sort by

229 publications mentioning mmu-mir-124-1 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-124-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 502
Although our current analysis already revealed a significant overlap between Ezh2 target genes and the miR-124 up-regulated gene list, more Ezh2 target genes could be up-regulated by persistent miR-124 overexpression in differentiating neurons. [score:13]
Six of the miR-124-up-regulated Ezh2 target genes were further validated by RT-qPCR, and their expression levels were down-regulated by simultaneous expression of miR-124-resistant Ezh2 (Fig. 1 D). [score:13]
A small fraction of Ezh2 target genes with predicted miR-124 target sites could potentially be down-regulated by miR-124 (81 genes; 7 non-CNS and 74 CNS-specific), but only 12 CNS-specific genes were down-regulated in miR-124 -overexpressing cells, which is not statistically enriched. [score:13]
Importantly, miR-124-specific antisense inhibitor restored Ezh2 expression in differentiating P19 cells, whereas disruption of the putative miR-124 target site in exogenously expressed Ezh2 3′-UTR abolished the miR-124 -mediated down-regulation and led to reduced neuronal differentiation. [score:12]
The Venn diagram shows that 414 genes are up-regulated (FC ≥1.5 and p < 0.001) by miR-124 expression, 194 of which are CNS-specific genes, and 52 of them are Ezh2 target genes that are significantly enriched in the miR-124-up-regulated CNS-specific gene list, as determined by Fisher's exact test (p = 7.03 × 10 [−5]). [score:11]
Overexpression of miR-124 in Neuroblastoma Up-regulates Neuron-specific Ezh2 Target GenesTo better understand miR-124 functions in the neural lineage, we transfected three N2a cell populations expressing distinct blends of Argonaute paralogs (N2a-WT, N2a-Ago1, and N2a-Ago2; see Ref. [score:10]
To examine the extent of miRNA -dependent regulation of Ezh2 expression, we co-expressed an EGFP-Ezh2 3′-UTR reporter construct with each of the 30 miRNAs (including miR-124) predicted to interact with Ezh2 3′-UTR by five miRNA target prediction algorithms (Target Scan, PicTar, miRBase, miRNA. [score:10]
FACS analysis showed that the miR-124 -induced down-regulation of the EGFP-Ezh2 3′-UTR expression exceeded that of most other miRNAs and was comparable with the effects induced by miR-26a and miR-101 (Fig. 2, A and B), two miRNAs previously reported to regulate Ezh2 expression and contribute to tumorigenesis (42, 43). [score:9]
Indeed, induction of Ezh2 expression following RA treatment led to dramatic down-regulation of miR-124 expression in differentiating P19 cultures (data not shown). [score:8]
Because, unlike Ezh2, the Suz12 and Eed 3′-UTRs lacked putative miR-124 target sites, we hypothesized that miR-124 may directly down-regulate Ezh2 during neuronal differentiation, whereas Suz12 and Eed are probably regulated by distinct post-transcriptional mechanisms. [score:8]
G, Ezh2 protein expression was up-regulated upon miR-124 inhibitor treatment. [score:8]
Conversely, the Ezh2 transgene with the Ezh2 3′-UTR containing the miR-124 target site (Ezh2 WT 3′-UTR) failed to up-regulate Ezh2 protein level and cause this inhibitory effect (Fig. 5, B and C). [score:8]
F, down-regulation of miR-124 expression level by inhibitor was confirmed by Northern blot analysis. [score:8]
To this end, we first expressed miR-124 in mouse neuroblastoma Neuro2a (N2a) cells and showed that this treatment was sufficient to up-regulate a significant fraction of neuron-specific Ezh2 target genes. [score:8]
Underscoring the biological relevance of these regulatory events, miR-124 is naturally expressed in neurons but not in astrocytes (15), and it is predicted to directly down-regulate a number of astrocyte-enriched genes (22, 39). [score:8]
In line with previous studies suggesting that this miRNA may directly regulate hundreds distinct mRNA targets, miR-124 consistently down-regulated 1255 genes (≥1.5-fold, p < 0.001; t test). [score:8]
Overexpression of miR-124 in Neuroblastoma Cells Up-regulates Neuron-specific Ezh2 Target Genes. [score:8]
Their expression is further down-regulated by simultaneous expression of miR-124-resistant Ezh2. [score:8]
Non-CNS-specific genes (634 genes) are probably associated with silent chromatin in neuronal progenitors and therefore could not be up-regulated simply by miR-124 -mediated Ezh2 down-regulation. [score:7]
C, a significant fraction of miR-124-up-regulated genes are direct target genes of Ezh2. [score:7]
Mutations of the miR-124 target site in Ezh2 3′-UTR specifically abolish miR-124 -mediated down-regulation of the luciferase reporter. [score:7]
However, miR-124 is likely to be the major regulator of Ezh2 expression in differentiating neurons, because it is the most abundant miRNA in the brain (12) and is also highly up-regulated in differentiating P19 cells (20 times for miR-124 versus 2 times for miR-20 and miR-26a) (62). [score:7]
Although the amount of miR-124 was significantly reduced by treatment with a high dose inhibitor, the remaining miR-124 was still sufficient to partially suppress Ezh2 expression. [score:7]
FIGURE 2. miR-124 regulates Ezh2 expression by targeting Ezh2 3′-UTR. [score:6]
F–H, miR-124 inhibitor up-regulates endogenous Ezh2. [score:6]
Other than miR-124, miR-26a, and miR-101, six additional miRNAs consistently down-regulated the expression of Ezh2 3′-UTR reporter genes (Fig. 2 D). [score:6]
Thus, it is possible that the stimulatory effect of miR-124-resistant Ezh2 on astrocyte generation observed in our study might be caused by Ezh2 -mediated down-regulation of miR-124 expression. [score:6]
Moreover, overexpression of miR-124, as well as miR-26a and miR-101, caused a noticeable down-regulation of endogenous Ezh2 protein level in HEK293T cells (Fig. 2 C). [score:6]
Notably, disruption of the predicted evolutionarily conserved miR-124 target site in the Ezh2 3′-UTR (Fig. 2 E) by substitution or deletion (32, 44) abolished the miR-124 -mediated down-regulation effect (Fig. 2 F). [score:6]
Thus, down-regulation of Ezh2 protein expression by miR-124 is critical for efficient neuronal differentiation. [score:6]
miR-124 Down-regulates Expression of Ezh2 but Not Other PRC2 Components during Neuronal Differentiation. [score:6]
During the neurogenic phase, the H3K27-specific demethylase Jmjd3 is up-regulated, leading to derepression of neuron-specific genes, possibly including miR-124 (58), that can now dampen Ezh2 expression. [score:6]
On the other hand, the overlap between the corresponding subsets of miR-124-down-regulated CNS-specific genes and Ezh2 target genes could be explained by random sampling (p = 0.56; Fisher's exact test) (data not shown). [score:6]
FIGURE 3. miR-124 down-regulates Ezh2 expression during P19 neuronal differentiation. [score:6]
FIGURE 1. miR-124 up-regulates neuron-specific Ezh2 target genes. [score:6]
To address functional significance of miR-124 -induced Ezh2 down-regulation during neuronal differentiation, we generated several transgenic P19 lines stably expressing doxycycline-inducible Ezh2 mRNAs with various 3′-UTRs (Fig. 4, A and B). [score:6]
35 for details) with either a synthetic siRNA-like duplex designed to deliver mature 22-mer miR-124 or a non -targeting siRNA control and analyzed the samples by Agilent gene expression microarrays. [score:5]
Indeed, we found that miR-124 expression was inversely correlated with Ezh2 expression during P19 neuronal differentiation (Fig. 3 C). [score:5]
Although we show here that miR-124 represents one of the most potent miRNA regulators of Ezh2 expression, our data are also consistent with the possibility of combinatorial regulation by miRNA. [score:5]
Interestingly, 414 genes were consistently up-regulated (≥1.5-fold, p < 0.001; t test) in miR-124 -transfected N2a cells, presumably as a result of indirect effects (Fig. 1 B). [score:5]
Interestingly, overexpression of miR-124 in hepatocellular carcinoma cells, where it is normally present at negligibly low levels, has been shown to reduce Ezh2 expression (32). [score:5]
A, expression of miR-124 uncontrollable Ezh2 (Ezh2 or Ezh2 Sub 3′ UTR) inhibited neuronal differentiation. [score:5]
miR-124 may regulate hundreds and possibly thousands of distinct target genes (18, 20 – 23). [score:4]
D, selected genes from the miR-124-up-regulated CNS-specific gene list were validated by RT-qPCR. [score:4]
To examine whether physiological levels of miR-124 could regulate Ezh2 expression during neuronal differentiation, we took advantage of the retinoic acid (RA) -induced P19 embryonic carcinoma in vitro differentiation mo del (45, 46). [score:4]
However, whether miR-124 contributes to down-regulation of Ezh2 expression during neurogenesis has not been investigated. [score:4]
The data sets were normalized using RobiNA (36), and genes showing consistent miR-124 -induced up- or down-regulation were shortlisted in Excel using appropriate -fold change and t test p value cut-offs. [score:4]
We have previously shown that miR-124 also targets mRNA of Ptbp1 (polypyrimidine tract -binding protein), a global regulator of pre-mRNA splicing (11). [score:4]
Of these, only miR-20a, miR-26a, and miR-124 are known to be up-regulated in differentiating P19 cells (62), which predicts possible synergistic effects of these three miRNAs on Ezh2 abundance. [score:4]
Black star, mutation in the miR-124 target site of wild-type 3′-UTR (Ezh2 Sub 3′ UTR). [score:4]
FIGURE 5. miR-124-regulated Ezh2 expression is important for P19 neuronal differentiation. [score:4]
Notably, when we compared the list of the miR-124-up-regulated central nervous system (CNS)-specific genes (39) with genes known to be regulated by Ezh2 in stem cells (40), a highly significant overlap was detected (p = 7.03 × 10 [−5]; Fisher's exact test) (Fig. 1 C). [score:4]
A similar effect of miR-124-regulated Ezh2 expression on neurogenesis was also observed in differentiating embryonic mouse neural stem cells. [score:4]
We concluded that miR-124 is among the most efficient miRNA regulators of Ezh2 expression. [score:4]
These results suggested that miR-124 might regulate extensive subsets of genes by targeting Ezh2. [score:4]
The QuikChange site-directed mutagenesis kit (Stratagene) was used to destroy the miR-124 target site in Ezh2 3′-UTR (32). [score:4]
miR-124 -overexpressing N2a cell lines generated a distinctive gene expression pattern compared with non -transfected controls. [score:4]
miR-124 Is a Potent miRNA Regulator of Ezh2 Expression. [score:4]
We provide evidence that Ezh2 down-regulation by miR-124 in this context promotes neuronal and counters astrocyte-specific differentiation route. [score:4]
miR-124-regulated Ezh2 Expression Is Critical for Efficient Neuronal Differentiation. [score:4]
Our results suggest that miR-124 -dependent regulation of Ezh2 expression might be critical for a balanced production of astrocytes and neurons. [score:4]
miR-124 inhibitor was transfected into differentiating P19 cells at day 6 after the start of RA treatment. [score:3]
We further found that in P19 cells undergoing neuronal differentiation, the Ezh2 protein level was significantly reduced in an inverse correlation with increasing expression of mature miR-124. [score:3]
B, miR-124 targets Ezh2 3′-UTR. [score:3]
A–E, inverse expression patterns of PRC2 members and miR-124 during P19 neuronal differentiation. [score:3]
C, increased miR-124 expression level during P19 neuronal differentiation. [score:3]
miR-124 expression levels were determined by Northern blot, and U6 RNA served as a loading control. [score:3]
These results, however, suggested that Ezh2 is the only PRC2 member directly regulated by miR-124. [score:3]
The remaining 1242 CNS-specific genes may require additional CNS-specific activators that are not expressed just 24 h after miR-124 transfection. [score:3]
E, the miR-124 target site in Ezh2 3′-UTR is highly conserved among vertebrates. [score:3]
During neuronal differentiation, Ptbp1 expression is reduced by miR-124, which triggers a switch in alternative splicing patterns among a wide range of transcripts. [score:3]
The seeding region of the miR-124 target site in Ezh2 3′-UTR was either mutated by deletion (Del 3′ UTR) or substitution (Sub 3′ UTR) or left intact (WT 3′ UTR). [score:3]
The miR-124-specific inhibitor has been tested and published previously (11). [score:3]
To better understand miR-124 functions in the neural lineage, we transfected three N2a cell populations expressing distinct blends of Argonaute paralogs (N2a-WT, N2a-Ago1, and N2a-Ago2; see Ref. [score:3]
Here we expand this list by showing that in cells undergoing neural differentiation (P19 as well as embryonic mouse neural stem cells), miR-124 represses the expression of a critical epigenetic factor, lysine methyltransferase Ezh2. [score:3]
We found that the efficiency of astrocyte differentiation was significantly enhanced in P19 cells expressing the miR-124-resistant Ezh2 Sub 3′-UTR transgene but not the miR-124-repressible Ezh2 WT 3′-UTR transgene (Fig. 6, A and B). [score:3]
A similar astrogenesis-promoting effect was observed in cultured embryonic mouse neural stem cells expressing miR-124-resistant Ezh2 as well (Fig. 6 D). [score:3]
Moreover, the efficiency of P19 neuronal differentiation was significantly reduced by the Ezh2 Sub 3′-UTR transgene lacking the miR-124 target site in its Ezh2-derived 3′-UTR. [score:3]
N2a cells were chosen because they express endogenous miR-124 at negligibly low levels (11, 35). [score:3]
Neuron-enriched miRNA miR-124 provides a compelling example of a non-coding RNA modulating cellular gene expression at multiple levels (23). [score:3]
It is therefore difficult to achieve more profound changes in Ezh2 protein levels through treatment with miR-124 inhibitor. [score:3]
A, expression of miR-124 uncontrollable Ezh2 (Ezh2 or Ezh2 Sub 3′ UTR) promotes astrocyte differentiation. [score:3]
Thus, our results implicate Ezh2 as an important miR-124 target in the context of neuronal differentiation. [score:3]
Analysis of this subset by gene set enrichment analysis (37, 38) showed a dramatic overrepresentation of predicted miR-124 targets (p = 0; data not shown). [score:3]
Zheng F. Liao Y. J. Cai M. Y. Liu Y. H. Liu T. H. Chen S. P. Bian X. W. Guan X. Y. Lin M. C. Zeng Y. X. (2012) The putative tumour suppressor microRNA-124 modulates hepatocellular carcinoma cell aggressiveness by repressing ROCK2 and EZH2. [score:3]
F, miR-124 target sites in Ezh2 3′-UTR was analyzed by luciferase reporter. [score:3]
Ezh2 Regulation by miR-124 Balances Neurogenesis Versus Astrogenesis. [score:2]
Ponomarev E. D. Veremeyko T. Barteneva N. Krichevsky A. M. Weiner H. L. (2011) MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-α-PU. [score:2]
Interestingly, however, knock-out of just the miR-124-1 gene in the mouse resulted in visible reduction of mature miR-124 levels, defective neuronal survival, and axonal outgrowth as well as smaller brain size (19). [score:2]
Collectively, these studies demonstrate that miR-124 regulates several molecular pathways critical for proper progression of neuronal differentiation. [score:2]
Loci Positions of miR-124 promoter Positions of Pre-miR-124 Suz12 binding sites Other transcription factors or histone modification associated with miR-124 loci mmu-mir-124-1 chr14:63540450–63546275 chr14:63544772–63544848 (+) chr14:63540776–63544525 Oct4 Nanog 3meH3K27 mmu-mir-124-2 chr3:17986635–17986835 chr3:17987829–17987903 (+) chr3:17985751–17988075 Oct4 Sox2 Nanog Tcf3 3meH3K27 mmu-mir-124-3 chr2:180819000–180825000 chr2:180823445–180823520 (+) chr2:180820551–180823275 Oct4 3meH3K27 Although further work will be needed to address the miR-124-Ezh2/PRC2 cross-regulation mo del, the results of our preliminary studies are consistent with this possibility. [score:2]
The predicted miR-124 binding site was mutated by base pair changes using DpnI -mediated site-directed mutagenesis (Stratagene). [score:2]
H, Suz12 protein level was not altered upon miR-124 inhibitor treatment, whereas Eed protein level was below the detection limit of the Western blot assay. [score:2]
Cheng L. C. Pastrana E. Tavazoie M. Doetsch F. (2009) miR-124 regulates adult neurogenesis in the subventricular zone stem cell niche. [score:2]
Visvanathan J. Lee S. Lee B. Lee J. W. Lee S. K. (2007) The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development. [score:2]
Another recent study showed that miR-124 may prevent the activation of microglia, immune cells residing in the central nervous system (16). [score:1]
To determine whether the miR-124/Ezh2 circuitry could control the choice between the two differentiation scenarios, we followed an established P19 astrogenesis protocol (50) and allowed transgenic P19 cells to differentiate for 12 days. [score:1]
miR-124 is derived from three independent genes (miR-124-1, miR-124-2, and miR-124-3) contributing to the increased mature miR-124 levels during neuronal differentiation (4, 17, 18). [score:1]
It is therefore possible that Ezh2 controls miR-124 levels in stem cells, synergizing with the repressive effect of REST (57). [score:1]
To test this prediction, we disrupted the activity of endogenous miR-124 with a miR-124-specific locked nucleic acid antisense oligonucleotide in differentiating P19 cultures (47) (Fig. 3 F). [score:1]
The levels of miR-124 and PRC2 members were analyzed at day 10. [score:1]
miR-124 has been shown previously to promote neurogenesis and hinder gliogenesis using an in vitro differentiation mo del (48). [score:1]
Differentiated P19 cells (day 6) were seeded in 6-well plates at 3 × 10 [5] cells/well in 2 ml of antibiotic-free medium and transfected with 1, 5, or 30 pmol/ml miR-124 locked nucleic acid antisense oligonucleotide (Exiqon) using Lipofectamine 2000 (Invitrogen). [score:1]
Hierarchical clustering of the microarray data suggested that all three cell populations responded to miR-124 in a largely similar manner (Fig. 1 A). [score:1]
Alignment of the predicted miR-124 binding site in Ezh2 3′UTR of different species is shown (Mmu, Mus musculus; Hsa, Homo sapiens; Rno, Rattus norvegicus; Ocu, Oryctolagus cuniculus; Ptr, Pan troglodytes; Cfa, Canis familiaris; Oga, Otolemur garnettii; Mml, Macaca mulatta; Eca, Equus caballus; Bta, Bos taurus). [score:1]
Interestingly, examination of published genomic maps of the Ezh2-specific 3meH3K27 modifications suggests that promoter regions of all three mouse miR-124 genes are associated with this repressive mark as well as Suz12, a component of the PRC2 complex, in ES cells (Table 2) (52). [score:1]
Notably, Ascl1 is one of the genes consistently derepressed by miR-124 in N2a neuroblastoma cells (Table 1), and our future studies will determine the functional significance of this effect. [score:1]
This hypothetical double -negative feedback between miR-124 and Ezh2/PRC2 would be similar to the previously reported relationship between miR-124 and SCP1/REST (26). [score:1]
One of the most abundant and perhaps best studied miRNAs in the brain is miR-124 (12 – 16). [score:1]
Makeyev E. V. Zhang J. Carrasco M. A. Maniatis T. (2007) The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. [score:1]
A1, Argonaute-2 kinase-dead/Argonaute-1 reconstituted; A2, Argonaute-2 kinase-dead/Argonaute-2 reconstituted; WT, wild type; NT, non -transfected; 22, 22-mer miR-124 -transfected. [score:1]
Hierarchical clustering analysis (uncentered Pearson's correlation) of 16 samples and 24,288 genes separated untransfected samples from miR-124 -transfected ones. [score:1]
These findings were further confirmed by a secondary screen with a luciferase Ezh2 3′-UTR reporter co -transfected with miR-124 or several other high scoring miRNA candidates (Fig. 2 D). [score:1]
In addition to its role in balancing neurogenesis versus astrogenesis, the miR-124/Ezh2 circuitry may function in other biological scenarios. [score:1]
[1 to 20 of 114 sentences]
2
[+] score: 427
In this regard, the bacterial pathogen (BCG) triggers TLR signaling activation, and augments MyD88 expression, which in turn induces miR-124 expression, subsequently the miR-124 post-transcriptionally down-regulated the MyD88 protein expression via directly targeting its mRNA and other targets in TLR signaling cascade, resulting in an attenuation of MyD88 -dependent TLR signaling activity, and a substantial reduction of pro-inflammatory cytokine and/or chemokine production. [score:15]
During the course of infection, the activated TLR signaling components and their down-stream target genes, particularly MyD88, are capable of inducing miR-124 expression, which in turn inhibits TLR signaling by directly targeting multiple components of the TLR pathway. [score:10]
The overexpression of MyD88 was accompanied by an increase in miR-124 transcription, and the inhibition of MyD88 expression was in tandem with a decrease in miR-124 expression (Figure 8B). [score:9]
Over expression of miR-124 was linked to the suppression of inhibitory member of apoptosis-stimulating protein of p53 (iASPP), which subsequently led to an increased expression of NF-κB (p65) [29], [30]. [score:9]
We showed that miR-124 was elevated in an alveolar epithelial cell line (A549 cells) and murine lungs upon BCG infection; the introduction of miR-124 mimic or inhibitor resulted in a down-regulation and up-regulation of BCG -induced TLR signaling proteins and pro-inflammatory factors, respectively. [score:9]
We reasoned that miR-124 was capable of targeting multiple components of the TLR signaling cascade, and targeting any of components might functionally impact on the expression of its down-stream target genes. [score:9]
B: miR-124 transcription was significantly elevated in cells overexpressing MyD88 or infected with BCG, but dramatically down-regulated when MyD88 expression was silenced by siRNA. [score:8]
