. [score:3]
In vitro anti-proliferative activity of miR-221 and miR-222 inhibitors on MM cell lines. [score:3]
Hierarchical clustering was performed based on differential gene expression after 24 hours of miR-221/222 silencing as compared to the control (Fig. 5A). [score:2]
C) p27Kip1 protein expression 48-72 and 96 hours after transfection of U266 and RPMI-8226 cells with pre-miR-221/222 mimics or scrambled controls (NC) was assessed by Western blotting assay. [score:2]
As assessed by trypan blue exclusion assay (Fig. 3A and B) and BrdU cell uptake (Fig. 3C and D), we found significant anti-proliferative activity induced by miR-221/222 inhibitors in both cell lines. [score:2]
Since miR-221/222 negatively regulates p27Kip1 expression in different cell types [34, 40, 41], we evaluated if this effect also occurred in transfected U266 cells. [score:2]
For cell proliferation analysis, 1.5x10 [5] MM cells were seeded in 24 well plates, electroporated with synthetic miR-221 and/or miR-222 or with miR -inhibitors or NC, and then harvested and counted at 24-hour intervals using a Trypan Blue viable cell-excluding assay. [score:2]
The bar graphs show pathways most modulated by miR-221/222 inhibitors as compared to control, based on statistical significance (P-value and ratio). [score:2]
D) Inverse correlation between p27Kip1 mRNA and miR-221 levels in a dataset of 40 (38 MM + 2 PCL) patients is shown. [score:1]
Again, enforced increase of miR-221/222 resulted in a marked reduction of p27Kip1 protein (Fig. 2C, bottom panel). [score:1]
Figure 1A shows the heatmap of miR-221/222 expression in a panel of CD138+ cells from 38 MM patients, 2 PCL patients and plasma cells from 3 healthy donors previously investigated by microarray analysis [15]. [score:1]
Moreover, we evaluated by microarray miRNA profiling the miR-221/222 expression in 16 MM cell lines (Fig. 1B). [score:1]
Several reports suggested a key role of miR-221/222 in tumorigenesis. [score:1]
This point is relevant since the optimal bioavailability of unformulated miR-221/222 will support the design of therapeutic strategies without the need of delivery systems. [score:1]
The genes lists filtered for fold change >0.5 were applied to Ingenuity Pathway Analysis (IPA [®]) software to reveal biological pathways modulated by miR-221/222 silencing (Ingenuity System, Redwood city, CA). [score:1]
Moreover, we evaluated the effects induced on others validated miR-221/222 canonic targets, including PUMA, PTEN, and p57Kip2 mRNAs. [score:1]
Among these cells, we selected the U266 t(1;11) and RPMI-8226 t(1;14) cells which express very low levels of miR-221/222 to evaluate the growth promoting role of miR-221/222 mimics. [score:1]
We then analyzed the correlation between miR-221/222 and p27Kip1 mRNA expression, as measured by microarray analysis, in a same dataset of MM patients: we found a significant inverse correlation between miR-221/222 and p27Kip1 mRNA (Pearson product-moment correlation, p<0.05) (Fig 2D). [score:1]
In vivo anti-tumor activity of miRNA-221/222 against MM xenografts. [score:1]
We first investigated the growth promoting activity of miR-221/222 by enforced expression of their synthetic mimics in MM cells. [score:1]
Since the therapeutic potential of miR-221/222 selective inhibitors has not before investigated in MM, we studied and report here the biological effects induced by miR-221/222 in vitro and in vivo silencing. [score:1]
The molecular mechanisms of anti-MM activity of miR-221/222 inhibitors are presently under investigation. [score:1]
B) Effects induced on BrdU uptake of RPMI-8226 cells by transfection with pre-miR-221/222 mimics or scrambled sequences. [score:1]
[1 to 20 of 114 sentences]
3
[+] score: 348
Therefore, we next examined NF-κB protein expression by EMSA using nuclear extracts from cells exhibiting upregulation or downregulation of miR-221. [score:9]
NF-κB activity increased in cells overexpressing miR-221, and inhibition of NF-κB suppressed miR-221 -induced IL-4 secretionMany studies have demonstrated that a variety of inflammatory processes are regulated through nuclear factor NF-κB signaling. [score:8]
After incubating for 24 h, the culture medium was replaced for another 16 h. To further explore the role of p38 in the regulation of miR-221 in the Toll-like receptor (TLR) signaling pathway, cells transfected with lentiviral vector 3-mmu- miR-221 were treated for 30 min with a specific p38 signaling pathway inhibitor, SB203580 (20 μmol/L), followed by stimulation with lipopolysaccharide (LPS) for 6 h. Alternatively, P815 cells transfected with control vector or lentiviral vector 3-mmu- miR-221 were stimulated with LPS alone for 6 h. To determine the role of NF-κB in the regulation of miR-221, cells were treated with the NF-κB inhibitor ammonium pyrrolidinedithiocarbamate (PDTC) at a concentration of 50 μmol/L. [score:7]
For transfection, the cells were grown to 20% confluence and transfected with miR-221 inhibitor (the miR-221 inhibitor group) or inhibitor negative control using Lipofectamine 2000 (Lip 2000; Life Technologies) followed by incubation in Opti-Mem I for 6 h. The cells were then transferred into fresh DMEM containing 10% FBS. [score:7]
NF-κB activity increased in cells overexpressing miR-221, and inhibition of NF-κB suppressed miR-221 -induced IL-4 secretion. [score:7]
miR-221 was upregulated after treatment with LPS in mast cells and regulated the levels of IL-4 in the supernatantNext, we analyzed the effects of LPS on miR-221 expression. [score:7]
After incubating for 24 h, the culture medium was replaced for another 16 h. To further explore the role of p38 in the regulation of miR-221 in the Toll-like receptor (TLR) signaling pathway, cells transfected with lentiviral vector 3-mmu- miR-221 were treated for 30 min with a specific p38 signaling pathway inhibitor, SB203580 (20 μmol/L), followed by stimulation with lipopolysaccharide (LPS) for 6 h. Alternatively, P815 cells transfected with control vector or lentiviral vector 3-mmu- miR-221 were stimulated with LPS alone for 6 h. To determine the role of NF-κB in the regulation of miR-221, cells were treated with the NF-κB inhibitor ammonium pyrrolidinedithiocarbamate (PDTC) at a concentration of 50 μmol/L. [score:7]
TLR expression and p38 phosphorylation increased in cells overexpressing miR-221To explore changes in signaling pathway components in cells overexpressing miR-221, we used gene chip analysis. [score:7]
The expression levels of mature miR-221 increased after transfection with the miRNA overexpression lentivirus but not with the negative control lentivirus, indicating successful transfection (P < 0.05; Fig 2B). [score:5]
PTEN reversed the effects of miR-221 on IL-4 secretionTo further illustrate the effects of PTEN on IL-4 secretion in miR-221-stimulated P815 cells, P815 cells were transfected with a PTEN overexpression lentivirus vector in cells overexpressing miR-221. [score:5]
TLR expression and p38 phosphorylation increased in cells overexpressing miR-221. [score:5]
Changes in NF-κB expression in response to different miR-221 levels and effects of NF-κB inhibition on miR-221 -induced IL-4 secretion. [score:5]
P815 cells were transfected with an miR-221 overexpression lentivirus vector, and miR-221 expression was then assessed in the blank control group, negative virus group (LV3NC), and miR-221 -transfected cells. [score:5]
Moreover, miR-221 was upregulated in the lungs of mo del mice, suggesting that miR-221 may play an important role in the onset or development of asthma. [score:5]
To identify potential changes to signaling pathways related to disruptions in miR-221 expression, cells transfected with the control vector, lentiviral vector 3-mmu- miR-221, or miR-221 inhibitor were subjected to microarray analysis (KangChen Bio-tech Inc. [score:5]
As shown in Fig 5A, there were dramatic differences in overall gene expression in the context of miR-221 overexpression; these changes were primarily related to the inflammation reaction category in gene ontology (GO) analysis. [score:5]
Consistent with this and our other findings, inhibition of NF-κB in cells overexpressing miR-221 resulted in decreased IL-4 secretion, suggesting that miR-221 may increase the secretion of IL-4 through activation of the NF-κB pathway. [score:5]
C) Analysis of the expression of TLR pathway components in cells overexpressing miR-221 and control cells. [score:5]
Changes in p38 expression and phosphorylation in response to miR-221 overexpression. [score:5]
To determine the role of miR-221 in IL-4 secretion from P815 cells, gain- and loss-of-function experiments were conducted by transfecting P815 cells with a negative control lentivirus, a synthetic specific overexpression lentivirus, or a specific miR-221 inhibitor. [score:5]
0148821.g007 Fig 7Changes in NF-κB expression in response to different miR-221 levels and effects of NF-κB inhibition on miR-221 -induced IL-4 secretion. [score:5]
In P815 cells overexpressing miR-221, TLR-1, -4, -6, and -7 expression increased. [score:5]
Additionally, IL-4 levels in the supernatant increased after transfection with the miR-221 overexpression lentivirus and decreased after transfection with the miR-221 inhibitor. [score:5]
Additionally, stimulation of P815 mouse mast cells with LPS increased miR-221 expression, and modulation of miR-221 expression altered IL-4 secretion in P815 cells. [score:5]
PTEN, a target of miR-221 regulation, and the p38/NF-κB pathway were involved in the regulation of mast cells by miR-221. [score:5]
Similarly, in this study, LPS stimulation promoted miR-221 expression in P815 cells, and changes in miR-221 expression altered IL-4 secretion in P815 cells. [score:5]
PTEN was a target of miR-221By bioinformatics analysis, PTEN was predicted to be a target of miR-221 at two different 3′-UTR sites. [score:5]
A) Heat map of differentially expressed genes between cells overexpressing miR-221 and control cells (1+: miR-221; N+: control; P < 0.05; n = 3). [score:5]
D, E) Total p38 protein expression and p38 phosphorylation were analyzed in control cells and cells overexpressing miR-221. [score:5]
0148821.g005 Fig 5Changes in p38 expression and phosphorylation in response to miR-221 overexpression. [score:5]
To further illustrate the effects of PTEN on IL-4 secretion in miR-221-stimulated P815 cells, P815 cells were transfected with a PTEN overexpression lentivirus vector in cells overexpressing miR-221. [score:5]
Treatment with a p38 pathway inhibitor blocked the secretion of IL-4. Effects of p38 inhibition on miR-221 -induced IL-4 secretion. [score:5]
miR-221 was upregulated after treatment with LPS in mast cells and regulated the levels of IL-4 in the supernatant. [score:5]
A, B) miR-221 was overexpressed in cells, and PTEN expression was analyzed. [score:5]
The results showed that the luciferase activity of cells transfected with the miR-221 overexpression vector was decreased compared with that in cells transfected with the blank vector control (mimic NC group), demonstrating that PTEN was inhibited by binding of miR-221 to its 3′-UTR (Table 1). [score:4]
miR-221 was upregulated in a murine asthma mo delIn BALF from our murine asthma mo del, the numbers of total cells and eosinophils increased, indicating the presence of airway inflammation. [score:4]
Additionally, we tested the hypothesis that miR-221 regulates the secretory function of mouse mast cells, focusing on identification of miR-221 target genes and signaling pathways. [score:4]
A gene expression microarray was then used to further elucidate the signaling pathways involved in the regulation of miR-221 in P815 cells. [score:4]
Moreover, in cells overexpressing PTEN, the IL-4 concentration was decreased compared with that in cells overexpressing miR-221 alone, suggesting that the positive effects of miR-221 on IL-4 secretion in mast cells could be reversed by PTEN (P < 0.05; Fig 4B). [score:4]
Additionally, a decrease in IL-4 secretion was observed, indicating that miR-221 could activate NF-κB to upregulate IL-4 in the supernatant (Fig 7C). [score:4]
In contrast, there was no significant difference in cells exhibiting miR-221 downregulation. [score:4]
miR-221 was upregulated in a murine asthma mo del. [score:4]
To further explore the role of p38 in the regulation of IL-4 in the TLR signaling pathway, cells overexpressing miR-221 were treated with a specific p38 MAPK signaling pathway inhibitor (SB203580), and the IL-4 concentration in the supernatant was measured. [score:4]
Profiling of miRNAs in pediatric asthma: upregulation of miRNA-221 and miRNA-485-3p. [score:4]
Next, we analyzed the effects of LPS on miR-221 expression. [score:3]
Effects of miR-221 levels on PTEN protein expression. [score:3]
Cells overexpressing miR-221 were treated with the PI3K/Akt inhibitor SB203580, and the concentration of IL-4 in the supernatant was measured. [score:3]
While p38 protein levels did not change significantly after overexpression of miR-221, the phosphorylation of p38 increased (P < 0.05; Fig 5D and 5E). [score:3]
PTEN was a target of miR-221. [score:3]
Our analysis identified PTEN as a target of miR-221. [score:3]
Specifically, miR-221 can modulate the mast cell cycle by inhibiting p27Kip1 [17]. [score:3]
0148821.g006 Fig 6Effects of p38 inhibition on miR-221 -induced IL-4 secretion. [score:3]
In conclusion, miR-221 expression was increased in a mo del of asthma in mice. [score:3]
Effects of PTEN overexpression on miR-221 -induced IL-4 secretion. [score:3]
Moreover, inhibition of p38 MAPK by SB203580 treatment blocked the secretion of IL-4. This suggested that miR-221 may increase the secretion of IL-4 by phosphorylating and activating p38 protein. [score:3]
0148821.g001 Fig 1 miR-221 expression in a murine asthma mo del. [score:3]
To explore changes in signaling pathway components in cells overexpressing miR-221, we used gene chip analysis. [score:3]
The medium was refreshed 48 h after infection, and the cells were then treated with 1 μg/mL puromycin (Life Technologies, Carlsbad, CA, USA) for 48 h. miR-221 inhibitor was synthesized by RiboBio Co. [score:3]
The expression of miR-221 in tumor tissues from patients with breast cancer, prostate cancer, and bladder cancer is much higher than that in normal tissues [15]. [score:3]
After transfection with the PTEN overexpression lentivirus vector in cells overexpressing miR-221, PTEN mRNA levels (A) and IL-4 concentrations in the supernatant (B) were measured. [score:3]
0148821.g004 Fig 4Effects of PTEN overexpression on miR-221 -induced IL-4 secretion. [score:3]
The expression of miR-221 was higher in the lung tissues of asthmatic mice than in those of normal mice, and analysis of lung pathology showed that inflammatory cell infiltration was increased. [score:3]
By bioinformatics analysis, PTEN was predicted to be a target of miR-221 at two different 3′-UTR sites. [score:3]
miR-221 expression in a murine asthma mo del. [score:3]
These results demonstrated that PTEN could reverse the effects of overexpression of miR-221 on secretion of IL-4 in mast cells. [score:3]
To investigate the involvement of NF-κB in miR-221 -induced IL-4 production, cells overexpressing miR-221 were treated with PDTC, an inhibitor of the NF-κB pathway. [score:3]
showed that phosphorylation of p38 increased in P815 cells overexpressing miR-221. [score:3]
B) Expression of miR-221 in the murine asthma mo del. [score:3]
A) Effects of LPS stimulation on the expression of miR-221 in P815 cells. [score:3]
0148821.g003 Fig 3Effects of miR-221 levels on PTEN protein expression. [score:3]
Our data also suggested that NF-κB activity was increased in response to overexpression of miR-221, resulting in induction of IL-4 in P815 cells. [score:3]
After treatment with SB203580, IL-4 levels in the supernatant were decreased compared with that in untreated cells overexpressing miR-221 (P < 0.05). [score:2]
miR-221 regulated IL-4 levels in the supernatants of P815 cells. [score:2]
Another study found that miR-221 is involved in the regulation of inflammatory reactions. [score:2]
revealed that PTEN protein levels were decreased in cells overexpressing miR-221 compared with those in normal cells (Fig 3A and 3B). [score:2]
0148821.g002 Fig 2 miR-221 regulated IL-4 levels in the supernatants of P815 cells. [score:2]
Our results also provided important insights into the mechanisms through which miR-221 regulates inflammation and signaling, involving the TLR, NF-κB, and MAPK pathways. [score:2]
As shown in Fig 7A and 7B, the levels of NF-κB DNA binding in nuclear fractions were higher in cells overexpressing miR-221 compared with those in control cells, suggesting that miR-221 induced the activation of NF-κB. [score:2]
These results suggested that miR-221 could regulate the secretory function of mast cells. [score:2]
C) Enzyme-linked immunosorbent assays were used to assess IL-4 levels in the supernatants in the miR-221, blank control, and miR-221 inhibitor (miR-221in) groups. [score:2]
In cholangitis, miR-221 regulates the secretion of cell adhesion molecule 1 induced by interferon gamma in bile duct cells [16]. [score:2]
In contrast, no differences were observed in control cells, indicating that miR-221 could activate p38 protein, increase p38 phosphorylation, and thereby regulate the release of IL-4 (Fig 6). [score:2]
*: P < 0.05 compared with untreated cells overexpressing miR-221 (n = 6). [score:2]
This analysis showed that miR-221 was increased by approximately three-fold in this mo del (Fig 1A and 1B). [score:1]
miR-221 is located on the X chromosome and is important for cell proliferation, differentiation, and apoptosis, especially in tumors. [score:1]
After a 16-h treatment with LPS, cells were collected, and miR-221 was detected by RT-PCR. [score:1]
In this study, we used a murine asthma mo del to examine the role of miR-221 in asthma. [score:1]
In this study, we found that miR-221 increased IL-4 secretion from P815 mouse mast cells. [score:1]
Moreover, miR-221 has been suggested to function as a biomarker for the early diagnosis of cancer. [score:1]
The sequence of mature miR-221 (5′-AGCUACAUUGUCUGCUGGGUUUC-3′) was obtained from miRBase (http://www. [score:1]
PTEN reversed the effects of miR-221 on IL-4 secretion. [score:1]
As shown in Fig 2A, cells treated with LPS exhibited higher levels of miR-221 than control cells (P < 0.05). [score:1]
The cells were then cotransfected with a vector containing the PTEN-3′UTR and an miR-221 mimic (Invitrogen, Carlsbad, CA, USA). [score:1]
The cells were then infected with lentiviral vector 3-mmu- miR-221 (the miR-221 group), lentiviral vector 3-normal control (the LV3NC group), or lentiviral vector 5-mmu-PTEN (the PTEN group), purchased from GenePharma (Shanghai, China). [score:1]
Moreover, deletion of PTEN reversed the effects of miR-221 stimulation in P815 cells. [score:1]
We have previously found miR-221 increased in serum of asthmatic children[7]. [score:1]
Because miR-221 was found to be increased in pediatric asthmatics [7], reverse transcription (RT)-PCR was used to confirm the changes in lung tissues in the murine asthma mo del. [score:1]
[1 to 20 of 97 sentences]
4
[+] score: 268
Other miRNAs from this paper: hsa-mir-17, hsa-mir-221, hsa-mir-222, mmu-mir-17, mmu-mir-222
The upper part of the panel (Northern blot) shows the persistent expression of miR-221 in p-221 transduced tumors, and the lower part (Western blot) shows the downregulation of p27 in miR-221 expressing tumors. [score:8]
We also checked if antagomir -mediated suppression of miR-221/222 resulted in a correspondent increase of p27 levels, as compared to untreated tumors; Fig. 3D shows a representative image of Western blot analyses of total protein extracts from the same tumors already tested for miR-221/222 expression: in all cases assayed, a high p27 expression was measured where miR-221 and miR-222 were kept low by antagomir action, whereas the lack of inhibition of the two microRNAs matched with a low level of p27 expression. [score:7]
Moreover, the molecular analyses demonstrating the effectiveness of antagomir treatment were performed at very short times after antagomir injection, whereas we were able to prove an effective downregulation of miR-221/222, and a consequent upregulation of p27, for longer than three weeks. [score:7]
More recently, another cell cycle inhibitor, p57, has been described as a specific target of miR-221/222 [8], [13], once more contributing to the general rule that one microRNA can have pleiotropic effects by targeting more than one mRNA. [score:7]
We believe that our work now indicates that miR-221/222 upregulation may be one of the possible mechanisms responsible for p27 downregulation in this tumor. [score:7]
As a first step to test this hypothesis, we pre -transfected PC3 cells, a high miR-221 and miR-222 expressing prostate carcinoma cell line [9], with LNA oligonucleotides targeting mir-221 and miR-222, in order to abolish their expression. [score:7]
MiR-221 and miR-222 are two highly homologous microRNAs whose upregulation has been recently described in several types of human tumors, for some of which their oncogenic role was explained by the discovery of their target p27, a key cell cycle regulator. [score:7]
The molecular basis of their “oncogenic” role was clarified for the first time by our group in the context of prostate carcinoma cells, through the discovery of their target mRNA, p27 [kip1], a negative regulator of cell cycle progression [9], and then this same finding was confirmed in most forms of cancers where the overexpression of miR-221/222 had been detected [7], [8], [11], [13], [15]. [score:6]
In our work we aimed to demonstrate that the overexpression of miR-221 and miR-222, a couple of microRNAs that we had previously shown to be strongly upregulated in vitro in aggressive prostate carcinoma cell lines, is relevant to prostate carcinoma cell growth in vivo, both in mouse mo dels and in human tumor samples. [score:6]
The numerical values under each lane indicate the relative expression of miR-221 and of p27, where each p-221 transfected tumor is compared to its controlateral control (pCDNA3.1) tumor, whose miR-221 and p27 expression levels are set as  = 1. G p27 mRNA 3′UTR sites targeted by miR-221 and miR-222. [score:6]
Furthermore, we provide evidence in favour of a clinical relevance of the role of miR-221/222 in prostate carcinoma, by showing their general upregulation in patient-derived primary cell lines, where we find a significant inverse correlation with p27 expression. [score:6]
We previously described that miR-221/222 expression is directly correlated with the aggressiveness of cell mo dels of prostate carcinoma, and that the forced overexpression of miR-221 or miR-222 in the poorly aggressive prostate carcinoma LNCaP cell line is sufficient to accelerate their proliferation and in vitro tumorigenicity [9]. [score:6]
The reason accounting for the recognition of shared targets for both miR-221 and miR-222 is found in their “seed” sequences, short (∼7–8 nt) regions at their 5′ ends through which they bind their target sites in mRNA 3′UTRs: these “seeds” are identical in miR-221 and miR-222 and are also very well evolutionarily conserved, likely indicating the common involvement of these two microRNAs in the same pathways. [score:5]
Our results are in full agreement with the pro-proliferative action of miR-221: tumors grew faster and larger, their mitotic and proliferative (Ki-67) indexes were strongly enhanced, and the long-lasting overexpression of miR-221 reduced the tumor expression of p27, again confirming our in vitro data. [score:5]
These data indicate that the persistent miR-221 overexpression reduces p27 expression and stimulates proliferation in LNCaP cell xenografts. [score:5]
In vivo intratumoral knockdown of miR-221 and miR-222 upregulates p27 and reduces tumor growth of PC3 xenografts. [score:5]
MiR-221 and miR-222 are highly expressed in human prostate carcinoma primary samples and their expression is inversely correlated to that of p27. [score:5]
Moreover, we wanted to validate the clinical relevance of miR-221/222 expression in prostate tumors, and thus we measured the expression of these two microRNAs in primary cells from 18 patients with stage II–III prostate cancer, and concurrently quantified p27 expression, to check if the inverse relationship linking miR-221/222 to p27 is reproducible and significant in clinical samples. [score:5]
When the values of p27 protein expression were plotted against miR-221 and miR-222 expression, an inverse correlation was evident (Fig. 4C, Spearman: p = 0.0164 for miR-221 and p = 0.0057 for miR-222). [score:5]
Under each lane, a number indicates the relative miR-221 expression as compared to LNCaP cells transfected with the empty vector pCDNA3.1, where miR-221 endogenous expression is set as  = 1. B In vivo tumor growth in SCID mice. [score:4]