Interestingly, its expression was down-regulated in breast cancer specimens and cell lines, and enforced expression of miR-124 showed a reduction in cell motility and invasion in human breast cancer cells [28]. [score:8]
miR-124 mimic significantly inhibited IL-6 and TNF-α expressions in both non-infected (A, C) and BCG infected (B, D) cells, and inhibition of miR-124 expression significantly elevated both cytokines, compared to control groups. [score:8]
As such, targeting of TLR6 by miR-124 might lead to decreased expression of down-stream targets of the TLR signaling cascade, including MyD88 and TRAF6, as well as inflammatory cytokines and chemokines, even in uninfected cells. [score:7]
The putative targets of miR-124 were predicted using the miRanda, PicTar and TargetScan target algorithms. [score:7]
represent the mean ± SD from three independent triplicated experiments (N = 9) in A, and from 8 animals in B. Since the TLR pathway is known to play a pivotal role in modulating the immune response against mycobacterial infection [32], the online computational miRNA target prediction tool, TargetScan, was used to identify potential targets of miR-124 within the TLR pathway. [score:7]
Additionally, the transfection of a miR-124 inhibitor decreased endogenous miR-124 by 2.5-fold and partially inhibited BCG -dependent induction of miR-124 expression (Figure 1A). [score:7]
Specifically, in a co-transfection experiment, miR-124 mimic reduced the luciferase activity of cells expressing pMIR-Report/TLR6 by 1.9-fold (Figure 2B), pMIR-Report/MyD88 by 2.1-fold (Figure 2C), pMIR-Report/TRAF6 by 2.0-fold (Figure 2D), and pMIR-Report/TNF-α by 2.3-fold (Figure 2E), relative to the negative control miRNA (miR-124 nc); whereas in cells co -transfected with a miR-124 inhibitor, luciferase activities were enhanced in cells expressing pMIR-Report/TLR6 by 2.5-fold (Figure 2B), pMIR-Report/MyD88 by 2.4-fold (Figure 2C), pMIR-Report/TRAF6 by 1.3-fold (Figure 2D), and pMIR-Report/TNF-α by 4.9-fold (Figure 2E) relative to miR-124 nc transfected cells. [score:7]
However, as is the case for MyD88, the introduction of miR-124 mimic and inhibitor resulted in a respectively decreased and increased expression of TRAF6 at both mRNA and protein levels regardless of BCG infection, although the non-infected cells only showed a moderate alteration of TRAF6 expression at mRNA level detected by a qRT-PCR assay (Figure 5). [score:6]
miR-124 -induced down-regulation of NF-κB expression. [score:6]
miR-124 expression was induced by BCG infection and repressed TLR signaling by directly targeting multiple signaling components in the TLR pathway, including TLR6, MyD88 and TRAF6. [score:6]
Treating patients suffering from immunosuppressed glioblastoma with the systemic administration of miR-124 or adoptive miR-124–transfected T-cell transfers resulted in a remarked up-regulation of IL-2, interferon (IFN)-γ, and TNF-α [31]. [score:6]
To validate whether miR-124 is able to directly target these molecules, dual-luciferase reporter vectors containing either wild-type 3′UTR sequence or the 3′UTR sequence with scrambled miR-124 seed sequences of TLR6, MyD88, TRAF6 or TNF-α mRNA were constructed (Figure 2A), and tested by co-transfecting the constructs with miR-124 mimic, inhibitor or control (Figure 2B–2E). [score:6]
miR-124 down-regulates MyD88 expression in A549 cells during BCG infection. [score:6]
Of interest, the transfection of miR-124 mimic or inhibitor was also moderately altered the expression of pro-inflammatory factors in BCG uninfected cells (p<0.05) (Figure 6– 7, Figure S1–S4 in File S1). [score:5]
The expression of IL-1α was detected by qRT-PCR in A549 cells transfected with pcDNA3.1, miR-124 nc, miR-124 mimic or miR-124 inhibitor followed by infected without (A) or with BCG (B). [score:5]
Both NF-κB mRNA and protein decreased in cells introduced with miR-124 mimic and decreased in cells transfected with miR-124 inhibitor, regardless of BCG infection, although the non-infected (naïve) cells showed only a moderate alteration in NF-κB expression at the mRNA level (Figure 6). [score:5]
3′ untranslated region (3′UTR) luciferase reporters and miR-124 target validation. [score:5]
The expression of IL-12α was detected by qRT-PCR in A549 cells transfected with pcDNA3.1, miR-124 nc, miR-124 mimic or miR-124 inhibitor followed by infected without (A) or with BCG (B). [score:5]
Furthermore, miR-124 transcription was elevated by overexpressing MyD88 and was decreased when MyD88 expression was silenced by MyD88 siRNA. [score:5]
Notably, the alteration in MyD88 expression was inversely correlated with the expression of miR-124. [score:5]
In addition, the expression of miR-124 was suppressed in several types of cancer, including medulloblastoma, glioma, oral squamous cell carcinomas and hepatocellular carcinoma [25]– [27]. [score:5]
Additionally, miR-124 expression was declined by 60% when endogenous MyD88 expression was repressed with siRNA. [score:5]
In addition, miR-124 was able to suppress the expression of the pro-inflammatory cytokine, TNF-α. [score:5]
These data suggest that miR-124 negatively regulates MyD88 dependent-TLR signaling by directly repressing downstream gene targets of TLR signaling. [score:5]
The expression of IL-8 was detected by qRT-PCR in A549 cells transfected with pcDNA3.1, miR-124 nc, miR-124 mimic or miR-124 inhibitor followed by infected without (A) or with BCG (B). [score:5]
Of note, although the infection of BCG augmented the expression of TLR6 (Figure 4) and TRAF6 (Figure 5) at protein levels, the expression levels were dramatically repressed in BCG-infected cells that were transfected with miR-124 mimic (p<0.05). [score:5]
The expression of IFN-γ was detected by qRT-PCR in A549 cells transfected with pcDNA3.1, miR-124 nc, miR-124 mimic or miR-124 inhibitor followed by infected without (A) or with BCG (B). [score:5]
Both MyD88 transcription and protein levels were decreased in cells introduced miR-124 mimic, and increased in cells transfected miR-124 inhibitor regardless of BCG infection; however, non-infected cells showed only a moderate alteration of MyD88 mRNA expression. [score:5]
Intriguingly, miR-124 did not alter TLR6 expression at an mRNA level; however, TLR6 protein decreased in both non-infected and BCG infected cells transfected with miR-124 mimic, despite miR-124 mimic and inhibitor only moderately altered TLR6 protein in non-infected cells (Figure 4). [score:5]
To investigate the biological significance of up-regulated miR-124 upon BCG infection, we examined the transcription of pro-inflammatory target genes down-stream of TLR signaling, including NF-κB, IL-6, TNF-α, IL-1α, IL-8, IL-12α and IFN-β in A549 cells. [score:4]
miR-124 regulates IL-8 expression. [score:4]
miR-124 regulates IFN-γ expression. [score:4]
Moreover, the introduction of miR-124 mimic or inhibitor to BCG-infected cells showed more significant alterations to pro-inflammatory cytokine expression compared to naïve cells. [score:4]
miR-124 regulates IL-12α expression. [score:4]
miR-124 regulates IL-1α expression. [score:4]
Furthermore, we showed that miR-124 transcription was inversely correlated with MyD88 expression, which suggested a negative feedback mechanism of regulation between miR-124 and MyD88. [score:4]
The mechanism of suppression was in part through miR-124 directly binding to multiple components of the TLR signaling pathway. [score:4]
miR-124 directly targets TLR signaling TLR6, MyD88, TRAF6 and TNF-α. [score:4]
In addition, the qRT-PCR results also revealed a significant down-regulation of the pro-inflammatory cytokines IFN-β (Figure S1 in File S1), IL-1α (Figure S2 in File S1), IL-8 (Figure S3 in File S1) and IL-12α (Figure S4 in File S1) in cells transfected with miR-124 mimic (p<0.05). [score:4]
The miR-124 levels were increased by 3.5-fold and 2.2-fold in MyD88 overexpression and BCG stimulation, respectively (Figure 8B). [score:3]
The net result of miR-124 expression is an attenuation of the mycobacteria-triggered inflammatory response. [score:3]
Thus, this study identifies a previously unrecognized negative feedback mechanism by which miR-124 expression is able to attenuate excessive inflammation in alveolar epithelial cells in the context of mycobacterial infection. [score:3]
Cells were transfected with miR-124 mimic, miR-124 inhibitor or miR-124 control and pMIR-Report/TLR6 containing wild type or mutant 3′UTR sequence (B), pMIR-Report/MyD88 containing wild type or mutant 3′UTR sequence (C), pMIR-Report/TRAF6 containing wild type or mutant 3′UTR sequence (D) or pMIR-Report/TNF-α containing wild type or mutant 3′UTR sequence (E). [score:3]
0092419.g007 Figure 7 A549 cells were transfected with pcDNA3.1, miR-124 mimics, miR-124 inhibitors or miR-124 nc, followed by BCG infection. [score:3]
Impacts of miR-124 on the expressions of TNF-α and IL-6.. [score:3]
Among the predicted targets of miR-124, we first experimentally confirmed interactions between miR-124 and TLR6, MyD88, TRAF6 and TNF-α, and showed that miR-124 significantly attenuates the immune response upon BCG stimulation by blocking components of the TLR pathway. [score:3]
We found that miR-124 was induced upon BCG stimulation, which in turn attenuated the inflammatory response by suppressing TLR signaling in epithelial cells. [score:3]
In contrast, the transfection of miR-124 inhibitor further elevated BCG -induced TLR6 and TRAF6 protein levels, in comparison with the BCG-infected control cells (Figure 4 and Figure 5). [score:3]
miR-124 targets TLR6 mRNA. [score:3]
miR-124 targets TRAF6 mRNA. [score:3]
miR-124 exerts its function by targeting multiple components of the TLR signaling pathway, including TLR6, MyD88, TRAF6 and TNF-α. [score:3]
For cells cultured in a 6-well dish, 20 µM of miR-124 mimic, miR-124 nc or miR-124 inhibitor was transfected. [score:3]
miR-124 targets MyD88 mRNA. [score:3]
The TLR6, myeloid differentiation factor 88 (MyD88), TNFR -associated factor 6 (TRAF6) and TNF-α, were identified as potential targets of miR-124 by virtue of possessing several seed sequences of miR-124 within the 3′UTR of their mRNA (Table S1 in File S1). [score:3]
In agreement with this notion, we found miR-124 was able to attenuate a pro-inflammatory response in alveolar epithelial cells by targeting multiple components of the TLR pathway, including the signaling adaptors of MyD88 and TRAF6, upon mycobacterial infection. [score:3]
represent the mean ± SD from three independent triplicated experiments (N = 9) in A, and from 8 animals in B. A: miR-124 transcript abundance in A549 cells transfected with miR-124 mimic, miR-124 inhibitor, or miR-124 nc in the presence or absence of BCG infection was determined by qRT-PCR. [score:3]
Taken together, these data suggest that miR-124 regulates TLR signaling by directly binding to the 3′UTRs of TLR6, MyD88, TRAF6 and TNF-α mRNAs. [score:3]
Potential targets of miR-124 in TLR signaling pathway predicted by bioinformatics tools. [score:3]
Intriguingly, the transfection of miR-124 mimic or inhibitor displayed moderate alterations of MyD88, TRAF6, NFκB, and several pro-inflammatory cytokine transcripts excluding TLR6, in both naïve and BCG-stimulated A549 cells. [score:3]
A549 cells were transfected with pcDNA3.1, miR-124 mimics, miR-124 inhibitors or miR-124 nc, followed by BCG infection. [score:3]
Infection with BCG induced miR-124 expression in A549 cells by about 3-fold over non-infected control cultures. [score:3]
In the absence of BCG stimulation, miR-124 mimic and miR-124 inhibitor moderately altered MyD88 abundance at both the mRNA and protein levels (Figure 3A). [score:3]
A 2-fold decrease and a 1.5-fold increase of MyD88 transcript abundance were observed in BCG infected-cells that transfected with miR-124 mimic and miR-124 inhibitor, respectively (Figure 3B). [score:3]
miR-124 represses TLR6 and TRAF6 expression in A549 cells during BCG infection. [score:3]
Based on the sequence of miR-124 in miRBase database (MIMAT0000422), miR-124 mimic (dsRNA oligonucleotides), negative control mimic (miR-124 nc) and miR-124 inhibitors (single- stranded chemically modified oligonucleotides) were synthesized in Ribobio Inc (Guangzhou, China). [score:3]
A549 cells were transfected with pcDNA3.1, miR-124 nc, miR-124 mimic or miR-124 inhibitor, followed by BCG infection. [score:3]
A: miR-124 transcript abundance in A549 cells transfected with miR-124 mimic, miR-124 inhibitor, or miR-124 nc in the presence or absence of BCG infection was determined by qRT-PCR. [score:3]
The specificity of miR-124 to each 3′UTR target was tested by co-transfecting 293T cells with a miR-124 mimic and the reporter constructs. [score:3]
Of note, as a tumor suppressing miRNA [34], less abundant endogenous miR-124 was detected in naïve A549 cells (http://www. [score:3]
Fold changes in miR-124 expression are relative to untreated cells. [score:3]
MyD88 induces miR-124 expression in A549 cells. [score:3]
On the other hand, the production of pro-inflammatory factors was significantly increased in cells transfected with miR-124 inhibitor, as compared with the controls (p<0.05) (Figure 6– 7, Figure S1–S4 in File S1). [score:2]
In an effort to identify miR-124 induction by TLR signaling, and in support of the notion that MyD88 could directly activate miR-124 transcription, we showed that MyD88 was able to induce miR-124 transcription upon BCG infection in A549 cells. [score:2]
These studies imply that miR-124 may performs an immunoregulatory role in epithelial cells. [score:2]
To gain insight into the underlying regulatory mechanism of miR-124 in the TLR pathway, we next interrogated whether MyD88 induced miR-124 transcription in A549 cells following BCG infection. [score:2]
miR-124 mediated attenuation of the BCG -induced inflammatory response by down -regulating the production of pro-inflammatory cytokines. [score:2]
Nevertheless, additional mechanisms in TLR signaling pathway are also likely to contribute to miR-124 -mediated immunoregulation in epithelial cells in response to mycobacterial infection, which needs to be further elucidated. [score:2]
Further work will be required to fully appreciate the underlying immunoregulatory mechanism of miR-124 in alveolar epithelial cells, and the alveolar macrophages using virulent Mtb strain in vitro and in vivo. [score:2]
Validation of potential targets of miR-124 by a dual-luciferase reporter assay. [score:2]
Mutations were introduced into the putative miR-124 binding sites to generate variant 3′UTRs (bottom sequence). [score:2]
In light of the above findings, we hypothesize that miR-124 performs a role in the regulation of the immune response in pulmonary epithelial cells during mycobacterial infection. [score:2]
This observation demonstrated a crucial crosstalk between miR-124 and MyD88 in modulate inflammatory response, and a feedback regulatory mechanism of miR-124/MyD88 in the alveolar epithelial cells against infection, suggesting that MyD88 is a critical mediator through which miR-124 exerts its biological functions in alveolar epithelial cells in response to mycobacterial infection. [score:2]
The results showed decreased luciferase activities in cells co -transfected with miR-124 mimic and all dual-luciferase reporters harboring the wild-type 3′UTR sequences, and enhanced luciferase activities in cells transfected with miR-124 inhibitor compared to cells transfected with miR-124 control (p<0.05). [score:2]
miR-124 is a miRNA enriched in the brain and plays a crucial role in gastrulation and neural development [23], [24]. [score:2]
In this report, miR-124 was identified as a negative regulator of immune responses in alveolar epithelial cells following mycobacterial infection. [score:2]
A mo del of the immunoregulatory role of miR-124 in alveolar epithelial cells following mycobacterial infection. [score:2]
However, the expression of these pro-inflammatory factors decreased to different extents in cells transfected with miR-124 mimic compared to the controls (p<0.05). [score:2]
Taken together, these data provide evidence that miR-124 represses TLR signaling during mycobacterial infection by down -regulating MyD88. [score:2]
A: Sequences of potential binding sites of miR-124 in the 3′UTR of TLR6, MyD88, TRAF6 and TNF-α mRNA (top sequences). [score:1]
Furthermore, in vivo study also exhibited a significant increased miR-124 transcript in the murine lung infected with BCG, in comparison with the PBS controls (p<0.05) (Figure 1B). [score:1]
0092419.g002 Figure 2 A: Sequences of potential binding sites of miR-124 in the 3′UTR of TLR6, MyD88, TRAF6 and TNF-α mRNA (top sequences). [score:1]
More importantly, we found that activated MyD88 was able to induce miR-124 transcription following BCG infection. [score:1]
These results suggest that MyD88 is needed to induce miR-124 transcription, which in turn, attenuates the immune response in A549 alveolar epithelial cells following BCG infection. [score:1]
Interestingly, both miR-124 and MyD88 transcripts were augmented in the cells infected with BCG (Figure 8). [score:1]
These findings suggest that MyD88 plays a critical role in mediating miR-124 -dependent biological functions in alveolar epithelial cells in response to a pathogen invasion. [score:1]
The changes in miR-124 transcripts were then assessed using qRT-PCR. [score:1]
These data suggest that miR-124 is involved in the immune response of A549 cells, as well as the murine lungs during BCG infection. [score:1]
No significant change in luciferase activity was detected in cells co -transfected with either miR-124 nc or with reporters containing a mutant 3′UTR (Figure 2B–2E). [score:1]
Indeed, miR-124 induction seen in BCG-infected cultures resembled cultures that had been transfected with miR-124 mimic (Figure 1). [score:1]
These data further indicate that miR-124 can modulate TLR signaling in alveolar epithelial cells upon mycobacterial infection. [score:1]
MyD88 activates miR-124 transcription in alveolar epithelial cells. [score:1]
0092419.g001 Figure 1 Mycobacterium bovis BCG induces miR-124 transcription in A549 alveolar epithelial cells and murine lungs. [score:1]
org), however its transcription was dramatically elevated following BCG stimulation, and an additive effect of transfection of miR-124 mimic and BCG infection on miR-124 transcript was also observed. [score:1]
BCG induces miR-124 transcription in A549 cells and murine lungs. [score:1]
Intriguingly, an additive level of miR-124 transcription, a 5.8-fold increase in miR-124 expression, was measured when the cells were transfected with mimic and infected with BCG, in comparison with the naïve control. [score:1]
Mycobacterium bovis BCG induces miR-124 transcription in A549 alveolar epithelial cells and murine lungs. [score:1]
These results suggest that miR-124 plays a crucial role in moderating the immune response in alveolar epithelial cells during an infection, such as by Mtb. [score:1]
Collectively, we identified miR-124 as a potent modulator of the immune response in alveolar epithelial cells in the present study. [score:1]
To this end, we interrogated the function of miR-124 in an in vitro infection system using a human alveolar epithelial cell line, A549 cells, and in vivo murine lungs, with Mycobacterium bovis Bacillus Calmette-Guerin (BCG). [score:1]
[1 to 20 of 116 sentences]
3
[+] score: 394
Our results showed that over -expression of miR-124 significantly suppressed the expression of LPS- or MPTP -induced upregulation and the activation of p-p65 in protein level. [score:10]
In conclusion, we found that miR-124 expression was downregulated in LPS -treated BV2 cells and could suppress the secretion of pro-inflammatory mediators by targeting the MEKK3/NF-κB signalling pathways. [score:10]
Finally, we found that the apoptosis and death of SH-SY5Y cells could be suppressed when the microglial activation was inhibited by the upregulation of miR-124 or the knockdown of MEKK3 in MCS. [score:9]
Taken together, our data suggest that miR-124 can inhibit neuroinflammation in the development of PD by regulating the MEKK3/NF-κB signalling pathways and implicate miR-124 as a potential therapeutic target for regulating the inflammatory response in PD. [score:8]
We further treated mice with MPTP and found that an increasing expression level of MEKK3 was evidenced in the SNpc, whereas we observed a similar result in a silencing MEKK3 gene study where MEKK3 expression level was also reduced by upregulation of miR-124 in vivo. [score:8]
It is interesting that we observed that upregulation of miR-124 could inhibit the expression of MEKK3 and p-p65 in vivo, which was consistent with in vitro results (Fig.   9b– f). [score:8]
Accordingly, considering the neuroprotective effect of miR-124 in other CNS diseases [19], miR-124 agomir or negative control was injected into the right lateral ventricle 2 days before MPTP treatment to upregulate the miR-124 expression in the midbrain. [score:8]
e, f The BV2 cells were transfected with miR-124 inhibitor or ctrl inhibitor, and the cells were harvested at 48 h. The relative expression of MEKK3 mRNA was evaluated using RT-qPCR (e), and the MEKK3 protein expression was studied using western blot analysis (f). [score:7]
Studies have demonstrated that miR-124 may alleviate neuron death in diverse types of neurodegeneration diseases, including Alzheimer’s disease, Parkinson’s disease, amyotrophic lateral sclerosis, and multiple sclerosis [16, 41]. [score:7]
Taken together, our data suggest that miR-124 can inhibit neuroinflammation that occurs in the development of PD and implicate miR-124 as a potential therapeutic target for regulating the inflammatory response in PD. [score:7]
Accordingly, MEKK3, an inflammation -associated protein that has been identified as a target of miR-124 in our study, is upregulated in the MPTP -induced PD mo del. [score:6]
Nevertheless, we observed that the transfection of miR-124 mimic to microglial cells could counter-regulate the MEKK3 upregulation induced by LPS in vitro, as miR-124 targeting MEKK3 was demonstrated by the luciferase reporter assay in our study. [score:6]
Brain-specific microRNA-124 (miR-124) expression is significantly downregulated in lipopolysaccharide (LPS) -treated BV2 cells and in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mo del of PD. [score:6]
MicroRNA-124 (miR-124) is highly expressed in the brain, with an abundance that is (more than 100 times) higher than that in other organs, and it plays a critical role in PD, which regulates apoptosis and autophagy in the MPTP mo del of PD by targeting Bim and loads nanoparticles to enhance brain repair in PD [16– 18]. [score:6]
In addition, miR-124 expression is downregulated in neurons from the MPTP -induced PD mo del [42]. [score:6]
a miR-124 expression in BV2 cells treated with different concentrations (0.1, 0.2, 0.5, and 1 μg/mL) of LPS for 24 h. b miR-124 expression in BV2 cells exposed to 1 μg/mL LPS for different durations (0, 1, 6, 12, and 24 h). [score:5]
The miR-124 mimics (miR10000134), control miRNA mimics (MIMAT0000295), miR-124 inhibitor (miR20000134), and control inhibitors (MIMAT0000039) were synthesised by RiboBio (Guangzhou, China) and were transfected into BV2 cells by using riboFECT™ CP (RiboBio) according to the manufacturer’s protocol. [score:5]
NS not significant In the anti-inflammatory role of over -expression of miR-124 or the knockdown of MEKK3 in activated microglia, as evidenced by our results in BV2 cells, we evaluated the potential modulation of the over -expression of miR-124 or the knockdown of MEKK3 as an anti-inflammatory and neuroprotective strategy. [score:5]
Furthermore, exogenous delivery of miR-124 could suppress MEKK3 and p-p65 expression levels and attenuate the activation of microglia in MPTP -treated mice. [score:5]
Consequently, exogenous delivery of miR-124 could inhibit the expression levels of MEKK3 and p-p65 in the SNpc of MPTP -treated mice. [score:5]
We used the TargetScan database (Whitehead Institute, Cambridge, MA, USA) to analyse the targets predicted for miR-124. [score:5]
Fig. 9Exogenous delivery of miR-124 could inhibit the expression of MEKK3 and p-p65 in the SNpc of MPTP -treated mice in vivo. [score:5]
Over -expression of miR-124 could effectively attenuate the LPS -induced expression of pro-inflammatory cytokines and promote the secretion of neuroprotective factors. [score:5]
In our study, we found that miR-124 was downregulated in the LPS-stimulated BV2 cells in a dose- and time -dependent manner, which is consistent with previous reports that miR-124 is a key regulator of microglial cell quiescence in the CNS [19]. [score:5]
Computational prediction via the TargetScan database revealed that highly and poorly conserved miR-124 (miR-124-3p) might target the 3′-UTR of MEKK3 (Fig.   4a). [score:5]
In addition, the mRNA expression levels of the pro-inflammatory cytokines iNOS, IL-6, and TNF-α were highly increased while the neuroprotective factors TGF-β1 and IL-10 decreased meaningfully when transfected with the miR-124 inhibitor (Fig.   2g– k). [score:5]
Meanwhile, we found no significant difference in the p-p65 levels of the pro-inflammatory cytokines regardless of transfection of miR-124 mimic or miR-124 inhibitor when the cells were pre -treated with MEKK3 siRNA, demonstrating that miR-124 regulates the LPS -induced secretion of pro-inflammatory cytokines and NF-κB in microglial cells, at least partly, through the regulation of MEKK3. [score:5]
As a result, we showed that the neurotoxic cytokines iNOS, IL-6, and TNF-α had strongly decreased mRNA levels following the over -expression of miR-124 (Fig.   2b– d), whereas TGF-β1 and IL-10, for which the production was decreased in the LPS -induced BV2 cells, had significantly increased mRNA levels with the over -expression of miR-124 (Fig.   2e, f). [score:5]
In particular, we considered that miR-124 could mediate the NF-κB signalling pathway by regulating the expression of MEKK3, which might be a therapeutic target in inflammatory responses. [score:5]
In addition, exogenous delivery of miR-124 could suppress MEKK3 and p-p65 expression and attenuate the activation of microglia in the substantia nigra pars compacta of MPTP -treated mice. [score:5]
Exogenous delivery of miR-124 could inhibit the expression of MEKK3 and p-p65 in the SNpc of MPTP -treated mice in vivo. [score:5]
Taken together, the over -expression of miR-124 could effectively suppress LPS -induced microglial activation. [score:5]
The downregulation of miR-124 in response to LPS stimulation suggested that miR-124 might be involved in the regulation of the microglial response to LPS. [score:5]
g– k BV2 cells were transfected with miR-124 inhibitor or control inhibitor for 48 h. The mRNA levels of pro-inflammatory cytokines iNOS (g), IL-6 (h), TNF-α (i), TGF-β1 (j), and IL-10 (k) were determined using RT-qPCR following a 24-h incubation with LPS. [score:5]
To assess this issue, the over -expression of miR-124 in microglia was examined, and the transfection efficacy of miR-124 mimics and miR-124 inhibitor was assessed using RT-qPCR (Fig.   2a). [score:5]
Fig. 1Brain-specific miR-124 was downregulated in the LPS-stimulated BV2 cells. [score:4]
Over -expression and knockdown studies of miR-124 were performed to observe the effects on MEKK3/NF-κB signalling pathways, and the induction of pro-inflammatory and neurotoxic factors was assessed. [score:4]
3′-UTR 3′ untranslated regions CNS Central nervous system DA Dopaminergic GAPDH Glyceraldehyde-3-phosphate dehydrogenase HtrA2 HtrA serine peptidase 2 IL-10 Interleukin-10 IL-6 Interleukin-6 iNOS Inducible nitric oxide synthase IOD Integrated optical density LPS Lipopolysaccharide MCS Microglial culture supernatant MEKK3/MAP3K Mitogen-activated protein kinase kinase kinase MEKK3-si MEKK3 small interfering RNA miR-124 MicroRNA-124 miRNAs MicroRNAs MPTP 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine NC Negative control NF-κB Nuclear factor of kappaB p65 RelA PD Parkinson’s disease p-p65 Phosphorylation of NF-κB p65 RIPA Radioimmunoprecipitation assay ROS Reactive oxygen species RT-qPCR TGF-β1 Transforming growth factor beta 1 TH Tyrosine hydroxylase TNF-α Tumour necrosis factor alpha Not applicable. [score:4]
Parkinson’s disease MicroRNA-124 Microglia MEKK3 NF-κB Parkinson’s disease (PD) is one of the most common neurodegenerative diseases worldwide, and its clinical features are characterised by the progressive degeneration of midbrain dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc) [1]. [score:4]
Fig. 6Over -expression of miR-124 or knockdown of MEKK3 could prevent neuronal death and apoptosis following microglial activation in the MCS transfer mo del. [score:4]
Over -expression of miR-124 or knockdown of MEKK3 could prevent neuronal death and apoptosis following microglial activation in the MCS transfer mo del. [score:4]
Brain-specific miR-124 was downregulated in the LPS-stimulated BV2 cells. [score:4]
In the microglial culture supernatant (MCS) transfer mo del, over -expression of the miR-124 or knockdown of MEKK3 in BV2 cells prevented SH-SY5Y from apoptosis and death. [score:4]
However, whether abnormal miR-124 expression could regulate the activation of microglia remains poorly understood. [score:4]
The fold change is significant where * P < 0.05, ** P < 0.01, and *** P < 0.001 We first demonstrated that the expression level of miR-124 decreased in the activated BV2 cells. [score:3]
Interestingly, we finally observed that over -expression of miR-124 in the midbrain could prevent midbrain DA neuronal death and apoptosis in the SNpc of MPTP -treated mice (Fig.   11a– d). [score:3]
We also first identified a unique role of miR-124 in mediating the microglial inflammatory response by targeting MEKK3/NF-κB signalling pathways. [score:3]
Consequently, these data indicate that the over -expression of miR-124 could effectively attenuate LPS- or MPTP -induced microglial activation in vitro or in vivo. [score:3]
We then determined whether the over -expression of miR-124 could attenuate LPS -induced BV2 microglial activation. [score:3]
Therefore, our data identified MEKK3 as a target of miR-124. [score:3]
However, we obtained the opposite result when transfecting with the miR-124 inhibitor in comparison with the miR-124 mimics. [score:3]
a The miR-124 expression level was determined using RT-qPCR and normalised with U6 RNA. [score:3]
We further studied whether miR-124 could attenuate LPS -induced expression of MEKK3. [score:3]
a Alignment of the miR-124 binding site to Bim 3′-UTR is shown for different species as predicted using the TargetScan database. [score:3]
miR-124 attenuates LPS -induced inflammatory responses by targeting MEKK3/NF-κB signalling pathways in BV2 cells. [score:3]
Over -expression of miR-124 could effectively attenuate LPS -induced BV2 microglial activation. [score:3]
The recommended concentrations are as follows: miR-124 mimics (50 nM), miR-124 inhibitor (100 nM), and MEKK3 siRNA (100 nM). [score:3]
Evidence shows that miR-124 is a critical mediator for the peripheral and CNS inflammatory process by inhibiting the activation of microglia/macrophages and reducing the production of pro-inflammatory cytokine [20, 43]. [score:3]
BV2 cells were activated by exposure to LPS, and the expression levels of miR-124, mitogen-activated protein kinase kinase kinase 3 (MEKK3), and the nuclear factor of kappaB (NF-κB) p-p65 were analysed. [score:3]
These data indicate that exogenous delivery of miR-124 could suppress the activation of microglia in the SNpc of MPTP -treated mice in vivo. [score:3]
g– j The BV2 cells were pre -transfected with MEKK3 siRNA for 48 h, and then the cells were transfected with miR-124 mimic or miR-124 inhibitor. [score:3]
To investigate whether the inhibitory effect on NF-κB of miR-124 was through MEKK3, the BV2 cells were transfected with MEKK3 siRNA/negative control for 48 h. Interestingly, when the cells were pre -treated with MEKK3 siRNA, no significant difference in p-p65 level was observed regardless of transfection of miR-124 mimic or miR-124 inhibitor was transfected (Fig.   5g). [score:3]
miR-124 targets MEKK3. [score:3]
Furthermore, miR-124 mediates cholinergic anti-inflammatory action by inhibiting the production of pro-inflammatory cytokines [20]. [score:3]
With the stimulation of an increasing concentration gradient of LPS (0.1, 0.2, 0.5, and 1 μg/mL) for 24 h, we found that the miR-124 expression showed a significant dose -dependent induction (Fig.   1a). [score:3]
The miR-124 inhibitor sequence was 5′-GGCAUUCACCGCGUGCCUUA-3′. [score:3]
miR-124 expression level was determined using reverse transcription quantitative real-time PCR (RT-qPCR) and normalised with U6 RNA. [score:3]
An increased level of miR-124 following transfection with miR-124 mimics in BV2 cells resulted in a significant reduction in the expression levels of the neurotoxic cytokines iNOS, IL-6, and TNF-α and in a high increase in the levels of the anti-inflammatory cytokines TGF-β1 and IL-10. [score:3]
When miR-124 was over-expressed in BV2 cells, the percentage of apoptotic midbrain DA cells was significantly lower (approximately 15%) than that in the control (Fig.   6a, b). [score:3]
We then investigated the effects of modulated miR-124 expression in microglia transfected with miR-124 mimic and miR-124 inhibitor. [score:3]
According to the TargetScan database, miR-124 potentially binds to MEKK3. [score:3]
Fig. 2Over -expression of miR-124 could effectively attenuate LPS -induced BV2 microglial activation. [score:3]
Considering that miR-124 is highly expressed in the brain and promotes microglial quiescence [17, 19], we investigated the expression of miR-124 in the cell lines by RT-qPCR. [score:3]
a Microglia were transfected with miR-124 mimics or miR-124 inhibitor. [score:3]
In addition, a luciferase reporter assay was conducted to confirm whether MEKK3 is a direct target of miR-124. [score:3]
By contrast, the production of MEKK3 increased prominently in terms of both mRNA and protein levels when the BV2 cells were transfected with miR-124 inhibitor (Fig.   5e, f). [score:3]
Meanwhile, the RT-qPCR results confirmed that the level of pro-inflammatory cytokines underwent little change regardless of transfection of miR-124 mimic or miR-124 inhibitor (Fig.   5h– j). [score:3]
Hence, in our study, we provide a direct correlation between miR-124 and MEKK3/NF-κB signalling pathways in the inflammatory pathogenesis of PD in vivo and in vitro. [score:2]
Then, we detected that miR-124 directly binds to the mRNA encoding MEKK3 by using the luciferase reporter system. [score:2]
However, whether miR-124 could attenuate microglial activation in the development of PD remains unknown. [score:2]
Ponomarev ED Veremeyko T Barteneva N Krichevsky AM Weiner HL MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU. [score:2]
When we transfected miR-124 mimics to BV2 cells, compared with the control, MEKK3 expression was reduced in both its mRNA (Fig.   4b) and protein levels (Fig.   4c). [score:2]
In fact, miR-124 promotes microglial quiescence, and knockdown of miR-124 in microglia resulted in its activation [19]. [score:2]
Following the transfection of miR-124 mimics in BV2 cells, the p-p65 protein level and MEKK3 mRNA and protein levels were both significantly inhibited as compared with the control (Fig.   5a– c). [score:2]
Exogenous delivery of miR-124 attenuates the activation of microglia in the SNpc of MPTP -treated mice in vivo. [score:1]
To construct luciferase reporter vectors, the 3′-UTR of MEKK3 cDNA fragments containing the predicted potential miR-124 binding sites were subcloned into the XhoI/NotI site of psi-CHECK™-2 Vector (Promega, Madison, WI, USA). [score:1]
The mice were then administered one dose of agomir (MIMAT0000134; RiboBio, Guangzhou, China) miR-124-3p (20 nM of ribonucleotide in a total volume of 5 μL) through the catheter per day for five consecutive days. [score:1]
After 48 h, cells were harvested, and miR-124 expression was evaluated using RT-qPCR. [score:1]
Indeed, the luciferase activity reduced significantly when cells were transfected with miR-124 mimics (Fig.   4d). [score:1]
All these results showed a significantly lower level of miR-124 in LPS-stimulated BV2 than in the controls. [score:1]
Having found that miR-124 inhibited inflammation in the BV2 cells, we investigated the mechanisms underlying this effect. [score:1]
Meanwhile, production of miR-124, MEKK3, and p-p65; midbrain DA neuronal death; or activation of microglia were analysed when treated with or without miR-124 in the MPTP -induced mo del of PD. [score:1]
miR-124 attenuates MPTP -dependent apoptotic midbrain DA cell death in vivo. [score:1]
The BV2 cells were transfected with miR-124 mimics or ctrl mimics. [score:1]
The mice were treated with stereotactic intraventricular treatment of miR-124 agomir for five consecutive days. [score:1]
Following the stimulation of BV2 cells with LPS (1 μg/mL) maintaining a temporal gradient (0, 1, 6, 12, and 24 h), the downtrend in the miR-124 level was monitored by RT-qPCR at different time points, and this effect became much more pronounced at 24 h (Fig.   1b). [score:1]
b, c BV2 cells were transfected with miR-124 mimics or ctrl mimics. [score:1]
Fig. 10Exogenous delivery of miR-124 attenuates the activation of microglia in the SNpc of MPTP -treated mice in vivo. [score:1]
On the basis of the above-mentioned studies, we examined the anti-inflammatory properties of miR-124 and further studied the potential mechanisms of its neuroprotective effect. [score:1]
These results demonstrated that exogenous delivery of miR-124 offers strong neuroprotection in the PD pathogenic process. [score:1]
b– f BV2 cells were transfected with miR-124 mimics or miR-124 control for 48 h and then treated with LPS. [score:1]
Regarding the experiment with the exogenous delivery of miR-124 into an animal mo del, the right lateral ventricle of the mice was surgically implanted with a stereotactic catheter (62004, 62104, and 62204; Woruide, Shenzhen, China). [score:1]
The constructs were cotransfected into HEK293 cells along with scramble (50 nM) or miR-124 mimic (50 nM) using riboFECT™ CP as described by the manufacturer. [score:1]
BV2 microglial cells were transfected with miR-124 mimics/control mimics or MEKK3 siRNA/negative control for 48 h. Subsequently, the cells were incubated in the presence of LPS (1 μg/mL) for 12 h. SH-SY5Y cells were cultured normally for 24 h before adding a mixture of BV2-conditioned medium and fresh medium at a ratio of 1:1 (v/ v). [score:1]
The cells were cotransfected with indicated constructs and miR-124 mimics (100 nm) or control, and normalised levels of luciferase activity are shown. [score:1]
Briefly, BV2 microglial cells were transfected with miR-124 mimics/control mimics or MEKK3 siRNA/negative control for 48 h before exposure to LPS. [score:1]
Notably, we would demonstrate the potential neuroprotective role of miR-124 in both cell lines and a pre-clinical mouse mo del for PD. [score:1]
To compare miR-124 levels in both resting and active microglia, BV2 microglial cells were incubated with LPS. [score:1]
Then, the exogenous delivery efficacy of miR-124 agomir was assessed using RT-qPCR (Fig.   9a). [score:1]
a The miR-124 expression was evaluated using RT-qPCR and normalised with U6 RNA. [score:1]
The miRNA-124 mimic sequence was 5′-CCGUAAGUGGCGCACGGAAU-3′. [score:1]
Meanwhile, the exogenous delivery of miR-124 could attenuate the activation of microglia in MPTP -treated mice and prevent MPTP -dependent apoptotic midbrain DA cell death in vivo. [score:1]
In MPTP -treated mice, we first investigated the expression of miR-124 and found that intraperitoneal injection of MPTP could decrease the miR-124 level (Fig.   7a). [score:1]
miR-124 also could prevent MPTP -dependent apoptotic midbrain DA cell death in a MPTP -induced PD mo del. [score:1]
Besides, the mRNA levels of the pro-inflammatory cytokines IL-6 and TNF-α were highly decreased, while that of the neuroprotective factor IL-10 increased considerably with injection of miR-124 agomir (Fig.   10f– h). [score:1]
We then suggested that decreasing miR-124 levels may be necessary for the progression of microglial cell activation and the production of inflammatory mediators. [score:1]
Specifically, our data for exogenous delivery of miR-124 showed the same trend in MPTP -induced inflammatory response in vivo, which was consistent with in vitro experiments. [score:1]
[1 to 20 of 117 sentences]
4
[+] score: 369
Small RNA sequencing analysis by software showed that miR-124 might target MCP-1. MiRNAs regulate gene expression by binding to target sites of mRNAs and causing their degradation or translational repression. [score:10]
As shown in Supplementary Figure 1, both ICAM-1 and miR-124 mRNA were significantly upregulated in infected swine lungs, the MCP-1 mRNA expression downregulated in swine lungs (Supplementary Figure 1A). [score:9]
MiR-124 regulates monocyte chemotactic protein 1 (MCP-1) mRNA and protein expression via direct binding to the 3’UTR of MCP-1. ICAM-1 depletion increases MCP-1 expression by suppressing miR-124 levels. [score:9]
ICAM-1 upregulated miR-124 suppresses MCP-1 production via direct binding to the 3’UTR of MCP-1. ICAM-1 deficiency induces M1 macrophage polarization and overexpression of miR-124 promoted M2 macrophage polarization. [score:9]
Overexpression of miR-124 also resulted in M2 polarization as downregulation of M1 markers and upregulation of the M2 markers (Figure 6B). [score:9]
In the effort to understand the mechanism of this regulation, we then analyzed the miRNA profile and identified miR-124 might be the potential candidate to medicate the regulation of ICAM-1 on MCP-1 production based on those observations: (1) miR-124 expression is lower in ICAM-1 knockout mouse lungs compared to wild-type ones, (2) miR-124 is highly expressed in lung and brain, and no MCP-1 production in heart and kidney tissues from ICAM-1knockout mice. [score:8]
Overexpression of miR-124 in RAW264.7 cells suppressed the expression of MCP-1. These results indicate that miR-124 mediates the ICAM-1 regulated MCP-1 production in macrophages. [score:8]
Further study confirmed that down-regulation of Sp1 by ICAM-1 knockdown contributed to low miR-124 expression in macrophage. [score:7]
Figure 7 (A) Real-time qPCR analysis of expression levels of miR-124 in porcine alveolar macrophages (primary macrophages) after transfected with mimic-NC, miR-124 mimics, inhibitor-NC and miR-124 inhibitor. [score:7]
Both downregulation of ICAM-1 and overexpression of miR-124 were able to induce M2 polarization in porcine alveolar macrophages (Figure 7E), further demonstrating the regulatory roles of ICAM-1 and miR-124 in macrophage polarization. [score:7]
Downregulation of miR-124 (A) and upregulation of MCP-1 (B) in RAW264.7 cells transfected with siRNA against ICAM-1. Twenty-four h after transfection, expressions were measured with real-time qPCR. [score:7]
In this report, we observed the overexpression of MCP-1 in ICAM-1 knockout mouse lungs and found that miR-124 mediates ICAM-1 regulated MCP-1 expression in macrophages, thereby modulates macrophage polarization. [score:7]
Here, we reported a novel role of ICAM-1 in the downregulation of miR-124 mediated expression of MCP-1, a key regulator molecule in monocytes recruitment, in both lungs and macrophages. [score:7]