After approximately one week, when the tumors reached an average volume of ∼50 mm [3], the tumors were directly injected with a cocktail of antagomirs (Dharmacon, CelBio, Italy) targeting miR-221 and miR-222 on one flank, or with a control antagomir on the other. [score:4]
Once more, we show that treated tumors growing smaller than controls maintain reduced levels of miR-221 and miR-222 for the whole duration of the experiments, and that this produces a permanent upregulation of p27, otherwise low in control tumors. [score:4]
Real-time PCR showed a consistent upregulation of both miR-222 and miR-221 in about 80% of the tumor samples analyzed with respect to normal counterparts, even if no correlation was observed with Gleason and stage (Fig. 4A and Table 1). [score:4]
Thus, our prostate carcinoma xenograft data demonstrate, as a whole, that miR-221 (and most likely miR-222, even if here we are not providing a direct evidence for this) is sufficient to strongly enhance prostate carcinoma growth and, consequently, that the inhibition of miR-221 and miR-222 is necessary, and in fact effective, to reduce the in vivo growth of this tumor. [score:4]
This observation led us to check the p27 status in transfected tumors, in search of the inverse correlation expected on the basis of the in vitro validated negative regulation of p27 by miR-221 [9], exerted by miR-221 and miR-222 via the specific recognition of two target sequences in the p27 3′UTR (Fig. 1G ). [score:4]
MiR-221 overexpressing tumors display significantly enhanced levels of proliferation markers and reduced p27 expression. [score:4]
After 48 hr from transfection, the cells were collected and miR-221 expression was analyzed by Northern blotting to verify the effective miRNA knockdown. [score:4]
MiR-221 is strongly expressed in prostate carcinoma-derived primary cells and its expression inversely correlates with that of p27. [score:4]
However, of course, the great interest of this observation lies in its reverse implications: that inhibiting miR-221 and miR-222 in prostate carcinoma may be a way to reduce its growth potential. [score:3]
The data collected with LNCaP cells, physiologically expressing low levels of miR-221, represent a proof of principle that miR-221 is a powerful enhancer of prostate tumor growth. [score:3]
In vitro inhibition of miR-221 and miR-222 reduces tumor growth of PC3 derived tumors in SCID mice. [score:3]
In order to verify whether the effects observed in tumor growth and proliferation were due to a persistent expression of miR-221, we performed Northern blot analysis. [score:3]
The ectopic overexpression of miR-221 is able, per se, to confer a high growth advantage to LNCaP-derived tumors in SCID mice. [score:3]
The mitotic index showed a similar trend with a three-fold increase in miR-221 expressing cells (p-221 = 44.4 vs CTRL 13.6, p<0.00003; Fig. 1D,E, upper panels). [score:3]
As shown in Fig. 1F, the expression of miR-221 was still very strong, even though a long time had passed after the subcutaneous injection of LNCaP cells. [score:3]
0004029.g002 Figure 2 In vitro inhibition of miR-221 and miR-222 reduces tumor growth of PC3 derived tumors in SCID mice. [score:3]
On the other hand, we sought to investigate if it is possible to inhibit miR-221 and miR-222 expression in mouse mo dels of established prostate carcinoma, in order to set up the premises for a future therapeutic approach. [score:3]
However, our results represent the first step toward a possible use of miR-221/222 as molecular markers for prostate carcinoma, and set the base for the future employment of anti-miR-221/222 antagomirs for the inhibition of prostate carcinoma growth. [score:3]
The overexpression of miR-221 is sufficient to strongly enhance growth of LNCaP xenografts. [score:3]
We have pre -transfected cells from the highly aggressive PC3 cell line with LNA antisense oligonucleotides targeting miR-221 and miR-222, and subsequently followed the growth of tumor xenografts obtained through the injection of pre -transfected cells into SCID mice. [score:3]
As shown in Fig. 2A, LNA oligoes efficiently depleted miR-221 and mir-222 from PC3 cells, to such an extent that miR-221/222 expression was almost undetectable by Northern blot. [score:3]
For these reasons we believe that our positive data in this latter settlement are the most significant and interesting, as they show that miR-221/222 inhibition can reduce the growth of pre-established prostate carcinoma xenografts. [score:3]
As clearly depicted in the graph, the advantage in growth was very early achieved by miR-221 expressing tumors, producing volumes that were statistically much greater than control ones for the whole duration of the experiment (p<0.01 for all time points). [score:3]
To achieve this, we have overexpressed miR-221 in the poorly aggressive human prostate carcinoma cell line LNCaP, and observed the growth of tumor xenografts derived from those cells in SCID mice. [score:3]
The intratumoral injection of anti-miR-221 and anti-miR-222 antagomirs into PC3-derived tumors reduces tumor growth and has long lasting effects on miR-221 and miR-222 endogenous expression. [score:3]
Altogether, these results indicate that intratumoral injection of antagomirs targeting miR-221 and miR-222 can effectively keep low the concentration of these two microRNAs for as long as 24 days (i. e. time elapsed from third and last antagomir injection to animal sacrifice), concomitantly increasing p27 amount and ultimately reducing the growth of PC3 xenografts. [score:3]
Thus, the mere overexpression of miR-221 is able, per se, to highly enhance the growth of LNCaP xenografts. [score:3]
Finally, we think that the relevance of our data, collected in mouse mo dels of prostate carcinoma, is supported by the last results we show in this study, about a significant inverse correlation between miR-221/222 and p27 expression in primary cell lines derived from tumor samples of prostate carcinoma. [score:3]
Further studies are certainly needed to more deeply dissect miR-221/222 role, also taking into account that it is very likely that their oncogenic action is not limited to the inhibition of p27, as recently demonstrated in other tumors [8], [13]. [score:3]
In agreement with this observation, the average volume fold increase of miR-221 expressing tumors at the end of the experiment was extremely higher than that of control tumors (4.024±0.89 vs 74.432±19.79, p = 0.025) (Fig. 1C ). [score:3]
To assess the significance of our results in human tumor samples, we analyzed miR-221 and miR-222 expression in 21 patients with stage II–III prostate cancer. [score:3]
The expression of miR-221 in the highly aggressive PC3 prostate carcinoma cell line is also shown, as a positive control. [score:3]
Consistently, the anti-miR-221/222 antagomir treatment of established subcutaneous tumors derived from the highly aggressive PC3 cell line, naturally expressing high levels of miR-221/222, reduces tumor growth by increasing intratumoral p27 amount; this effect is long lasting, as it is detectable as long as 25 days after the treatment. [score:3]
MiR-221 ectopic overexpression enhances the growth of LNCaP-derived tumors. [score:2]
Encouraged by the previous results, we took a further step toward the assessment of the feasibility of the direct in vivo anti-miR-221/222 treatment. [score:2]
We have recently shown that miR-221 and miR-222 are positive regulators of in vitro prostate carcinoma growth through the repression of p27 [9]. [score:2]
We previously showed this regulatory relationship in prostate carcinoma cell lines in vitro, underlying the role of miR-221/222 as inducers of proliferation and tumorigenicity. [score:2]
The graph shows the log fold change of miR-221 and miR-222 expression as compared to the value obtained for non-tumoral control sample N1. [score:2]
Western blot analysis performed on protein extracts from miR-221 expressing tumors showed a clear reduction of p27 levels, as compared to control samples (Fig. 1F ). [score:2]
As shown in Fig. 1B, a strongly significant increase in growth was conferred to tumors overexpressing miR-221, as compared to empty-vector transfected control tumors. [score:2]
These results provide a strong indication that the previously identified regulatory relationship inversely linking miR-221/222 to p27 is true and relevant in human primary prostate carcinoma samples. [score:2]
Among oncomiRs, we and others previously found that miR-221 and miR-222 are involved in several different types of human neoplasms, such as glioblastoma [5]– [8], prostate carcinoma [9], non-small cell lung cancer [10], [11], hepatocellular cancer [12], [13], pancreatic cancer [14], and many others. [score:1]
Under each lane, the numerical values represent p27 relative amount, that was set  = 1 in each control tumor (ctrl), and the p27 expression in the respective controlateral anti-miR221/222 tumor was calculated. [score:1]
For studies involving LNCaP cells, 3×10 [6] exponentially growing, empty vector-transduced or miR-221-transduced LNCaP cells were resuspended in a solution of 50% Matrigel in PBS, and s. c. injected into the left and the right flank respectively of 5 wk old male CB. [score:1]
To answer this question, we performed Q-RT-PCR on total RNA extracted from excised tumors, and verified an effective and persistent reduction of miR-221 and miR-222 in treated tumors vs control ones (Fig. 3C ). [score:1]
These findings suggest that modulating miR-221/222 levels may have a therapeutic potential in prostate carcinoma. [score:1]
Both approaches clearly aimed at reducing miR-221 and miR-222 in the tumors but, while the first one theoretically conferred a delay to pretransfected cells that received the LNA oligoes, before they settled in the host environment and started assembling a true tumor, the second one more closely mimicked a “treatment”, as it was performed in already grown tumors, where cells had already formed their network of contacts within the host body. [score:1]
A MiR-221 and miR-222 expression measured by quantitative real-time PCR in primary cell lines from prostate carcinomas (T samples) or normal prostate (N samples). [score:1]
We then sought to determine if the observed effects on tumor growth were still accompanied, at the day of sacrifice, by a consistent reduction of miR-221/222. [score:1]
C Average volume fold increase of tumors derived from PC3 cells transfected with anti-miR-221+anti-miR-222 LNA oligonucleotides (anti-221/222) or with a negative control LNA oligonucleotide (ctrl). [score:1]
For the experiments with in vitro transfected PC3 cells, LNA oligonucleotides against miR-221 and miR-222, and a negative control oligonucleotide were obtained from Ambion Inc. [score:1]
Our findings indicate that miR-221 and miR-222 are key modulators of prostate carcinoma also in vivo. [score:1]
A Northern blot analysis of total RNA extracted from PC3 cells transfected in vitro with anti-miR-221+anti-miR-222 LNA oligonucleotides (anti-221/222). [score:1]
For each mouse, the tumor on one flank was injected with a mixture of anti-miR-221 and anti-miR-222 antagomirs, while the controlateral tumor was injected with a control antagomir. [score:1]
C Quantitative real-time PCR of miR-221 (upper panel) or miR-222 (lower panel) in tumors excised from four representative mice (A10, D3, D10, E3) at the day of sacrifice, 24 days after the last antagomir injection. [score:1]
To achieve this goal, we treated pre-established tumors induced by the s. c. injection of PC3 cells into SCID mice, with anti-miR-221 and anti-miR-222 “antagomirs”, cholesterol-conjugated antisense molecules previously shown to own a good bioavailability and stability in vivo [25], [26]. [score:1]
Each animal received control cells on one flank and anti-miR-221+anti-miR-222 pre -treated cells on the other. [score:1]
A Tumor growth curves depicting the average±SEM values of PC3 derived tumors injected either with a negative control antagomir (ctrl) or with a mixture of anti-miR-221 and anti-miR-222 antagomirs (anti-miR221/222). [score:1]
The specific probes, end-labeled with T4 polynucleotide kinase in the presence of γ- [32]P-ATP, were: miR-221, 5′-gaaacccagcagacaatgtagc-3′; miR-222, 5′-gagacccagtagccagat-3′; U6, 5′-cacgaatttgcgtgtcatccttgcgcaggggcc-3′. [score:1]
C Spearman correlation analysis performed between miR-221, miR-222, and p27 levels in 18 primary cell lines derived from prostate carcinoma tissues. [score:1]
0004029.g004 Figure 4 A MiR-221 and miR-222 expression measured by quantitative real-time PCR in primary cell lines from prostate carcinomas (T samples) or normal prostate (N samples). [score:1]
On the other hand, we have injected anti-miR-221 and anti-miR-222 antagomirs into pre-established PC3 xenografts. [score:1]
Spearman correlation analysis was performed between miR-221/222 and p27 levels. [score:1]
Antagomir sequences were 5′-g [s]a [s]aacccagcagacaaugu [s]a [s]g [s]c [s]u-Chol 3′ (anti-miR-221), 5′-g [s]a [s]gacccaguagccagaugua [s]g [s]u [s]c [s]u-Chol 3′ (anti-miR-222). [score:1]
The in vitro depletion of miR-221 and miR-222 renders PC3 cells less efficient in the establishment of in vivo xenografts. [score:1]
0004029.g003 Figure 3 A Tumor growth curves depicting the average±SEM values of PC3 derived tumors injected either with a negative control antagomir (ctrl) or with a mixture of anti-miR-221 and anti-miR-222 antagomirs (anti-miR221/222). [score:1]
40 µl of PBS containing 1 µg of each anti-miR-221 and anti-miR-222 antagomir, or control antagomir, were injected intratumorally at day 0, 5 and 9, for a total of three injections per tumor. [score:1]
[1 to 20 of 87 sentences]
5
[+] score: 260
analysis showed that TIMP3 expression was up-regulated in cells with reduced levels of miR-221/222, whereas TIMP3 expression was down-regulated in cells over -expressing miR-221/222 (Figure 3B). [score:13]
Furthermore, knockdown of miR-221/222 decreased invasion capability, reduced tumor growth and up-regulated the expression of the target, TIMP3, whereas ectopic expression of miR-221/222 exhibited the opposite effects. [score:11]
The number of patients in each group was shown: miR-221, low expression (14 patients) and high expression (22 patients); miR-221, low expression (16 patients) and high expression (20 patients). [score:9]
[14] Here, we demonstrated that miR-221/222 play an important role in the regulation of glioma invasion by directly targeting TIMP3, an inhibitor of MMPs. [score:7]
Immunohistochemistry then revealed that TIMP3 levels were up-regulated in As-miR-221/222 treated tumors and down-regulated in miR-221/222 treated tumors. [score:7]
As-miR-221/222 inhibits glioblastoma xenograft growth and induces TIMP3 up-regulation. [score:6]
In addition, knockdown of miR-221/222 increased TIMP3 expression and considerably inhibited tumor growth in a xenograft mo del. [score:6]
The expression and secretion of MMP2 and MMP9 were significantly reduced in the As-miR-221/222 group but were up-regulated in the miR-221/222 group (Figure 2C). [score:6]
To conclude, our data suggest that miR-221/222 could be intrinsic regulators of progression in glioma cells and could be used as potential targets and predictors of survival in this devastating disease. [score:6]
Over -expression of miR-221/222 increased cell invasion, whereas knockdown of miR-221/222 decreased cell invasion via modulating the levels of the target, TIMP3. [score:6]
MiR-221 and miR-222 (miR-221/222), upregulated in gliomas, can regulate glioma cell cycle progression and apoptosis, respectively. [score:5]
To determine the mechanism of action of miR-221 and miR-222 in glioma cell invasion, we performed a miRNA target search using TargetScan and found that the “seed sequence” of miR-221 and miR-222 matched the 3′ UTR of the TIMP3 gene (Figure 3A), which has been evidenced in non small cell lung cancer cells. [score:5]
Our recent data have shown that miR-221/222 inhibit cell apoptosis in human glioma cells by targeting the proapoptotic gene, PUMA. [score:5]
In summary, our data demonstrate that miR-221/222 regulate glioma cell invasion by directly targeting TIMP3. [score:5]
To further explore the role of miR-221/222 in cell invasion, we performed gain-of-function and loss-of-function analyses by over -expressing or suppressing miR-221/222 with As-miR-221/222 or miR-221/222, respectively. [score:5]
[12] To detect whether TIMP3 is indeed regulated by miR-221 and miR-222 in glioma cells, we knocked-down miR-221/222 and ectopically expressed miR-221/222 in U251 and LN229 cells. [score:5]
In this study, our data suggest that a high miR-221/222 expression level is a valuable marker for pathological diagnosis and prognosis prediction in high-grade glioma; high miR-221/222 expression levels were significantly associated with poor survival in high-grade glioma patients as determined by Kaplan-Meier analysis. [score:5]
The present data indicate that miR-221 and miR-222 directly regulate cell invasion by targeting TIMP3 and act as prognostic factors for glioma patients. [score:5]
These findings indicate that TIMP3 is a critical target of miR-221 and miR-222 and that these two miRNAs could be critical therapeutic targets and survival predictors in glioma. [score:5]
Reduction of miR-221/222 levels inhibited tumor growth in vivo, and over -expression of miR-221/222 slightly increased tumor growth (Figure 5A). [score:5]
Having demonstrated TIMP3 to be a direct target of miR-221/222 by our present and other previous studies [12], the importance of TIMP3 in miR-221/222 -mediated cell invasion is still unclear. [score:4]
These data indicate that miR-221/222 can directly modulate TIMP3 expression by binding to the 3′ UTR of TIMP3 in gliomas. [score:4]
We also provide direct evidence that high levels of miR-221/222 expression are significantly associated with poorer overall survival. [score:4]
Our present data and previous studies have shown that miR-221/222 affects the behavior of glioma cells including invasion, proliferation, apoptosis and radioresistance, by regulating multiple targets, including TIMP3, p27, PUMA, and PTEN [13- 15]. [score:4]
These results indicate that TIMP3 is a major target of miR-221 and miR-222 in regulating glioma cell invasion. [score:4]
TIMP3 is a direct target of miR-221 and miR-222. [score:4]
MiR-221 and miR-222 share the same seed sequence, which are short, evolutionarily conserved regions through which miRNAs bind their target sites in mRNA 3' UTRs, indicating an important role in coordinated regulation and function. [score:4]
However, recent data showed that miR-221 and miR-222 were downregulated in GBM and neither prognostic nor predictive associations were found for miR-221or miR-222 [28]. [score:4]
MiR-221/222 modulates glioma malignant phenotype by regulating multiple targets, indicating a critical prognostic value for glioma patients. [score:3]
Figure 1 DTI and expression of miR-221 and miR-222 in gliomas. [score:3]
Correlation of miR-221/222 expression levels and glioma invasion. [score:3]
Figure 4 Expression of TIMP3 abrogates miR-221/222 -mediated invasion. [score:3]
Figure 3 TIMP3 is a target for miR-221 and miR-222. [score:3]
TIMP3 was also inversely correlated with miR-221/222 expression. [score:3]
Furthermore, expression of TIMP3 could largely override miR-221/222 -mediated invasion. [score:3]
Notably, we found that miR-221 and miR-222 are associated with glioma cell invasion by integrating expression and DTI data. [score:3]
Having demonstrated TIMP3 as a major target of miR-221/222, we further investigated the correlation of between miR-221/222 and TIMP3 expression in gliomas. [score:3]
Finally, the increased level of miR-221/222 expression in high-grade gliomas confers poorer overall survival. [score:3]
These results demonstrate that TIMP3 is a core target of miR-221/222 in glioma cell invasion. [score:3]
Kaplan-Meier survival curve analysis showed that a highly statistically significant correlation was observed between the overall survival and the expression levels of miR-221 (P = 0.011) and miR-222 (P = 0.020) in high-grade gliomas (Figure 6C). [score:3]
However, expression of TIMP3 largely abrogated the effects of miR-221/222 on cell invasion (Figure 4A and B). [score:3]
Figure 6 Clinical significance of miR-221/222 and TIMP3 expression in gliomas. [score:3]
According to the expression profile of miR-221/222 and TIMP3, the tissue samples were categorized as low positive (≤3) and high positive (>3). [score:3]
The Pearson correlation showed that a significant negative correlation existed between FA values and miR-221 and miR-222 expression in these 22 gliomas (R = 0.755, P < 0.005 and R = 0.612, P < 0.005, respectively) (Figure 1C). [score:3]
Consistent with the results of the transwell assay, in the wound healing assay, repression of miR-221/222 significantly inhibited cell migration, while over -expression of miR-221/222 increased migration in both U251 and LN229 cells (Figure 2B). [score:3]
In the current study, we demonstrate that high levels of miR-221/222 expression in gliomas confer highly aggressive invasion and poorer overall survival. [score:3]
Inverse correlation of expression of miR-221/222 and TIMP3 in glioma tissues. [score:3]
Expression of TIMP3 overrides miR-221/222 -induced invasion. [score:3]
Expression levels of miR-221/222 and TIMP3 were quantified as described in methods. [score:3]
Kaplan-Meier analysis was employed to assess the survival rate of patients relative to expression levels of miR-221 and miR-222. [score:3]
Thus, As-miR-221/222 could be a therapeutic target for glioma intervention. [score:3]
Further, the target of miR-221/222 was determined by luciferase reporter, western blot and gene rescue assay. [score:2]
Interestingly, the transwell assay revealed that knockdown of miR-221/222 significantly decreased cell invasion potential compared with cells treated with scrambled oligonucleotide, whereas over -expression of miR-221/222 increased cell invasion (Figure 2A). [score:2]
However, there is little direct evidence to show the mechanism by which miR-221/222 controls glioma invasion. [score:2]
MiR-221 expression was significantly increased in high-grade gliomas compared with low-grade gliomas, and a similar trend for miR-222 was detected (Figure 1B). [score:2]
However, the association of miR-221/222 with glioma cell invasion and survival remains unknown. [score:1]
Significant prognostic value of miR-221/222 in high-grade glioma. [score:1]
These data indicate that the miR-221/222 high positive cases have a markedly worse outcome. [score:1]
These findings suggest that miR-221/222 may have an important role in glioma invasion. [score:1]
The association of miR-221/222 with outcome was examined in fifty glioma patients. [score:1]
LNA-miR-221 uses DIG modification and LNA-miR-222 uses BIO modification in 3' distal end. [score:1]
Then As-miR-221 and/or As-miR-222 (200 pmol) were transfected using Lipofectamine 2000 (Invitrogen). [score:1]
According to the above methods, cells were transfected with As-miR-221/222 or miR-221/222. [score:1]
Figure 5 Effects of miR-221/222 on tumor growth in a xenograft mouse mo del. [score:1]
Because the levels of miR-221 and miR-222 are frequently elevated in glioblastoma and because they play an important role in cell survival, we further examined the effects of miR-221/222 on tumor growth in a glioblastoma xenograft mo del. [score:1]
Introduction of a TIMP3 cDNA lacking 3’ UTR abrogated miR-221/222 -induced cell invasion. [score:1]
There was an inverse relationship between miR-221/222 and TIMP3 levels in glioma tissues. [score:1]
High-grade glioma patients with high levels of miR-221 or miR-222 had a significantly worse outcome. [score:1]
MiR-221 and miR-222-LNA oligonucleotides with digoxigenin modification contained LNAs at five locations (underlined): 5′-GAAA CCC AGC AGAC AATGTA GCT-3′ (miR-221); 5′-GAGA CCC AGTA GCCA GATG TAGCT-3′ (miR-222). [score:1]
Therefore, miR-221 and miR-222 are required for glioma cell invasion. [score:1]
For quantitative analysis of miR-221 and miR-222 in frozen tumor tissues of 22 patients, we performed real-time PCR. [score:1]
Representative images of miR-221/222 are shown in Figure 6A. [score:1]
The sequences are: 2'-OMe -miR-221 (miR-221), 5'-AGCUACAUUGUCUGCUGGGUUUC-3'; 2'-OMe -miR-222 (miR-222), 5'-AGCUACAUCUGGCUACUGGGU-3'; 2'-OMe-As-miR-221 (As-miR-221), 5'-AGCUACAUUGUCUGCUGGGUUUC-3'; 2'-OMe-As-miR-222 (As-miR-222), 5'-AGCUACAUCUGGCUACUGGGU-3'. [score:1]
Each group was treated with 200 pmol scramble oligo, As-miR-221/222 in 10 μl Lipofectamine, miR-221/222 or PBS through local injection of the xenograft tumor at multiple sites (3–4 injected sites). [score:1]
In high-grade glioma, DTI indicated a decrease and deflection of the fibers surrounding the glioma that was associated with high levels of miR-221/222. [score:1]
MiR-221/222 expression was significantly increased in high-grade gliomas compared with low-grade gliomas, and positively correlated with the degree of glioma infiltration. [score:1]