Figure 4Downregulation of miR-124 (A) and upregulation of MCP-1 (B) in RAW264.7 cells transfected with siRNA against ICAM-1. Twenty-four h after transfection, expressions were measured with real-time qPCR. [score:7]
It was reported before that miRNA-124 specifically expressed in brain tissue [21], we analyzed miR-124 expression in wild-type mouse brain, heart, liver, spleen, lung, and kidney tissues, and the results showed that miR-124 expression is abundant in mouse brain, followed by lung (Figure 2D). [score:7]
In neurons enriched miR-124 inhibits the expression of small C-terminal domain phosphatase 1 (SCP-1), a key regulator to the process of induction of neuronal differentiation [14]. [score:6]
ICAM-1 downregulation resulted in reduced expression of miR-124 (Figure 4A). [score:6]
It is known that miR-124 targets transcription factor STAT3, regulating of endometrial carcinoma cell cycle G1 phase and then inhibiting tumor differentiation [17]. [score:6]
Furthermore, our data also show that miR-124 directly targets the 3’UTR of MCP-1. demonstrated that miR-124 specially suppressed the reporter activity driven by the 3’UTR MCP-1 mRNA. [score:6]
Co-transfection of miR-124 mimics and siRNA-ICAM-1 resulted in attenuation of the increased MCP-1 expression induced by downregulation of ICAM-1 (Figure 4C). [score:6]
MiR-124 directly binds and downregulates MCP-1 expression. [score:6]
To determine the effects of downregulation of ICAM-1 on expression of miR-124 and MCP-1, RAW264.7 cells were transfected with siRNA-ICAM-1 and expression of miR-124 was measured by real-time qPCR. [score:6]
And mutation of the miR-124 target site abolished miR-124 mimic effects, indicating miR-124 specifically targets the MCP-1 3’UTR. [score:6]
Taken with the regulation of ICAM-1 on the expression of miR-124, our results also suggest that the regulation of ICAM-1 on macrophage polarization is likely through miR-124. [score:5]
Transfection of PAM cells with miR-124 mimic decreased MCP-1 expression analyzed by Western blot analysis, anti-miR-124 transfection resulted in increased MCP-1 expression (Figure 7B). [score:5]
Such as miR-100, miR-124, miR-206, miR-5116 and miR-760 were significantly downregulated in ICAM-1 knockout mouse lung tissue. [score:5]
It is likely that miR-124 may regulate the expression of other inflammatory factors and MCP-1 may work together with them to decide the direction of macrophage polarization. [score:5]
ICAM-1 stimulates miR-124 expression by increasing Sp1 activation, and Sp1 in turn binds to the miR-124 promoter and transactivates its expression. [score:5]
In cervical cancer cells or hepatocellular carcinoma cells, overexpression of miR-124 suppressed the occurrence of tumors [15, 16]. [score:5]
Recent studies show that in the pathological pulmonary hypertension, miR-124 also controls pulmonary vascular fibroblast proliferation, migration and inflammation [18] by inhibiting the expression of MCP-1 and polypyrimidine tract-bind protein 1(PTBP-1). [score:5]
Although our studies suggest miR-124 modulates the inflammation in macrophage and mouse lungs by targeting to MCP-1, other miR-124 targets may also play some roles. [score:5]
Transfection of RAW264.7 cells with miR-124 mimic decreased MCP-1 expression analyzed by Western blot analysis, whereas anti-miR-124 treatment resulted in increased MCP-1 expression (Figure 3F and 3G). [score:5]
These data suggest that the polarized macrophage induced by siRNA-ICAM-1 or miR-124 are still able to response the stimuli LPS or IL-4. To confirm our findings regarding ICAM-1 regulation of MCP-1 expression via miR-124 in primary macrophages, we isolated the porcine alveolar macrophages (PAM) from porcine lung tissue. [score:4]
MiR-124 plays a key role in inhibiting macrophage activation and promoting microglial differentiation by inhibiting the transcription factors C/EBP-α and PU. [score:4]
Our results suggest a novel role of ICAM-1 in the regulation of inflammation and raise a possibility that targeting ICAM-1/miR-124/MCP-1 axis in modulating inflammation during acute lung injury. [score:4]
In summary, our studies demonstrated that ICAM-1 regulates both miR-124 and MCP-1 expression in macrophages. [score:4]
To confirm our findings regarding ICAM-1 regulation of MCP-1 expression via miR-124 in primary macrophages, we isolated the porcine alveolar macrophages (PAM) from porcine lung tissue. [score:4]
ICAM-1 regulation of MCP-1 expression via miR-124 in porcine alveolar macrophages. [score:4]
In our study transfection of macrophage with miR-124 mimics increased the expression of anti-inflammatory cytokines including ym-1, Mrc-1 and IL-10, and caused no significant changes of M1 macrophage markers, suggesting that in contrast to ICAM-1 knockdown, miR-124 mimics promotes the M2 macrophage polarization. [score:4]
Recent reports suggest that miR-124 may target USP2 and USP14, then in turn negatively regulates LPS -induced TNF-α production in mouse macrophage in vivo and vitro [28]. [score:4]
Intravenous injection of miR-124 mimics also downregulated MCP-1 expression in mouse lungs, as measured by immunohistochemistry analysis (Figure 8D3, D4). [score:4]
To determine whether Sp1 regulates expression of miR-124 in RAW264.7 cells, a two truncated promoter constructs including full-length, deletion mut1 (BS1) and mut2 (BS2) were generated (Figure 5C). [score:4]
We also examined the effects of miR-124 on the expression of MCP-1. In the mouse lungs, MCP-1 expression was decreased in the miR-124 mimics group compared with the negative control group (Figure 8C). [score:4]
In primary macrophages confirm ICAM-1 regulation of MCP-1 expression via miR124. [score:4]
In addition, we also used real-time qPCR to determine the mRNA expression of ICAM-1, miR-124 and MCP-1 in a swine lung injury caused by infection of porcine reproductive and respiratory syndrome virus (PRRSV). [score:3]
Furthermore, overexpression of miR-124 protects mice against LPS -induced acute lung injury. [score:3]
The results showed that miR-124 mimic significantly inhibited the luciferase activity of pLuc-MCP-1 (Figure 3B and 3C). [score:3]
C57BL/6 mice used in miR-124 injection were purchased from the Disease Prevention and Control Center (Wuhan, China). [score:3]
mmu-miR-124 dsRNA mimics, ssRNA inhibitor and control oligonucleotides were synthesized by GenePharma (Shanghai, China). [score:3]
Analysis of miR-124 gene promoter and activity assay suggest that the transcriptional factor Sp1 binds to the miR-124 promoter and ICAM-1 knockdown dramatically decreases Sp1 expression in cultured macrophages. [score:3]
Analysis of miR-124 expression in infected porcine lungs suggests that there are positive correlation of ICAM-1 and miR-124. [score:3]
Moreover, high level of miR-124 expression induces M2 macrophage polarization in the patients with bronchial asthma [19]. [score:3]
Further studies are needed to determine whether other transcription factors and Sp1 may collaborate in the transcriptional regulation of miR-124 in ICAM-1 knockdown macrophages. [score:3]
ICAM-1depletion attenuates miR-124 expression and promotes MCP-1 production in macrophages. [score:3]
We transiently transfected PAM cells with miR-124 mimic or miR-124 inhibitor. [score:3]
We further investigated whether miR-124 expression affects expression of the M2 markers of the polarized macrophages. [score:3]
Nucleic acid sequences for miR-124 mimics and inhibitor. [score:3]
The miR-124 had a little effect on the expression of M1 and M2 markers in the LPS treated RAW264.7 cells (Figure 6D). [score:3]
To understand how ICAM-1 regulates miR-124, we then determined the transcriptional regulation of miR-124. [score:3]
Mature miR-124 expression in transfected cells was confirmed by real-time qPCR (Figure 7A). [score:3]
Intravenous injection of miR-124 mimics and liposome mixture was performed to overexpress miR-124 in mouse lung (Figure 8A). [score:3]
To understand how ICAM-1 regulates miR-124, our study next focused on the transcriptional regulation of miR-124. [score:3]
Mice mmu-miR-124 dsRNA mimics, ssRNA inhibitor and control oligonucleotides were synthesized by GenePharma (Shanghai, China). [score:3]
These data suggest that the polarized macrophage induced by siRNA-ICAM-1 or miR-124 are still able to response the stimuli LPS or IL-4. (A) Real-time qPCR analysis of the mRNA expression of M1 marker (iNOS, CD86, IL-6) and M2 (ym-1, Mrc-1, IL-10) markers in ICAM-1 siRNA or negative control transfected with RAW264.7 cells. [score:3]
Mature miR-124 expression in transfected cells was confirmed by real-time qPCR (Figure 3D and 3E). [score:3]
Next, we transiently transfected RAW264.7 cells with miR-124 mimic, miR-124 inhibitor, or control vector, respectively. [score:3]
We then determined whether miR-124 was able to target MCP-1, and a dual-luciferase reporter assay was performed. [score:2]
Differential regulation of M1/M2 macrophage polarization by ICAM-1 and miR-124. [score:2]
Our studies thus identify a previously unrecognized pathway of ICAM-1/miR-124/MCP-1 in regulate macrophage polarization. [score:2]
The protection role of miR-124 in the mouse lung injury mo del clearly suggests that miR-124 is able to regulate inflammation. [score:2]
The mutated 3’UTR of MCP-1 and miR-124 promoter constructs containing site-specific mutations at transcription factor binding sites were generated with overlap-extension PCR. [score:2]
To understand the biological roles of ICAM-1 regulating miR-124, we studied the effects of miR-124 or ICAM-1 on macrophage polarization. [score:2]
Previous studies from others on pulmonary hypertension fibroblasts and heumatoid arthritis synoviocytes showed that MCP-1 production is under the direct control of miR-124 [18, 24]. [score:2]
Taken together, ICAM-1 and miR-124 are regulating MCP-1 production in inflammatory lungs. [score:2]
DNAs containing different length of miR-124 promoter sequence, such as pre-3031, pre-2116, pre-1323 or pre-493, were subcloned into the reporter plasmid for promoter activity analysis. [score:1]
The first nucleotide of mature pre-miR-124 is assigned +1. [score:1]
For miR-124 promoter analysis, RAW264.7 cells were co -transfected with 100 ng full length, truncated or mutant promoter firefly luciferase reporter constructs and 10 ng Renilla luciferase vector (pRL-TK). [score:1]
Genomic information and chromosomal location of miR-124 were obtained from miRBase and its potential promoter was analyzed. [score:1]
Clearly, the roles of miR-124 in macrophage and inflammation need further study. [score:1]
The potential binding site of miR-124 in the 3’UTR of the mouse MCP-1 mRNA was determined by miRanda. [score:1]
A schematic representation of the miR-124 promoter was shown in Figure 5A. [score:1]
ICAM-1 and miR-124 induce different macrophage polarizations. [score:1]
To understand whether miR-124 is able to modulate inflammation in vivo, we have injected miR-124 in the mice treated with LPS. [score:1]
Next, we co -transfected RAW264.7 cells with miR-124 mimics and siRNA-ICAM-1 and then measured MCP-1 expression. [score:1]
We then investigated whether ICAM-1 or miR-124 expression affected the macrophage polarization. [score:1]
LPS induced MPO activity in the mouse lungs was greatly decreased by co-injection of miR-124. [score:1]
To understand the role of miR-124 in vivo, we examined the effects of miR-124 on lung injury using a mouse mo del. [score:1]
We performed the M1 polarization of the macrophages by LPS in the presence of miR-124 mimics or negative control. [score:1]
Figure 5 (A) RAW264.7 cells were co -transfected with pRL-TK and a miR-124 promoter reporter plasmid containing various lengths of the miR-124 promoter. [score:1]
After co-transfection of miR-124 mimic and the wild-type pLuc-MCP-1 into RAW264.7 cells, luciferase activity was performed. [score:1]
Exogenous administration of miR-124 protects against acute lung injury. [score:1]
Moreover, LPS induced lung morphological damage was remarkably attenuated by miR-124 (Figure 8D2). [score:1]
Nevertheless, our studies also suggest that miR-124 may have potential therapeutic function against inflammation. [score:1]
The close relationship of miR-124 with inflammation was also revealed in a porcine lung injury caused by PRRSV infection. [score:1]
Sp1 is required for miR-124 transcription. [score:1]
Furthermore, we measured the expression of M1 and M2 markers in siRNA-ICAM-1 or miR-124 mimic transfected PAM cells. [score:1]
To define the boundaries of the minimal promoter region, an approximately 3 kb DNA fragment containing non-coding sequences upstream of the first nucleotide site of pre-miR-124 promoter was cloned and then transfected into RAW264.7 cells to analyze the promoter activity. [score:1]
As shown in Figure 8B, LPS induced high myeloperoxidase (MPO) activity was remarkably attenuated by miR-124, suggesting the protective role of miR-124 agaist lung injury. [score:1]
These results suggest that miR-124 blunts MCP-1 production induced by ICAM-1 deficiency. [score:1]
Analysis of the miR-124 promoter and transcription factor Sp1 binds to miR-124 promoter. [score:1]
Figure 8 (A) Real-time qPCR detection of miR-124 in the lung tissues of C57BL/6 mice 48 hours after tail-vein injection with miR-124 mimics and negative control. [score:1]
To determine the effects of miR-124 on the macrophage polarization, miR-124 was overexpressed in RAW264.7 and the M1 and M2 markers were measured with real-time qPCR. [score:1]
[1 to 20 of 102 sentences]
5
[+] score: 324
miR-124 also directly targets and suppresses expression of small C-terminal domain phosphatase 1 (SCP1), an inhibitor of neuronal gene expression [44]. [score:12]
Our studies showed, for the first time to the best of the authors' knowledge, that miR-124 and miR-137: (1) are expressed at significantly lower levels in GBM tumors relative to non-neoplastic brain tissue; (2) are up-regulated during neuronal differentiation of adult mNSCs induced by growth factor withdrawal; (3) promote neuronal-like differentiation of growth-factor-deprived mNSCs, mOSCs and hGSCs; (4) promote G0/G1 cell cycle arrest in GBM cells and growth-factor-deprived hGSCs; (5) inhibit expression of CDK6 mRNA, CDK6 protein and phosphorylated RB in GBM cells. [score:10]
Finally, miR-124 overexpression in HCT-116 colon cancer cells inhibits the expression of CDK6, an established target of miR-124 (see [26]). [score:9]
It remains unclear why miR-124 and miR-137 were not detected previously in GBM tumors, particularly in light of our results that show dramatic expression decreases of miR-124 and miR-137 in GBMs (and AAs) relative to non-neoplastic brain tissue, and results that show clear down-regulation of miR-124 expression in human oligodendrogliomas [28], human astroblastomas [32] and GBM cell lines [32, 33]. [score:8]
CDK6 is an established target of miR-124 in HCT-116 colon cancer cells [26], a predicted target of miR-137 (TargetScan and PicTar), and has been functionally implicated in the development of multiple malignancies. [score:8]
We tested, therefore, whether expression of miR-124 and miR-137 could be activated in GBM cell lines following treatment with 5-aza-2'-deoxycytidine (5-aza-dC), a DNA methylation inhibitor and/or TSA, a histone deacetylase inhibitor. [score:7]
MiRNA-124 is down-regulated in human oligodendrogliomas [28], and both miR-124 and miR-137 are down-regulated over 10-fold in S100β-v- erbB tumor stem cells relative to mNSCs (Additional file 7). [score:7]
miR-124 and miR-137 are down-regulated in high-grade gliomas and up-regulated during adult NSC differentiation. [score:7]
Expression of miR-124 and miR-137, respectively, increased up to 8- and 24-fold, expression of miR-129 and miR-139, respectively, decreased up to 2- and 4-fold, and expression of miR-7 and miR-218 did not change appreciably. [score:7]
Overexpression of miR-124 or miR-137 also reduced the expression of phosphorylated RB (Figure 6B), a downstream target of CDK6 [30]. [score:7]
Figure 1 miR-124 and miR-137 are down-regulated in anaplastic astrocytomas and glioblastoma multiformes and are up-regulated in glioblastoma multiforme cell lines following treatment with DNA demethylating agents. [score:7]
Our studies revealed that miR-137, as well as miR-124, inhibited expression of CDK6, a predicted target of both miRNAs. [score:7]
As we observed that expression of miR-124 and miR-137 is reduced in HGAs and that miR-124 and miR-137 promote differentiation of non-neoplastic adult mNSCs, we tested next whether up-regulation of miR-124 and miR-137 could promote differentiation of brain tumor-derived stem cells. [score:6]
The second mechanism by which miR-124 and miR-137 expression may be suppressed in GBM stem cells is via epigenetic modification of their transcriptional regulatory sequences. [score:6]
Given that activation of EGF [37], PDGF [38] and FGF [39] signaling pathways have each been implicated in gliomagenesis, it is reasonable to speculate that one mechanism by which growth factor signaling promotes brain tumor formation is through suppression of miR-124 and/or miR-137 expression and NSC/TSC differentiation. [score:5]
It has also been shown that miR-124 expression is epigenetically suppressed in a number of tumor types including colorectal and breast cancers [26]. [score:5]
These results suggest that targeted delivery of miR-124 and/or miR-137 to GBM tumor cells may be therapeutically valuable for GBM disease treatment. [score:5]
Figure 6 CDK6 expression is inhibited by miR-124 and miR-137 in glioblastoma multiforme cells. [score:5]
These results suggest that targeted delivery of microRNA-124 and/or microRNA-137 to glioblastoma multiforme tumor cells may be therapeutically efficacious for the treatment of this disease. [score:5]
Previous studies have demonstrated that miR-124 is up-regulated during development of the rodent nervous system [41, 42], and during neuronal differentiation of mouse ES cells [12], and mouse and human embryonal carcinoma cells [25]. [score:5]
miR-124 and miR-137 inhibit CDK6 expression and phosphorylated retinoblastoma levels in GBM cells. [score:5]
For example, expression of miR-124 and miR-9 increases during differentiation of mouse ES cell-derived neural progenitors, and experimental manipulation of miR-124 and miR-9 expression affects neural lineage differentiation in the ES cell-derived cultures [12]. [score:5]
Our differentiation studies in mNSCs suggested that growth factor signaling, which is recurrently activated in HGAs, suppresses expression of miR-124 and miR-137. [score:5]
For example, in mouse neuroblastoma cell lines CAD and Neuro2a, ectopic up-regulation of miR-124 alone is sufficient to induce neuron-like differentiation, whereas in mouse embryonic carcinoma cells (P19), miR-124 enhances neuronal differentiation only in the presence of retinoic acid, an established inducer of P19 neuronal differentiation [13]. [score:4]
Therefore, miR-137, in addition to miR-124, is a direct inhibitor of CDK6. [score:4]
It is interesting to note that CDK6 is known to regulate both cell cycle progression and differentiation (reviewed in [29]), suggesting that mir-124- and miR-137 -mediated inhibition of CDK6 may, in part, account for the observed effects on GBM cell proliferation and differentiation in this study. [score:4]
Regulation of miR-124 and miR-137 expression. [score:4]
Up-regulation of miR-124 also induces neuronal differentiation of mouse neuroblastoma cell lines CAD and Neuro2a and the mouse embryonal tumor cell line P19 [13]. [score:4]
Of the 35 miRNAs, we identified six HGA-miRNAs, which were down-regulated in both AA and GBM tumors at a more stringent degree of significance (P < 0.01): miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218. [score:4]
In particular, prior work [28] has shown that miR-124 is only expressed in the neurons of adult human brains, which indicates that our observed decrease in miR-124 expression in HGAs is a likely consequence of there being relatively fewer neurons in tumor tissue compared with non-neoplastic glioses controls. [score:4]
Of particular interest to our studies, miR-124 is hyper-methylated in over one-third of colon, breast, lung, lymphoma and leukemia primary tumors, and is up-regulated in breast (MCF-7) and colon (HCT-116) cancer cell lines following DNA demethylation [26]. [score:4]
To ascertain the molecular mechanisms by which miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells, we assessed expression of CDK6, a regulator of the cell cycle and differentiation (reviewed in [29]), following transfection of these miRNAs to U251 cells. [score:4]
We identified six miRNAs of particular interest, miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218, which were down-regulated in both AAs and GBMs (Figure 1A, Additional file 8 and Table 1) at a more stringent level of significance (P ≤ 0.01). [score:4]
For example, miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, a global repressor of alternative pre-mRNA splicing in non-neuronal cells, resulting in the transition from non-neuronal- to neuronal-specific alternative splicing patterns [13]. [score:4]
To test whether up-regulation of miR-124 and miR-137 promote differentiation of adult mNSCs, we transfected proliferating mNSCs with double-stranded RNA oligonucleotides corresponding to the mature sequences of each miRNA. [score:4]
Overall, the most robust effects of miR-124 and miR-137 overexpression on cellular differentiation and proliferation were observed in growth factor-deprived human cells (Figures 4B and 5B). [score:3]
miR-124 and miR-137 inhibit proliferation of GBM cell lines. [score:3]
Our results reveal two potential mechanisms by which miR-124 and miR-137 may be suppressed in stem cells and/or tumor cells. [score:3]