Critical role of miR-221/222 in glioma cell invasion. [score:1]
Thus, we reasoned that miR-221/222 should have a critical prognostic value for glioma patients (Figure 6B). [score:1]
Figure 2 MiR-221 and miR-222 play an important role in glioma cell invasion. [score:1]
[1 to 20 of 79 sentences]
6
[+] score: 242
Other miRNAs from this paper: hsa-mir-221
In this study, we found that miR-221-5p can specific target SOCS1, which is tumor suppressor genes,and suppress SOCS1 protein expression in PC3 and DU145 cells. [score:9]
Next, by RT-PCR and western blotting analysis, we found that overexpression of miR-221-5p significantly suppressed SOCS1 expression but silencing of miR-221-5p increased SOCS1 expression (Fig.   3d and e). [score:9]
miR-221-5p down-regulates SOCS1 expression by targeting its 3’UTR. [score:8]
This study indicates that miR-221-5p may suppress the expression of SOCS1 by targeting the binding 3’UTR sites of the SOCS1. [score:7]
On the contrary, silencing of miR-221-5p promoted the expression of E-cadherin while suppress the expression of vimentin (Fig.   4d). [score:7]
miR-221-5p regulates the proliferation, migration of prostate cancer cells in vitro and tumorigenesis in vivo by regulating socs1 expression through targeted its 3’UTR, and. [score:7]
c, d miR-221-5p promotes EMT features and regulates the expression of mesenchymal marker vimentin and epithelial marker E-cadherinEpithelial-mesenchymal transition (EMT), a critical process for tumor migration and metastasis, was increased that shown as decrease of epithelial marker E-cadherin and increase of mesenchymal marker vimentin by overexpression of miR-221-5p (Fig.   4c). [score:6]
Up-regulation and silencing of miR-221-5p expression in prostate cancer cells are correlated with cell proliferation, migration and tumorigenesis, which suggest that miR-221-5p plays an important role in prostate cancer progression. [score:6]
At the cellular level, by establishing the stably expression cell lines of overexpression or silencing miR-221-5p, we found that miR-221-5p regulates the cell proliferation, colony formation and migration of human prostate cancer cells. [score:6]
c, d miR-221-5p promotes EMT features and regulates the expression of mesenchymal marker vimentin and epithelial marker E-cadherin Epithelial-mesenchymal transition (EMT), a critical process for tumor migration and metastasis, was increased that shown as decrease of epithelial marker E-cadherin and increase of mesenchymal marker vimentin by overexpression of miR-221-5p (Fig.   4c). [score:6]
c, d The expression level of miR-221-5p in control and miR-221-5p -overexpressing (miR-221-5p OV) prostate cancer cells as detected by quantitative RT-PCR. [score:5]
Bioinformatic analysis of miR-221-5p target sites was performed using TargetScan website (http://www. [score:5]
But studies of Coarfa et al. show that miR-221-5p suppressed AR protein expression in LNCAP cells. [score:5]
The miR-221-5p and miR-221-5p silencing sequence (TuD RNA, Tough Decoy (TuD) miRNA inhibitor) [26] were constructed into lentivirus plasmid pLKD-CMV-G&PR-U6-shRNA, establishing stable expression cell lines. [score:5]
In our studies, luciferase assays, qRT-PCR and western blotting demonstrated that miR-221-5p can target SOCS1 and regulates the expression in cells level. [score:5]
Our studies have provided evidence that miR-221-5p can inhibit the expression of SOCS1 to control tumor proliferation, migration and tumorigenicity of prostate cancer cells both in vitro and in vivo. [score:5]
In this study, we investigated the potential functions of miR-221-5p in prostate cancer and found that miR-221-5p can specific target SOCS1 (Suppressers of cytokine signaling (SOCS) family protein, which is tumor suppressor genes [22– 25]. [score:5]
miRNA-221-5p and its target gene SOCS1 expression levels in the stable cells were analyzed by real-time polymerase chain reaction (RT-PCR) and western blotting. [score:5]
Discovery of chemical molecules or other ways to regulate tumor promoting activity of miR-221-5p will have more effective to control tumor cells and inhibit tumor cell proliferation, tumor migration/metastasis. [score:4]
Fig. 3SOCS1 is a direct downstream target for miR-221-5p. [score:4]
Given that the expression of SOCS1 is regulated at post-transcriptional level by miR-221-5p, detection the expression of miR-221-5p in cancer tissues would discover an effective approach to evaluate miR-221-5p as a potential prostate cancer biomarker. [score:4]
Theoretically, silencing the tumor promoting activity of miR-221-5p can stand out as an effective approach to inhibit cancer progression. [score:3]
But Coarfa et al. [21] examined some publicly available, independent sets data and found that many of SIM-miRNAs were significantly downregulated in primary PC (compared with normal prostate),including miR-221-5p. [score:3]
Future studies are needed to explore the association with miR-221-5p and SOCS1, and whether miR-221-5p/SOCS1 pair can be used as a new biomarker to diagnosis of prostate cancer, and whether it can be as a novel therapeutic target in prostate cancer treatment. [score:3]
By TargetScan and miRBase bioinformatics analyses, the 3’UTR of SOCS1 were identified as the potential binding site of miR-221-5p (Fig.   3b). [score:3]
But the molecular mechanisms of miR-221-5p and the related target genes are largely unknown. [score:3]
Gene microarray data have shown the abnormal expression and paradoxical roles of miR-221-5p in human prostate cancer tissues [19– 21]. [score:3]
At the animal level, silencing of miR-221-5p inhibited significantly the tumorigenesis of prostate cancers in nude mice. [score:3]
After serum starvation for 16 h, PC3 cells with overexpression of miR-221-5p or control were stimulated with 10% FBS for 20 min and the cells were harvested for immunoblotting. [score:3]
In earlier research, we find that the expression of miR-221-5p is significantly different between tumor tissues and adjacent tissues of prostate cancer patients. [score:3]
And we have found that the expression of miR-221-5p is significantly different between tumor tissues and adjacent tissues of prostate cancer patients (Fig.   1a). [score:3]
e, f By MTT assay, miR-221-5p overexpression or silencing regulated cell viability in PC3 cell lines (at24,48,and72 h). [score:3]
miR-221-5p overexpression or silencing vector was co -transfected with the packaging plasmids pMD2. [score:3]
To determine whether SOCS1 was regulated by miR-221-5p through direct binding to its 3’UTR, we inserted PCR products containing wild-type or mutant SOCS1 3’UTR binding sites into the pMIR-REPORT Luciferase vector. [score:3]
A previous microarray data has shown that miRNAs are differentially expressed in prostate cancer tissues, borderline tissues and that some miRNAs, including miR-221-5p, are correlated with the progression of prostate cancer. [score:3]
For verification of miR-221-5p expression by polymerase chain reaction (PCR),20 tumor tissue and adjacent tissue samples were collected from patients with prostate cancer at Second People’s Hospital of Wuxi Affiliated to Nanjing Medical University. [score:3]
We established PC3 cell lines with stable overexpression or silencing of miRNA-221-5p via lentivirus infection. [score:3]
We discovered that the phosphorylation of ERK was observably increased by overexpression of miR-221-5p in the prostate cancer cells (Fig.   4a). [score:3]
We established PC3 and DU145 cell lines stably expressing miR-221-5p via lentivirus infection. [score:3]
TaqMan miRNA Kit (Applied Biosystems) were used to detect the expression level of mature miR-221-5p with U6 small nuclear RNA as an internal control. [score:3]
a Overexpression of miR-221-5p enhances MAPK/ERK signaling pathways. [score:3]
As shown in Fig.   1e and f, the proliferation rate of PC3 and DU145 cells was significantly increased by stably expressing miR-221-5p cells in comparison with the control cells. [score:3]
In contrast, silencing of miR-221-5p could inhibit serum -induced phosphorylation of ERK (Fig.   4b). [score:3]
a The expression level of miR-221-5p in tumor tissues and adjacent tissues of prostate cancer patients. [score:3]
b Silencing of miR-221-5p inhibits MAPK/ERK signaling pathways. [score:3]
Successful overexpression of exogenous miR-221-5p was confirmed by RT-PCR (Fig.   1c). [score:3]
And the corresponding mutant plasmid was constructed through mutations in the seed regions of the miR-221-5p -binding sites. [score:2]
And miR-221-5p is able to regulate Ras/Raf/MEK/ERK signaling cascades in prostate cancer cells and such enhancement likely underlies its tumor-promoting activity in prostate cancer cells. [score:2]
We next explored the changes in cell proliferation after stably expressing miR-221-5p by MTT and colony formation assays. [score:2]
Consistently, in wound healing assay, the migration rate was significantly increased with miR-221-5p overexpression (Fig.   2c). [score:2]
And we also confirm that miR-221-5p enhances cell proliferation and metastasis through post-transcriptional regulation of SOCS1 by vitro and vivo experiments in human prostate cancer. [score:2]
d, e Western blot assays of SOCS1 protein in PC3 cells after infection with miR-221-5p overexpression or silening lentivirus. [score:2]
For experiments, HEK293T cells plated on 96-well plates were co -transfected with miR-221-5p mimics or mimics NC, and with pMIR-REPORT-SOCS1–3’UTR(WT) or mutation plasmid pMIR-REPORT-SOCS1–3’UTR(MUT) using Lipofectamine 2000 Transfection Reagent. [score:2]
We will also collect more patient samples in subsequent trials to analyze the relationship between mir-221-5p and prostate cancer during different stages of development. [score:2]
a, b Effect of miR-221-5p overexpression or silencing on PC3 cells migration in wound healing assay. [score:2]
These data indicated that Ras/Raf/MEK/ERK signaling pathway was regulated by miR-221-5p, likely explaining its effects on tumor-promoting activity in prostate cancer cells. [score:2]
miR-221-5p regulates MAPK/ERK signaling pathway and EMT features in prostate cancer cells. [score:2]
EMT as a critical step for tumor migration and metastasis has been demonstrated that miR-221-5p regulates EMT features in prostate cancer cells. [score:2]
The results of our study with Coarfa et al. are inconsistent, and in order to find out why the results were inconsistent, We measured our collection of prostate cancer clinical sample, and found that in some tumor samples, the expression of miR-221-5p in the adjacent tissues was elevated and decreased in the cancer tissue, which is consistent with Coarfa et al’s findings and indicated that the patient had obvious heterogeneity, but in the whole clinical data, miR-221-5p was positively correlated with prostate cancer. [score:1]
Fig. 5Silencing of miR-221-5p enhances the growth of PC3 cell xenografts in nude mice mo del. [score:1]
Therefore, this clearly indicated that miR-221-5p has an effective activity to promote the xenograft of prostate cancer in vivo. [score:1]
b The mode pattern of miR-221-5p silencing system. [score:1]
Collectively, these data indicated that miR-221-5p has a positive effect on the growth of human prostate cancer cells. [score:1]
a The subcutaneous tumors xenografts in nude mice derived from the silencing of miR-221-5p clones were smaller in size than control clones(n = 5 each group). [score:1]
miR-221-5p promotes cell proliferation of prostate cancer cells. [score:1]
To further study the function of miR-221-5p in human prostate cancer we established nude mice xenograft mo del in vivo. [score:1]
miR-221-5p promotes prostate cancer xenograft growth in vivo. [score:1]
We next explored whether MAPK/ERK signaling pathway was also affected by miR-221-5p in prostate cancer cells. [score:1]
This suggests that miR-221-5p may have different effects at different stages of prostate cancer, but the number of prostate cancer samples currently collected is only 20, which is not enough to illustrate the problem. [score:1]
For xenograft mo dels, the two PC3 cell lines were contributed, including miR-221-5p silencing cell and control cell lines. [score:1]
However,using the TuD RNA (Tough Decoy RNA) (Fig.   1b), we established PC3 cell lines that the activity of miR-221-5p is closed. [score:1]
Prostate cancer miR-221-5p SOCS1 Cell proliferation Cell migration Tumor xenograft Prostate cancer (PCa) is the most common malignant tumor in the human urinary system, and it is also the second major cause of death in the world. [score:1]
PC3 cells, silencing of miR-221-5p or its control, were implanted into the nude mice (4 weeks). [score:1]
PC3 stably cells of silencing miR-221-5p or control were serum-starved for 16 h, and cells were stimulated with 10% FBS for 20 min. [score:1]
The transwell assay further confirmed that miR-221-5p regulates the migration of prostate cancer cells (Fig.   2a and b). [score:1]
In conclusion, we find a new miR-221-5p/SOCS1 pair that may play an important role in progression of prostate cancer. [score:1]
miR-221-5p promotes the migration of prostate cancer cells. [score:1]
As miR-221-5p is able to promote migration of prostate cancers, the association of miR-221-5p/SOCS1 with metastasis and EMT need to be addressed in the future. [score:1]
[1 to 20 of 78 sentences]
7
[+] score: 222
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-1a-2, mmu-mir-222, mmu-mir-1b
Others have reported that the KPC E3 ligase directly regulates G1 phase p27 degradation [9], but our ability to fully prevent serum-stimulated p27 downregulation by the combined inhibition of miR221/222 and the Skp2/T187 pathways indicates that KPC is either poorly expressed or minimally involved in p27 degradation in VSMCs. [score:10]
In addition to p27, the miR-221/222 family downregulates expression of the closely related cdk inhibitor, p57 [kip2] [17], [32], [44]. [score:8]
To directly compare the roles of miR-221/222 and Skp2 on p27 regulation, we transfected wild-type and p27T187A VSMCs with a modified RNA oligonucleotide complementary to miR-222 (hereafter called the “anti-miR”) that effectively inhibits the expression of both miR-221 and 222 ([32] and Fig. S2). [score:7]
It is possible, however, that the changes in Skp2 expression reported by Wu et al. [8] are an indirect effect of miR-221/222-regulated p27 expression as described here. [score:7]
Since miR221/222 and Skp2 must both be inhibited to prevent p27 down-regulation (refer to Fig. 2) and since Skp2 is required in S phase, we propose that miR221/222 has a major role tranducing the effect of cicaprost on G1 phase p27. [score:6]
In contrast, miR-221/222 inhibition in p27T187A cells efficiently blocked the FBS -induced downregulation of p27 and S phase entry (Fig. 2A–B). [score:6]
in panel C show mean ± SD, n = 3. Primary and Secondary Effects of PGI [2] on miR221/222 and Skp2As compared to wild-type VSMCs, the T187A mutation prevented serum-stimulated downregulation of p27 expression in S phase but not in G1 phase (Fig. 4A–B; compare 18 and 30 h). [score:6]
Based on this reasoning, the fact that cicaprost inhibited both miR221/222 and Skp2 induction agreed well with its ability to block the downregulation of p27. [score:6]
Note that G1 phase downregulation of p27 was evident 9 h after FBS stimulation in this experiment, affording us more time points to document the inhibitory effect of MG132 on G1 phase miR221/222. [score:6]
Figure S4 PGI2 inhibits miR221/222 expression in wild-type and IP -null VSMCs. [score:5]
We suggest that the primary response to PGI [2] is an inhibition of miR221/222 expression in G1 phase. [score:5]
We did not detect an inhibitory effect of miR-221/222 inhibition on VSMC cycling unless Skp2 -mediated degradation was blocked. [score:5]
Suppression of miR-221/222 Expression by cAMP. [score:5]
Thus, the effect of MG132 on G1 phase p27 downregulation may be indirect and involve miR221/222 (see). [score:5]
We show that miR221/222 redundantly regulate p27 levels post-transcriptionally, and this finding helps to explain why pronounced defects in p27 expression and cell cycling are not regularly observed in vitro or in vivo when Skp2 -mediated p27 degradation is precluded by mutation of p27T187. [score:5]
However, the inhibitory effect of 8-Br-cAMP and forskolin on miR-221/222 expression was not associated with reduced ERK activity (Fig. 6B). [score:5]
Based on these data and this report, we posit that PGI [2] inhibits cell cycling by integrating miR221/222- and Skp2 -dependent p27 expression. [score:5]
We conclude that miR-221/222, rather than Skp2, is the primary target of PGI [2. ] Nevertheless, PGI [2] has an indirect effect on Skp2 and this contributes to the observed effect of PGI [2] on overall p27 levels in VSMCs (see). [score:4]
While this result would appear to conflict with a miR -dependent regulation of p27 in G1 phase, we unexpectedly found that MG132 inhibits G1 phase miR221/222 as well as p27 (Fig. 4C–D; 9 and 18 h). [score:4]
miR-221/222 is a bicistronic microRNA family that directly suppresses p27 levels post-transcriptionally by binding to two discrete sites in the p27 mRNA 3′UTR [15]– [17]. [score:4]
Thus, miR-221/222 and Skp2 redundantly contribute to the down-regulation of p27. [score:4]
However, since miR221/222 and Skp2 have compensatory effects on p27 (Fig. 2), both pathways must be inactivated to prevent p27 downregulation. [score:4]
show mean ± SD, n = 3. Regulation of miR221/222 and Skp2 by PGI [2] Prostacyclin (PGI [2]) is a potent anti-mitogen for VSMCs, and the anti-mitogenic effect of PGI [2] is fully dependent on p27: PGI [2] strongly increases p27 levels and blocks S phase entry in wild-type VSMCs yet fails to inhibit S phase entry in p27 -null VSMCs [22]. [score:4]
Collectively, the results in Fig. S3 and 3 indicate that either the Skp2 or miR221/222 pathway is sufficient to stimulate p27 downregulation. [score:4]
This analysis identified miR-221 as a differentially expressed upstream regulator of p27 (Fig. 1C). [score:4]
Thus, the cAMP effect on miR-221/222 reflects active inhibition that is independent of and antagonistic to ERK -dependent miR-221/222 induction (Fig. 6F). [score:3]
One of these studies [32] reported that transfection with an antisense oligonucleotide targeting miR-221/222 reduced neointima formation in injured arteries and reduced cycling in cultured VSMCs. [score:3]
miR-221/222 is a primary target of PGI [2]. [score:3]
RT-qPCR was performed for miRNA221, miRNA222 and Skp2 expression. [score:3]
Inhibition of serum -induced miR221/222 by cicaprost was seen in both WT and p27T187A VSMCs (Fig. S4), indicating that Skp2 -mediated p27 degradation is not required for the effect. [score:3]
Effects of miR-221/222 and Skp2 on p27 levels during cell cycling and cell cycle inhibition. [score:3]
In A, total RNA was extracted at 24 h, and miR-221/222 expression levels were determined by RT-qPCR. [score:3]
For the analysis of miR-221 and miR-222 expression, total RNA was isolated from cells or isolated aortae with TRIZOL and reverse transcribed using ∼50 ng of RNA in a 15-µl reaction with TaqMan microRNA reverse transcription kit (Applied Biosystems). [score:3]
In striking contrast, the inhibitory effect of cicaprost on miR-221/222 persisted in p27 -null VSMCs (Fig. 5C). [score:3]
Additionally, we show that miR-221/222 plays a primary role in cell cycle inhibition by PGI [2] and its canonical second messenger, cAMP. [score:3]
To determine if miR-221/222 might be the target of cAMP signaling, we treated VSMCs with 8-Br-cAMP or forskolin. [score:3]
Effect of cAMP elevating agents on miR-221/222 and p27 expression. [score:3]
These results reveal an unanticipated connection between proteosomal degradation and miR221/222 expression. [score:3]
In C, coverslips were fixed at 48 h and stained for EdU; results are plotted relative to the FBS -treated control; n = 3. In D-E, total RNA was extracted at 24 h, and miR-221 or miR-222 expression levels were determined by RT-qPCR. [score:3]
miR-221/222 and Skp2 mRNA expression in injured femoral arteries. [score:3]
Importantly, the effect of cAMP on miR-221/222 is upstream of p27 and cell cycle progression because the inhibitory effect of 8-Br-cAMP and forskolin on miR-221/222 remained even in p27 -null cells (Fig. 6D–E) where neither agent could prevent S phase entry (Fig. 6C). [score:3]
Both treatments repressed miR-221/222 (Fig. 6A), increased p27 levels (Fig. 6B), and inhibited EdU incorporation (Fig. 6C). [score:3]
However, serum also induces miR221/222, and this induction is also strongly inhibited by cicaprost (Fig. 3A). [score:3]
miR-221/222 induction is mediated by the ERK MAP kinase pathway [38], and in agreement with that study we found that the MEK/ERK inhibitor, U0126, reduced serum-stimulation of miR-221/222 in VSMCs (Fig. 6A). [score:3]
Most recently, miR-221/222 has emerged as a novel regulator of p27 [15]– [18]. [score:2]
Directed analysis by RT-qPCR confirmed the induction of miR-221 and also revealed induction of its bicistronic partner, miR-222, in the injured arteries of 5 of 6 additional SMA-GFP mice (Table 1). [score:2]
Regulation of miR221/222 and Skp2 by PGI [2]. [score:2]
show mean ± SD, n = 2. (F) miR-221/222 regulation by mitogens, ERK, PGI [2], and cAMP. [score:2]
miR221/222 regulation by PGI2 and role in mitogensis. [score:2]
In this report, we combined vascular injury in the mouse with transcript profiling to identify miR-221/222 as the compensatory regulator of p27. [score:2]
Our data also indicate that miR221/222 regulates p27 levels in G1 phase whereas Skp2 acts in S phase. [score:2]
Regulation of p27 by miR-221/222 and Skp2. [score:2]
Whether this connection relates to proteasome-sensitive transcriptional regulation of the miR221/222 promoter or proteasome -dependent miR221/222 maturation/function remains to be determined. [score:2]
Total RNA was extracted at 9 (n = 3) and 18 h (n = 2) and analyzed for miR221/222 by RT-qPCR. [score:1]
Quiescent early passage VSMCs from wild-type and p27T187A mice were stimulated with 10% FBS in the absence (control) or presence of 200 nM cicaprost for 24 h. Cells were analyzed by RTqPCR for miR221 and miR222. [score:1]
Primary and Secondary Effects of PGI [2] on miR221/222 and Skp2. [score:1]
Early passage VSMCs from wild-type mice were transfected with control anti-miR (Cntl) or anti-miR222, serum-starved (G0) and then stimulated with 10% FBS for 24 h. Cells were collected, lysed and analyzed by RT-qPCR for miRNA221 and miR222. [score:1]
However, we also show that MG132 effectively blunts miR221/222 induction. [score:1]
Others have individually examined the roles of Skp2 or miR-221/222 on p27 and VSMC cycling. [score:1]
miR-221/222 Compensates for Loss of Skp2 -mediated p27 Degradation. [score:1]
This notion is consistent with our finding that the serum -dependent induction of miR221/222 precedes S phase entry (Fig. 2A; compare top and bottom panels). [score:1]
miR-221/222 induction was also seen after FBS stimulation of primary VSMCs in vitro (Fig. 1D), and in agreement with our in vivo data, the magnitude of the FBS effect on miR-221/222 exceeded that seen for Skp2 mRNA (Fig. 1D). [score:1]
Figure S2 Effect of anti-miR222 on miR221 and miR222. [score:1]
Still other studies describe a mitogen-stimulated induction of miR-221 [18] or both miR-221 and miR-222 [32] in VSMCs, and these effects inversely correlate with p27 levels. [score:1]
Transcript profiling reveals that miR-221/222 is induced after vascular injury in vivo. [score:1]
The boxed region of interest at the bottom of the interaction map is expanded below to highlight the induction of miR-221 (green oval). [score:1]
[1 to 20 of 66 sentences]
8
[+] score: 203
Down-regulation of miR-221 was associated with up-regulation of p27Kip1 at both mRNA and protein level (Fig. 3C and D, respectively). [score:7]
In vivo, systemic treatment with LNA-i-miR-221 triggered significant anti-tumor activity against t(4;14) MM xenografts; it also induced miR-221 downregulation, upregulated p27Kip1 and reduced Ki-67. [score:7]
We previously reported that silencing of miR-221/222 by an antisense oligonucleotide induces anti-MM activity and upregulates canonical miR-221/222 targets. [score:6]
In vitro, LNA-i-miR-221 exerted strong antagonistic activity against miR-221 and induced upregulation of the endogenous target p27Kip1. [score:6]
The latter effect was associated with reduced miR-221 expression and upregulation of p27Kip1. [score:6]
This finding demonstrates that, as expected, the inhibition of cell growth was related to the miR-221 overexpression. [score:5]
Overexpression of miR-221 interferes with a wide set of gene targets involved in proliferation and apoptosis in a variety of these malignancies [12], [20], [35]. [score:5]
We also demonstrated that miR-221 inhibitors were more active than miR-222 inhibitors. [score:5]
RNA extracts from retrieved tumors were analyzed for miR-221 levels and modulation of canonical targets expression. [score:5]
The specificity of miR-221 inhibition in our study is demonstrated by the lack of significant changes in the proliferation rate of MM cells not bearing the t(4;14) translocation and expressing low miR-221 levels. [score:5]
In fact, miR-221 and 222 are well recognized oncogenic miRNAs that are upregulated in several malignancies [15], [17]– [25]. [score:4]
The miR-221/222 cluster is upregulated in malignant plasma cells from multiple myeloma (MM) patients harboring the t(4;14) translocation. [score:4]
The in vivo anti-tumor activity occurred when miR-221/222 inhibitors were delivered directly into MM xenografts. [score:4]
The LNA-i-miR-221 oligonucleotide that has a complete PS backbone resulted in lasting and effective miRNA antagonism as shown by the decrease of both miRNAs and by the upregulation of p27Kip1 up to 2 weeks after the last LNA-i-miR-221 treatment. [score:4]
To probe further the effect of LNA-i-miR-221 on derepression of p27Kip1, which is a well established miR-221 canonical target, we co -transfected a luciferase reporter vector containing the 3′UTR region of p27Kip1 into MM cells. [score:3]
A pLightSwitch_3′UTR Reporter Vector containing a synthetic target consisting of sequence repeats fully complementary to the miR-221-3p, based on miRBase 16 annotations, was purchased from Switch Gear Genomics (Menlo Park, CA, USA). [score:3]
A 20% of cell growth inhibition was also detected in LNA-i-miR-221 -transfected t(4;14) OPM-2 cells (Fig. 2C). [score:3]
We previously demonstrated that silencing the miR-221/222 by specific inhibitors in MM cells bearing the t(4;14) translocation resulted in powerful anti-tumor activity in vitro and in murine mo dels of human MM [15]. [score:3]
We also demonstrated that silencing of miR-221 resulted in higher anti-tumor activity as compared to miR-222, when inhibitors were injected directly into the tumors. [score:3]
The miR-221-3p synthetic target was cloned downstream of the Renilla luminescent reporter gene (RenSP). [score:3]
Subsequently, we evaluated the inhibitory activity of LNA-i-miR-221 on MM cells not bearing the t(4;14) translocation and expressing low levels of miR-221 [15]. [score:3]
10 µg of pLightSwitch_3′UTR reporter plasmid and 100 nM of LNA-i-miR-221 inhibitor or scrambled control were used to co-transfect 1×10 [6] MM cells. [score:3]
B) q-RT-PCR of p27Kip1 mRNA expression 24 and 48 hours after transfection with LNA-i-miR-221 or scrambled control in NCI-H929 cells. [score:3]
In vivo Activity of LNA-i-miR-221 Inhibitor by Systemic InjectionTo assess the translational relevance of our findings, we evaluated the anti-tumor potential of LNA-i-miR-221 in human MM xenografts in NOD. [score:3]
It had a marked anti-proliferative effect on t(4;14)-translocated MM cells but not on MM cells not carrying the translocation and not overexpressing miR-221. [score:3]
Among these miRNAs, the miR-221/222 cluster is of particular interest for translational approaches in MM. [score:3]
B) Western blot analysis of p27Kip1 protein in retrieved tumors from mice treated with LNA-i-miR-221 inhibitors or LNA-i-miR-NC. [score:3]
Antiproliferative effects induced by transient expression of LNA-i-miR-221 in MM cell lines. [score:3]
When t(4;14) MM xenografts became palpable, mice were randomized into 2 groups and treated with LNA-i-miR-221 or scrambled control by injection of naked (unformulated) inhibitors. [score:3]
As predicted, luciferase activity was reduced when miR-221/222 mimics were co -transfected with 3′UTR reporter plasmid (Fig. 1A) and increased in LNA-i-miR-221 -transfected MM cells (Fig. 1B), thereby indicating efficient and stable binding to the miRNA target. [score:3]
In vivo Activity of LNA-i-miR-221 Inhibitor by Systemic Injection. [score:3]
LNA-i-miR-221 antiproliferative activity and target silencing in retrieved MM xenografted tumors. [score:3]
Moreover, LNA-i-miR-221 significantly impaired miR-221 function as demonstrated by strong derepression of p27Kip1, which is a direct target of miR-221, by functional luciferase assays. [score:3]
To obtain an ASO with the properties and stability suitable for systemic delivery, we designed a novel novel phosphorothioate (PS) modified backbone 13-mer locked nucleic acid (LNA)-Inhibitor-miR-221 (LNA-i-miR-221). [score:3]
We previously demonstrated that silencing of miR-221/222 with an antisense oligonucleotide (ASO) inhibits proliferation of t(4;14) MM cells in vitro and significantly slows the tumor growth in xenografted non-obese diabetic/severe combined immunodeficient (NOD. [score:3]
Indeed, miR-34a [12] and miR-29b [13], [14] mimics as well as miR-221/222 [15] and miR-21 [16] inhibitors were found to be promising anti-MM therapeutic agents when delivered in vitro and in vivo. [score:3]
To this aim we used the 3′UTR reporter (luciferase renilla/firefly) construct containing the miR-221 target site. [score:3]
NCI-H929 cells were co -transfected by electroporation, as described above, with 5 µg of the firefly luciferase reporter vector, 0.5 µg of the control vector containing Renilla luciferase, pRL-TK (Promega) and 100 nM of the LNA-i-miR-221 inhibitor or LNA-i-miR-NC. [score:3]
0089659.g002 Figure 2 Effects on proliferation (A) and BrdU uptake (B) in NCI-H929 cells induced by transient LNA-miR-221 inhibitor (LNA-i-miR-221) transfection compared to scrambled control (LNA-i-miR-NC). [score:2]
To evaluate the anti-tumor potential of the novel 13-mer inhibitor, LNA-i-miR-221, we first verified that it effectively knocked down miR-221 function in MM cells cultured in vitro. [score:2]
After two weeks of exposure to LNA-i-miR-221, the tumor growth was significantly inhibited as compared to xenografted control mice. [score:2]
Statistical significance of the in vivo growth inhibition observed in LNA-i-miR-221 -treated mice compared with scrambled control group was determined using Student’s t test. [score:2]
After the intraperitoneal injection of LNA-i-miR-221 (25 mg/kg once a week for 2 weeks), tumors were significantly inhibited as compared to the control group (p<0.5) (Fig. 4A). [score:2]
Effects on proliferation (A) and BrdU uptake (B) in NCI-H929 cells induced by transient LNA-miR-221 inhibitor (LNA-i-miR-221) transfection compared to scrambled control (LNA-i-miR-NC). [score:2]
Moreover, at immunohistochemistry, p27Kip1 expression was higher in LNA-i-miR-221 -treated tumors as compared to controls (60% versus 10% of p27Kip1 -positive cells, respectively) and the Ki-67 proliferation index was greatly reduced (Fig. 5C). [score:2]
In vitro Silencing of miR-221 by LNA-i-miR-221To evaluate the anti-tumor potential of the novel 13-mer inhibitor, LNA-i-miR-221, we first verified that it effectively knocked down miR-221 function in MM cells cultured in vitro. [score:2]
These data provide the rationale for the clinical development of LNA-i-miR-221 for the treatment of MM. [score:2]
C) q-RT-PCR of miR-221 in retrieved tumors treated intravenously with LNA-i-miR-221 or LNA-i-miR-NC. [score:1]
The data are shown as relative luciferase activity of miR-221/222 -transfected cells versus the control (miR-NC) or LNA-i-miR-221 -transfected cells versus the scrambled control (LNA-i-miR-NC). [score:1]
C) Western blot analysis of p27Kip1 protein in NCI-H929 cells 24, 48 and 72 hours after transfection with LNA-i-miR-221 or control. [score:1]
0089659.g005 Figure 5 A) q-RT-PCR of p27Kip1 mRNA levels in treated tumors retrieved from mice after intravenous LNA-i-miR-221 treatment. [score:1]
When tumors became palpable (approximately 10 days after the injection of MM cells) mice were randomized into 2 groups (5 animals per group) and treated with LNA-i-miR-221 or scrambled control. [score:1]
LNA-i-miR-221 is a highly stable, effective agent against t(4;14) MM cells, and is suitable for systemic use. [score:1]
LNA-i-miR-221 specifically recognizes the miR-221 complementary sequence. [score:1]
However, we found that systemically administered LNA-i-miR-221 exerted a significant anti-MM activity in vivo. [score:1]
To investigate the molecular effects induced by LNA-i-miR-221 on tumor cells in vivo, we measured miR-221 expression levels in retrieved xenografts and in different mouse tissues after intravenous administration of the inhibitor. [score:1]
In vitro Silencing of miR-221 by LNA-i-miR-221. [score:1]
We speculate that, in vitro, this novel LNA-i-miR-221 formed strong heteroduplexes with miR-221 as suggested by reduced miR-221 levels as assessed by quantitative PCR. [score:1]
Biological Effects Induced by LNA-i-miR-221 in vivo. [score:1]
In vivo anti-tumor activity of LNA-i-miR-221 in MM-xenografted SCID/NOD mice. [score:1]
Exposure to LNA-i-miR-221 did not cause any significant behavioral changes or weight loss in animals. [score:1]
Molecular effects induced by LNA-i-miR-221 transfection in MM cells. [score:1]
Given these promising findings, the aim of the present study was to obtain miR-221 silencing in vivo by systemic delivery in order to evaluate the therapeutic potential of this approach in a translational setting. [score:1]
miR-221(A) q-RT-PCR 24, 48 and 72 hours after transfection with LNA-i-miR-221 and LNA-i-miR-NC in NCI-H929 cells. [score:1]
To assess the translational relevance of our findings, we evaluated the anti-tumor potential of LNA-i-miR-221 in human MM xenografts in NOD. [score:1]
For cell growth analysis, we used the Neon® Transfection System (Life Technologies) to transfect MM cells with LNA-i-miR-221 and LNA-i-miR-NC, or with miR-221/222 mimics (Life Technologies), as previously described [15]. [score:1]
We also evaluated the specificity of anti-miRNA activity on endogenous miRNA-221 targets in these experimental mo dels. [score:1]
The aim of the present study was to evaluate the activity of a novel 13-mer LNA-i-miR-221 inhibitor specifically designed for systemic delivery. [score:1]
SCID) mice bearing t(4;14) MM xenografts, which were intraperitoneally or intravenously treated with naked LNA-i-miR-221. [score:1]
We found that the luciferase/Renilla ratio was much higher in LNA-i-miR-221 than in the control transfected cells (Fig. 1C). [score:1]
D) q-RT-PCR of miR-221 in liver, kidney and heart tissue biopsies of mice after 2 weeks of treatment. [score:1]
miR-221 acts as an oncomiR in many human solid and hematologic neoplasms. [score:1]
MM-xenografted mice were treated with saline solution of LNA-i-miR-221 or LNA-i-miR-NC as control. [score:1]
LNA-i-miR-221 is a 13-mer DNA/LNA oligonucleotide whose sequence is CAGACAATGTAGC. [score:1]
As shown in Figure 4C, miR-221 levels were 34% lower in LNA-i-miR-221 -treated tumors than in controls. [score:1]
The data are shown as relative luciferase activity of LNA-i-miR-221 -transfected cells versus the control (NC). [score:1]
This construct was co -transfected either with miR-221/222 mimics or LNA-i-miR-221 into NCI-H929 cells. [score:1]
After transfection with LNA-i-miR-221 or scrambled control, 1×10 [4] cells were seeded in 96-well plates. [score:1]
Effects of LNA-i-miR-221 after 2 intraperitoneal injections of 25 mg/kg (A) and 4 intravenous injections of 25 mg/kg (B). [score:1]
0089659.g004 Figure 4 In vivo anti-tumor activity of LNA-i-miR-221 in MM-xenografted SCID/NOD mice. [score:1]
miR-221 was barely detectable in the liver, kidney and heart tissues of treated animals (Fig. 4D). [score:1]
We next evaluated the effect of LNA-i-miR-221 on cell proliferation and BrdU incorporation at different time points after transfection of t(4;14) MM cells overexpressing miR-221. [score:1]
A) q-RT-PCR of p27Kip1 mRNA levels in treated tumors retrieved from mice after intravenous LNA-i-miR-221 treatment. [score:1]
As shown in Figure 2A, 48 hours after transfection, cell proliferation was 25% lower in LNA-i-miR-221 -transfected NCI-H929 cells than in control cells. [score:1]
0089659.g003 Figure 3 miR-221(A) q-RT-PCR 24, 48 and 72 hours after transfection with LNA-i-miR-221 and LNA-i-miR-NC in NCI-H929 cells. [score:1]
Biological Effects Induced by LNA-i-miR-221 in vivo To investigate the molecular effects induced by LNA-i-miR-221 on tumor cells in vivo, we measured miR-221 expression levels in retrieved xenografts and in different mouse tissues after intravenous administration of the inhibitor. [score:1]
The aim of the present study was to evaluate the anti-MM activity of a novel phosphorothioate modified backbone 13-mer locked nucleic acid (LNA)-Inhibitor-miR-221 (LNA-i-miR-221) specifically designed for systemic delivery. [score:1]
[1 to 20 of 87 sentences]
9
[+] score: 183
Other miRNAs from this paper: mmu-mir-130a, mmu-mir-130b, mmu-mir-130c
Given the importance of balanced expression and function between molecules that promote and inhibit angiogenesis in development, it is not surprising that the temporal expression of miR-221 and miR-130a is finely tuned in the developing lung. [score:8]
The highly branched phenotype is similar to what was observed with miR-221 downregulation and miR-130a upregulation in the ex vivo lung cultures. [score:7]
To begin to understand the functional roles of miR-221 and miR-130a in the developing lung, E14 ex vivo lung cultures were treated with anti-miRs to downregulate or mimics to upregulate these miRNAs. [score:7]
Given that upregulating miR-221 or downregulating miR-130a (and vice versa) in ex vivo lung cultures produce a similar branching phenotype, we wanted to elucidate whether miR-221 and miR-130a had opposing effects on the underlying vascular bed in these lungs as well. [score:7]
At E16, miR-221 was intensely expressed in bronchiolar epithelium (arrowhead) and mesenchyme (arrows) whereas at E17 mesenchymal expression remained strong (arrow) and epithelial expression decreased (arrowhead). [score:7]
Furthermore, the opposite effects were observed with miR-221 upregulation or miR-130a downregulation. [score:7]
Both downregulation of miR-221 and upregulation of miR-130a resulted in increased vascular density, with a concomitant increase in distal airway branching (Table 2). [score:7]
At 24 hours of culture, lungs were randomly assigned for an additional 48 hours to the following conditions, which are summarized in Table 1: A) To inhibit specific miRNA function, antisense oligos (anti-miRs) to miR-221 or miR-130a (IDT, Coralville, IA), or anti-miR scrambled control oligo (Ambion, Grand Island, NY); B) To upregulate specific miRNA function, Pre-miR 221 (Mimic 221), Pre-miR 130a (Mimic 130a) or Pre-miR scrambled control (Ambion, Grand Island, NY) oligos. [score:6]
miR-221 and miR-130a Target Expression of Hox Proteins. [score:5]
Hoxb5 has been identified as a target of miR-221 in thyroid carcinoma, and Hoxa5 as a target of miR-130a in human umbilical vein endothelial cells (HUVEC) cells [13], [22]. [score:5]
Upregulation of miR-221 and miR-130a was confirmed by qRT-PCR (60 to 100 fold up regulation, data not shown). [score:5]
A dose response was done in MFLM-91U cells to confirm that 1 nM of Mimic upregulated miR-221 levels by 100 fold and miR-130a levels by 20 fold. [score:4]
Downregulation of miR-221 (blue bar) and miR-130a (red bar) was confirmed by qRT-PCR. [score:4]
Upregulation of miR-221 (blue bar) and miR-130a (red bar) was confirmed by qRT-PCR. [score:4]
Importantly, the opposing effects on angiogenesis of miR-221 and miR-130a and their respective targets Hoxb5 and Hoxa5, and the functions of Hoxb5 and Hoxa5 on airway morphogenesis suggests that these miRNAs and Hox proteins control both lung blood vessel and airway development. [score:4]
We were unable to identify direct targets for either miR-221 or miR-130a in the lung endothelial cells. [score:4]
These ex vivo and in vitro studies show that miR-221 and miR-130a mediate their effects on lung development partly through targeting the developing vasculature. [score:4]
These results suggest that miR-221 and miR-130a target the developing lung vasculature and are consistent with reports that miR-221 is anti-angiogenic and mir-130a is pro-angiogenic. [score:3]
Mir-221 and miR-130a are reported to target two Hox genes known to have important functions in embryonic lung branching morphogenesis and epithelial cell fate [14]– [21]. [score:3]
This concept is further supported by our previously published work on the expression and function of these Hox proteins in the developing lung and the phenotype observed when miR-221 and miR-130a are manipulated [16], [34]. [score:3]
Several studies describe promotion or suppression of angiogenesis by specific microRNAs, including miR-221 and miR-130a. [score:3]
Reported targets of miR-221 and miR-130a in other cell types mostly include downstream signaling molecules and transcription factors which were not present in this array [39], [40]. [score:3]
However, miR-221 overexpression in lymph endothelial cells did not result in the migration defects that we observed using lung microvascular endothelial cells [35]. [score:3]
Total miR-221 expression initially decreased from E15 to E16, followed by an increase as gestation progressed (Figure 1A). [score:3]
In this study we show for the first time that miR-221 and miR-130a regulate both airway branching and lung microvascular development. [score:3]
miR-221 and miR-130a alter localization of Hox protein expression. [score:3]
Several groups have shown that miR-221 and miR-130a regulate endothelial cell function, suggesting that regulation of these miRNAs in the embryonic lung vasculature may also affect airway branching morphogenesis [10]. [score:3]
MiR-221 inhibited endothelial cell tube formation and migration, whereas miR-130a enhanced tube and vascular plexus formation and cell migration. [score:3]
Hoxb5 is a target of miR-221 in human thyroid carcinoma cells. [score:3]
To address whether miR-221 and miR-130a altered neovascularization by directly targeting fetal lung endothelial cells, we utilized an in vitro angiogenesis assay. [score:3]
miR-221 and miR-130a Target Angiogenesis in vitro. [score:3]
Taken together, analysis of miR-221 and miR-130a distribution in the developing lung suggests functional roles in the progression of lung development. [score:2]
miR-221 and miR-130a Regulate Branching Morphogenesis. [score:2]
MiR-221 has anti-angiogenic properties through targeting several important proteins involved in angiogenesis. [score:2]
MiR-221 and miR-130a are present in multiple cellular compartments during lung development, as shown by the in situ hybridization results. [score:2]
miR-221 and miR-130a Regulate Neovascularization During Lung Branching Morphogenesis. [score:2]
Different from miR-221, miR-130a expression was more intense in the epithelium (arrowhead) compared to the mesenchyme at E16 (arrows). [score:2]
These studies show that miR-221 and miR-130a can alter vascularization by directly affecting endothelial cell behavior resulting in changes in tube formation and cell migration. [score:2]
A recent study also found that miR-221 promotes endothelial tip cell migration in the development of zebrafish intersegmental vessels [36]. [score:2]
These results suggest a regulatory role for miR-221 and miR-130a on Hoxb5 and Hoxa5, respectively, in developing lung. [score:2]
We propose that miR-221 and miR-130a actively participate in regulation of embryonic lung vascular and airway branching. [score:2]
In summary, we have shown that miR-221 and miR-130a coordinately regulate airway and vascular branching. [score:2]
Some of the opposing airway branching phenotypes created by perturbations of miR-221 and miR-130a could be due to regulation of an epithelial mechanism controlling the progression of branching morphogenesis. [score:2]
miR-221 and miR-130a are Temporally and Spatially Regulated Across Gestation. [score:2]
Our present study used ex vivo and in vitro mo dels to explore how miR-221 and miR-130a regulate airway and vascular branching in the lung. [score:2]
Several studies have highlighted the role of miR-221 and miR-130a in regulating endothelial cell biology for angiogenesis, showing that miR-221 has angiostatic and miR-130a has pro-angiogenic properties [10]. [score:2]
Summary and explanation of all miR-221 and miR-130a manipulations used in experiments. [score:1]
We found that increased miR-221 or decreased miR-130a levels in lung cultures produced a disorganized vascular network that was associated with reduced airway branching. [score:1]
Effect of miR-130a and miR-221 on Epithelial Cell Fate And Morphology. [score:1]
Summary of phenotypes observed when ex vivo lung cultures were treated with anti-miRs or mimics to miR-221 and miR-130a. [score:1]
miR-221 temporal, spatial and cellular localization changes with advancing gestation. [score:1]
We used ex vivo and in vitro culture mo dels to identify the phenotypic function of miR-221 and miR-130a in branching morphogenesis and neovascularization of the developing lung. [score:1]
Manipulation of miR-221 and miR-130a levels caused spatial and cellular changes in Hoxb5 and Hoxa5 localization, respectively. [score:1]
These results are consistent with the current knowledge that miR-221 is anti-angiogenic and miR-130a is pro-angiogenic. [score:1]
0055911.g001 Figure 1(A) Quantification of total miR-221 levels in mouse fetal of gestational days E15– E18 was done by qRT-PCR. [score:1]
Our findings with regards to the angiostatic properties of miR-221 and pro-angiogenic properties of miR-130a are consistent with studies of these miRNAs in human venous or lymphatic endothelial cells [11]– [13], [35]. [score:1]
0055911.g005 Figure 5 (A) Manipulation of miR-221 levels alters Hoxb5 localization. [score:1]
To investigate the temporal and spatial expression of miR-221 and miR-130a in the developing lung, qRT-PCR and in situ hybridzation were done on mouse fetal lungs. [score:1]
These observations provide insight into the mechanisms underlying similarities and differences in airway branching observed with miR-221 and miR-130a manipulation. [score:1]
Therefore, we investigated how miR-221 manipulation impacted Hoxb5 expression patterns within the developing lung [22]. [score:1]
The opposite phenotypes were observed when lungs were transfected with mimics to miR-221 and miR-130a. [score:1]
Changes in total miR-221 and miR-130a were verified by qRT-PCR to ensure transfection efficiency (Figure 3A, 3D). [score:1]
[1 to 20 of 62 sentences]
10
[+] score: 176
Other miRNAs from this paper: mmu-mir-222
These miRNAs are complementary to the ICAM-1 3′UTR region and modulate ICAM-1 expression at the post-transcriptional level by binding to the UTR 5. A previous study demonstrated that increased ICAM-1 expression in human immunodeficiency virus-1 Tat -treated ECs was concomitant with a reduction of miR-221/222 expression 8. Interferon-γ suppressed miR-221, resulting in increased ICAM-1 expression in cholangiocytes 33. [score:11]
Furthermore, miR-221/222 expression was markedly downregulated in TNF-α -treated HUVECs, whereas resveratrol upregulated the expression of miR-221/-222. [score:11]
Recent studies have suggested that ICAM-1 is a target of miR-221/-222, both of which regulate ICAM-1 expression in response to inflammatory stimuli 8. To examine whether post-transcriptional regulation by miR-221/222 is critical for the TNF-α -induced expression of ICAM-1, HUVECs were treated with TNF-α and assessed for miR-221/-222 expression using RT-PCR. [score:11]
To manipulate the cellular functions of miR-221/222 in HUVECs, we transfected cells with miR-221/222 precursors to increase miR-221/222 expression levels or with miR-221/222 inhibitors to decrease miR-221/222 expression levels. [score:7]
These findings strongly suggested that TNF-α -induced ICAM-1 expression was mediated, at least in part, by miR-221/222 directly targeting 3′UTR of ICAM-1 in HUVECs. [score:6]
Resveratrol -mediated reduction in ICAM-1 expression in TNF-α -treated HUVECs involves miR-221/222 upregulation. [score:6]
Resveratrol -mediated reduction in ICAM-1 expression in TNF-α -treated HUVECs involves miR-221/-222 upregulation. [score:6]
HUVECs were transfected with miR-221/222 inhibitors for 48 h and then treated with 50 μM resveratrol for 24 h and 3 ng/mL TNF-α for 4 h in the continued presence of miR-221/-222 inhibitors and resveratrol. [score:5]
In summary, this study provides the first evidence that the anti-inflammatory effects of resveratrol are mediated through increased miR-221/222 expression and blockade NF-κB and p38 phosphorylation, resulting in decreased ICAM-1 expression and monocyte adhesion to ECs under inflammatory conditions. [score:5]
To test whether miR-221 and miR-222 target the ICAM-1 3′UTR, we used TargetScan. [score:5]
The immunohistochemical staining of mouse aorta samples revealed a notable increase in ICAM-1 expression specific to the aortic endothelial layer of the TNF-α -treated-miR-221/222 KO mice, whereas resveratrol treatment had no effect on TNF-α -induced ICAM-1 expression in these mice. [score:5]