Levels of phosphorylated retinoblastoma (RB) (pSer 807/811), a known target of CDK6 [30], were also reduced in response to miR-124 and miR-137 transfection (Figure 6B). [score:3]
Further analyses of miR-137 and miR-124 promoter sequence methylation in primary tumors, TSCs and NSCs are warranted to establish the degree to which epigenetic mechanisms contribute to suppression of these miRNAs in HGAs. [score:3]
The ability of miR-124 and miR-137 to induce potent antiproliferative and prodifferentiation effects in CD133+ and CD133- human GBM cells suggests their potential value for treatment of this disease. [score:3]
Since exit from the cell cycle is required for induction of differentiation, we tested whether miR-124 and miR-137 inhibit proliferation of GBM cells. [score:3]
Click here for file Validation of miR-124 expression and function in glioblastoma multiforme cells. [score:3]
Transfection of microRNA-124 or microRNA-137 also induced G1 cell cycle arrest in U251 and SF6969 glioblastoma multiforme cells, which was associated with decreased expression of cyclin -dependent kinase 6 and phosphorylated retinoblastoma (pSer 807/811) proteins. [score:3]
Validation of miR-124 expression and function in glioblastoma multiforme cells. [score:3]
Further analyses are required to determine the relative contributions of EGF-, FGF- and PDGF -induced signaling on suppression of miR-124 and miR-137 transcription in adult NSCs and GBM tumor stem cells. [score:3]
Our results show that miR-124 and miR-137 can induce neuronal differentiation of OSCs and GBM stem cells and inhibit proliferation of GBM cell lines. [score:3]
Our results indicate that overexpression of either miR-124 or miR-137 promotes neuron-like differentiation of non-neoplastic adult (mNSCs), mOSCs and CD133+ hGSCs. [score:3]
The first mechanism is growth factor signaling: removal of EGF, and FGF from the culture media resulted in robust increases in miR-124 and miR-137 expression in adult NSCs. [score:3]
Further, neuronal differentiation is enhanced following ectopic overexpression of miR-124 in mouse ES cells [12], mouse neuroblastoma cells [13], and mouse embryonal carcinoma cells [13]. [score:3]
Our studies revealed that expression levels of microRNA-124 and microRNA-137 were significantly decreased in anaplastic astrocytomas (World Health Organization grade III) and glioblastoma multiforme (World Health Organization grade IV) relative to non-neoplastic brain tissue (P < 0.01), and were increased 8- to 20-fold during differentiation of cultured mouse neural stem cells following growth factor withdrawal. [score:3]
Although we restricted further analyses of these six miRNAs to miR-124 and miR-137 because of their elevated expression during adult NSC differentiation (Figure 1B), assessments of the other HGA-miRNAs may lead to novel insights into the biology of high-grade gliomas. [score:3]
Transfection of microRNA-124 or microRNA-137 induced morphological changes and marker expressions consistent with neuronal differentiation in mouse neural stem cells, mouse oligodendroglioma-derived stem cells derived from S100β-v- erbB tumors and cluster of differentiation 133+ human glioblastoma multiforme-derived stem cells (SF6969). [score:3]
Consistent with our observations in mNSCs, we observed a significant increase in the numbers of cells that express the neuronal marker Tuj1 following transfection with miR-124, miR-137 or a combination of both miRNAs (Figure 4A). [score:3]
Thus, overexpression of miR-124 and miR-137 enhances neuronal-like differentiation of adult NSCs in vitro. [score:3]
Interestingly, we did not observe an increase in miR-124 expression in either cell line following 5-aza-dC treatment. [score:3]
While this does not change our conclusions that miR-124 and miR-137 can induce mNSC-, mOSC- and human GBM-derived stem cell (hGSC)-differentiation, it indicates that in situ expression analyses of miRNAs in HGAs, non-neoplastic adult brain tissue, and during fetal- and post-natal development of the mammalian central nervous system will be an important component of studies aimed at investigating the functions of miRNAs during normal brain development and tumorigenesis. [score:3]
miRIDIAN miRNA mimic negative control (cel-miR-67) and miRIDIAN miRNA mimics (mmu-miR-124, mmu-miR-137) were purchased from Dharmacon (Lafayette, CO) and validated using the pMIR-REPORT miRNA Expression Reporter Vector System (Ambion, Austin, TX). [score:3]
We observed that the majority of the HGA-miRNAs show expression changes during, or have been implicated in, differentiation of various cell lineages: miR-7 during photoreceptor differentiation [23]; miR-124 and miR-137 during erythropoiesis [24]; miR-124 and miR-218 during neuronal differentiation of embryonal carcinoma cell differentiation [25]; miR-124 during neuronal differentiation of ES cells [12]. [score:3]
Investigations of miR-124 expression and function during development of the embryonic chick spinal cord have determined that the proneural activity of miR-124 is, at best, subtle [43, 44], suggesting that additional factors- and/or signals are required for robust neurogenesis at this developmental stage. [score:3]
Figure 5 miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme stem cells and induce cell G0/G1 cycle arrest. [score:3]
Regulation of differentiation and the cell cycle by miR-124 and miR-137. [score:2]
Further investigations are needed to define the relationship between CDK6 down-regulation and cell cycle arrest and/or differentiation in GBM stem cells, and to identify and characterize additional miR-124 and miR-137 target genes. [score:2]
Recent studies have begun to shed light on the molecular mechanisms by which miR-124 regulates differentiation and proliferation. [score:2]
These data suggest that epigenetic modification of regulatory sequences in CpG islands may contribute to miR-124 and miR-137 silencing in GBMs. [score:2]
MiRNA-124 expression increased around 2-fold in U251 and U87 cells following combined treatment with 5-aza-dC (5 μM) and TSA (Figure 1B and Additional file 8). [score:2]
The ability of miR-124 to induce robust stem cell differentiation appears to be dependent on cell type, developmental timing and other, as yet unidentified, factors. [score:2]
A total of 100 nM miRIDIAN miRNA mimics (50 nM each for miR-124 and miR-137 co-transfections) were complexed with LipofectAMINE 2000 (Invitrogen) and added directly to cells growing in proliferating medium. [score:2]
Cells were transfected with miR-124 and/or miR-137 (100 nM) or a negative control oligonucleotide for 4 hours using lipofectamine. [score:1]
Our studies show that miR-124 and miR-137 enhance neurogenesis of mNSCs, mOSCs and hGSCs in the absence of growth factor signaling. [score:1]
Relative to control oligonucleotides, transfection of miR-124 or miR-137 resulted in a marked reduction in the number of cells in the S-phase of the cell cycle and a marked increase in the number of cells in G0/G1 in U251 GBM cells (Figure 5A) and early passage GBM cells derived from a newly diagnosed human GBM (Figure 5B). [score:1]
Further testing of miR-124 and miR-137 in pre-clinical mo dels of GBM [52, 53] in conjunction with various delivery strategies will help define their ultimate therapeutic potential for treatment of GBM. [score:1]
Our data suggest that miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells. [score:1]
Thus, our study is the first to implicate miR-124 in neuronal differentiation of post-natal NCSs and brain TSCs. [score:1]
However, cell cycle arrest was more pronounced in miR-124- and miR-137 -transfected GBM cells (SF6969) that were deprived of growth factors (Figure 5B). [score:1]
Collectively, our results suggest that while miR-124 and miR-137 have the capacity to induce alone cell cycle arrest and differentiation in human GBM cells and stem cells, abrogation of growth factor signaling enhances their capacity to do so. [score:1]
Figure 4 Induction of neuronal differentiation of tumor-derived neural stem cells by miR-124 and miR-137. [score:1]
Finally, transfection of miR-124, but not miR-137, resulted in a 2-fold decrease in the numbers of GFAP -positive cells (Figure 3A and 3C). [score:1]
Figure 3 miR-124 and miR-137 promote neuronal differentiation of subventricular zone-neural stem cells. [score:1]
We tested next whether miR-124 and miR-137 could promote differentiation of human GBM stem cells. [score:1]
We also observed that transfection of miR-124 and miR-137 reduced the numbers of GFAP -positive mOSCs (Figure 4A). [score:1]
For transfection of miR-124/137 into SVZ-NSCs, 50,000 cells were plated into eight-well culture slides (BD Falcon Biosciences) pretreated with 0.1 mg/ml poly-D-lysine (Sigma) and 10 μg/ml laminin (Invitrogen) 24 hours prior to transfection. [score:1]
microRNA-124 and microRNA-137 induce differentiation of adult mouse neural stem cells, mouse oligodendroglioma-derived stem cells and human glioblastoma multiforme-derived stem cells and induce glioblastoma multiforme cell cycle arrest. [score:1]
Transfection of either miR-124 or miR-137 resulted in a 5-fold increase in the numbers of cells stained with the neuronal marker Tuj1 relative to controls (Figure 3A, B and 3C). [score:1]
Both CD133+ and CD133- cells were transfected with miR-124 and/or miR-137 and then cultured for 10 days in NBE media without growth factors. [score:1]
Collectively, our results show that in the absence of growth factor signaling, miR-124 and miR-137 enhance neuron-like differentiation of oligodendroglial and GBM TSCs. [score:1]
In independent experiments we observed marked reductions of CDK6 transcript (Figure 6A) and CDK6 protein (Figure 6B) in response to miR-124 and miR-137 transfection. [score:1]
Transfection with either miR-124 or miR-137 resulted in rounded or trapezoidal cellular morphology of Tuj1 -positive cells with reduced neuritic outgrowth. [score:1]
Transfection of miR-124 and/or miR-137 dramatically increased the percentage of Tuj1 -positive cells, and reduced the percentage of GFAP -positive cells and in both CD133+ and CD133- GBM cell fractions (Figure 4B). [score:1]
Therapeutic potential of miR-124 and miR-137. [score:1]
miR-124 and miR-137 promote neuronal differentiation of adult NSCs. [score:1]
Levels of phosphorylated RB (pSer 807/811) are also markedly reduced in response to miR-124 or miR-137 transfection. [score:1]
Although we have not tested whether miR-124 and miR-137 alone can induce differentiation of the various stem cells tested in this study, transfection of miR-124 or miR-137 alone was sufficient to induce G1 cell cycle arrest in standard GBM cell lines (Figure 5A). [score:1]
Distinct morphological changes were also apparent for each miRNA; miR-124 induced neuritic branching of the cells whereas miR-137 induced a rounded or trapezoidal cellular appearance with no neuritic outgrowth (Figure 3A and 3B). [score:1]
These results suggest that miR-124 and miR-137 may be useful therapeutic agents for the treatment of GBMs. [score:1]
The inset shows a Tuj1+ cell with neuronal morphology from a miR-124 and/or miR-137 cotransfection. [score:1]
miR-124 and miR-137 promote neuronal differentiation of brain TSCs. [score:1]
was conducted by fluorescence-activated cell sorter at 48 hours after transfection of 100 nM (final total microRNA concentration) miR-124, miR-137, miR-124 and miR-137 together or negative control oligonucleotides (neg#1, neg#2) to U251 (A) and SF6969 (B) glioblastoma multiforme cells. [score:1]
We also identified a number of miRNAs, including miR-124 and miR-137, which have not been described in prior GBM profiling studies. [score:1]
[1 to 20 of 99 sentences]
6
[+] score: 322
We also found that hypermethylation of the miR-124-1 promoter was associated with the downregulation of its expression in HCC cell lines, and demethylation treatment with 5-aza-2-deoxycytidine recovered the expression levels of miR-124-1. These data indicated that a major mechanism for the downregulation of miR-124-1 is hypermethylation. [score:11]
These results suggest that miR-124-1 downregulates CASC3 expression by directly targeting its 3′-UTR. [score:9]
Grade 4 or undifferentiated: *(for certain tumors) features are not significantly distinguished to differentiate from undifferentiated cancers, which occur in other organs TNM grade: T - Primary tumor (Tx - Primary tumor cannot be assessed; T0 - No evidence of primary tumor; Tis - Carcinoma in situ; intraepithelial or invasion of lamina propria; T1 - Tumor invades submucosa; T2 - Tumor invades muscularis propria; T3 - Tumor invades through muscularis propria into subserosa or into non-peritonealized pericolic or perirectal tissues; T4 - Tumor directly invades other organs or structures and/or perforate visceral peritoneum) N - Regional lymph nodes (Nx - Regional lymph nodes cannot be assessed; N0 - No regional lymph node metastasis; N1 - Metastasis in 1 to 3 regional lymph nodes; N2 - Metastasis in 4 or more regional lymph nodes) M - Distant metastasis (Mx - Distant metastasis cannot be assessed; M0 - No distant metastasis; M1 - Distant metastasis) * For miR-124-1 expression, median values were used as the cut-off point for definition of subgroups (low expression and high expression groups). [score:8]
MicroRNA-124-1 downregulates CASC3 expression by directly targeting its 3′-UTR. [score:8]
The levels of the activated forms of p38 MAPK, ERK and JNK were significantly increased in correlation with the upregulation of CASC3 expression in HCC cell lines, whereas overexpression miR-124-1 reversed this effect. [score:8]
Consistent with these results, CASC3 mRNA and protein expression was downregulated in normal liver and HCC cell lines ectopically expressing miR-124-1 (Figure 4B). [score:8]
MicroRNA-124-1 downregulates CASC3 expression by targeting its 3′UTR. [score:7]
These findings indicate that miR-124-1 effectively suppresses the tumorigenesis and metastasis of HCC cells though the inhibition of the expression of CASC3 in vivo. [score:7]
Kaplan-Meier analysis revealed that the median survival time of patients with low miR-124 expression levels was 37.1 months, whereas the median survival time of patients with high miR-124-1 expression levels was 46.5 months (log-rank = 2.530, P = 0.1117, Figure 3A), indicating that miR-124-1 expression level was not significantly associated with overall survival in HCC patients. [score:7]
Assessment of miR-124-1 expression in eight paired hepatocellular carcinoma samples by real-time PCR showed a significant downregulation of miR-124-1 expression in cancer tissues compared with the matched non-cancer tissues (P = 0.024; Figure 3B). [score:7]
Taken together, these findings indicate that miR-124-1 effectively suppresses the tumorigenesis and metastasis of HCC cells though the inhibition of the expression of CASC3 in vivo. [score:7]
These results indicate that miR-124-1 suppresses tumorigenesis by inhibiting CASC3 expression, which affects the activity of the p38/MAPK/Akt signaling pathways. [score:7]
We found that miR-124-1 is downregulated by methylation -mediated gene silencing in HCC and its downregulation is significantly associated with clinicopathological factors in HCC patients. [score:7]
We identified CASC3 as a direct target of miR-124-1 and found that miR-124-1 modulates the activity of the p38-ERK-JNK pathway by regulating CASC3 expression, which may play a role in HCC tumorigenesis. [score:7]
The results showed that the expression levels of miR-124-1and miR-320a were downregulated in HCC cell lines with genomic deletion. [score:6]
It was found that the percentage of methylated CpGs of miR-124–1 was 37.5% in QSG-7701 and LO2, and 75% (12/16), 75% (12/16), 75% (12/16) and 56.25% (9/16) in MHCC-LM3, Huh7, MHCC-97L and HepG2, respectively, suggesting that overmethylation of miR-124-1 promoter downregulates its expression in HCC cell lines. [score:6]
Furthermore, miR-124-1 was downregulated and CASC3 was overexpressed in HCC tissues (Figure 4C). [score:6]
CASC3 mediates the tumor-suppressive function of miR-124-1. MicroRNA-124-1 suppresses the tumorigenesis of HCC cells in vivo. [score:5]
Whereas miR-124-1 expression level was lower in HCC cell lines than those miRNAs expression in HCC cell lines. [score:5]
Furthermore, we performed IHC on serial sections of HCC tissues and showed that the expression of p-MKK4, p-JNK and p-c-Jun correlated inversely with miR-124-1 expression in HCC. [score:5]
To further explore the downstream effects of miR-124-1, potential targets of miR-124-1 were identified using the TargetScan, Pictar and miRanda databases. [score:5]
D. Relative expression levels of miR-124-1 are expressed as fold change relative to the untreated control. [score:5]
All groups formed tumors, but miR-124-1 overexpression or CASC3 inhibition significantly slowed the growth of liver tumors (Figure 6B and 6C). [score:5]
miR-124-1 functions to inhibit HCC cell proliferation by targeting CASC3. [score:5]
In summary, the present study showed that HCC progression may be associated with epigenetic regulation through miR-124-1 methylation and that downregulation of miR-124-1 may be involved in the pathogenesis of HCC. [score:5]
MicroRNA-124-1 suppresses the tumorigenesis of HCC cells in vivo To further examine the effect of miR-124-1 on the inhibition of tumor growth in vivo, nude mice were subcutaneously injected with MHCC-LM3-Ver, MHCC-LM3-miR-124-1 and MHCC-LM3-Sh-CASC3 cells; all groups successfully formed tumors 15 days post inoculation (Figure 6). [score:5]
We also found that miR-124-1 overexpression decreased the activity of this pathway, whereas ectopic expression of CASC3 blocked the miR-124-1 induced inactivation of the P38 MAPK pathway (Figure 7B). [score:5]
To examine the possible correlation of miR-124-1 expression with clinical features or the prognosis of HCC patients, miR-124-1 expression levels were detected by real-time PCR in 40 formalin-fixed paraffin-embedded HCC tissue samples. [score:5]
To further evaluate the miR-124-1 inhibition of HCC cell growth and proliferation mediated by its target CASC3, we established stably overexpressing miR-124-1 MHCC-LM3 and Huh7 transfectants by infecting the cells with lentivirus encoding CASC3 (Figure 5B-a). [score:5]
In vitro cell proliferation assays revealed that overexpression of miR-124-1 significantly inhibited HCC cell proliferation. [score:4]
The results showed that 134 genes may be regulated by miR-124-1 (potential targets of miR-124-1 were listed in supplementary 2). [score:4]
In addition, our data suggest that the effect of miR-124-1 on the development of HCC is mediated by its target CASC3 and the p38 MAPK-ERK-JNK pathway. [score:4]
To investigate whether miR-124-1 is involved in HCC progression through regulation of the p38 MAPK/Akt pathway, we used cells with low miR-124-1 expression (MHCC-LM3 and Huh7) and analyzed the expression of components of the p38 MAPK/Akt pathway. [score:4]
In the present study we showed that miR-124-1 expression was reduced in HCC tissues, and its downregulation was significantly associated with certain clinical characteristics, such as TNM grade or pathologic stage. [score:4]
The comparative cycle threshold (Ct) method was used to analyze the relative expressions of specific mRNAs and miR-124-1. The primer sequences are listed in Supplementary Table 1. A partial human pri-miR-124-1 gene was subcloned into the lentiviral expression vector pWPI-GFP. [score:4]
B. Effects of miR-124-1 overexpression on endogenous CASC3 expression as measured by real-time PCR and western blotting. [score:3]
The activity of the JNK pathway in HCC cells infected with a control lentiviral vector or an miR-124-1expression lentiviral vector was assessed after transduction with a lentiviral vector encoding CASC3 (open reading frame without the 3′-UTR). [score:3]
We found that miR-124-1 expression was not significantly associated with overall survival in patients with HCC (P = 0.117). [score:3]
We further analyzed the correlation between miR-124-1 expression levels and pathological and clinical data, including pathological classification, TNM grade, pathologic stage, sex, Hepatitis B and Hepatitis C infection status (Table 1). [score:3]
CASC3 reversed the effects of miR-124-1 on HCC cells (Figure 5B-b, c), suggesting that CASC3 is a functional target of miR-124-1. Figure 5 A. MHCC-LM3 and Huh7 cells were transfected by siRNA for CASC3. [score:3]
Although our data show that miR-124-1 expression is not correlated with the survival of patients (P = 0.117), this could be attributed to the small number of patient samples analyzed. [score:3]
We found that the expression of miR-124-1 was restored in correlation with the reversal of methylation (Figure 2A, 2B and 2D). [score:3]
Figure 3 A. Kaplan-Meier survival analysis of HCC patients grouped by miR-124-1 expression level. [score:3]
Methylation mediated microRNA-124-1 expression in hepatocellular carcinoma cell lines. [score:3]
miR-124-1 inhibits tumorigenesis via the p38-Akt-JNK pathway. [score:3]
In a previous study, we showed that miR-124-1 was expressed at higher levels in the normal liver cell lines QSG-7701 and LO2 than in the HCC cell lines MHCC-LM3, Huh7, MHCC-97L and HepG2. [score:3]
The χ2 and Fisher's exact test were used to analyze the association between miR-124-1 expression and pathological parameters. [score:3]
MicroRNA-124-1 is downregulated and correlated with prognosis in hepatocellular carcinoma. [score:3]
Further experiments showed that miR-124-1 (located in 8p23.1) is a tumor suppressor in HCC. [score:3]
Correlation between microRNA-124-1 expression levels and clinicopathological factors in hepatocellular carcinoma tissues (N=40). [score:3]