These data further corroborate the hypothesis that the TNF-α -mediated suppression of miR-221/222 is involved in the expression of ICAM-1 in HUVECs and influences monocyte adhesion. [score:5]
Briefly, HUVECs were grown to 70% confluence and transfected with the miR-221/222 mimic or miR-221/222 inhibitor (Dharmacon, CO, USA) at a concentration of 100 nM/well using Lipofectamine 3000 (Invitrogen, CA, USA), followed by an analysis of ICAM-1 expression and cell adhesion. [score:5]
There was a significant decrease in the expression levels of both miR-221/-222 in HUVECs following TNF-α stimulation for 4 h, whereas resveratrol pretreatment increased miR-221/222 expression as assessed by real-time PCR (Fig. 5A). [score:5]
To confirm that miR-221/222 regulate the expression of ICAM-1, we constructed a firefly luciferase reporter plasmid containing the ICAM-1 3′UTR with miR-221/222 binding site. [score:4]
ICAM-1 expression was strongly expressed in the TNF-α -treated miR-221/222 KO mice compared with the TNF-α -treated WT animals. [score:4]
The reporter assay showed that miR-221 and miR-222 could significantly inhibit the expression of the luciferase. [score:4]
To determine the effect of resveratrol on ICAM-1 expression in vivo, WT mice and miR-221/222 KO mice were injected with resveratrol for 3 days before being injected with TNF-α for 3 days. [score:3]
However, the transfection of cells with a precursor control sequence did not inhibit the TNF-α -mediated induction of ICAM-1. A significant increase in the phosphorylation of p38 and p65 was detected in TNF-α -treated HUVECs, which was significantly attenuated in cells transfected with the miR-221/-222 precursors (Fig. 5D). [score:3]
Recent reports indicate that ICAM-1 expression is controlled by many miRNA species, such as miR-221 and miR-222 33 34. [score:3]
As shown in Fig. 5D, the precursors of both miR-221/222 significantly attenuated TNF-α -induced ICAM-1 protein expression in HUVECs. [score:3]
Furthermore, we also demonstrated that miR-221/222 overexpression involves the inactivation of p38 and NF-kB-p65 in TNF-α -treated ECs. [score:3]
HUVECs were also treated with sequence-specific inhibitors for miR-221/-222. [score:3]
Importantly, we demonstrated that resveratrol treatment increased miR-221/222 expression. [score:3]
HUVECs were transfected with miR-221 or miR-222 precursors for 48 h and then exposed to TNF-α for 4 h, followed by Western blot analysis for ICAM-1, p-p38, and p-p65 expression. [score:3]
Additional results confirmed that the transfection of miR-221/222 precursors significantly decreased TNF-α -induced ICAM-1 expression and monocyte adhesion. [score:3]
Next, to test the role of miR-221/222 in the TNF-α -mediated induction of ICAM-1, HUVECs were transfected with miR-221/222 precursors for 48 h and then exposed to TNF-α for 4 h; subsequently, ICAM-1 protein expression was assessed by Western blot. [score:3]
To analyze miR-221/222 expression, comparative real-time PCR was performed by using the TaqMan microRNA Reverse Transcription kits. [score:3]
Resveratrol reduces ICAM-1 expression in the ECs of thoracic aortas in TNF-α -treated WT mice but not miR-221/222 KO mice. [score:3]
The protection of ECs by resveratrol against inflammation is due to the inhibition of p38/NF-κB and ICAM-1 by miR-221/222. [score:3]
To determine the functional relevance of the miR-221/222-regulated expression of ICAM-1 in HUVECs, monocyte adhesion assays were performed using HUVECs transfected with miR-221/222 precursors. [score:3]
Moreover, resveratrol did not decrease ICAM-1 expression in the miR-221/-222 KO mice. [score:3]
TNF-α induced higher ICAM-1 expression in TNF-α -treated miR-221/-222 KO mice than in TNF-α -treated WT mice. [score:3]
Altogether, these findings demonstrate the important role of miR-221/222 in the resveratrol -mediated reduction in ICAM-1 expression and monocyte adhesion in TNF-α -treated ECs. [score:3]
Moreover, resveratrol reduced ICAM-1 expression in the thoracic aorta ECs of TNF-α -treated WT mice but not in those of miR-221/222 KO mice. [score:3]
How to cite this article: Liu, C. -W. et al. Resveratrol attenuates ICAM-1 expression and monocyte adhesiveness to TNF-α -treated endothelial cells: evidence for an anti-inflammatory cascade mediated by miR-221/222/AMPK/p38/NF-κB pathway. [score:3]
Resveratrol reduces ICAM-1 expression in the thoracic aorta ECs of TNF-α -treated WT mice but not miR-221/-222 KO mice. [score:3]
In the present study, for the first time, we report the role of TNF-α in modulating the regulation of ICAM-1 via miR-221/222 in HUVECs. [score:2]
These findings indicate that the beneficial effects of resveratrol were lost in miR-221/222 KO mice. [score:1]
C57BL/6 WT mice and miR-221/-222 KO mice (weight: 25–30 gm; age: 9–12 weeks) were used in this study. [score:1]
Further validation of these in vitro findings was carried out in vivo using a well-established miR-221/-222 KO mouse mo del. [score:1]
The amounts of miR-221/222 were obtained by normalizing them to that of RNU6B and the control. [score:1]
In addition, HUVECs were co -transfected with this plasmid and either miR-221 or miR-222. [score:1]
miR-221 and miR-222 are tandemly encoded on the X chromosome, are highly conserved and share significant homology. [score:1]
We found that miR-221 and miR-222 are complementary to a region in the ICAM-1 3′UTR that is located between positions 413 and 419 (Fig. 5B). [score:1]
We generated miR-221/-222 KO mice by deleting the X-linked miR-221/222 genes and breeding the mice for 10 generations on a C57BL/6 background (unpublished result). [score:1]
Transfection of miR-221/222. [score:1]
[1 to 20 of 47 sentences]
11
[+] score: 155
Other miRNAs from this paper: mmu-mir-211
By examining the functional, pathological, and molecular changes at this early stage (less than 3 months after the onset of diabetes) in the spontaneous T1D OVE26 mouse mo del [19], the present study reveals three novel findings, as illustrated in Figure 5D: (1) Treatment with acute and subpressor Ang II exacerbates diabetes -induced cardiac hypertrophy and autophagy inhibition; (2) Ang II and diabetes additively activates JNK/c-Jun -mediated up-regulation miR-221 expression; and (3) Direct down-regulation of p27 by miR-221 leads to mTOR activation and autophagy inhibition in the hearts of diabetic OVE26 and/or Ang II -treated mice, resulting in cardiac hypertrophy. [score:14]
The present study, therefore, was designed to test our hypothesis: (a) Ang II treatment exacerbates diabetes -induced cardiac hypertrophy and remolding due to autophagy inhibition, independent of increased BP; (b) inhibited cardiac autophagy in diabetes and/or Ang II exposure may be mediated by increased miR-221 expression that further inhibits autophagy negative regulator p27 function; and (c) increased level of miR-221 in diabetes and/or Ang II condition may be mediated by diabetes- and/or Ang II-increased JNK/c-Jun -mediated transcription. [score:10]
Overexpression of miR-221 has been shown to cause cardiac dysfunction and heart failure accompanied with impaired autophagy through the targeted repression of p27, a cyclin -dependent kinase inhibitor, and subsequent mammalian target of rapamycin (mTOR) activation [8]. [score:9]
Ang II further increases cardiac miR-221 expression through activating JNK/c-Jun and enhancing c-Jun binding to miR-221 gene promoter, which directly inhibits p27 and then activates mTOR, leading to the inhibition of autophagy and final cardiac hypertrophy, remo deling and DCM. [score:8]
The cardiac-specific overexpression of miR-221 in mice produces cardiac enlargement and dysfunction through impairing autophagy [8] and miR-221 is up-regulated in diabetic hearts and Ang II -treated aortas [7, 10]. [score:6]
Moreover, we found that p27, the direct target of miR-221, was further inhibited and that mTOR was further activated in Ang II -treated diabetic OVE26 mice. [score:6]
After 14 d of Ang II treatment, miR-221 expression (A) was detected by quantitative PCR, p27 (B, C), the direct target of miR-221, and p-mTOR (B, D) were analyzed by Western blot in the mouse heart. [score:6]
Figure 3After 14 d of Ang II treatment, miR-221 expression (A) was detected by quantitative PCR, p27 (B, C), the direct target of miR-221, and p-mTOR (B, D) were analyzed by Western blot in the mouse heart. [score:6]
Cardiac miR-221 is up-regulated in both transverse aortic constricted mice and patients with hypertrophic cardiomyopathy, resulting in increased myocyte cell size and the re -expression of fetal genes [28]. [score:6]
As shown in Figure 3B and 3C, the expression of p27, a direct target of miR-221, was significantly repressed in the diabetic OVE26 and Ang II -treated nondiabetic mouse heart (P < 0.05 vs. [score:6]
Taken together, these findings indicate that the hypertrophic effect of Ang II in diabetic hearts might be mediated, in part, by miR-221 -inhibited autophagy by suppressing p27 and thereby activating mTOR [8]. [score:5]
Our study provides insights into the development of DCM via Ang II-regulated microRNAs and implicates miR-221 as a potential therapeutic target for DCM. [score:5]
We hypothesized that Ang II induces alone, and synergizes with diabetes, the up-regulation of myocardial miR-221, accelerating the development of DCM. [score:5]
The pivotal role of miR-221 in the development of DCM would also be strengthened through the use of specific inhibitors of miR-221 [8, 28]. [score:4]
However, whether diabetes can up-regulate miR-221 and subsequent hypertrophy via activating JNK/c-Jun signaling pathway and whether Ang II involves in this pathological process remain to be elucidated. [score:4]
C-Jun is usually phosphorylated by JNK and then translocates into nucleus, resulting in the transcriptional up-regulation of miR-221 in multiple cell lines [11– 13]. [score:4]
In addition, miR-221 is up-regulated by Ang II in rat primary aortic vascular smooth muscle cells in vitro and aortas ex vivo, which stimulates cell proliferation [10]. [score:4]
Our present data suggest that Ang II might mediate the development of DCM through the inhibition of autophagy by miR-221. [score:4]
After 14 d of Ang II treatment, the expressions of p-JNK (A) and p-c-Jun (B) were detected by Western blot, and c-Jun binding to miR-221 (C) was analyzed by ChIP in the mouse heart. [score:3]
Therefore, it is believed that miR-221 may stimulate myocyte hypertrophy and block autophagy by targeting p27/mTOR signaling in the diabetic myocardium. [score:3]
The effect of Ang II on cardiac expression of miR-221 in vivo has not been defined. [score:3]
In the current study we demonstrated that subpressor Ang II and diabetes additively elicited cardiac hypertrophy along with increased cardiac miR-221 and inhibition of autophagosome-lysosome pathway, as evidenced by the decrease of LC3-II level and the increase of p62 level. [score:3]
In summary, we found that subpressor Ang II treatment exacerbated early diabetes -induced cardiac hypertrophy in OVE26 mice, which was associated with activation of JNK/c-Jun and subsequent miR-221 -mediated autophagy inhibition. [score:3]
A significant increase in miR-221 expression was found in both the diabetic OVE26 and Ang II -treated nondiabetic mouse hearts (P < 0.05 vs. [score:3]
Ang II enhances diabetes -mediated inhibitory effect on cardiac autophagy via modulating miR-221/p27/mTOR axis. [score:3]
Figure 5After 14 d of Ang II treatment, the expressions of p-JNK (A) and p-c-Jun (B) were detected by Western blot, and c-Jun binding to miR-221 (C) was analyzed by ChIP in the mouse heart. [score:3]
A recent report demonstrated that cardiac miR-221 is massively overexpressed in streptozotocin (STZ) -induced diabetic mice and glycemic control fails to normalize miR-221 levels [7]. [score:3]
MiR-221 has been identified in the heart and protects cardiomyocytes against hypoxia/reoxygenation injury via theinhibition of autophagy [26]. [score:2]
Since STZ -induced type 1 diabetes (T1D) mo del may involve a direct STZ effect on the JNK/c-Jun/miR-221 axis, we used OVE26 mice [19], a commonly-used spontaneous T1D mouse mo del, in the present study. [score:2]
Schematic illustration of the working hypothesis for the regulation of miR-221 and diabetes -induced cardiac injury by Ang II (D). [score:2]
Activation of c-Jun NH [2]-terminal kinase (JNK) leads to enhanced c-Jun phosphorylation (which stabilizes c-Jun) and nuclear localization, which is essential in transcriptionally up -regulating miR-221 in cancer cell lines [11– 13]. [score:2]
Ang II and diabetes additively activate cardiac JNK/c-Jun and c-Jun binding to miR-221. [score:1]
Moreover, confirmed that c-Jun binding to the upstream of miR-221 gene promoter increased in the Ang II -treated diabetic mouse heart. [score:1]
In addition, miR-221 orchestrates the antiviral and inflammatory immune responses to viral infection of the heart [27]. [score:1]
Previous study has shown that miR-221 is involved in vascular smooth muscle cells proliferation [9]. [score:1]
These data suggest that Ang II and diabetes additively impair autophagy, which is associated with miR-221/p27/mTOR axis. [score:1]
Abundant studies demonstrated that transcription of miR-221 is under the positive control of promoter -binding transcription factor, c-Jun [11– 13]. [score:1]
These data suggest that the Ang II -induced miR-221 may be due to increasing transcriptional activity of JNK/c-Jun, and is also central for causing cardiac hypertrophy and ultimately results in DCM, as shown in Figure 5D. [score:1]
Effect of acute Ang II on the miR-221/p27/mTOR axis in diabetic OVE26 mice hearts. [score:1]
[1 to 20 of 39 sentences]
12
[+] score: 92
These analyses identified four miRNAs, miR-146a (upregulated twofold), miR-221, miR-654-5p, and miR-656 (all three down-regulated ~1.3-fold), significantly deregulated in the patients (P < 0.05) (see Fig.   1a). [score:8]
Putative target genes of the differentially expressed miRNAs were enriched for pathways previously associated to ASD, and altered levels of neuronal transcripts targeted by miR-146a, miR-221, and miR-656 were observed in patients’ cells. [score:7]
miR-146a and miR-221 displays strong expression in regions important for high cognitive functionsIn the mouse brain, the expression pattern of miR-146a and miR-221 strongly correlates with that in the human brain (Allen Brain Atlas, Brain Span); they are expressed throughout the cortex, hippocampus, and amygdala as evidenced by in situ hybridization (see Fig.   3a). [score:7]
We also demonstrated that miRNA expression deregulation correlates with a reduced level of KCNK2 protein in patients’ OMSCs and that both miR-146a and miR-221 directly target KCNK2 3′UTR. [score:7]
miR-654-5p and miR-656 are conserved only in the primate chain and are expressed at low level in the human brain; by contrast, miR-146a and miR-221 sequences are 100 % conserved in the mouse and are highly expressed in different human brain regions throughout development including the cortex, hippocampus, and cerebellum (Allen Brain Atlas, Brain Span) [23], supporting a role in development. [score:7]
In the mouse brain, the expression pattern of miR-146a and miR-221 strongly correlates with that in the human brain (Allen Brain Atlas, Brain Span); they are expressed throughout the cortex, hippocampus, and amygdala as evidenced by in situ hybridization (see Fig.   3a). [score:5]
In the mouse brain, miR-146a, and miR-221 display strong neuronal expression in regions important for high cognitive functions, and we demonstrated that reproducing abnormal miR-146a expression in mouse primary cell cultures leads to impaired neuronal dendritic arborization and increased astrocyte glutamate uptake capacities. [score:5]
Overexpressing either miR-146a, miR-221, or miR-656 significantly reduced the luciferase activity of reporter constructs carrying the 3′-untranslated region (3′-UTR) of GRIA3, KCNK2. [score:5]
miR-146a and miR-221 displays strong expression in regions important for high cognitive functions. [score:3]
Fig. 3Expression of miR-146a and miR-221 in the brain. [score:3]
a Significantly deregulated miRNAs after validation in ASD OMSC after the validation round, representing the miRNA deregulation signature of ASD: miR-146a, miR-221, miR-654-5p, and miR-656 (±SD, controls— dark gray bar, patients— light gray bar). [score:3]
In situ hybridization associated with the immune-detection of cell-specific markers showed that in the adult mouse brain, miR-146a and miR-221 are essentially expressed in neurons (see Fig.   3c), whereas very few signal was detected in the glial lineage (see Fig.   3c). [score:3]
Zongaro S, Hukema R, D'Antoni S, Davidovic L, Barbry P, Catania MV, et al. The 3′ UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse. [score:3]
Long term potentiation pathway is predicted to be specifically targeted by miR-146a and miR-221. [score:3]
Selected enriched pathways predicted to be targeted by miR-146a and miR-221. [score:3]
Expression (±SD) of miR-146a, miR-221, miR-654-5p, and miR-656 were assessed in primary skin fibroblasts of ASD patients (n = 5, light gray bar), ID patients (n = 12, white bar), and controls (n = 4, dark gray bar). [score:3]
The 3′UTRs of GRIA3, KCNK2, and MAP2 were subcloned into the 3′UTR of Renilla luciferase in the psiCheck2 plasmid and co -transfected into HEK293T with either plasmid overexpressing miR-146a, miR-221, and miR-656 or empty plasmid. [score:3]
We showed that GRIA3 is a target transcript for both miR-146a and miR-221. [score:3]
Expression profiles of miR-146a, miR-221, miR-654-5p, and miR-656 were assessed using Taqman assays on Fluidigm 48.48 array in technical triplicates; for fibroblast samples, two different miRNA extractions from consecutive passages were analyzed and six miRNAs were used as reference miRNAs (see Additional file 1: Figure S2 and Additional file 2 for raw data); for peripheral blood mononuclear cells (PBMC), only one extraction was analyzed and seven miRNAs were used as reference miRNAs (see Additional file 1: Figure S3 and Additional file 2 for raw data). [score:2]
We identified a signature of four miRNAs (miR-146a, miR-221, miR-654-5p, and miR-656) commonly deregulated in ASD. [score:2]
We identified a signature of four miRNAs (miR-146a, miR-221, miR-654-5p, and miR- 656) commonly deregulated in ASD. [score:2]
b Hybridization of scramble or miR-146a and miR-221 was performed onto mice at different developmental from embryonic (E11 and E16) and postnatal (P5 and P30) stages. [score:2]
a ISH of miR-146a and miR-221 in the adult mouse brain. [score:1]
Moreover, the level of miR-221, miR-656, and miR- 654-5p transcripts observed in the ID group suggests that these miRNAs could be used to develop a diagnostic panel allowing the distinction between the ASD, ID, and the control groups. [score:1]
This analysis showed a significant deregulation of miR-146a, miR-221, and miR-654-5p in the ASD group compared to controls in the same trend as in OMSC (see Fig.   1b). [score:1]
[1 to 20 of 25 sentences]
13
[+] score: 77
miR-221 was also predicted to regulate murine ATF6, and its expression was significantly increased in native airway tissues of 6-week-old βENaC -overexpressing transgenic mice with CF-like lung disease versus wild-type littermates. [score:8]
For example, although inhibition of luciferase activity in a vector containing the full-length human ATF6 3′UTR indicated that each of the three miRNAs were capable of decreasing luciferase expression, in order to demonstrate that miR-145, miR-221 and miR-494 directly target the human ATF6 3′UTR, additional experiments using reporter constructs in which the predicted MREs for the individual miRNAs are deleted or mutated would be required. [score:8]
Here, we report decreased expression of ATF6 mRNA in F508 del CF bronchial epithelium both in vitro and in vivo and correlate this observation with increased expression of miR-145, miR-221 and miR-494, three miRNAs predicted to target the ATF6 3′UTR. [score:7]
ATF6, a protein of interest to us, was predicted to be regulated by three of the upregulated miRNAs - miR-145, miR-221 and miR-494 (Figure  1). [score:5]
Three of these miRNAs, miR-145, miR-221 and miR-494, were upregulated in F508 del-CFTR homozygous CFBE41o- versus non-CF 16HBE14o- bronchial epithelial cells and also in F508 del-CFTR homozygous or heterozygous CF (n = 8) versus non-CF (n = 9) bronchial brushings. [score:4]
Figure 3 miR-221 is increased in trachea and bronchi and is predicted to target murine ATF6 3’UTR. [score:3]
ATF6 Cystic fibrosis miRNA-221 Cystic fibrosis (CF) is a common autosomal recessive inherited disease. [score:3]
miR-145, miR-221 and miR-494 target human ATF6 via repression of an ATF6 3′UTR luciferase reporter. [score:3]
Figure  1A depicts the full-length human ATF6 3′UTR with predicted binding locations for miR-145, miR-221 and miR-494, and Figure  1B shows the locations and base pair matches of their proposed binding sites, adapted from TargetScan 6.2. [score:3]
Together, the data implicate altered miRNA expression, in particular miR-221, in controlling ATF6 levels in CF bronchial epithelium. [score:3]
Thus, βENaC-Tg mice may represent a useful mo del for further studies into the biology and function of miR-221 in CF lung disease. [score:3]
In the future, manipulation of miR-221 levels in vivo using miRNA overexpression strategies could be used to decrease levels of ATF6 in CF, thereby limiting ER stress -mediated inflammation. [score:3]
Expression of miR-145, miR-221 and miR-494 is increased in airway tissues from βENaC-transgenic versus wild-type mice. [score:3]
Of these three miRNAs, only miR-221 is predicted to regulate murine ATF6 mRNA, and in βENaC-Tg mice, expression of miR-221 is increased in native airway tissues (tracheal and bronchial tissues) compared to wild-type mice. [score:3]
Taken together, the data here demonstrate a role for miR-145, miR-221 and miR-494 in regulating ATF6. [score:2]
In order to determine whether human ATF6 is regulated by miR-145, miR-221 and miR-494, HEK293 cells were transiently transfected with a luciferase reporter vector containing the full-length wild-type 408 bp human ATF6 3′UTR and a reference Renilla luciferase reporter plasmid pRLSV40. [score:2]
Here, we extend our understanding of miR-145 and miR-494 in the context of CF bronchial epithelial cells by demonstrating their reciprocal relationship with ATF6 mRNA levels and provide evidence that miR-221 also contributes to the post-transcriptional regulation of ATF6. [score:2]
Interestingly, bioinformatic analysis of the murine ATF6 3′UTR revealed two predicted miRNA recognition elements for miR-221, whereas miR-145 and miR-494 were not identified as potential regulators. [score:2]
These results implicate miR-145, miR-221 and miR-494 in the regulation of ATF6 in CF bronchial epithelium, with miR-221 demonstrating structural and functional conservation between humans and mice. [score:2]
In contrast to human bronchial brushings, only miR-221 was significantly increased in the airway tissues of the βENaC-Tg mice. [score:1]
It contains two predicted binding locations for miR-221, but none for miR-145 or miR-494. [score:1]
miR-221 is increased in CF versus non-CF cell lines and bronchial brushings. [score:1]
Figure  2A shows that miR-221, which was significantly elevated with a median fold change of 1.92 in CF versus non-CF bronchial brushings as shown by miRNA profiling [10], is similarly increased in CF versus non-CF cell lines (p < 0.05) and also in CF versus non-CF bronchial brushings (p < 0.01). [score:1]
miR-145, miR-221 and miR-494 are conserved in mammals. [score:1]
The observation that miR-221 is increased in CF versus non-CF bronchial brushings and also in native airway tissues of βENaC-Tg versus wild-type mice indicates that this miRNA is both structurally and functionally conserved between humans and mice. [score:1]
In this study, we observed that levels of miR-145, miR-221 and miR-494 are increased in CF bronchial epithelial cells in vitro and in vivo. [score:1]
HEK293 cells (1 × 10 [5] in triplicate) were transiently co -transfected for 24 h with a WT-ATF6 3′UTR (OriGene, Rockville, MD, USA) firefly luciferase reporter vector containing the full-length 3′UTR (250 ng), a constitutive Renilla luciferase vector (100 ng) and 30 nM synthetic premiR mimics (PM) for miR-145, miR-221 and miR-494 (Applied Biosystems, Foster City, CA, USA) as indicated or with a scrambled control. [score:1]
[1 to 20 of 27 sentences]
14
[+] score: 70
Previously, we reported that in t(8;21) and inv(16) CBF-AML samples there is upregulation of KIT (CD117 antigen) concomitant with downregulation of miR-221, a RUNX1-regulated miRNA that targets KIT-3'UTR [17]. [score:10]
Consistently, in mouse myeloid 32D cells, stable expression of RUNX1-MTG8 also leads to downregulation of miR-221 and miR-223 (Figure  5A). [score:6]