confirmed that cells with enhanced miR-124 expression formed fewer and smaller colonies than control cells. [score:3]
To determine whether miR-124-1 regulates CASC3 through direct binding to its 3′-UTR, wild-type or mutant fragments of the CASC3 3′UTR were inserted immediately downstream of the luciferase reporter gene. [score:3]
CASC3 reversed the effects of miR-124-1 on HCC cells (Figure 5B-b, c), suggesting that CASC3 is a functional target of miR-124-1. Figure 5 A. MHCC-LM3 and Huh7 cells were transfected by siRNA for CASC3. [score:3]
We identified CASC3 as a target of miR-124-1 associated with its effects on tumorigenesis in HCC. [score:3]
was performed to detect miR-124-1 expression in HCC tissues. [score:3]
B. Comparison of miR-124-1 expression in 8 paired HCC tissues and adjacent non-cancer tissues by real-time PCR. [score:3]
C. miR-124-1 and CASC3 protein expression were examined by in situ hybridization and immunohistochemistry, respectively. [score:3]
To further examine the effect of miR-124-1 on the inhibition of tumor growth in vivo, nude mice were subcutaneously injected with MHCC-LM3-Ver, MHCC-LM3-miR-124-1 and MHCC-LM3-Sh-CASC3 cells; all groups successfully formed tumors 15 days post inoculation (Figure 6). [score:3]
These data indicate that miR-124-1 expression could be a useful marker for the diagnosis of patients with HCC. [score:3]
B. MHCC-LM3 and Huh7 transfectants stably expressing CASC3, miR-124-1 and control vector were generated using a lentiviral infection system. [score:3]
Methylation of miR-124-1 promoter was further confirmed by analyzing its re -expression after treatment with a demethylating agent, 5-Aza-CdR, in HCC and normal liver cell lines. [score:3]
The results showed that HCC patients with clinical stage I and II tended to show high miR-124-1 expression in cancer tissues compared to those with clinical stage IIIA (P = 0.048). [score:2]
MiR-124-1 restoration not only significantly decreased the expression of CASC3, but also attenuated the tumor-promoting activity of HCC cells in vitro. [score:2]
Moreover, the expression levels of these proteins in HCC tissues from orthotopical implantation mo dels of miR-124-1 transfected MHCC-LM3 cells were markedly increased compared with the controls (Figure 8). [score:2]
MiR-124-1 expression was not significantly correlated with sex, pathological grade and Hepatitis B infection status (P > 0.05). [score:2]
Similarly, our results indicated that miR-124-1 mediated CASC3 silencing might provide the critical link between p38 MAPK, ERK and JNK signaling. [score:1]
HEK293 cells were cotransfected with miR-124 or a control vector and a luciferase reporter construct containing the wild-type or mutant CASC3 3′-UTR. [score:1]
Methylation of miR-124-1 promoter in HCC cells. [score:1]
miR-124-1 decreased the relative luciferase activities in the presence of the wild-type 3′-UTR, whereas the decrease in luciferase activity was attenuated in the mutant constructs of CASC3 (Figure 4A). [score:1]
In the present study, we analyzed the role of miR-124-1 in HCC. [score:1]
Immunohistochemistry was performed on HCC tissues from orthotopical implantation mo dels of miR-124-1 vector and control vector transfected MHCC-LM3 cells for CASC3, p-JNK, and p-ERK. [score:1]
Tumors penetrating the submucosa and muscularis propria (T1 and T2) had higher levels of miR-124-1 than tumors invading through the muscularis propria and invading other organs (T3 and T4) (P = 0.048). [score:1]
The tumor volumes of the MHCC-LM3-miR-124-1 and MHCC-LM3-Sh-CASC3 induced tumors were significantly reduced (Figure 6A). [score:1]
A. Putative miR-124-1 binding sequence in the 3′-UTR of CASC3 mRNA. [score:1]
Future experiments will include a larger number of samples to investigate the correlation between miR-124-1 expression and patient outcome in HCC. [score:1]
A. control lentiviral vector groups; B. miR-124-1 vector groups; C. Sh-CASC3 groups. [score:1]
Nude mice were injected subcutaneously in opposite flanks with 5×10 [6] control lentiviral vector-infected cells and miR-124-1 vector-infected cells. [score:1]
Figure 6Nude mice were injected subcutaneously in opposite flanks with 5×10 [6] control lentiviral vector-infected cells and miR-124-1 vector-infected cells. [score:1]
This further suggested that miR-124-1 is silenced by methylation in HCC cells. [score:1]
The DNA methylation pattern of miR-124-1 is shown in Figure 2C. [score:1]
A human CASC3 3′-UTR fragment containing the wild-type or mutant miR-124-1 binding sequence was cloned downstream of the luciferase reporter gene. [score:1]
The binding sequences for miR-124-1 in the 3′UTR of CASC3 were mutated at positions 1520–1525 from CCGUGU to GGCACG. [score:1]
The effect of miR-124-1 on tumor formation in a nude mice xenograft mo del. [score:1]
In fact, miR-124-1 has been confirmed to be involved in several human solid cancers [41– 43], but its role in HCC has not yet been reported. [score:1]
Meanwhile, we found that miR-124-1 level in HCC with Hepatitis C infection are lower than without Hepatitis C infection (P = 0.01). [score:1]
Based on previous studies showing that miR-124-1 methylation silences its expression in various human cancer cell lines, we investigated the effect of miR-124-1 methylation in HCC cell lines. [score:1]
Figure 4 A. Putative miR-124-1 binding sequence in the 3′-UTR of CASC3 mRNA. [score:1]
Next, we examined the methylation status of miR-124-1 in two normal liver cell lines (QSG-7701, LO2) and HCC cell lines (MHCC-LM3, Huh7, MHCC-97L and HepG2) using bisulfite sequencing PCR. [score:1]
Thus, our current study suggests that activation of the p38 MAPK, ERK and JNK pathways by CASC3 plays a key role in miR-124-1 silencing -induced tumorigenesis in HCC. [score:1]
C. Bisulfite sequencing PCR analysis of miR-124-1 CpG island methylation in two normal and four malignant lines. [score:1]
The position of the pre-miR-124-1 sequence is indicated by black boxes, and the transcription start site is designated as +1. [score:1]
[1 to 20 of 91 sentences]
7
[+] score: 307
Overexpression of miR-124 significantly suppressed the luciferase reporter which contained Sp1 3′UTR and this suppression was interestingly abolished by the mutation of the miR-124 binding site in Sp1 3′UTR, and overexpression of miR-124 led to a significant reduction in Sp1 mRNA and protein levels, but the effect was reduced by miR-124 inhibitor. [score:12]
MiR-124 inhibits HCC metastasis in vivoSince miR-124 overexpression resulted in downregulation of integrin αV subunit expression, then animal experiments were performed to evaluate the influence of miR-124 overexpression on HCC metastasis in vivo. [score:10]
High level of miR-124 expression in HCC directly resulted in low expression of Sp1, which subsequently suppressed integrin αV subunit gene expression. [score:10]
Since miR-124 overexpression resulted in downregulation of integrin αV subunit expression, then animal experiments were performed to evaluate the influence of miR-124 overexpression on HCC metastasis in vivo. [score:8]
These suggested that ectopic expression of miR-124 contributed to the down-regulation of integrin αV subunit gene expression. [score:8]
Moreover, down-regulation of Sp1 by miR-124 subsequently inhibited integrin αV subunit expression since integrin αV subunit gene transcription relied on Sp1 as the major transcription factor in human hepatocellular carcinoma cells as demonstrated in our previous study 19. [score:8]
After transfection of anti-miR-124 inhibitor in SMMC-7721 and BEL-7404 cells, the expression of miR-124 was inhibited, and the expression levels of Sp1 and integrin αV subunit were simultaneously increased by 1.4 and 1.1 folds in SMMC-7721 cells, and 4 and 1.6 folds in BEL-7404 cells compared to negative control group (Fig. 4D). [score:8]
Sp1 is an important transcription factor for integrin αV subunit gene 19, and the down-regulation of Sp1 by miR-124 might lead to the down-regulation of integrin αV subunit gene transcription. [score:7]
Our data further indicated that high level of miR-124 expression inhibited the wound healing, migration and invasion in HCC and suppressed integrin αV which is the malignant driver for anchorage independence. [score:7]
A strong correlation was noted between miR-124 and integrin αV subunit expression levels with the correlation coefficient −0.605 (P < 0.01) (Fig. 2B), indicating that miR-124 was associated with the down regulation of integrin αV subunit expression. [score:6]
In our data, we identified Sp1 mRNA as the direct target of miR-124, and integrin αV gene as subsequent target in HCC. [score:6]
How to cite this article: Cai, Q. Q. et al. MiR-124 inhibits the migration and invasion of human hepatocellular carcinoma cells by suppressing integrin αV expression. [score:6]
These results indicated that miR-124 functioned as a negative regulator or tumor suppressor for the cell growth and migration in HCC, which might be related to its repressing integrin αV subunit expression. [score:6]
In order to confirm miR-124 regulation of integrin αV expression, we investigated and observed the mRNA and protein expression levels of Sp1 and integrin αV subunit in SMMC-7721 and BEL-7404 cells with over -expression of miR-124. [score:6]
In this study we observed that miR-124 alone down-regulated the expression of Sp1 efficiently. [score:6]
The analysis results indicated that there were 53 transcription factors that either matched miR-124 target or were expressed in HCC. [score:5]
The targets of miR-124 were analyzed using four online algorithms including miRanda, TargetScan, PicTar and microRNA. [score:5]
The results of RT-PCR and Western-blotting showed that in the cells with over -expression of miR-124, the expression levels of Sp1 and integrin αV subunit reduced significantly in both SMMC-7721 and BEL-7404 cells (Fig. 4B and C). [score:5]
Having found that miR-124 inhibited wound healing and migration which were related to down -regulating integrin αV subunit, we next investigated the possible regulation of integrin αV subunit expressions by miR-124. [score:5]
Through further analysis we noted that the expression levels of miR-124 in 11 HCC cell lines and other cancer cells was strikingly inversely correlated with the expression of integrin αV which is the driver molecule for the anchorage independence and migration of tumor cells 14. [score:5]
The predicated mRNA target for mature miR-124 was analyzed using four online algorithms including miRanda, TargetScan, PicTar and microRNA. [score:5]
Herein, we confirmed Sp1 as a direct target of miR-124, which played an important role in regulating integrin αV gene transcription. [score:5]
Through analysis using online algorithm TargetScan, we found that among 53 transcription factors screened Sp1 was not only predicted to match miR-124 target but also was the major transcription factor required for integrin αV gene promoter activation in HCC. [score:5]
The miR-124 expressional construct was transfected into human hepatocellular carcinoma cells of either SMMC-7721 or BEL-7404 cells, to achieve over -expression of miR-124. [score:5]
Our current results further showed that overexpression of miR-124 reduced the expression levels of Sp1 and integrin αV subunit significantly. [score:5]
In current study, we noted that the expression level of integrin αV significantly decreased in the cells overexpressing miR-124, but increased when the hepatoma cells were treated with miR-124 antagomir. [score:5]
Through the luciferase reporter assay and binding site mutation, the results showed that miR-124 directly targeted Sp1 mRNA. [score:4]
These results indicated that miR-124 directly targeted Sp1 mRNA via the putative binding sites in the 3′UTR. [score:4]
MiR-124 inhibits integrin αV expression. [score:4]
We further investigated the possible regulation of integrin αV subunit expression by miR-124 and noted that miR-124 has two conserved binding sites on the 3′ untranslated region of transcription factor Sp1 mRNA. [score:4]
These reports shows that the expression of miR-124 was reduced in carcinomas, which may result from multiple regulatory events, such as the methylation of CpG islands. [score:4]
MiR-124 inhibits integrin αV subunit expression. [score:4]
Our data is consistent with these reports that miR-124 was down-regulated in HCC. [score:4]
MiR-124 is abundantly expressed in the brain tissues, but the roles of miR-124 were also noted in gastric cancer 4 and nasopharyngeal carcinoma 6. In this study, we demonstrated that miR-124 was involved in the regulation of migration and metastasis of human hepatocellular carcinoma cells (SMMC-7721 and BEL-7404). [score:4]
This implied that miR-124 regulation of hepatocellular carcinoma cell migration might be related with the expression of integrin αV that is important in HCC cell migration and metastasis. [score:4]
Therefore, our findings identified a novel pathway for miR-124 regulation of HCC metastasis, and miR-124 could possibly be an alternative strategy for controlling integrin αV expression in liver cancer and a viable anticancer therapeutic approach for HCC metastasis. [score:4]
Four online algorithms were used to predicate miR-124 targets (b). [score:3]
Correlation analysis between miR-124 and ITGAV expressions. [score:3]
The red rectangle indicates miR-124, the yellow diamond indicates ITGAV gene, and the blue circles indicate the miR-124 -targeted TF mRNAs. [score:3]
SMMC-7721 or BEL-7404 cell, transfected with miR-124 construct or with miR-124 inhibitor oligonucleotide for 48 h, were harvested and lysed in lysis buffer (1%SDS containing 50 mM NaF, 1.5 mM Na [3]VO [4], 0.5 mM PMSF). [score:3]
These suggested that miR-124 suppressed cell migration in HCC. [score:3]
Since cell migration is usually controlled by integrins, we then analyzed the relationship between miR-124 and integrin αV expression. [score:3]
The group transfected with miR-124 rather than control vector significantly suppressed the luciferase activity of reporter genes containing 3′UTR of Sp1 in both cells. [score:3]
All the transcription factors screened were the predicted targets of miR-124 and all of them were important in HCC. [score:3]
In order to confirm that miR-124 directly targets Sp1 3′UTR, we performed luciferase reporter assay. [score:3]
Further in Hep3B, HepG2 and SK-Hep-1 cells which expressed high levels of integrin αV, the inhibitory effect on the cell migration by miR-124 was investigated (Fig. 2C). [score:3]
The miR-124 inhibitor and their scramble control oligonucleotides were synthesized and provided by Gene Pharma Co. [score:3]
Ectopic overexpression of miR-124 significantly reduced the metastasis foci in either liver or lung tissues in nude mice experiments. [score:3]
We employed the SMMC-7721 cells stably expressing miR-124 and green fluorescence protein (GFP) as the cell mo del for in vivo metastasis studies. [score:3]
We interestingly observed that the expression level of integrin αV subunit was often low when miR-124 level was high. [score:3]
This implied negative association of miR-124 with integrin αV expression levels. [score:3]
After lentivirus infection and selection, SMMC-7721 cells that stably expressed miR-124 (SMMC-7721 [MiR-124]) and control cells (SMMC-7721 [Mock]) (5 × 10 [6]) were injected into 6-week-old female nude mice through the tail veins (6 mice/group) for the assessment of in vivo metastasis. [score:3]
To confirm the role of miR-124 in migration further, both SMMC-7721 and BEL-7404 cells were transfected with specific miR-124 inhibitor. [score:3]
The low level of miR-124 expression may be a candidate biomarker for further prospective molecular stratification of cancer patients possibly for prognosis prediction. [score:3]
These results indicated that miR-124 was capable of suppressing HCC metastasis in vivo. [score:3]
Interestingly, all of these cases showed decreased miR-124 expression except 3 cases. [score:3]
MiR-124 suppresses the wound healing and migration capability of HCC. [score:2]
It was noted in our study that miR-124 played an important negative role in regulation of migration and metastasis of HCC cells. [score:2]
The protein levels of expression of Sp1 and integrin αV also reduced in miR-124 group by 85% and 74% in SMMC-7721, and 77% and 58% in BEL-7404 cells compared to control group. [score:2]
MiR-124 may act together with miR-137 and miR-128 synergistically to regulate neural cells 25. [score:2]
MiR-124 inhibits HCC metastasis in vivo. [score:2]
MiR-124 directly regulates the transcription factor Sp1. [score:2]
In vivo metastasis assaysAfter lentivirus infection and selection, SMMC-7721 cells that stably expressed miR-124 (SMMC-7721 [MiR-124]) and control cells (SMMC-7721 [Mock]) (5 × 10 [6]) were injected into 6-week-old female nude mice through the tail veins (6 mice/group) for the assessment of in vivo metastasis. [score:2]
MiR-124 suppresses the wound healing and migration of HCC. [score:2]
Systemic delivery of miR-124 may perturb the hepatocyte growth and prevent hepatocellular carcinogenesis 34. [score:1]
The miR-124 and integrin αV expression levels were measured in 11 different non-tumor and tumor cell lines with qPCR (Fig. 2A). [score:1]
In 58 cases both integrin αV and miR-124 expression were measured in the same sample. [score:1]
Moreover, the migrated cells through the polyporous membrane were significantly fewer in miR-124 group than control cells (Fig. 1B). [score:1]
The plasmid pLL 3.7-pre-miR-124 which carries green fluorescence protein (GFP) was constructed as described in our previous study 2. Plasmids pLL-3.7-pre-miR-124 and psiCHECK-2 containing Sp1 3′UTR, mutated sequence or psiCHECK-2 control vector were co -transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) at the ratio of 1:3 in weight. [score:1]
SMMC-7721 and BEL-7404 cells were infected with miR-124 or control lentivirus which is an efficient, stable gene delivery tool in mammalian cells to induce stable gain- and loss-of-function phenotypes for individual miRNAs 20 or shRNAs 21. [score:1]
Human hepatocellular carcinoma SMMC-7721, Hep3B, HepG2, SK-Hep-1and non-tumor hepatocyte LO2 cells were transfected with miR-124 or control plasmids and 48 h after transfection, the cells were transferred into the upper chamber of the Millicell inserts with 8-μm pore size polyporous membrane (Millipore, Billerica, MA, USA) in a serum-free DMEM with a cell density of 5 × 10 [6]/mL. [score:1]
Sp1 3′UTR sequence possesses two conserved binding motifs for miR-124, which are well conserved from worm to human being (Fig. 3C). [score:1]
The relative closure in miR-124 group was significantly slower than control (Fig. 1A). [score:1]
In functional studies, reintroduction of miR-124 dramatically repressed the migration and invasion of HCC in vitro and tumor metastasis in vivo. [score:1]
72 hours after wound healing in SMMC-7721 cells, the scratched wound in miR-124 group was not closed as fast as the control group. [score:1]
Expression of miR-124 was measured by RT-PCR (middle) and quantitative RT-PCR (right). [score:1]
HEK-293T and HeLa cells were co -transfected with these reporter constructs and miR-124 or control vectors. [score:1]
Strikingly, the group of mice receiving miR-124 transfection showed significantly fewer metastases colonies in the liver and lung by 79% and 77% respectively. [score:1]
SMMC-7721 and BEL-7404 cells were infected with lentivirus containing miR-124 (SMMC-7721 [miR-124], BEL-7404 [miR-124]) or control virus (SMMC-7721 [control], BEL-7404 [control]). [score:1]
The successful infection of miR-124 lentivirus was observed with fluorescence microscope (Fig. 4A) and the over -expression of miR-124 was validated in the miR-124 group by RT-PCR measurement (Fig. 4A middle & right). [score:1]
Four weeks after the injection by tail vein of nude mice, the metastasis foci were examined at the liver and lung of both miR-124 and control groups. [score:1]
MiR-124 regulates the transcription factor Sp1. [score:1]
The invasion capability of SMMC-7721 cells transfected with miR-124 through Matrigel in miR-124 group was lower than control (data not shown). [score:1]
MiR-124 is encoded in three genomic loci [miR-124a-1 (8p23.1), miR-124a-2 (8q12.3), and miR-124a-3 (20q13.33)], but these three miR-124a loci give rise to only one mature miRNA, miR-124 (Fig. 3A top). [score:1]
Parallel with the anatomy results, H&E staining of lungs also showed that the number and size of micro-metastases foci were significantly more and larger in control group than those in miR-124 group (p < 0.001, Fig. 5B). [score:1]
These findings suggest that miR-124 plays an important role in the metastatic and/or invasive potential of HCC, which could be a potential therapeutic approach for HCC. [score:1]
[1 to 20 of 86 sentences]
8
[+] score: 306
The miR-124 expression profile in the developing embryonic cortex includes an abrupt upregulation in apical precursors undergoing direct neuronogenesis as well as a two-step upregulation in basal progenitors during indirect neuronogenesis. [score:11]
Conversely, the miR-124 expression profile appeared biphasic in indirect neuronogenesis; a transition from low to intermediate expression took place within Tbr2 [+ ]basal progenitors that had lost contact with the ventricular cavity, and a further upregulation was localized in basal progenitors or early post-mitotic β-tubulin [+ ]neurons (Figures 2 and 7B). [score:9]
We show that miR-124 expression is progressively up-regulated in the mouse embryonic neocortex during the apical to basal transition of neural precursor cells and upon their exit from cell cycle, and that miR-124 is involved in the fine regulation of these processes. [score:7]
The presence of isolated β-tubulin [+ ]cells and Pax6 [- ]cells within the VZ, both of which expressed miR-124 highly, suggested that an abrupt upregulation of miR-124 might occur during direct neuronogenesis (Figures 2 and 7A). [score:7]