Based on these preliminary observations, we set out to assess the effects of stable ectopic miR-17 expression in U937 cells on both miR-221 and KIT expression. [score:5]
Altogether, these findings show that ectopic miR-17 expression deregulates the same RUNX1-miR-221-KIT axis, which is also deregulated by CBF-AML fusion proteins (Figure  2G). [score:5]
Stable expression of miR-17 deregulates the same core RUNX1-miR-221-KIT axis affected by CBF-AML fusion proteins. [score:4]
The integrated information gathered from the two myeloid cell mo dels shows that RUNX1 regulates myeloid differentiation not only by direct transcriptional regulation of coding and non-coding myeloid differentiation functions (e. g. miR-223), but also by modulating KIT -induced proliferation via non-coding miRNAs (e. g. miR-221). [score:4]
Thus, the two CBF-AML fusion proteins, by interfering with wild type RUNX1 transcriptional function, induce miR-221 downregulation concomitant with KIT -induced proliferation. [score:4]
Consistently, both CBF-AML and non-CBF-AML display miR-221 downregulation (right). [score:4]
This finding is in agreement with miR-221 downregulation not only in CBF-AML, but also in 50-60% of non-CBF-AML (Figure  2D, right, based on our previous report [17]). [score:4]
Figure 2 Stable expression of miR-17 deregulates the same core RUNX1-miR221-KIT axis affected by CBF-AML fusion proteins. [score:4]
We also reported that both t(8;21) and inv(16) CBF-AML display lower levels of miR-221 and miR-222 relative to non-CBF-AML, in association with increased expression of the KIT receptor (CD117 antigen) [17]. [score:3]
We found that the effects of ectopic miR-17 expression mimic the biological effects induced by the RUNX1-MTG8 and CBFB-MYH11 fusion proteins by affecting the same core mechanism: the RUNX1-miR-221-KIT axis and miR-223. [score:3]
The expression of miR-221 in (12 non-CBF-AML and 27 CBF-AML) was evaluated from our previous miRNA expression data [17]. [score:3]
Transient transfection of wild type U937 with a synthetic anti-miR-221 targeting endogenous miR-221 induced a significant increase of KIT -positive cells (Figure  2E, left) as well as increased EdU-proliferation (Figure  2E, right). [score:3]
Apparently, in the U937 cell context miR-17 ectopic expression significantly reduced miR-221 level, thus recapitulating the effect of RUNX1-MTG8 and CBFB-MYH11 (Figure  2D, left). [score:3]
Intrigued by this observation, we tested whether other factors, capable of interfering with RUNX1-CBFB regulatory function, can also negatively affect the RUNX1-miR-221-KIT axis and miR-223 transcription. [score:2]
Transient transfection of human U937 myeloid cells with a luciferase reporter driven by the miR-221 promoter shows that RUNX1, alone or in combination with CBFB, induces miR-221 transcription, while both RUNX1-MTG8 and CBFB-MYH11 repress miR-221 promoter (Figure  1B). [score:1]
Previously we reported that the RUNX1 consensus sequences of the miR-221 and miR-223 promoters, as well as the miR-221 and miR-223 seed sequences, are conserved between human and mouse [17]. [score:1]
Thus, both CBF-AML fusion proteins negatively affect both the RUNX1-miR-221-KIT axis and RUNX1-miR-223 transcription, leading to increased KIT -induced proliferation of undifferentiated myeloid cells. [score:1]
[1 to 20 of 19 sentences]
15
[+] score: 68
In Dicer siRNA -transfected cells, mir-221 expression has also been shown to indirectly downregulate expression of endothelial nitric oxide synthase (eNOS) [78]. [score:9]
This anti-angiogenic effect correlated with downregulated expression of the mir-221 target protein c-kit [66]. [score:8]
Since mir-221/222 exhibit tumor suppressor activity in endothelial and other cancer mo dels [55], [56], [65], [66], this suggests that the down-regulation of the mir-221 biomarker is of biological significance. [score:6]
Additional targets for mir-221 include CDKN1B/p27 and CDKN1C/p57, which are cell cycle regulators [56], [59], [65], [82]. [score:4]
In summary, mir-221 seems to possess endothelial cell lineage-specific differentiation functions as well as general tumor/proliferation suppressor functions. [score:3]
C-kit expression was also reduced by mir-221 in hematopoietic progenitor cells. [score:3]
There was one significant difference between mir-15 and mir-221 expression: the KSHV -negative SLK cells transcribed significantly lower levels of mir-15. [score:3]
High levels of mir-221 exert anti-angiogenic effects in HUVEC cells, resulting in inhibited tube formation, migration and wound healing [66]. [score:3]
The picture is more complicated, though, since depletion of mir-221 in HUVEC cells causes secondary changes in other miRNAs [66], [80]; these included many that are predicted to also target c-kit. [score:3]
In the present case mature mir-221 levels were also downregulated in KS and PEL compared to non-tumorigenic controls, but for the two others (mir-140, mir-24-2) we could not establish a statistically significant pattern based on mature miRNA levels (O'Hara et al., in press). [score:3]
Loss of mir-221 precursor miRNA and gain of mir-15 precursor miRNA expression demarked the transition from merely immortal to fully tumorigenic cells. [score:3]
In this system, mir-221 also inhibited proliferation [81]. [score:3]
Mir-222 was co-regulated with mir-221, but did not change as dramatically (data not shown). [score:2]
Disregulation of mir-221 has been found in melanomas due to silencing of the promyelocytic leukemia zinc finger (PLZF) transcription factor [83]. [score:2]
Mir-221 is a tumor suppressor for endothelial cell lineage cancers independent of KSHV infection. [score:2]
The pattern of mir-222 parallels that of mir-221, which is expected because of their known co-regulation [55], [56]. [score:2]
We found the highest levels of pre-mir-221 in uninfected and KSHV latently infected tert-HUVEC and tert-HMVEC cell lines. [score:1]
These are mir-26b, mir-29a, mir-34b, mir-92-1, mir-93, mir-133a-1, mir-133a-2, mir-193, mir-221, mir-223, mir-301, mir-323 and mir-346. [score:1]
Pre-mir-221 and pre-mir-24-2 showed steep cdfs, which allowed for binary classification into positive and negative classes. [score:1]
This corroborates prior reports of high mir-221 levels in endothelial cell lines [66], [78], [79]. [score:1]
The mir-221 pre-miRNA emerged as a biomarker for the transition from immortalized to tumorigenic endothelial cells independent of KSHV infection status (Figure 4A). [score:1]
However, the range of change was much larger for mir-221 as seen in group IV. [score:1]
We also identified specific KSHV and KS -associated pre-miRNAs, foremost among them mir-221, mir-140, mir-15a and mir-24. [score:1]
The mir-15 pre-miRNA is an example for miRNAs that exhibit the opposite pattern of transcription as mir-221. [score:1]
Dots indicate individual data points (>2 for each sample) for mir-221, mir-140, mir-24-2. (D) Decision tree of clustering based on just these 3 biomarkers. [score:1]
[1 to 20 of 25 sentences]
16
[+] score: 63
Mir-221 expression was upregulated in both MFP and SC tumour tissue compared to controls (p<0.01), however returned to basal levels in lymph nodes (p<0.001, figure 2B), with no significant difference in expression between healthy tissue and diseased lymph nodes. [score:8]
Plots of the change in mean log expression for each response variable across time and between groups are given in Figure 4. In the case of miR-221, following an initial decrease between week 1 and 3, there was a trend towards increased levels by week 6 in animals bearing MFP tumours, although overall expression was not significantly altered from tumour induction to termination time at week 6 (Figure 4A). [score:5]
Relatively robust expression of miR-195 and miR-221 was detected in the cultured cells, while miR-497 expression was significantly lower. [score:5]
In contrast to miR-10b however, miR-221 was not seen to be over-expressed in diseased lymph nodes compared to controls. [score:4]
MiR-221, miR-195, and miR-497 were detected in all samples and expression was found to remain unchanged in healthy controls throughout the 6 week duration of the study. [score:3]
Summary statistics and graphical techniques were used to summarise and compare the change in mean log expression level for each response variable (i. e. miR-497, miR-195 and miR-221) between the groups (i. e. Control, MFP and SC) and across time (i. e. Weeks 1, 3 and 6). [score:3]
RNA was extracted from cultured MDA-MB-231 cells, reverse transcribed and RQ-PCR carried out targeting miR-195, miR-497, miR-221, and miR-10b. [score:3]
Unlike miR-10b, miR-221 was readily detectable in the circulation of both diseased and healthy animals. [score:3]
Previously studied and shown to be aberrantly expressed in sporadic ovarian carcinoma, prostate and thyroid carcinoma, increased miR-221 has also been attributed to tamoxifen resistance in breast cancer [48], [49], [50], [51]. [score:3]
Furthermore there was no significant relationship between the expression of circulating miR-221, miR-195 and miR-497 at week 6 and final tumour volume detected. [score:3]
The expression of a panel of breast cancer associated miRNAs (miR-10b, miR-221, miR-195 and miR-497) was examined on the basis of their reported relevance [29], [30]. [score:3]
In this study miR-221 was upregulated in tumour tissue of both MFP and SC tumours compared to healthy tissue. [score:3]
At 6 weeks following tumour induction there was no significant difference in miR-221 (Figure 3A), miR-195 (Figure 3B), or miR-497 (Figure 3C) expression at a circulating level in tumour bearing animals (n = 15) compared to healthy controls (n = 5). [score:2]
MiR-221 over -expression in tissue has been implicated in liver tumourigenesis and as a key modulator of aggressive prostate cancer [20], [21]. [score:2]
Relative levels of circulating miRNAs were quantified 1, 3, and 6 weeks following tumour induction to investigate the relationship with disease progression (n = 20 at each time point, total n = 60) Circulating miR-221 was no significantly altered during the 6 week study (A). [score:1]
Prior to in vivo inoculation, expression of miR-10, miR-221, miR-195 and miR-497 was investigated in the cultured MDA-MB-231 cell line. [score:1]
Furthermore circulating miR-221 was not reflective of tumour burden. [score:1]
Further significant correlations were detected between miR-221 and miR-497 (r = 0.4, p<0.001, Figure 5) and miR-221 and miR-195 in the circulation (r = 0.4, p<0.05, Figure 5). [score:1]
There was no significant difference between circulating miR-221 in tumour bearing animals and healthy controls at termination of the study. [score:1]
miR-221 has also been studied in the circulation of patients with breast cancer with elevated levels in plasma reported to be predictive of resistance to neoadjuvant chemotherapy. [score:1]
0050459.g004 Figure 4Relative levels of circulating miRNAs were quantified 1, 3, and 6 weeks following tumour induction to investigate the relationship with disease progression (n = 20 at each time point, total n = 60) Circulating miR-221 was no significantly altered during the 6 week study (A). [score:1]
Elevated circulating miR-221 has been associated with resistance to neoadjuvant chemotherapy in breast cancer [24]. [score:1]
Circulating levels of miR-195, miR- 497 and miR-221 were analysed and correlated with tissue levels from the same animals. [score:1]
Moreover, it has been reported that miR-221 is involved in the promotion of an aggressive basal-like phenotype in breast cancer, functioning downstream of the RAS pathway and triggering epithelial-to-mesenchymal transition [52]. [score:1]
Further significant positive correlations were observed between circulating miR-195 and miR-497, circulating miR-195 and miR-221, and between miR-497 and miR-221. [score:1]
0050459.g005 Figure 5Further significant positive correlations were observed between circulating miR-195 and miR-497, circulating miR-195 and miR-221, and between miR-497 and miR-221. [score:1]
A significant positive correlation was observed between miR -10b and miR-221 across all tissues examined (r = 0.31, p<0.05, Figure 2C). [score:1]
[1 to 20 of 27 sentences]
17
[+] score: 62
However, higher levels of APOBEC3G (25 ng) slightly inhibited pGL3-P27-3′-UTR (P = 0.023) expression and on the other hand, slightly enhanced luc-m1 (both DND1 binding sites mutated) (P = 0.04) and luc-m3 expression (both miR-221 binding sites mutated) (P = 0.01) (Figure  2d-f). [score:7]
When both DND1 binding sites on pGL3-P27-3′-UTR were inactivated (m1-luc), miR-221 was able to suppress luciferase activity but DND1 was unable to rescue miR-221 inhibition (P = 0.3) and APOBEC3G was not able to restore miR-221 inhibition (P = 0.3) (Figure  2b). [score:7]
For example, DND1 inhibits miR-221 function from the 3′-UTR of P27 resulting in increased P27 protein expression [4, 5]. [score:5]
miR-221 inhibits luc-P27 (P = 0.0153) (lane 2). [score:3]
Thus APOBEC3G restores miR-221 inhibition of pGL3-p27-3′UTR luciferase activity. [score:3]
However, 25 ng A3 (*) (lane 4), together with miR-221, further inhibits luc- LATS2 (P = 0.013). [score:3]
A3 (10 ng), together with miR-221 does not further inhibit luc- LATS2 (P= 0.1673). [score:3]
pGL3-P27-3′UTR was co -transfected into 293 T cells together with expression vectors encoding miR-221, HA-tagged DND1 (HA-tag in C-terminus of DND1) and myc-tagged APOBEC3G (myc-tag in C-terminus of APOBEC3G). [score:3]
Higher APOBEC3G, when present together with miR-221, also further inhibited pGL3-P27-3′-UTR (or luc -P27) (P = 0.0488), luc- CX43 (P = 0.0385) and luc- LATS2 (P = 0.013) (Figure  2g-i). [score:3]
A3 (10 ng), together with miR-221, does not further inhibit luc-P27 (P = 0.4553). [score:3]
As expected, we found that miR-221 inhibits pGL3-P27-3′UTR luciferase activity (P = 0.005). [score:3]
A3 (10 ng), together with miR-221 does not further inhibit luc-CX43 (P = 0.4765). [score:3]
Use of mutant P27 3′-UTR constructs in which the miRNA binding sites were mutated (m3-luc) [4] (Figure  2c) showed, as expected, no functional inhibitory effect of mir-221 or any further effects by DND1 or APOBEC3G. [score:3]
However, 25 ng A3 (*) (lane 4), together with miR-221, further inhibits luc- CX43 (P= 0.0385). [score:3]
However, A3 at 25 ng (lane 4), together with miR-221, further inhibits luc-P27 (P= 0.0488). [score:3]
al. [4] showed that DND1 blocks miR-221 function from the 3′-UTR of P27 mRNA. [score:1]
Two U-rich DND1 binding sites have been mapped adjacent to two miR-221 binding sites in the 3′-UTR of P27[4]. [score:1]
Luciferase activity of pGL3-P27-3’UTR in presence of miR-221, DND1 and APOBEC3G (lane 4). [score:1]
DND1 counteracts the effect of miR-221 to restore luciferase activity (P = 0.01) (Figure  1b). [score:1]
However, when we introduce APOBEC3G together with DND1, we found that presence of APOBEC3G opposes DND1 repression of miR-221 (P = 0.009) (Figure  1c). [score:1]
were carried out to monitor the effect of APOBEC3G and DND1 on miR-221 activity on P27 3′-UTR. [score:1]
Luciferase activity of pGL3-P27-3’UTR (or luc- P27 ) alone (lane 1); in the presence of miR-221 (lane 2); in the presence of DND1 (lane 3); in the presence of miR-221 and DND1 (lane 4). [score:1]
[1 to 20 of 22 sentences]
18
[+] score: 56
As shown in Figure 6, qualitative qPCR validated that ssc-miR-146a-5p, ssc-miR-221-5p and ssc-miR-148b-3p were significantly upregulated by LPS, and ssc-miR-215 and ssc-miR-192 were downregulated. [score:7]
Figure 7LPS upregulates the expression of miR-146a-5p and miR-221-5p in C2C12 myotubes. [score:6]
In our study, we observed greater miR-221-5p expression in LPS -injected pig skeletal muscle and LPS -treated C2C12 myotubes, suggesting that this miRNA may play a functional role in inflammatory muscle catabolism by regulating gene expression. [score:6]
In contrast, miR-221-5p was not upregulated until 24 h of LPS treatment (Figure 7). [score:4]
After normalization of the raw reads we found that four miRNAs (ssc-miR-146a-5p, ssc-miR-221-5p, ssc-miR-9860-5p and ssc-miR-148b-3p) were significantly upregulated in the LPS-challenged samples with a p-value cutoff of 0.05. [score:4]
However, a recent study found that miRNA-221 also regulates endothelial nitric oxide production and the inflammatory response by targeting adiponectin receptor 1 (ADIPOR1) [46]. [score:4]
Of note, injection of LPS resulted in significantly enhanced expression of ssc-miR-146a-5p and ssc-miR-221-5p. [score:3]
Moreover, inflammation significantly induced miR-221 expression in adipocytes [47]. [score:3]
Importantly, miR-146a-5p and miR-221-5p displayed significant differential expression in LPS -injected pig skeletal muscle and LPS -treated C2C12 myotubes, suggesting the two miRNAs might be involved in acute inflammation processes in skeletal muscle. [score:3]
RT-qPCR was performed to determine the time -dependent effects of LPS on the expression of TNF-α, IL-1β, MAFbx, MuRF1, miR-146a-5p and miR-221-5p. [score:3]
miR-221 is a well-known oncogenic miRNA, which is involved in tumor development by regulating cell proliferation and contributes to TNF-related apoptosis-inducing ligand (TRAIL) resistance [44, 45]. [score:3]
Differential expressions of five selected miRNAs (ssc-miR-146a-5p, ssc-miR-221-5p, ssc-miR-148b-3p, ssc-miR-215 and ssc-miR-192) were validated by quantitative polymerase chain reaction (qPCR). [score:3]
LPS Induces miR-146a-5p and miR-221-5p Expression in C2C12 Myotubes. [score:3]
Thus, further investigation would be focused on the potential function manners of miR-221-5p, targets identification and knock-out experiment at celluar level. [score:2]
Further investigations should focus on the potential function of miR-146a-5p and miR-221-5p during inflammatory muscle catabolism, including identification of targets and knock-out experiments at the cellular level. [score:2]
[1 to 20 of 15 sentences]
19
[+] score: 55
In contrast, it has been shown that simultaneous targeted inhibition of miR-221-3p and miR-222-3p affects multiple pro-oncogenic pathways, reverses the aggressive HCC phenotype, and suppresses tumor growth [24, 29, 32]. [score:7]
Several reports have demonstrated over -expression of miR-221-3p and miR-222-3p in human HCC, which is associated with inhibition of apoptosis, activation of the TGF-β, Wnt/β-catenin, and mTOR signaling pathways, cell migration, invasion, and the formation of a more aggressive tumor phenotype [27– 31]. [score:5]
We also demonstrated that over -expression of miR-25-3p, miR-93-5p, miR-106b-5p, miR-221-3p, and miR-222-3p was accompanied by the reduced protein levels of their targets, including E2F1, PTEN, and CDKN1A. [score:5]
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Among the miRNAs distinctively over-expressed in NASH-derived HCC, miR-221-3p and miR-222-3p, which exhibited a carcinogenesis stage -dependent increase in expression, and miR-25-3p, miR-93-5p, and miR-106b-5p, which are members of the oncogenic miR-106b∼25 cluster, are of special interest. [score:5]
Additionally, it has been demonstrated that miR-221-3p and miR-222-3p also target PTEN and CDKN1A [44, 45], indicating that the oncogenic activity of miR-93-5p, miR-221-3p, and miR-222-3p may be attributed to the silencing of these key cancer-related genes and consequent impairment in cell-cycle arrest and inhibition of apoptosis. [score:5]
Importantly, several of the identified miRNAs, including miR-34a, miR-93-5p, miR-221-3p, and miR-222-3p, were also significantly over-expressed in human HCC suggesting that aberrant expression of these miRNAs may serve as an indicator of the hepatocarcinogenic process. [score:5]
Figure 3 shows that the expression of four miRNAs, miR-34a-5p, miR-93-5p miR-221-3p, and miR-222-3p, that were over-expressed in mouse NASH-derived HCC was also significantly greater in human HCC (n = 358) as compared to non-tumor liver tissue samples (n = 50). [score:4]
The statistical analyses of miR-34a-5p, miR-93-5p, miR-221-3p, and miR-222-3p expression datasets in human HCC samples were conducted by the Mann-Whitney Rank Sum test. [score:3]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
Importantly, miR-93-5p, miR-221-3p, and miR-222-3 were significantly over-expressed in human HCC. [score:3]
Among these 19 differentially expressed miRNAs in HCC (20 weeks), 10 of the miRNAs were significantly different from that in NASH-fibrotic livers (12 weeks), among which miR-221-3p, miR-222-3p, and miR-223-3p showed a progressive stage -dependent increase (Figure 2A). [score:3]
Levels of miR-34a-5p, miR-93-5p, miR-221-3p, and miR-222-3p in human HCC samples. [score:1]
Importantly, five of these miRNAs (miR-34a-5p, miR-93-5p, miR-106b-5p, miR-221-3p, and miR-222-3p) were in common with those in the 10-miRNA set in our study. [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 53
Interestingly, a recent paper demonstrated that cardiac miR-222 expression increased after endurance exercise training, an activity required for physiological cardiomyocyte growth in adult hearts, and that miR-222 expression protected against adverse cardiac remo delling 44. miR-221 and miR-222 target the identical RNA sequence, and miR-221/222 overexpression in mice antagonized pressure overload -induced pathological cardiac remo delling 45. [score:9]
The main findings of this study are: (1) cardiac ANGPTL2 production increases in stressed mouse heart as it undergoes pathological remo delling and potentially in some DCM patients; (2) pathological stimuli increase cardiomyocyte ANGPTL2 production via calcineurin-NFAT signalling; (3) ANGPTL2 protein secreted from cardiomyocytes predisposes heart to HF development likely by perturbing left ventricular contractile ability, an outcome attributable to inactivation of AKT-SERCA2a signalling and decreased myocardial energy metabolism in cardiomyocytes; (4) exercise training and/or miR-221/222 activity decreases cardiac ANGPTL2 expression; (5) Angptl2 KO mice are protected from pathological cardiac remo delling, and their heart phenotypes resemble those induced by exercise; (6) AAV6-shAngptl2 blocks cardiac ANGPTL2 upregulation in heart stressed by pressure overload and blocks the transition to HF by activating AKT-SERCA2a signalling and improving energy metabolism in cardiomyocytes in mice; and (7) AKT-SERCA2a is activated and myocardial energy metabolism is enhanced in ANGPTL2-KD human iPS-derived cardiomyocytes. [score:7]
To determine whether miR-221/222 suppresses ANGPTL2 expression in vivo, we generated cardiomyocyte-specific miR-221/222 KO male mice by crossing miR-221/222 [Flox/y] mice with αMHC-Cre mice. [score:5]
Accordingly, miR-221/222 KO mice showed significantly increased ANGPTL2 protein levels in stressed heart after TAC (Supplementary Fig. 5g), suggesting that ANGPTL2 is a direct target of miR-221/222 (ref. [score:4]
Deletion of the miR-221/222 binding site in the Angptl2-3′UTR reporter (Fluc-Angptl2-3'UTR-Δ 221/222) was performed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer's instructions miR-221, miR-222, miR-211, miR-204 or miR-135a overexpression vectors were constructed by inserting sequences including the full-length mature microRNA sequences into pBApo-CMV (Takara Bio). [score:3]
Here, we found that expression of both miR-221 and miR-222 markedly increased in pressure overload -induced cardiac stress following TAC (Supplementary Fig. 5b). [score:3]
42) (Fig. 4b,c) and that miR-221/222 promotes cardioprotection via ANGPTL2 suppression (Supplementary Fig. 5). [score:3]
We observed that miR-221 or miR-222 overexpression in NRCMs significantly attenuated activity of a luciferase reporter fused to the Angptl2-3′UTR (Fig. 4b), an activity blocked by deletion of miR-221/222 binding sequences from the UTR (Fig. 4c). [score:3]
Relative luciferase activity in NRCMs harbouring the reporter and transfected with control pcDNA3.1 vector or miR-221, miR-222, miR-211, miR-204 or miR-135a expression vectors. [score:3]
We confirmed that miR-221 and miR-222 expression levels in heart of these were significantly decreased relative to control miR-221/222 [Flox/y] mice (Supplementary Fig. 5a). [score:3]
Notably, we also found that cardiomyocyte-specific miR-221/222 KO mice were predisposed to HF development (Supplementary Fig. 5c–f), suggesting that miR-221/222 functions in cardioprotection. [score:2]
However, it has been reported that pressure overload -induced cardiac miR-221 promotes HF development 46 47. [score:2]
org database identified five candidates, including miR-135a, miR-204, miR-211, miR-221 and miR-222, predicted to bind to the Angptl2 mRNA 3′UTR. [score:1]
When we subjected miR-221/222 KO and miR-221/222 [Flox/y] control mice to chronic exercise training, we found that ANGPTL2 protein levels in heart tissues of exercised miR-221/222 [Flox/y] control mice were significantly lower than that seen in sedentary miR-221/222 [Flox/y] controls (Fig. 4d). [score:1]