In their study, a first upregulation of miR-124 occurred after the transition of neural stem cells to transit amplifying cells and a second upregulation was generally associated with the exit of neuroblasts from the cell cycle [36, 56, 59]. [score:7]
Such upregulation was relatively weak for miR-124; however, levels of this miRNA in electroporated apical precursors were often above those of endogenously expressed miR-124 in the VZ, allowing functional perturbation of the system (Figures 3 and 6; Additional file 2). [score:6]
On the other hand, not all β-tubulin [+ ]neurons in the outer SVZ expressed miR-124 at the highest levels (Figure 2M, arrows), suggesting a remarkable variability in miR-124 upregulation along the neuronogenic lineage. [score:6]
However, a more detailed analysis showed that the amplitude of this upregulation was moderate and only strongly electroporated periventricular cells expressed miR-124 at levels above the local natural range (Additional file 2). [score:6]
By integrating locked nucleic acid (LNA)-oligo in situ hybridization, electroporation of stage-specific reporters and immunofluorescence, we reconstructed the cortico-cerebral miR-124 expression pattern during direct neuronogenesis from apical precursors and indirect neuronogenesis via basal progenitors. [score:5]
To assess the effectiveness of pPri-miR-124(2) to over-express mature miR-124, we built up a dedicated sensor plasmid, cloning a Lhx2_3' untranslated region cDNA fragment harboring two miR-124 responsive elements [48- 50] into the pDsRed2-N1 plasmid (Clontech) in-between the pCMV-DsRed2 and SV40pA modules (plasmid pmiR-124-sensor) (Figure 3A). [score:5]
Makeyev et al [38] performed cross-correlation studies on the expression of miR-124 and selected targets of it. [score:5]
miR-124 over -expression channels non-neural HeLa cells to neuron-specific molecular profiles [34], inhibits proliferation in medulloblastomas and adult neural precursors [35, 36] and promotes neuronal differentiation of committed neural precursors [36, 37]. [score:5]
To overexpress miR-124 in primary cortical precursor cells, we transferred the Pri-miR-124(2) cDNA fragment into the DsRed2 derivative of the constitutive lentiviral expressor pCCLsin. [score:5]
Stimulation of direct neuronogenesis and expansion of the basal compartment occurs at the expense of the apical one upon miR-124 over -expression. [score:4]
Inhibition of BrdU uptake and stimulation of direct neuronogenesis has been reported already in the chicken embryonic spinal cord, specifically upon electroporation of mature miR-124 [40, 42]. [score:4]
Electroporation of our gain-of-function constructs was followed by concerted upregulation of EmGFP and miR-124. [score:4]
Second, miR-124 overexpression stimulates direct neuronogenesis and promotes transition of neural precursors from the apical to the basal compartment (Figure 7). [score:4]
Looking for mechanisms linking miR-124 overexpression with promotion of apical-to-basal transition, we assayed expression of β1-integrin. [score:4]
Consistent with this hypothesis, neuroblasts infected by LV_Pri-miR-124(2) and allowed to differentiate under FCS specifically and progressively down-regulated DsRed2 (Additional file 3) concurrent with enhanced maturation of their primary DsRed2/miR-124(2) transcripts to Pre-miR-124. [score:4]
In summary, overexpression of miR-124 seems to promote precursor transition from the apical to the basal compartment and to stimulate direct differentiation of apical progenitors to post-mitotic neurons. [score:4]
Then, by in vitro lentivirus -based gene transfer and in utero electroporation of miR-124 -expressing plasmids, we addressed the roles played by this molecule in the regulation of embryonic cortico-cerebral neuronogenesis. [score:4]
Unexpectedly, however, electroporation of Pri-miR-124(2) in the mouse cerebral cortex did not elicit any detectable down-regulation of β1-integrin. [score:4]
We confirmed that miR-124 is progressively up-regulated during embryonic neuronogenesis, as previously reported [36, 38, 57, 58]. [score:4]
Following overexpression of miR-124, both direct neuronogenesis and progression of neural precursors from the apical to the basal compartment were stimulated. [score:4]
In vivo electroporation of pPri-miR-124(2) into the E12.5 lateral cortex resulted in specific upregulation of miR-124 in periventricular layers (Figure 3J, K). [score:4]
Transduction of primary cortical precursor cells with the resulting LV_Pri-miR-124(2) promoted neuronal generation, as shown by the increase in β-tubulin -expressing cells at 72 hours post-infection (Figure 3F, G). [score:3]
A reduction in proliferation has recently been reported to occur in the mammalian embryonic spinal cord upon combined miR-9*/miR-124 overexpression in neural precursors [41]. [score:3]
This protein is necessary for integrity of adherens junctions among radial glial cells and the subpial basal membrane [56] and is an established target of miR-124 in chicken [42]. [score:3]
Furthermore, isolated Pax6 [- ]and Tbr2 [- ]cells expressed miR-124 at the highest level (Figure 2D, J, arrowheads). [score:3]
We cloned the Pri-miR-124(2) cDNA fragment [48, 49] into the BLOCK-iT™ expression vector (Invitrogen) in-between the pCMV-EmGFP and TKpA modules in place of Pri-miR-155 derivative cDNA sequences (plasmid pPri-miR-124(2)). [score:3]
In particular, with the appearance of the SVZ, we found that miR-124 displayed three distinct expression levels: low in the VZ [36, 57], intermediate in the SVZ and high in more marginal layers (Figure 1; Additional file 1). [score:3]
This domain is quite complementary to that expressing miR-124 at high levels. [score:3]
Magnifications of boxed insets to the right show an EmGFP [+ ]electroporated cell co -expressing huge amounts of miR-124 and β-tubulin (arrow), as well as another EmGFP [+]/miR-124 [+ ]cell negative for β-tubulin (asterisk). [score:3]
Figure 7 Schematic of the miR-124 expression profile along neuronogenic lineages and the phenotype of miR-124 gain-of-function electroporated cortices. [score:3]
These effects were associated with strong over -expression of miR-124 in this zone (Figure 5C, arrows). [score:3]
Specific faint expression of miR-124 in the E14.5 VZ. [score:3]
Numbered magnifications of boxed areas in (D, G, J, M) show Pax6, pTα1-EGFP, Tbr2 and β-tubulin in cells expressing different levels of miR-124 Arrowheads in (D1), (J1) and (M) point to Pax6 [-]/miR-124 [high], Tbr2 [-]/miR-124 [high ]and β-tubulin [-]/miR-124 [high ]elements, respectively. [score:3]
The miR-124 expression pattern reported above suggested active involvement in promotion of cortico-cerebral neuronogenesis. [score:3]
We replicated the last result in vitro by over -expressing Pri-miR-124(2) in dissociated cortical neuroblasts, but only when these precursors were kept under differentiating medium (Figure 3F-I). [score:3]
Click here for file Levels of miR-124 expression in the E14.5 VZ after in vivo E12.5 pPri-miR-124 electroporation. [score:3]
Finally, scattered cells expressing miR-124 at high levels also appeared in the VZ (Figure 1D, E). [score:3]
Levels of miR-124 expression in the E14.5 VZ after in vivo E12.5 pPri-miR-124 electroporation. [score:3]
Arrowheads in boxed inset magnifications denote mid-to -high miR-124 expression levels, which are specifically restricted to heavily electroporated elements. [score:3]
Figure 3Overexpression of miR-124 in vitro and in vivo. [score:3]
Further studies are required to clarify modulation of miR-124 expression in vertebrates. [score:3]
Click here for file Specific faint expression of miR-124 in the E14.5 VZ. [score:3]
Figure 1 Time course analysis of miR-124 expression. [score:3]
Finally, high-level miR-124 expression elicited in apical progenitors (including pin-like cells; Figure 6, arrowheads) upon in vivo electroporation may support these phenomena. [score:3]
No miR-124 signal was detectable in the cortex at E10.5, although it was strongly expressed by post-mitotic neurons of the ganglionic eminence at this time (Figure 1A). [score:3]
Finally, we specifically detected an accumulation of cells highly expressing miR-124 and with multipolar morphology at the border between the VZ and SVZ from E14.5 onward (Figures 1 and 2I, L). [score:3]
A reduction in the number of dividing cells also takes place in vivo in the adult mouse SVZ upon Pri-miR-124(3) overexpression. [score:3]
The pPri-miR-124(2) construct contains the 285-bp mouse Pri-miR-124(2) genomic fragment (chr3 (+):17695562-17695846) cloned into the BLOCK-iT™ expression vector (Invitrogen - Life Technologies Corporation, Carlsbad, CA, U. S. A. ) in-between the pCMV-EmGFP and TK_pA modules using SalI and XbaI enzyme restriction sites. [score:3]
First, miR-124 is expressed in the developing embryonic cortex according to a complex pattern. [score:3]
In this study, by integrating LNA-oligo in situ hybridization, electroporation of stage-specific reporters and immunofluorescence, we carefully reconstructed the miR-124 expression pattern in the developing mouse cerebral cortex. [score:3]
This hypothesis is consistent with the discrepancy between the expression profiles of miR-124, which is mainly restricted to abventricular layers (Figures 1 and 2), and its precursors, which are conversely detectable at E14.5 at similar levels throughout the cortical wall [58]. [score:3]
Asterisks in (M2, M3) demarcate SVZ β-tubulin [- ]cells expressing high levels of miR-124. [score:3]
The miR-124 expression pattern became simplified at post-natal day 4 (P4), when the signal was restricted to the grey matter and was more intense in recently generated layer 2 to 4 neurons (Figure 1F). [score:3]
In vivo promotion of neuronogenesis by miR-124The miR-124 expression pattern reported above suggested active involvement in promotion of cortico-cerebral neuronogenesis. [score:3]
Overexpression of miR-124. [score:3]
We systematically studied the miR-124 expression pattern in the developing mouse cerebral cortex by LNA-oligo in situ hybridization [44]. [score:3]
Arrows in (M1) indicate SVZ β-tubulin [+ ]cells expressing intermediate levels of miR-124. [score:3]
Figure 6 Specific miR-124 overexpression in pPri-miR-124(2) electroporated periventricular neural precursors of the E14.5 cortex. [score:3]
To finely map the previously described different miR-124 expression levels to these compartments, these levels were compared with the distribution of specific protein markers at E14.5. [score:2]
Limited production of miR-124 despite abundant levels of the EmGFP/Pri-miR-124(2) transcript available in apical progenitors might stem from suboptimal, regulated processing of this chimeric transcript to mature miRNA. [score:2]
Post-transcriptional regulation of miR-124 has already been addressed in the developing Drosophila nervous system, where dFMR1 is required for its proper biogenesis [67]. [score:2]
Compared with pPri-miR-155neg_control/pmiR-124-sensor control, cotransfection of pPri-miR-124(2) and pmiR-124-sensor in HeLa cells specifically reduced the fraction of fluorescent cells expressing DsRed2 by about 60% (Figure 3B, C). [score:2]
These findings shed light on the role of miR-124 during early cortical development in mammals. [score:2]
This may mean that miR-124 -dependent regulation of β1-integrin is peculiar to the chicken neural tube and does not take place in the mammalian cortex. [score:2]
Their positions corresponded to those of VZ and SVZ cells, respectively, which co-expressed β-tubulin and abundant miR-124 (Figure 2M, arrowheads); they were thus considered to be newborn neurons. [score:2]
Among the best characterized miRNAs specifically expressed in the CNS is miR-124 [31]. [score:1]
Apical precursors, characterized by high Pax6 expression [7], generally displayed faint miR-124 staining (Figure 2D, box 2). [score:1]
Remarkably, we also found that miR-124 facilitates neuronogenesis in a permissive molecular environment, but is not able to initiate such a process per se, similar to what was previously described [37, 38, 68]. [score:1]
To cast light on the role played by miR-124, we developed a set of molecular tools for gain-of-function analysis. [score:1]
Click here for file Distribution of activated-Caspase3 [+ ]apoptotic cells within the cortical wall of E14.5 brains electroporated 2 days earlier with pPri-miR-124(2) or pPri-miR-155/neg_control. [score:1]
By electroporating a Pri-miR-124(2) precursor into the developing mouse cortex, we were able to promote cortical neuronogenesis. [score:1]
Distribution of β1-integrin within the cortical wall of E14.5 brains electroporated 2 days earlier with pPri-miR-124(2) or pPri-miR-155/neg_control. [score:1]
Finally, we did not find any increase in cell death upon Pri-miR-124(2) electroporation (Additional file 6), in contrast to what was previously reported for the chicken embryo [42]. [score:1]
Click here for file Distribution of β1-integrin within the cortical wall of E14.5 brains electroporated 2 days earlier with pPri-miR-124(2) or pPri-miR-155/neg_control. [score:1]
On other hand, older elements, lying more marginally (and including basal progenitors as well as newborn neurons), displayed enhanced, intermediate miR-124 staining (Figure 2J, box 3). [score:1]
Magnifications of boxed areas illustrate the faint staining detectable in the VZ (black arrowheads) but not in mesenchymal tissue (black harrow) upon miR-124 hybridization, as well as the absence of any signal in samples hybridized with miR-425 or miR-207 (asterisks). [score:1]
Nevertheless, displacement of Pax6 [+ ]and Tbr2 [+ ]progenitors was equally present in controls and Pri-miR-124(2) electroporated embryos, and so does not affect the results of the miR-124 gain-of-function analysis. [score:1]
Subsequently, the DsRed2-Pri-miR-124(2) and the Dsred2-Pri-miR-155neg_control AgeI/ SmaIfragments were transferred from the resulting plasmids into the pCCLsin. [score:1]
For each marker, at least three embryos electroporated with pPri-miR-124(2) and three electroporated with pPri-miR-155neg_control constructs (N ≥ 3+3) were analyzed and, for every embryo, at least 400 EmGFP [+ ]cells were scored. [score:1]
Upon pPri-miR-124(2) electroporation, the fraction of intermitotic EmGFP [+ ]cells was specifically reduced by 20% (N = 5+5; P < 0.05) when assessed by the S-phase marker terminally administered bromodeoxyuridine (BrdU). [score:1]
Electroporation of both pPri-miR-124(2) and pPri-miR-155neg_control also led to displacement of apical Pax6 [+ ]and basal Tbr2 [+ ]precursors towards the cortical plate (in six out of eight and eight out of ten embryos, respectively; Figure 4A, B, arrowheads). [score:1]
Distribution of activated-Caspase3 [+ ]apoptotic cells within the cortical wall of E14.5 brains electroporated 2 days earlier with pPri-miR-124(2) or pPri-miR-155/neg_control. [score:1]
Divergent temporal progression of DsRed2 fluorescence in E12.5 neuroblasts infected by LV_Pri-miR-124(2) or LV_Pri-miR-155/neg_control and allowed to differentiate in FCS. [score:1]
Remarkably, at all ages investigated, miR-124 expression was tightly restricted to the CNS, being completely absent in the surrounding mesenchymal tissue (Figure 1; Additional file 1) [45, 46]. [score:1]
Heterogeneous miR-124 expression was conversely detectable in basal precursors, characterized by weak Pax6 staining and robust Tbr2 immunoreactivity (Figure 2J) [7]. [score:1]
To confirm this and to clarify the cellular mechanisms underlying such promotion, we electroporated pPri-miR-124(2) or pPri-miR-155neg_control into the lateral ventricle of E12.5 mouse embryos and, 2 days later, immunoprofiled emerald green fluorescent protein (EmGFP) [+ ]electroporated cells and their progenies for molecular markers of neural precursors and newborn neurons. [score:1]
We detected a pronounced displacement of apical Pax6 [+ ]and basal Tbr2 [+ ]progenitors, just beneath the cortical plate, in both pPri-miR-124(2) and pPri-miR-155_neg_control electroporated brains (Figure 4A, B, arrowheads). [score:1]
In vivo promotion of neuronogenesis by miR-124. [score:1]
In situ hybridization was carried out on 10 μm coronal brain slices using miRCURY 5' DIG labeled detection probes (LNA) for mmu-miR-124, mmu-miR-425 and mmu-miR-207 according to the manufacturer's instructions (Exiqon, Vedbaek, Denmark), as previously described [44]. [score:1]
HeLa cells grown in 10% FCS and Dulbecco's modified Eagle's medium with Glutamax (DMEM/Glutamax; Invitrogen) were co -transfected with either pPri-miR-124(2) or pPri-miR-155neg_control, each pre-mixed with pmiR-124-sensor plasmid at a molar ratio of 30:1, using Lipofectamine (Invitrogen) and according to the manufacturer's instructions. [score:1]
At both these ages, miR-124 staining could distinguish the subplate from the cortical plate. [score:1]
Click here for file VZ neuronal differentiation in E14.5 cerebral cortex electroporated 2 days earlier with pPri-miR-124(2). [score:1]
The arrowhead in (B) points to the pPri-miR-124(2)-electroporated region, which does not display any overt reduction of β1-integrin immunoreactivity. [score:1]
Distribution of miR-124 and pCMV -driven EmGFP on E14.5 midfrontal telencephalic sections from brains electroporated at E12.5 with the plasmids pPri-miR-124(2) and pPri-miR-155/neg_control, respectively. [score:1]
Among Tbr2 [+ ]cells, presumptively younger elements, lying at more ventricular levels, showed weak miR-124 staining, like apical precursors (Figure 2J, box 2). [score:1]
Consistently, administration of antisense miR-124 to in vitro cultures of SVZ elements increases BrdU uptake by C-type transit amplifying cells and A-type neuroblasts, slowing down transition from the former to the latter [36]. [score:1]
Figure 2 Comparative profiling of cortical periventricular layers for miR-124 and markers of apical progenitors (Pax6 and pTα1 -driven EGFP), basal progenitors (Tbr2) and post-mitotic neurons (β-tubulin). [score:1]
pLV_Pri-miR-124(2) and pLV_Pri-miR-155neg_control, encoding lentiviral RNA genomes, were generated as follows. [score:1]
In two out of five analyzed embryos, pPri-miR-124(2) electroporation specifically elicited strong activation of the post-mitotic markers β-tubulin (Figure 5A, B, arrowheads) and Tbr1 [7] (Figure 5D, E, arrowheads) as well as neurite outgrowth (Additional file 5, arrowheads) in the VZ. [score:1]
Double arrowheads in (G3) denote pTα1-EGFP [+]/miR-124 [high ]cells that no longer contact the ventricular cavity. [score:1]
Plasmids pLV_Pri-miR-124(2) and pLV_Pri-miR-155neg_control were used to produce lentiviral vectors LV_Pri-miR-124(2) and LV_Pri-miR-155neg_control as previously described [51]. [score:1]
This phenomenon was replicated upon electroporation of pEGFP-C1 (Additional file 4, arrowheads), which shares the pCMV-EGFP module with the above two plasmids but does not harbor the Pri-miR stem-loop moiety, indicating that miR-124 or stem-loop specificity are not involved in it. [score:1]
Briefly, the Pri-miR-124(2) and Pri-miR-155neg_control DraI/ BglII fragments were transferred from pPri-miR-124(2) and pPri-miR-155neg_control, respectively, into the pDsRed2-N1 NotI-blunted/ BglII-cut plasmid downstream of the DsRed2 module. [score:1]
Distribution of miR-124, pCMV -driven EmGFP and neuron-specific β-tubulin in mid-frontal sections from brains electroporated in utero at E12.5 with pPri-miR-124(2). [score:1]
miR-124 may be specifically detected in: apical progenitors still connected to the ventricle (arrowheads in (A, B)) or undergoing mitosis (arrow in (A)); basal progenitors (asterisk in (B)); and nascent neurons still connected to the ventricle (arrowheads in (C)). [score:1]
VZ neuronal differentiation in E14.5 cerebral cortex electroporated 2 days earlier with pPri-miR-124(2). [score:1]
This may also account for the progressive lowering of DsRed2 fluorescence we found in in vitro differentiating neurons harboring a DsRed2/Pri-miR-124(2) transgene. [score:1]
miR-124 functions have also been studied in vivo in the developing chick spinal cord [40, 42], however, these studies led to some contrasting conclusions. [score:1]
Among the cortical miRNAs, miR-124 has been consistently shown to promote neuronogenesis progression in a variety of experimental contexts. [score:1]
So far, however, the role of miR-124 in mammalian embryonic corticogenesis has been determined in vivo only partially. [score:1]
For each marker under analysis, cell counting was performed on at least three different electroporated embryos for both pPri-miR-124(2) and pPri-miR-155 constructs (N ≥ 3+3); three sections from each electroporated embryo spaced 100 μm apart along the rostro-caual axis were inspected. [score:1]
Figure 5Immunoprofiling of cortical periventricular layers after in utero electroporation of plasmids pPri-miR-124(2) and pPri-miR-155/neg_control; part II. [score:1]
Figure 4Immunoprofiling of cortical periventricular layers after in utero electroporation of plasmids pPri-miR-124(2) and pPri-miR-155/neg_control; part I. (A, B) Distribution of terminally administered BrdU, Pax6, Tbr2, phospho-histone3 (PHH3) and pCMV -driven EmGFP on E14.5 mid-frontal sections from brains electroporated in utero at E12.5 with plasmids pPri-miR-124(2) and pPri-miR-155/neg_control. [score:1]
By integrated use of in utero electroporation of stage-specific reporter genes, locked nucleic acid (LNA)-oligo in situ hybridization and immunofluorescence, we investigated miR-124 expression in the developing mouse cortex. [score:1]
[1 to 20 of 118 sentences]
9
[+] score: 305
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-2, mmu-mir-124b