miR-221/222 conditional KO mice (miR-221/222 [Flox/y](male) and miR-221/222 [Flox/Flox](female)) on a C57BL/6N background were provided by the German Research Center for Environmental Health (GmbH; Neuherberg, Germany). [score:1]
Generation of miR-221/222 conditional KO mice. [score:1]
Thus, the role of cardiac miR-221/222 remains controversial. [score:1]
In contrast, an exercise -induced decrease in cardiac ANGPTL2 protein levels did not occur in hearts of exercised miR-221/222 KO mice (Fig. 4d). [score:1]
[1 to 20 of 18 sentences]
21
[+] score: 52
When the DLBCL cells were treated with OncomiR inhibitors, the expression levels of some target genes were changed, PTEN was upregulated by the inhibitors for miR-21, miR-125b and miR-155; p27kip1 was upregulated by the inhibitors for miR-21, miR-155 and miR-221; TIMP3 was upregulated by the inhibitors for miR-21, miR-155, miR-221 and miR-17; RECK was upregulated by all the tested inhibitors (Figure 4A). [score:27]
Of these OncomiRs, the expression levels of miR-21, miR-155, miR-221/222, miR-17, miR-19a/19b, and miR-20a/20b were higher in OCI-Ly10 cells, whereas the expression levels of miR-21, miR-155, miR-125a-5p/125b, miR-146a/146b-5p, and miR-17 were higher in SUDHL-4 and DB cells (Figure 1C). [score:5]
The luciferase activities of pGL3-miRs containing miR-21 and miR-155 binding sites were lower in OCI-Ly10, SUDHL-4 and DB cells than in IM-9 cells, and the inhibitors of miR-21 and miR-155 could increase the luciferase levels in DLBCL cells, but the control miR-221 inhibitor did not. [score:5]
For example, PTEN (phosphate and tensin homolog) is a tumor suppressor gene, which was regulated by several miRNAs, such as miR-21 [12], miR-155 [13], miR-221/222 [14], and miR-17~92 cluster [15]. [score:4]
A tandem sequence containing 10 copies of complementary sequences to the seed sequences of highly expressed OncomiRs (miR-21, miR-155, miR-221/222, miR-125a-5p/125b, miR-146a/146b-5p, miR-17, miR-19a/19b, miR-20a/20b) in DLBCL (Table 1) was generated and used as the encoding sequence for i-lncRNA. [score:3]
Based on the mechanisms of miRNA functions, we selected those that are highly expressed in DLBCL, including miR-21, miR-155, miR-221/222, miR-125a-5p/125b, and miR-146a/146b-5p, as well as the miR-17-92 family members miR-17, miR-19a/19b, and miR-20a/20b; subsequently, we generated tandem sequences of 10 copies of the antisense sequences to these miRNA seed sequences and synthesized an interfering long non-coding RNA (i-lncRNA). [score:3]
The expression levels of miR-21, miR-155, miR-221/222, miR-125a-5p/125b, miR-146a/146b-5p, miR-17, miR-19a/19b, and miR-20a/20b were significantly higher in the OCI-Ly10, SUDHL-4, and DB cells than in the IM-9 cells. [score:3]
The i-lncRNA-involved OncomiRs were not always decreased, miR-21 was decreased, miR-221 was increased, and the expression of miR-155, miR-17, miR-19a and miR-20a was not changed, compared with the control group. [score:2]
[1 to 20 of 8 sentences]
22
[+] score: 33
Other miRNAs from this paper: hsa-mir-221, rno-mir-221
Analysis of the expression of miRNA-221&222 in RNFwt and RNFmut cells, as well as in a series of normal and tumor rat adrenal tissues (organ affected by the MENX syndrome), showed no significant difference in the expression of these two miRNAs between samples expressing wild-type or mutant Cdkn1b (see Additional File 7). [score:7]
Therefore, a higher expression of miRNA-221&222 does not play a role in the low level of expression of p27fs177 in either rat primary cells or rat tissues. [score:5]
Overexpression of the negative regulators microRNA-221/222 plays no role in regulating the amount of p27fs177 in RNFs and rat tissues. [score:5]
Recently, it has been reported that miRNA-221&222 down-regulate p27 at the post-transcriptional level in cell lines and in primary tumors [8, 25]. [score:4]
Therefore, we checked whether the low amount of p27fs177 in MENX-affected rat tissues and cells might also be due to an up-regulation of miRNA-221&222. [score:4]
Expression of miRNA-221& 222 in rat adrenal tissues and in primary fibroblasts (REF cells) show no difference between normal and mutated rats. [score:3]
Click here for file Expression of miRNA-221& 222 in rat adrenal tissues and in primary fibroblasts (REF cells) show no difference between normal and mutated rats. [score:3]
Quantitation of mature miRNA-221 and 222 expression levels in and was performed by RT-PCR using TaqMan MicroRNA Assays. [score:2]
[1 to 20 of 8 sentences]
23
[+] score: 33
Other miRNAs from this paper: mmu-mir-143, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-107, mmu-mir-222
Moreover, changes in miRNAs expression correlated with several adipocyte gene expressions: miR-103 and -107 correlated with genes involved in fatty acid metabolism whereas miR-221 and miR-222 correlated with the expression of adipocytokines. [score:7]
Conversely, another set of miRNAs follows the opposite response pattern, for example miR-222 and miR-221, which are decreased during adipogenesis but upregulated in obese adipocytes [11]. [score:4]
In fact, expression of all miRNAs tested was significant and highly correlated within themselves, except for the case of miR-222 which was only correlated with miR-103 and miR-221. [score:3]
miR-221 was also specifically correlated with the expression of TNFα (r = 0.385, P<0.05) (Table 3). [score:3]
Consequently, expression levels of selected miRNAs (miR-143, miR-103, miR-107, miR-221 and miR-222) which seem to be related to adipose biology were studied in adipose tissue of mice treated with CLA. [score:3]
As potential targets of the action of CLA, we focused the study on five selected miRNAs (miR-143, miR-103, miR-107, miR-221 and miR-222) which, to a certain extent, have been shown to be involved in adipocyte differentiation and/or associated with obesity. [score:3]
Interestingly, a strong correlation was observed between miR-103 and -107 expression, as well as miR-221 and -222 in both experiments. [score:3]
miR-221 expression was not affected in Exp1 and only the highest dose of CLA in Exp2 (CLA4) produced a significant increase of miR-221 with respect to both CLA3 and control groups (P<0.01). [score:3]
We determined retroperitoneal adipose tissue (rWAT) expression of five miRNAs related to adipocyte differentiation (miRNA-143) and lipid metabolism (miRNA-103 and -107) and altered in obesity (miRNA-221 and -222), using the TaqMan®MicroRNA Assay (Applied-Biosystems). [score:2]
Correlation found for miR-221 and TNFα in Exp1 was maintained in Exp2 (r = 0.434, P<0.05) and a significant negative correlation between adiponectin and miR-221 (r = −0.444, P<0.05) was also identified (Table 4). [score:1]
This strong association was partially lost in Exp2, with CLA treatment under high-fat feeding, in which the only correlations maintained were between miR-103 and miR-143; mir103 and miR-107; and miR-221 and miR-222 (Table 1). [score:1]
[1 to 20 of 11 sentences]
24
[+] score: 29
Although we did not predict all miRNAs that were upregulated in PTC, we did identify the four mostly highly upregulated, based on their analysis, miR-146, miR-221, miR-222, miR-21 (upregulated 19.3 fold, 12.3 fold, 10.9 fold and 4.3 fold respectively) (Table 1). [score:10]
For example, genes upregulated in normal thyroid, contain binding sites for miRNAs that are upregulated in PTC (e. g. miR-221). [score:7]
MiR-146, miR-221 and miR-222, are an order of magnitude more upregulated than any of the other miRNAs. [score:4]
Those miRNAs highlighted in blue (miR-221, miR-222, and miR-146) are predicted to be upregulated in PTC, from visual inspection of the plots. [score:4]
Performing a supervised analysis on this dataset using BGA confirms that miR-221 and miR-222 are the miRNAs most highly associated with PTC. [score:1]
Therefore miR-221 is at the opposite end of the miRNA axes to PTC on the sample axes. [score:1]
Highlighted in blue are miR-221 and miR-222, which are associated with PTC. [score:1]
To the right of the figure, along the horizontal axis, we can see miR-221 and miR-222 highlighted in blue. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 27
We also demonstrated that miR-221, which is a paralog of miR-222, was up-regulated in the livers of G+HFHSD-fed mice. [score:4]
Furthermore, miR-221, which is a paralog of miR-222, was also up-regulated in the livers of G+HFHSD-fed mice (Fig 1F). [score:4]
However, miR-221/222 expression levels in patients with diabetes treated with metformin were comparable to those of individuals without diabetes [24]. [score:3]
miR-222 and miR-221 expression were analyzed by qRT-PCR (n = 8 per group). [score:3]
Li et al. reported that high glucose stimulation increased miR-221 expression in human umbilical vein endothelial cells [26]. [score:3]
Because the seed sequences of miR-222 and miR-221 are identical, both may be able to affect the same target genes. [score:3]
Coleman et al. reported increased miR-221/222 expression in the internal mammary arteries of patients with diabetes. [score:3]
They showed a significant inverse correlation between the dose of metformin and the levels of miR-221/222. [score:1]
MicroRNA-221 regulates high glucose -induced endothelial dysfunction. [score:1]
Elevation of miR-221 and -222 in the internal mammary arteries of diabetic subjects and normalization with metformin. [score:1]
Further examination is needed to demonstrate the role of miR-221 in future experiments. [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 26
Both miR-221 (highly expressed in the proestrus stage of females exposed to O [3]) and miR-222 (upregulated in males exposed to O [3]) are involved in the development and progression of lung cancer by targeting the tumor suppressor genes PTEN and TIMP3 [70]. [score:11]
Moreover, overexpression of miR-221/222 is known to inhibit apoptosis and promote cell migration by downregulating PTEN and TIMP3 [71]. [score:8]
More importantly, miR-221/222 has been reported to target estrogen receptor alpha (ESR1), and miR-221-3p has been shown to regulate IL-6 release from abnormal airway smooth muscle in patients with severe asthma, especially women [72, 73]. [score:4]
Specifically, we found nine differentially expressed miRNAs in females exposed to O [3] in proestrus: miR-694 (log fold change = 1.492), miR-9-5p (log fold change = 0.836), miR-712-5p (log fold change = 0.667), miR-181d-5p (log fold change = 0.597), miR-98-5p (log fold change = 0.558), miR-200c-3p (log fold change = 0.525), miR-221-3p (log fold change = 0.385), miR-126a-5p (log fold change = 0.421), and miR-106a-5p (log fold change = − 0.527) (Fig.   7). [score:3]
[1 to 20 of 4 sentences]
27
[+] score: 21
By RT-qPCR analysis we showed that absence of phosphorylated NKX2-1 results in a significant increment in the levels of miR-200c and miR-221; miR-1195 is down-regulated although no significantly, showing a similar trend than in Nkx2-1 knockdown experiments in MLE15 cells (Figure  2C). [score:5]
From these, 29 miRNAs increased their expression levels by Nkx2-1 knock-down including miR-200c (16.7 fold), miR-200b (1.7 fold), miR-221 (4.2 fold), and miR-222 (3.7 fold) (Figure  2A and Table  1). [score:4]
Expression patterns of the most altered miRNAs (miR-200c, miR-221, miR-1195, and miR-378) were analyzed in Nkx2-1 knock-down cells by RT-qPCR (Figure  2B) confirming the microarray data. [score:4]
These data indicate a potential regulatory link between NKX2-1 and miR-200c, miR-221, or miR-1195. [score:2]
NKX2-1 also binds to the 5′flanking region of miR-221. [score:1]
miR-221 and miR-1195 5′ flanking regions were not represented in the array. [score:1]
Detailed ChIP methods are described in Additional file 1. Genomic regions (1.1 kb) 5′ to the first nucleotide of miR-200c and of miR-221 pre-miRNA sequences were retrieved from the UCSC Mouse Genome Browser [29]. [score:1]
We used oligonucleotides with restriction enzyme adaptors to amplify ~ 0.9-1kb of each region by PCR (miR-200c F 5′-SacI CAGGCAGACACTGCCATCT-3′, R 5′-HindIII CTACCCAACCAGTCCACCTCC-3′; miR-221 F 5′-SacI AGGAGAGGCCCTTGGTATAG-3′, R 5′-HindIII GTTCAGCCTGCAAATTATCC). [score:1]
The 1kb fragment 5′ to miR-221 was transcriptionally inactive in the same conditions (Figure  3D). [score:1]
Thus, miR-200c-Luc and miR-221-Luc plasmids were transiently transfected using Lipofectamine 2000 (Life Technologies, Grans Island, NY) in the cell lines described above. [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 21
reported here are in line with those reported in the literature describing miR-25, miR-221 and miR-222 as direct regulators of CDKN1C expression in a wide variety of solid tumours, showing a new mechanism responsible for CDKN1C downregulation in carcinogenesis [43– 45]. [score:8]
There were only two significant deregulated miRNAs controlling CDKN1C expression, which are up-regulated in practically all the samples (miR-221–3p and miR-222-3p). [score:7]
In this context, our findings suggest that aberrant expression of miR-221 and miR-222 may have an oncogenic function in T-LBL development by targeting CDKN1C. [score:6]
[1 to 20 of 3 sentences]
29
[+] score: 20
At the molecular level, miR-221 was up-regulated and the targets of miR-221 (p27, p57, and bmf) were down-regulated in the liver tissue. [score:9]
After in vivo delivery of anti-miR-221 oligonucleotides, number and size of tumors were reduced significantly accompanied by a persistent, significant decrease of miR-221 expression [104]. [score:3]
Liver-specific miR-221 transgenic mouse is another mouse mo del targeting on the study of HCC related microRNA. [score:3]
Furthermore, we assessed the inhibited effects of miR-221 on subcutaneous xenografts pre-established with 2 × 10 [6] SK-HEP-1 and found that only a single intra-tumor injection with 2 × 10 [8] TU miR-221(D)-LV reduces the growth of tumors [15]. [score:3]
A conditionally transgenic mouse mo del carrying miR-221 gene. [score:1]
For instance, we once employed 2 × 10 [6] SK-HEP-1 cells which were pre-infected with lentivirus -mediated-anti-miR-221 (miR-221(D)-LV) to establish subcutaneous tumors in nude mice, and found that depletion of miR-221 renders SK-HEP-1 cells less efficient in establishing tumors in vivo [15]. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 20
For bats, 3 out of 4 up-regulated miRNA (miR-101-3p, miR-16-5p, miR-143-3p) likely function as tumor suppressors against various kinds of cancers, while one down-regulated miRNA (miR-221-5p) acts as a tumorigenesis promoter in human breast and pancreatic cancers. [score:9]
The summary of the six DE miRNA common to all species is described in Fig.   5. Briefly, all DE candidates were single copy miRNA across all libraries, and 4 DE miRNA (miR-101-3p, miR-16-5p, miR-143-3p and miR-155-5p) were up-regulated in bats while 2 (miR-125-5p and miR-221-5p) were down-regulated. [score:7]
Importantly, one down-regulated miRNA, miR-221, was reported to function as a tumorigenesis promoter in human breast cancer. [score:4]
[1 to 20 of 3 sentences]
31
[+] score: 19
0086033.g005 Figure 5 Fold expression changes of miR-221 (dark grey columns) and miR-29b (light grey columns) in MSG-obese mice were normalized to individual or combined reference genes. [score:3]
Previous reports have shown overexpression of miR-221 in obese mice and miR-29b in diabetic animals [35], [36]. [score:3]
If the most often used RG for miRNA studies U6 or geometric mean of all studied RGs were used, the difference in miR-221 and miR-29b expressions would be overlooked. [score:3]
In the present study, the RGs selected for miRNA profiling were tested in obese (MSG -treated) and lean mice with miR-221 and miR-29b as target miRNAs. [score:3]
Fold expression changes of miR-221 (dark grey columns) and miR-29b (light grey columns) in MSG-obese mice were normalized to individual or combined reference genes. [score:3]
Effects of different normalization approaches on the expression of miR-221 and miR-29b. [score:3]
In order to evaluate the RGs analyzed in this report, we studied the liver expression of miR-221 and miR-29b using the same experimental design. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 19
As such, the translational regulation of ESR1 represents another remarkable functional cross-talk between miRNAs, which we show to be expressed in a mutually exclusive manner between the cerebellum (miR-206) and the hippocampus/amygdaloid regions (miR-221/miR-222). [score:6]
Our data provides a detailed map of miRNA brain expression in rats and shows that there are some differences in the expression in the cerebellum of a subset of the detectable transcripts, which are either highly enriched (miR-206 and miR-497) or nearly depleted (miR-132, miR-212, miR-221 and miR-222). [score:5]
Notably, we found reciprocal expression profiles for a subset of the miRNAs predominantly found (> ten times) in either the cerebellum (miR-206 and miR-497) or the forebrain regions (miR-132, miR-212, miR-221 and miR-222). [score:3]
Accumulations of miR-497 in the cerebellum, of miR-7 in the hypothalamus, and of miR-221 and miR-222 in the hippocampus have also been described in mice [39] and zebrafish (larval and adult brain), where miR-222 is expressed in specific groups of differentiating cells in the rostral parts of the brain [42]. [score:3]
The most pronounced differences in expression patterns among these nine miRNAs were seen for the miR-221 family members (miR-221 and miR-222), which showed a cerebellar reduction of more than 60-fold compared to the hippocampus and the amygdaloid region. [score:2]
[1 to 20 of 5 sentences]
33
[+] score: 18
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
PRDM14 -transfected breast cancer cell lines also exhibited increased expression of oncogenic microRNAs (miRNAs) (miR-101, miR-155, miR-21, miR-221, and miR-23a) and decreased expression of tumor suppressor miRNAs (miR-128a, miR-200a/b, and miR-520f) (Supplementary Table 2). [score:7]
[1 to 20 of 2 sentences]
34
[+] score: 18
In fact, miR-222 has been found to be upregulated in 10 different myopathies: a study by Eisenberg et al. [31] reported that a large number of miRs were differentially expressed in various muscular pathologies and, that, in particular, the expression of five miRs (miR-146b, miR-221, miR-155, miR-214, miR-222) was altered in all the analyzed syndromes. [score:8]
These authors observed that in quails, murine primary muscle cells, and myogenic rodent cell lines, the miR-221/miR-222 cluster was highly expressed in proliferating myoblasts but downregulated in differentiated myotubes. [score:6]
Among these miRs, five (miR-146b, miR-221, miR-155, miR-214, and miR-222) were found to be consistently dysregulated in the different analyzed diseases [31]. [score:4]
[1 to 20 of 3 sentences]
35
[+] score: 16
Moreover, our miR expression data (Fig. 1d) confirm the findings of Xie (2009) [56] and Knelangen [57] that miR-221 and miR-125b-5p are down-regulated during differentiation of 3T3-L1 cells, whereas miR-103 and miR-146b are up-regulated. [score:9]
As proof of the integrity of our miR expression assay data, the expression levels of three putative adipogenesis-relevant miRs (miR-103, miR-146 and miR-221) and five highly regulated miRs (miR-29a, miR29b, miR-365, miR93 and miR96) were analysed by RT-qPCR (S1 and S2 Figures; the corresponding expression values are summarised in the Supporting information S3 and S4 Tables). [score:7]
[1 to 20 of 2 sentences]
36
[+] score: 16
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
Karakatsanis A Papaconstantinou I Gazouli M Lyberopoulou A Polymeneas G Voros D Expression of MicroRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significanceMol Carcinog. [score:3]
In addition, miRNAs have been described to be modulated even in steatosis/NASH (i. e. miR-155, miR-370, miR-34a, miR-200a/b, miR-99a/b), fibrosis (i. e. miR-200a/b, miR-221/222, miR-34a, miR-16, miR-99b), cirrhosis (i. e. miR-34a, miR-21, miR-31, miR-181b), and HCC (i. e. miR-16, miR-33, miR-21, miR-31, miR-181a/b, miR-99a, miR-200a/b) [15]. [score:1]
[1 to 20 of 3 sentences]
37
[+] score: 15
Other miRNAs from this paper: mmu-mir-205, hsa-mir-205, hsa-mir-221
Knowing that ZEB2, a direct target of miR-221 and whose downregulation by miR-221 leads to the upregulation of GAX expression, acts primarily as a transcriptional repressor, Chen et al. identified two ZEB2 binding sites in the GAX promoter that modulate the ability of ZEB2 to downregulate GAX promoter activity [24, 25]. [score:15]
[1 to 20 of 1 sentences]
38
[+] score: 15
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 15
The panel of differentially expressed miRNAs were validated by real-time PCR using TaqMan assays, and the results were consistent with the data that showed up-regulation of miR-21, miR-221, miR-100 and miR-26a and down-regulation of miR-26b, miR-141, miR-96, miR483-3p, miR-216, and miR-217 in the KC compared to control mice (Figure 1A). [score:7]
Further, Rieu et al. have shown that expression of miR-21, miR-221, miR-222, and Let-7a increases with PanIN grade, with the strongest expression in the hyperplastic ducts with PanIN 2/3 lesions [69]. [score:5]
At 50 weeks of age, variation in expression of miR-221 was not statistically significant between the KC and control animals (Figure 2D). [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 14
miR-221-3p, an established PCa tumor suppressor [52], uniquely targets Runx2. [score:5]
In Table 1, numerous miRNAs tied to androgen response in PCa are strikingly downregulated, such as miR-27b-3p, miR-141-3p, miR-181a-5p, miR-221-3p, and miR-375-3p. [score:4]
To discover the molecular mechanisms through which Runx1, Runx2, and the Runx -targeting miRNAs, miR-23b-5p, miR-139-5p, miR-205-5p, miR-221-3p, miR-375-3p, miR-382-5p, and miR-384-5p, drive prostate tumorigenesis, we interrogated well-accepted bioinformatics tools; DAVID [57, 58] and Ingenuity Pathway Analysis (IPA-www. [score:3]
Several of these candidate miRNAs, such as miR-23b-5p [51] and miR-221-3p [52], have a characterized phenotype in PCa and are downregulated in malignant human tissue [53]. [score:2]
[1 to 20 of 4 sentences]
41
[+] score: 13
For example, miR-221-3p and its protein target, serpinb1a, are expressed equally in the crypt and villus cells of WT mice but exhibit gradients between the crypts and villi of PepT1 KO mice. [score:5]
6 miRNAs (miR-221-3p, miR-181-5p, miR-181b-5p, miR-712-5p, miR-345-5p, miR-100-5p; Fig. 4a2,b2) showed a lower expression level in KO crypts than KO villi, but showed higher expression level in WT crypts than WT villi (Fig. 4b2: Red spots vs Fig. 4a2: Blue spots). [score:5]
The expression of miRNA-221-3p was higher in crypts than in villi of WT mice, whereas it was higher in villi than in crypts of PepT1 KO mice (Fig. 11a). [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 13
Another notable discrepancy is that of miR-221 expression, which was not overexpressed in any of the tumors tested in our study, but was shown to be overexpressed in five out of nine of GBMs studied by Ciafre et al. [22], and has been shown to inhibit expression of the cell-cycle inhibitor p27(Kip1) in GBM cells [34]. [score:13]
[1 to 20 of 1 sentences]
43
[+] score: 12
PTEN was also shown to be a direct target of miR-21 and miR-221& 222, and contribute to cell migration [21], [22]. [score:4]
The result showed that the expression of miR-21 and miR-221 was not affected by HBx. [score:3]
We tried to detect the expression of miR-21 and miR-221 in HBx positive cells and in the p21-HBx transgenic mice. [score:3]
Therefore, PTEN is regulated by miR-29a besides miR-21 [21] and miR-221&222 [22]. [score:2]
[1 to 20 of 4 sentences]
44
[+] score: 12
Kan X., Sun Y., Lu J., Li M., Wang Y., Li Q., Liu Y., Liu M., and Tian L. (2016) Coinhibition of miRNA21 and miRNA221 induces apoptosis by enhancing the p53 -mediated expression of proapoptotic miRNAs in laryngeal squamous cell carcinoma. [score:5]
Togliatto G., Trombetta A., Dentelli P., Cotogni P., Rosso A., Tschöp M. H., Granata R., Ghigo E., and Brizzi M. F. (2013) Unacylated ghrelin promotes skeletal muscle regeneration following hindlimb ischemia via SOD-2 -mediated miR-221/222 expression. [score:3]
Chen W. X., Hu Q., Qiu M. T., Zhong S. L., Xu J. J., Tang J. H., and Zhao J. H. (2013) miR-221/222: promising biomarkers for breast cancer. [score:1]
Liu X., Cheng Y., Yang J., Xu L., and Zhang C. (2012) Cell-specific effects of miR-221/222 in vessels: molecular mechanism and therapeutic application. [score:1]
Davis B. N., Hilyard A. C., Nguyen P. H., Lagna G., and Hata A. (2009) Induction of microRNA-221 by platelet-derived growth factor signaling is critical for modulation of vascular smooth muscle phenotype. [score:1]
miR-222, which belongs to the same miRNA family as miR-221, was identified as an important modulator in platelet-derived growth factor–induced SMC phenotypic change (23). [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Top conserved miRNAs in the MaSC/basal population include miR-204 (may target ERα), miR-221/222 (targets ERα and c-Kit) [37, 38], and miR-205 (targets Pten and Bcl-2) [39, 40]. [score:7]
Conversely, miR-146a, miR-221/222, and miR-205, which have been shown to regulate genes expressed in the ductal and alveolar luminal lineages (e. g., Brca1, Gata3, c-kit and Elf5), were restricted to the MaSC/basal population. [score:4]
Zhao JJ Lin J Yang H Kong W He L Ma X MicroRNA-221/222 negatively regulates estrogen receptor alpha and is associated with tamoxifen resistance in breast cancerJ Biol Chem. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 11
The chimeric miR-15b/16-2 and miR-221/222 clusters were created by concatenation of miRNA expression plasmids with artificial miRNA constructs (Fig. 1) as previously described [26, 32]. [score:3]
In order to assess the function of miRNA clusters, which are polycistronic primary miRNA transcripts that give rise to two or more mature miRNAs, we constructed two artificial miRNA cluster expression constructs (miR-15b and miR-16; miR-221 and miR-222) by sequence concatenation, as outlined in material and methods. [score:3]
The transcript levels of mature miRNA were analysed by RT-qPCR for each of the miRNAs of the two clusters (miR-15b-5p, miR-16-5p, mir-221-3p and mir-222-3p) and normalized against miR-185-5p as a stably expressed control [32]. [score:3]
Therefore endogenous miR-221/222 and the miR-15b/16-2 clusters were amplified from genomic DNA and cloned into the 3'UTR of the same vector that was used for the chimeric constructs (Fig. 1). [score:1]
Artificial mir-221 and mir-222 were synthesized individually and cloned into the pcDNA 6.2 vector using restriction sites as indicated by black arrows. [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 11
Some of the results are in accordance with previous studies, such as the up-regulation of mmu-miR-221 and mmu-miR222 cluster and the down-regulation of the mmu-miR-200 family, as well as of mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e*. [score:7]
The following miRNAs were found to be up-regulated in WAT after HFD feeding: mmu-miR-342-3p, mmu-miR-222, mmu-miR-221, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-647* and mmu-miR-379. [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 11
The most frequently deregulated miRNAs in HCC include the let-7 family (downregulated), miR-122 (downregulated), and miR-221/222 (upregulated) [52, 53]. [score:11]
[1 to 20 of 1 sentences]
49
[+] score: 11
Recently, Sarkar et al. found that DIM could up-regulate pTEN expression through down -regulating the expression of miR-221 and lead to the inhibition of cell proliferation and migration of pancreatic cancer cells [46]. [score:11]
[1 to 20 of 1 sentences]
50
[+] score: 10
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-155, mmu-mir-196b, mmu-mir-126b
In the absence of 14-3-3ζ, the Raf/Mek/Erk/Ets2 pathway, along with other signaling pathways, is inhibited and miR-126 expression is attenuated, resulting in defects in lung vascular integrity that leads to neonatal lethality (right) Previously, we reported that 14-3-3ζ regulates transcription of miR-221 via the Erk target c-fos and the Jnk target c-Jun [62]. [score:10]
[1 to 20 of 1 sentences]
51
[+] score: 10
The ten most up-regulated miRNAs included mmu-miR-205-5p, mmu-miR-222-3p, mmu-miR-205-3p, mmu-miR-146b-5p, mmu-miR-21-5p, mmu-miR-21-3p, mmu-miR-221-3p, mmu-miR-140-3p, mmu-miR-142-5p, and mmu-miR-140-5p and the ten most down-regulated miRNAs comprised mmu-miR-211-5p, mmu-miR-3096-5p, mmu-miR-711, mmu-miR-466h-5p, mmu-miR-130b-3p, mmu-miR-3082-5p, mmu-miR-1199-5p, mmu-miR-669b-5p, mmu-miR-1187, and mmu-miR-1224-5p (Table 1). [score:7]
For instance, miRNAs with anti-proliferative and anti-angiogenic properties such as hsa-miR-15, hsa-miR-16 or hsa-miR-221/-222 targeting vascular endothelial factor (VEGF), anti-B-cell CLL/lymphoma 2 (Bcl-2) and stem cell receptor c-kit, respectively, play an important role in either preventing or initiating carcinogenesis [4], [5], [6]. [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 10
Other miRNAs from this paper: mmu-mir-218-1, mmu-mir-218-2
A recent bioinformatics analysis showed that adiponectin signaling is regulated by microRNAs: miR-221 inhibits AdipoR1 expression, which suggests that miR-221 regulates AdipoR1 signaling in different pathological processes (Chen et al., 2015). [score:7]
MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1. Gene 565, 246– 251. [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 10
The miR-221/222 cluster regulates neovascularization by targeting the signal transducer and activator of transcription 5A (stat5A), and is associated with coronary artery disease [27]. [score:6]
miR-221 was 6-fold downregulated in DGCR8i KO mice. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 10
Other miRNAs from this paper: mmu-mir-193a, hsa-mir-221, hsa-mir-222, hsa-mir-193a, mmu-mir-222
Upon further analysis, Pandhare-Dash et al. found that LNCaP cells infected with XMRV upregulated miR-221 and miR-222 (which inhibit p27 [Kipl] expression) compared to uninfected cells, presenting a mechanism by which infected cells could be downregulating p27 [Kipl] and thus promoting progression through the G [1]-S transition of the cell cycle. [score:10]
[1 to 20 of 1 sentences]
55
[+] score: 10
A recent study reported that miR-221 and miR-222 inhibit PTEN expression by binding to the 3’UTR, while knockdown of these miRNAs causes induction of PTEN expression [42]. [score:8]
Recent reports have identified the specific role of miR-221 and miR-10a in the regulation of ASM proliferation [33, 39]. [score:2]
[1 to 20 of 2 sentences]
56
[+] score: 10
However, in 2005, Felli's group [16] discovered that KIT, a well-known oncogene, is targeted by miR-221/222 in erythroblastic leukemia, thus illustrating miR-221/222's function as a tumor suppressor in human erythroblast cells. [score:5]
miR-221, a member of the same cluster had similar inhibitory effect on AKT phosphorylation levels (supplementary Figure S2). [score:3]
Among such a large number of miRNAs already identified as being involved in tumorigenesis, miR-221/222 have emerged as key miRNAs, which are encoded in tandem from a single transcript located on human chromosome Xp11.3, with the same seed sequence, and show high sequence identity [11, 12]. [score:1]
Figure 7(A) Schematic diagram of the putative binding site in GNAI2 mRNA 3'UTR for miR-222-3p (The identical GNAI2 wild-type (WT) seed sequences AUGUAGC and mutant (Mut) 3'UTR sequences TACATCG for miR-221/222 as shown above). [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 10
miR-221 and miR-222 are downregulated upon differentiation of proliferating myoblasts, then upregulated in terminally differentiated myotubes [41]. [score:7]
Ectopic expression of miR-221 and miR-222 are capable of disrupting early myogenesis and terminal myotube differentiation [41]. [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 9
For example, miR-221, which was overexpressed in an asthma mo del, increased IL-4 secretion in mast cells by regulating PTEN, p38, and NF-κB expression [37]. [score:6]
Zhou, Y. et al. miRNA-221-3p Enhances the Secretion of Interleukin-4 in Mast Cells through the Phosphatase and Tensin Homolog/p38/Nuclear Factor-kappaB Pathway. [score:1]
It has been reported that miR-221 promotes IgE -mediated mast cell degranulation through the PI3K/Akt/PLCγ/Ca [2+] signaling pathway [46]. [score:1]
MiR-221 and miR-222 significantly increase the degranulation and adherence of mast cells 11, 12. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 9
Similarly, TargetScan analysis identified the following miRNAs that are conserved in humans and are predicted to influence the NT3 gene: miR-21-5p, miR-222-3p, and miR-221-3p. [score:3]
Both miR-222-3p and miR-221-3p share the same seed sequence (AUGUAGCA). [score:1]
MicroRNAs predicted to influence neurotrophins: a BDNF (miR-206-3p, miR-10a-5p, miR-1b, miR-195-5p and miR-497-5p), b NT3 (miR-21-5p, miR-222-3p and miR-221-3p), and c NGF (let-7b-5p and miR-98-5p) were quantified by qPCR analysis in YA (n = 8) vs VO (n = 10) rat vastus lateralis muscle and WT (n = 8) vs Sarco (n = 7) gastrocnemius muscle. [score:1]
In contrast to the aforementioned studies in aging muscle, most of the miRNAs studied herein have been examined in the context of experimental denervation, including miR-206 (increases after reinnervation), miR-10a-5p (increases four- to seven-fold with denervation), miR-1 (increases up to 10-fold following denervation and remains elevated after reinnervation), miR-195 (increases up to 10-fold with denervation), miR-21 (increases with denervation), miR-221 (no consistent change), miR-222 (no consistent change), and miR-98 (increases up to 10-fold with denervation) [43, 47, 48]. [score:1]
Similarly, for NT3, our analysis identified significant increases in miR-21-5p and miR-221-3P in VO rat muscle. [score:1]
The miRNAs that exhibited a different response in VO rat muscle from what is seen with experimental denervation are miR-1, which in experimental denervation increases [48] but in VO rat muscle was observed to decline, and miR-221, which does not change with denervation [47] but was observed to increase in VO rat muscle. [score:1]
In VO rat muscle, miR-21-5p and miR-221-3p were increased significantly (Fig.   5b). [score:1]
[1 to 20 of 7 sentences]
60
[+] score: 9
Other miRNAs from this paper: mmu-mir-150
Given that miR-221 is one of the highly upregulated miRNAs in response to Fas -induced apopotosis[31], we also examine the level of miR-221 in the livers; we observed a 2.3-fold increase in miR-221 expression in both WT and miR-150 KO mice after Jo2 injection (Fig 4C). [score:6]
The levels of miR-150 and miR-221 in the livers were determined by qRT-PCR (Data are expressed as mean ± SD, * p<0.05). [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
62
[+] score: 9
For example, miR-221 and miR-222, whose expression levels are up-regulated in CAD-EPCs [41], [42], also modulate angiogenesis by targeting cKit [43]. [score:8]
Accordingly, it is possible to design new biomarker panels consisting of circulating miR-361-5p/-484 and miR-221/-222 for monitoring EPC activities in vitro or in vivo during the therapeutic procedure. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 9
Other miRNAs from this paper: hsa-mir-221
REDD1 expression is regulated via multiple mechanisms including translational repression by miR-221 which was reported to regulate REDD1 in murine hepatic progenitor cells (Pineau et al, 2010). [score:7]
This inverse correlation suggests that mature miR-221 is possibly involved in control of REDD1 induction by steroids in skin. [score:1]
In agreement, pri-miR-221 was significantly increased at the time points when REDD1 protein levels started to decline, for example, 24 h after single FA application, and after the first week of the chronic treatment (Supplementary Fig S5). [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
Mdm2 is negatively regulated by several miRNAs including miR-192 (Pichiorri et al., 2010), miR-194 (Pichiorri et al., 2010), miR-215 (Pichiorri et al., 2010), miR-221 (Kim et al., 2010), and miR-17 (Li and Yang, 2012) in different cellular contexts; however, whether these or other miRNAs regulate Mdm2 expression during the CNS development must be determined. [score:6]
MicroRNA-221 regulates chondrogenic differentiation through promoting proteosomal degradation of slug by targeting Mdm2. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
The Cip/Kip family CKIs are targeted by miR-17-92, miR-106b, the miR-221 family and miR-25 in many different carcinomas [136]. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 9
Other miRNAs from this paper: mmu-mir-205, mmu-mir-10a, mmu-mir-222
To further explore how PTEN was up-regulated in lung cancer cells by SFE, we detected multiple known PTEN -targeting miRNAs including miR-10a, miR-205, miR-221, and miR-222. [score:6]
In the rescue assays, we observed that the anti-cancer effects of SFE were significantly inhibited by miR-10a, miR-205, miR-221, or miR-222 (Figure 3F). [score:2]
Moreover, to validate the biological function of these miRNAs in lung cancer cells, we transfected A549 and H1299 cells with mimics of miR-10a, miR-205, miR-221, or miR-222 with or without treatment of SFE. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 9
Other miRNAs from this paper: mmu-mir-202, mmu-mir-34a, mmu-mir-200c
Downregulation of miR-221 enhances the sensitivity of human oral squamous cell carcinoma cells to Adriamycin through upregulation of TIMP3 expression. [score:9]
[1 to 20 of 1 sentences]
68
[+] score: 9
Although miR-204 is expressed in MG, RPE cells and ciliary epithelial cells, it is unlikely that the MG in our study was contaminated by RPE or ciliary epithelial cells, since (1) the FACS-sorted tdTomato [+] cells in our samples were Sox2 [+] and this is not expressed in either the RPE or ciliary epithelium and (2) miRNAs miR-211, miR-222, and miR-221, are highly expressed in the RPE 39, but were not highly expressed in the MG-fraction in our study. [score:9]
[1 to 20 of 1 sentences]
69
[+] score: 8
Other miRNAs from this paper: hsa-mir-221
In addition, TGF β1 upregulates ANGPTL2 expression via the inhibition of miR-221 that negatively controls ANGPTL2 [49]. [score:8]
[1 to 20 of 1 sentences]
70
[+] score: 8
We employed a transgenic mouse mo del over -expressing microRNA-221 (TG221) [24], which was shown to be highly predisposed to the development of liver tumors and, most importantly, tumors exhibited a miRNA pattern similar to human HCC. [score:4]
For the treatment of liver cancer, the miR-221 transgenic strain (TG221), which is predisposed to the development of liver cancer, was employed [24]. [score:2]
In vivo mouse experimentsFor the treatment of liver cancer, the miR-221 transgenic strain (TG221), which is predisposed to the development of liver cancer, was employed [24]. [score:2]
[1 to 20 of 3 sentences]
71
[+] score: 8
Recent reports by Kotani et al. [18] demonstrated that the expression of two tumor-suppressive miRNAs, miR-128b and miR-221, was down-regulated in MLL-rearranged ALL relative to other types of ALL and was related to glucocorticoid resistance. [score:8]
[1 to 20 of 1 sentences]
72
[+] score: 8
Three miRNAs (miR-126-3p, miR-221 and miR-200c) were exclusively up-regulated in thymocytes of DBA-1/J strain, and three others (miR-let-7e, miR-100 and miR-19a*) were exclusively up-regulated in the DBA-2/J strain. [score:7]
To the best of our knowledge, only miR-181a and miR-221, from the interaction networks showed in this study, have been previously identified as playing a role in T lymphocytes [26], [54]. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
Conversely, knockdown of miR-221 and miR-22 in ERα -negative MDA-MB-468 partially restored ERα protein expression and increased tamoxifen -induced apoptosis [212]. [score:4]
Two miR-221 and miR-222 seed elements were identified in the 3’UTR of ERα and transfection of miR-221 and miR-222 suppressed ERα protein, but not mRNA in ERα positive MCF-7 and T47D cells. [score:3]
miR-221/222 was recently reported to be higher in ERα negative than ERα positive breast cancer cell lines and human breast tumors [212]. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 8
For example, the expression levels of miRNA-181a, miR-155, miR-150, miRNA-221, miR-106a, miRNA-221, miR-146a and miR-146b were increased in OVA -induced mouse mo del of asthma [15– 18]; the miR-126, miR-145 and miR-106a expression levels were increased in house dust mite (HDM) -induced experimental asthma mo del [19– 21]; and miR-21 was up-regulated in lung-specific interleukin (IL)-13 -induced asthma mo del [22]. [score:8]
[1 to 20 of 1 sentences]
75
[+] score: 8
Upregulated genes included miR-9, which was previously shown to inhibit cancer metastasis by suppressing e-cadherin [30], and miR-221 [31], which contributes to liver tumorigenesis. [score:8]
[1 to 20 of 1 sentences]
76
[+] score: 7
MiRNA-122 and miRNA-221 were oppositely expressed in HUH7 and HLE cells, while miRNA-133 was not significantly detected. [score:3]
For this purpose, we exploited the fact that HUH7 and HLE cell lines express opposite levels of miRNA-122 (32) and miRNA-221 (33). [score:3]
In contrast luciferase induction was detected only in cells transfected with pRILES/122T, pRILES/133T and pRILES/221T in presence of the corresponding miRNA-122, miRNA-133 and miRNA-221 (Figure 2C–E). [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 7
MicroRNA, specifically miR-221 and miR-222-3p have been established as regulators of PTEN expression [19], [38]. [score:4]
In a previous report, Zhao et al. have demonstrated that ERα is suppressed by miR-221 and miR-222-3p [17]. [score:3]
[1 to 20 of 2 sentences]
78
[+] score: 7
Some miRNAs with distinct sex-biased patterns in expression, such as miR-133a and miR-221, have been implicated in adipogenesis [28, 52]. [score:3]
Expression was quantified using ΔCt for miR-221 or standard curve for miR-133a, miR-192, and miR-205. [score:3]
miR-221-3p, which is located on the X chromosome and has been previously associated with obesity and adipogenesis [28], showed no sex or sex chromosome difference in mice fed a chow diet (Additional file 5: Figure S1D). [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 7
We also assessed the expression levels of two miRNAs previously associated with lung disease (mmu-miR-146a-5p and mmu-miR-221) [24, 25], but could not detect differential expression in this study (data not shown). [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
Other miRNAs from this paper: mmu-mir-150, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-29c
Liu Z, et al. found that inhibition of miR-221 expression obviously induced apoptosis and inhibited growth and invasion in Hepatocellular carcinoma HepG2 cells [34]. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
miR-522, miR-139-3p, miR-520c-5p, miR-518d-5p, miR-146b-5p, miR-34a, miR-526a, miR-193a-3p, miR-221, miR-4674 were significantly upregulated and miR-760 was downregulated in ECSCs (Figure 2A). [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
A recent study showed that miR-221&222 overexpresses in aggressive hepatocarcinoma cells regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation [32]. [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 7
Other miRNAs from this paper: mmu-mir-155, mmu-mir-222
During the adipogenic program of both immortalized and primary hMSCs, the expression of miR-155, miR-221, and miR-222 decreased, however, ectopic expression of these miRNAs significantly inhibited adipogenesis [7]. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
miRNAs have been reported to be involved in regulation of angiogenesis through different mechanisms, including miR-214 reducing the secretion of the hepatoma-derived growth factor in human hepatoma [43], miR-221 regulating andiogenin and CXCL16 expression levels [44], and miR-29b reducing the expression of matrix metalloproteinase 2 [45]. [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
Finally, down-regulation of microRNAs (miR-122 and miR-29), and up-regulation of miR-34a, miR-155, and miR-221 occur in methyl -deficient liver [72]. [score:7]
[1 to 20 of 1 sentences]
86
[+] score: 7
Inhibition of function of either of these two miRNAs in BM cells by using their agonist oligo increased pDC/cDC ratio, which suggests that mir-221/mir222 may promote pDC development [23]. [score:4]
miR-221 and miR-222 are more highly expressed in cDCs than in pDCs. [score:3]
[1 to 20 of 2 sentences]
87
[+] score: 7
In addition to our results that identify miR-22 as a negative regulator of the DC transcription factor IRF8 by controlling Irf8 mRNA abundance, recent studies by others have shown that miR21, miR34a, miR-221 and miR-222 are differentially expressed in pDCs and cDCs, and play a role in DC differentiation via inhibitory functions on Jag1, Wnt1, and possibly the pDC master regulator Tcf4 (E2–2), respectively [62]– [66]. [score:7]
[1 to 20 of 1 sentences]
88
[+] score: 6
It is plausible that mir-125a-5p indirectly regulates VEGF and eNOS expression, similar to the mir-221/222 mechanism that regulates eNOS in ECs (Rippe et al., 2012). [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
It would be interesting to determine whether ADAMTS-4 may induce mechanisms previously described to downregulate neurotrophic factor production, for instance, by modulating the nuclear translocation of transcription factors such as the histone deacetylase HDAC6 (negative regulator) [35], CREB (cAMP response element -binding protein) or NF-κB (nuclear factor kappa B) (positive regulators) [36– 38], and/or by modulating micro -RNAs (miR) production such as miR-15a, miR-132, miR-134, miR-221 or Let-7 miR [39– 41]. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
On the basis of the opposite functions of CBX7, as oncogene and oncosuppressor, it was not surprising to find that CBX7 was able to regulate in opposite sense miRNAs that have recognized to have oncogenic functions, such as miR-199 (negatively regulated) and miR-155, miR-221 and miR-222 (positively regulated). [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
Among these dysregulated miRNAs, miR-378 was downregulated while miR-221 expression increased in aHSCs compared to qHSCs, consistent with previous reports 18, 19 and demonstrating the reliability of our microarray data. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
We previously found that, using microRNA array analysis, miR-221/222 expression was upregulated in a fibrosis progression–dependent manner in human livers that are chronically infected with HCV [25]. [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
For instance, the oncogenic miR-17/92 and miR-221/222 clusters can downregulate CDK inhibitors and Rb family members, leading to the activation of Cyclin/CDK complexes and cell cycle progression [56- 59]. [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 6
To identify the specific microRNA targeting GSK3 β, we used a neuronal cell line to test the regulatory effects of several potential candidates based on the 3′-untranslated region (3′-UTR) sequence of GSK3 β and previous studies, including microRNA-23b (miR-23b), microRNA-28a (miR-28a), microRNA-221 (miR-221), microRNA-135b (miR-135b), microRNA-101a (miR-101a), microRNA-26a (miR-26a) and microRNA-603 (miR-603). [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
In contrast RNA levels of Foxo3 and Foxo4, transcription factors which regulate p27 expression, were both increased, and miR-221, which represses p27 expression, was increased [30– 33]. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
These disease -associated miRNAs are also listed in Table 1. In addition, we detected a trend in the up-regulation of the following miRNAs, although the values were not consistent enough to meet the criteria that 5 of the 6 infected mice show a fold change >1.75; miR-200a, miR-200b, miR-26a, miR-186, miR-331-3p, miR-152, miR-221. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 6
Out of 12 miRNA families that were predicted to target the PRKAG1 sense promoter in both human and mouse, nine (miR-718, miR-1224, miR-188, miR-346, miR-296, miR-671, miR-221, miR-1306, miR-506) can form highly stable duplex structures with their target sites (MFE ≤ −30 kcal/mol) in both organisms. [score:5]
Some miRNAs in six families (miR-34, miR-188, miR-671, miR-340, miR-221, miR-1306) were shown by at least one experimental study to be nuclear dominant. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 6
Also, miR-153 in the Udown group together with miR-221, miR-384-5p, and miR-30a in the Uup group targeted Nfat. [score:3]
miR-153 in the Udown group targeted Nfatc3, along with miR-221, miR-384-5p, and miR-30a in the Uup group. [score:3]
[1 to 20 of 2 sentences]
99
[+] score: 6
Ets-1 targeted by microrna-221 regulates angiotensin II -induced renal fibroblast activation and fibrosis. [score:3]
MicroRNA-221/222 regulate ox-LDL -induced endothelial apoptosis via Ets-1/p21 inhibition. [score:3]
[1 to 20 of 2 sentences]
100
[+] score: 6
In this study, we identified a focused group of 8 miRNAs comprising has-miR-494, has-miR-29b-3p, has-miR-551a, has-miR-606, has-miR-876-5p, has-miR-30c-5p, has-miR-221-3p, and has-miR-150-5p, which demonstrated an expression pattern in patients infected with EV71 as distinct from the controls. [score:3]
The expression of has-miR-494, has-miR-29b-3p, has-miR-876-5p, and has-miR-30c-5p was more abundant in the blood serum of patients with mild or severe EV71 infections, whereas has-miR-551a, has-miR-606, has-miR-221-3p, and has-miR-150-5p were less abundant in the blood serum of patients with mild or severe EV71 infections than they were in the blood serum of healthy controls (Fig. 2). [score:3]
[1 to 20 of 2 sentences]