showed that GATA6 protein levels were downregulated by miR-124 overexpression in QBC939 cells (Fig.   3a) and upregulated by miR-124 inhibition in RBE cells (Fig.   3b). [score:11]
miR-124 downregulates GATA6 expression by directly targeting its 3′-UTR. [score:9]
Because a bioinformatics prediction analysis indicated that the 3′-UTR of GATA6 mRNA had a target site for miR-124, we determined whether miR-124 downregulated GATA6 by targeting its 3′-UTR. [score:8]
Moreover, cell migration was significantly decreased by miR-124 overexpression in QBC939 cells and upregulated by miR-124 inhibition in RBE cells (Fig.   2e). [score:8]
miR-124 decreases GATA6 expression by directly targeting its 3′-UTR, which in turn inhibits CCA cell invasion and metastasis. [score:8]
By targeting GATA6, miR-124 may also downregulate 67LR expression and play important roles in these processes during CCA cell metastasis. [score:8]
Here, we showed that a downregulation of miR-124 expression might contribute to the aberrant expression of GATA6 in CCA. [score:8]
Our data suggested that miR-124 decreases GATA6 expression by targeting its 3′-UTR, which in turn inhibits CCA invasion and metastasis. [score:7]
Downregulation of miR-124 contributed to CCA invasion and metastasis, indicating its tumour-suppressor function. [score:6]
a, b The effect of miR-124 overexpression and downregulation on GATA6 protein levels in CCA cells, determined by western blot analysis. [score:6]
Moreover, miR-124 inhibited CCA cell invasion and metastasis by downregulating GATA6. [score:6]
miR-124 inhibits CCA invasion and metastasis by downregulating GATA6. [score:6]
Our data suggest that miR-124 might inhibit invasion and metastasis of CCA cells through downregulation of GATA6. [score:6]
miR-124 downregulated GATA6 by targeting the 3′-UTR. [score:6]
Because QBC939 cells exhibited a lower miR-124 level, overexpression of miR-124 was induced in QBC939 cells (Fig.   2b), and downregulation of miR-124 was performed in RBE cells (Fig.   2c). [score:6]
Previous studies have shown that miR-124 inhibits cancer cell invasion and metastasis by targeting other molecules, including slug [13], Rac-1 [12, 28], SMYD3 [18], SphK1 [29], and ROCK1 [30]. [score:5]
Transwell assays showed a significant decrease in QBC939 cell invasion after miR-124 overexpression (Fig  2d), whereas RBE cell invasion was significantly increased by miR-124 downregulation (Fig.   2d). [score:5]
The miR-124 -induced suppression of CCA invasion was abrogated by remedial expression of GATA6. [score:5]
GATA6 expression was decreased by miR-124 overexpression in liver masses from nude mice. [score:5]
miR-124 significantly inhibited the luciferase activity of reporter genes containing the wild-type GATA6 3′-UTR, whereas the inhibition was significantly rescued by mutating the miR-124 -binding site (Fig.   3f). [score:5]
Remedial GATA6 expression significantly abrogated the miR-124 -induced suppression of QBC939 cell invasion and migration in Transwell and wound healing assays (Fig.   4c and d). [score:4]
Furthermore, many miR-124-decreased CCA patients did not have HCV infections, indicating that there might be other mechanisms regulating miR-124 expression during CCA progression. [score:4]
In the present study, we found miR-124 was downregulated in cancerous samples from CCA patients. [score:4]
Here, we found that miR-124 was downregulated in both intrahepatic and extrahepatic CCA. [score:4]
Among the numerous miRNAs, we focused on miR-124 based on the following observations: (1) Recently, mir-124 was reported to be downregulated and to affect metastasis in several types of cancer, including hepatocellular carcinoma, pancreatic cancer, breast cancer, prostate cancer, glioma and lung cancer [11– 16]. [score:4]
miR-124 has been reported to be downregulated by the hepatitis C virus (HCV) core protein in HCV-related intrahepatic CCA [18]. [score:4]
Recent studies have shown that aberrant DNA methylation plays important roles in miR-124 downregulation in several types of cancers, including hepatocellular carcinoma, gastric cancer, colon cancer, lung cancer, lymphoma, and pancreatic cancer [12, 19– 21]. [score:4]
In conclusion, we show miR-124 is downregulated in CCA. [score:4]
miR-124 inhibited the luciferase activity of reporter genes containing the wild-type GATA6 3′-UTR, which was abrogated by mutation of the binding site. [score:4]
c, d Remedial expression of GATA6 significantly abrogated the miR-124 -induced suppression of QBC939 cell invasion and migration in Transwell and wound healing assays. [score:4]
Fig. 5Expression of miR-124 affected overall survival (a) and recurrence (b) in 57 CCA patients following surgical resection, determined by Kaplan–Meier analysis Deregulation of miRs has been reported in various cancer tissues from numerous profiling data [17]. [score:4]
Fig. 5Expression of miR-124 affected overall survival (a) and recurrence (b) in 57 CCA patients following surgical resection, determined by Kaplan–Meier analysis We first compared the miR-124 expression in 57 CCA tissue samples and 38 matched paracancerous samples. [score:4]
These cDNAs were used to analyse the expression of miR-124 and GATA6 by qPCR using a SYBR premix Ex Taq kit (TaKaRa, Dalian, China). [score:3]
The number of distant masses was significantly lower by miR-124 overexpression (Fig.   2f). [score:3]
These data suggested that miR-124 inhibited CCA migration and invasion in vitro. [score:3]
In addition, miR-124 may potentially be a new prognostic indicator and molecular target for treatment of CCA. [score:3]
miR-124 expression were separated to high and low levels by the median value. [score:3]
miR-124 expression is negatively correlated with prognosis in CCA patients. [score:3]
f Validation of miR-124 expression in the liver masses. [score:3]
miR-124 expression was inversely associated with GATA6 in 57 cancerous samples. [score:3]
f The effect of miR-124 overexpression on QBC939 cell metastasis following xenotransplantation into nude mice by intrasplenic injection. [score:3]
The data suggested that miR-124 expression is decreased in CCA, and decreased miR-124 level is correlated with enhanced metastatic behaviour. [score:3]
Although our results showed a potential new target of miR-124 and the important role of this pathway in CCA cell metastasis, there must be other pathways by which miR-124 exerts its effects. [score:3]
c, d Correlation between GATA6 and miR-124 expression in 57 CCA samples. [score:3]
miR-124 inhibits CCA cell invasion and metastasis in vitro and in vivo. [score:3]
Therefore, the result suggest that miR-124 expression is negatively correlated with the prognosis of CCA patients. [score:3]
Cells were transfected with 100 nM miR-124 mimic (ExmiR-124) or 200 nM miR-124 inhibitor (InmiR-124) (Ribobio, Guangzhou, China) in the six-well plate using Lipofectamine 2000 (Invitrogen). [score:3]
miR-124 expression was separated to high and low levels according to the median value. [score:3]
These data suggested that miR-124 inhibits invasion and metastasis of CCA cells. [score:3]
miR-124 significantly inhibited invasion and migration of CCA cells in vitro. [score:3]
In-miR-124: CCA cells transfected with miR-124 inhibitors; Ex-miR-124: CCA cells transfected with miR-124 mimics. [score:3]
Furthermore, miR-124 inhibited CCA cell metastasis in nude mice. [score:3]
The expression levels of miR-124 and GATA6 in cancerous tissues from 57 CCA patients was detected by RT-PCR and IHC. [score:3]
We also determined the miR-124 expression level in the liver masses and found that miR-124 was increased in the miR-124 group (Fig.   4f). [score:3]
In addition, we demonstrated that GATA6 is a new potential target of miR-124. [score:3]
We therefore propose that the restoration of miR-124 expression might represent a potential strategy for CCA therapy. [score:3]
Decreased expression of miR-124 is correlated with higher metastatic behaviour in clinical CCAs. [score:3]
The protein levels of GATA6 were negatively regulated by miR-124. [score:2]
Finally, we examined the mechanism of miR-124 in regulating GATA6 in CCA cells. [score:2]
Whether miR-124 participates in regulating other hallmarks of CCA by targeting GATA6 needs to be investigated further. [score:2]
The above data indicated that GATA6 might be regulated by miR-124 in CCA cells. [score:2]
In this study, we studied the potential function of miR-124 in CCA and the mechanism of GATA6 regulation. [score:2]
d The effect of miR-124 overexpression on CCA cell invasion, as shown by Transwell assays in vitro. [score:2]
miR-124 is also reported to participate in regulating angiogenesis, chemosensitivity and proliferation of cancers [14, 36, 37]. [score:2]
We compared postoperative and disease-free survival between miR-124 [high] and miR-124 [low] patients with a Kaplan-Meier analysis. [score:2]
Thus, we postulate that miR-124 might participate in the regulation of GATA6 in CCA. [score:2]
The miR-124 level was significantly lower in cancerous samples compared with paracancerous samples (Fig.   1a), indicating that expression of miR-124 decreased in CCA. [score:2]
Whether DNA methylation also participates in the downregulation of miR-124 in CCA, especially HCV -negative CCA, needs to be investigated further. [score:2]
We first compared the miR-124 expression in 57 CCA tissue samples and 38 matched paracancerous samples. [score:2]
e The effect of miR-124 overexpression on CCA cell migration according to wound healing assays in vitro. [score:2]
QBC939 cells were transfected with a miR-124 agomir (200 nM) or an negative control for 48 h (200 nM) (Ribobio, Guangzhou, China). [score:1]
The miR-124 level was inversely associated with lymph node involvement and distant metastasis. [score:1]
a, b Validation of miR-124 and GATA6 levels after transfection. [score:1]
A low miR-124 level significantly related with lymph node involvement but not with gender, age, location, histological grade, or T status (Table  1). [score:1]
The present results, together with the above evidence, indicate the important role of the miR-124-GATA6-67LR pathway in CCA cell invasion and metastasis. [score:1]
b, c Validation of the miR-124 levels after transfection. [score:1]
Cholangiocarcinoma Invasion and metastasis miR-124 GATA6 Cholangiocarcinoma (CCA) is a highly malignant cancer with a poor prognosis. [score:1]
The luciferase reporters were constructed containing mutant or wild-type 3′-UTRs of the GATA6 gene (Fig.   3e) and cotransfected them with miR-124 mimics into QBC939 cells. [score:1]
The cells were co -transfected with 10 nM miR-124 mimics or NC and 10 ng of firefly luciferase reporter construct. [score:1]
In the present study, the expression profile of miR-124 in CCA samples was investigated. [score:1]
c miR-124 levels between CCA primary cancerous samples with distant metastasis (N = 17) and without distant metastasis (N = 40). [score:1]
Our previous and present results suggest that miR-124 and GATA6 play important roles in this network. [score:1]
In brief, The CDS template of GATA6 without the miR-124 binding site was synthesized chemically and amplified by PCR. [score:1]
Intraperitoneal injection was performed with miR-124 agomir (5 nmol each) or negative control agomir (5 nmol each) twice a week for 2 weeks, which began at week 3 after xenotransplantation. [score:1]
b miR-124 levels between CCA primary cancerous samples with lymphnode involvement (N = 32) and without lymphnode involvement (N = 25). [score:1]
a The miR-124 levels in two CCA cell lines, QBC939 and RBE, were lower than those in cultured primary biliary epithelial cells, determined by real-time PCR analysis. [score:1]
miR-124 levels was negatively correlated with GATA6 in 57 CCA samples (Fig.   3d). [score:1]
Taken together, these findings suggest an important role of miR-124 in CCA invasive and metastatic potential. [score:1]
GATA6 was decreased in the miR-124 group (Fig.   4e), which was consistent with the diminished metastatic behaviour. [score:1]
a miR-124 levels between CCA cancerous samples (N = 57) and paracancerous samples (N = 38). [score:1]
Ex-miR-124: CCA cells transfected with miR-124 mimics. [score:1]
f The effect of miR-124 on the relative luciferase activity of the GATA6 wild-type and mutant 3′-UTR constructs. [score:1]
[1 to 20 of 92 sentences]
10
[+] score: 283
Inhibition of mTOR signaling by rapamycin upregulated the expression of miR-124, which was followed by abnormal development of intersegmental vessels of zebrafish embryos [21]. [score:9]
CCK-8 assays indicated that over -expression of miR-124 inhibited the viability of HUVECs in a time -dependent manner, while miR-124 inhibitor resulted in opposite effects (Figure 3A). [score:6]
Further, flow cytometry assays showed that miR-124 mimics transfection significantly reduced CD151 expression, and miR-124 inhibitor increased CD151 expression in HUVECs (Figure 4D). [score:6]
Taken together, these results suggest that miR-124 suppresses cardiac angiogenesis by directly targeting CD151 in HF. [score:6]
Further, miR-124 was significantly downregulated in glioma specimens and inhibited angiogenesis in glioma [22]. [score:6]
These results suggest that miR-124 inhibits CD151 expression by directly binding to its 3′ UTR. [score:6]
miR-124 was reported to inhibit the transdifferentiation from bone marrow-derived mesenchymal stem cells into cardiomyocytes in heart repair after injury by targeting STAT3 [32]. [score:5]
Consistently, we found that over-expressed miR-124 significantly decreased the eNOS phosphorylation and NO content in the heart, while re-expressed CD151 restored both. [score:5]
Using miRNA target prediction programs, we found that CD151 was a putative miR-124 targets, and the predicted binding sites were highly conserved during evolution (Figure 4A). [score:5]
Overexpression of miR-124 aggravated cardiac dysfunction and cardiac microvascular injury induced by Ang II infusion in vivoTo explore the effects of miR-124 in cardiac maladaptive hypertrophy and HF, rAAV-miR-124 and rAAV-miR-124 TuDs were used to manipulate the expression of mature miR-124 in Ang II -treated mice. [score:5]
Regarding Ang II -induced cardiac microvascular injury, enforced CD151 expression counteracted the deleterious effects of rAAV-miR-124, as indicated by increased CD31 expression (Figure 6E), restored CFR (Figure 6F), and enhanced levels of NO and p-eNOS in the heart tissues (Figure 6G and 6H). [score:5]
Figure 2Overexpression of miR-124 aggravated impairment of cardiac function and cardiac angiogenesis induced by Ang II infusion in vivo(A) Cardiac expression of miR-124 as detected by real-time PCR. [score:5]
Inhibition of endogenous miR-124 expression alleviated the abnormalities of cardiac angiogenesis in the hypertrophic heart, and thereby impeded HF. [score:5]
In the current study, we found for the first time that over-expressed miR-124 inhibited cultured ECs’ viability, promoted apoptosis, and impaired migration, tube formation, and NO release. [score:5]
Compared with the Ang II infusion group, additional over -expression of miR-124 resulted in a dramatic decrease in CFR, while downregulation of miR-124 attenuated the coronary microvascular dysfunction (Figure 2G). [score:5]
The results showed that restored CD151 expression markedly eliminated the destructive effects of miR-124 over -expression in Ang II -induced cardiac dysfunction as determined by EF (Figure 6A), FS (Figure 6B), and ±dp/dt (Figure 6C). [score:5]
rAAV-miR-124 treatment further exacerbated the cardiac dysfunction, while downregulation of miR-124 by rAAV-miR-124 TuDs alleviated the impairment (Figure 2B–2D). [score:4]
In the present study, we found that miR-124 was a key negative regulator of cardiac angiogenesis by targeting CD151. [score:4]
Over -expression of miR-124 aggravated Ang II -induced cardiac dysfunction and abnormalities of cardiac angiogenesis in mice, while knockdown of miR-124 protected mouse hearts from the impairments induced by Ang II infusion. [score:4]
Consistent with the effects of miR-124, results showed that downregulation of CD151 by siRNA significantly reduced the viability of HUVECs (Figure 5B) and promoted cell apoptosis (Figure 5C). [score:4]
miR-124 was upregulated in the heart tissues from patients and mice with HF. [score:4]
In contrast, downregulation of miR-124 attenuated the loss of p-eNOS and NO levels in the transition from cardiac hypertrophy to HF, and thereby improved cardiac function. [score:4]
miR-124 was upregulated in failing hearts. [score:4]
Moreover, we verified CD151 as a direct target of miR-124. [score:4]
miR-124 was identified as a critical regulator of vascular smooth muscle cell (VSMC) function and behavior in neo-intima hyperplasia, and inhibition of miR-124 significantly increased proliferation and migration of VSMC [33, 34]. [score:4]
Consistently, overexpression of miR-124 aggravated the increase in cardiomyocyte size induced by Ang II infusion, while rAAV-miR-124 TuDs treatment reduced the development of cardiac hypertrophy (Figure 2E). [score:4]
Data are expressed as mean ± SEM, n ≥ 3. (A) Sequence alignment between miR-124 and the 3′ UTR of CD151 among several species. [score:3]
To manipulate the expression of miR-124 in vivo, the rAAV (type 9) was used. [score:3]
A higher level of miR-124 is associated with an increased risk for advanced atherosclerotic disease and subclinical atherosclerosis in smokers [24]. [score:3]
Re -expression of CD151 abolished the damaging effects of miR-124 in HF. [score:3]
Our data showed that cardiac expression of miR-124 was increased in patients with HF as well as Ang II- and TAC -treated mice. [score:3]
In the present study, we identified miR-124 -mediated impairment of cardiac angiogenesis by targeting CD151 in HF. [score:3]
CD151 is a target of miR-124. [score:3]
Decreased expression of miR-124 contributed to an activated phenotype of hypertensive pulmonary adventitial fibroblasts with advanced proliferation, migration, and pro-inflammatory activation [35]. [score:3]
Furthermore, CD151 was predicted and verified as a target of miR-124 in ECs. [score:3]
Regarding cardiac angiogenesis, re -expression of CD151 weakened the deleterious effects of miR-124, as indicated by restored cardiac CD31, p-eNOS, and NO levels, as well as improved CFR. [score:3]
To explore the effects of miR-124 in cardiac maladaptive hypertrophy and HF, rAAV-miR-124 and rAAV-miR-124 TuDs were used to manipulate the expression of mature miR-124 in Ang II -treated mice. [score:3]
de/rnahybrid/) bioinformatic prediction websites were applied to predict the targets of miR-124. [score:3]
Our observations support the idea that the aberrant expression of miR-124 contributed to the process from cardiac hypertrophy to HF by impairing angiogenesis. [score:3]
These findings suggest that miR-124 plays an essential role in the transition of adaptive cardiac hypertrophy to HF by impairing cardiac angiogenesis through CD151 inhibition. [score:3]
Over -expression of miR-124 by delivery vector aggravated the loss of cardiac microvessel density and function, which led to subsequent cardiac dysfunction in Ang II -treated mice. [score:3]
These findings suggest a possible application for our rAAVs to manipulate the expression of miR-124 in vivo. [score:3]
For the overexpression of miR-124, oligonucleotides were designed as miR-124 (5′- GATCCGGCATTCACCGC GTGCCTTATTCAAGAGATAAGG CACGCGGTGAATGCCCCGC-3′) according to the mature sequence of hsa-miR-124-3p provided by miRBase (Accession: MIMAT0000422). [score:3]
CD151 was a target of miR-124. [score:3]
However, this suppressive effect of miR-124 was abolished by mutating CD151 3’ UTR (Figure 4C). [score:3]
Overexpression of miR-124 impaired endothelial cell angiogenesis in vitroEndothelial cells’ (ECs) behaviors are the key events in angiogenesis and vascular function. [score:3]
, Rockford, IL) were used for real-time PCR to detect the relative expression of miR-124 with the 7900HT Fast RealTime PCR system (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. [score:3]
These findings suggest that over -expression of miR-124 exacerbates the reduction in microvascular density and endothelial injury, as well as cardiac dysfunction induced by Ang II infusion. [score:3]
miR-124 has been reported to significantly suppress angiogenesis and tumor growth in MCF7 cells [20]. [score:3]
As shown in Figure 2A, rAAV-miR-124 treatment induced miR-124 over -expression in Ang II mice as measured by real-time PCR, while rAAV-miR-124 TuDs delivery decreased the expression of miR-124 (Figure 2A). [score:3]
Ang II infusion also induced reduction of cardiac nitric oxide (NO) content and eNOS phosphorylation was aggravated by miR-124, while miR-124 inhibition reversed the effects (Figure 2H and 2I). [score:3]
Therefore, our data suggest that the miR-124/CD151 pathway may suppress cardiac angiogenesis in HF. [score:3]
Overexpression of miR-124 aggravated cardiac dysfunction and cardiac microvascular injury induced by Ang II infusion in vivo. [score:3]
Our study suggests that miR-124 plays a suppressive role in angiogenesis and endothelial function via CD151, which contributes to the transition of adaptive cardiac hypertrophy to HF. [score:3]
Conversely, miR-124 inhibitor improved ECs’ ability to migrate, form tubes, and release NO (Figure 3C–3E). [score:3]
Overexpression of miR-124 aggravated impairment of cardiac function and cardiac angiogenesis induced by Ang II infusion in vivo. [score:3]
To verify the role of the miR-124/CD151 pathway in HF, we re-expressed CD151 in rAAV-miR-124 -treated mice using rAAV-CD151, which contained the coding sequence of human CD151 gene. [score:3]
To achieve the efficient and long-term-suppression of miR-124, tough decoy RNAs (TuDs) were employed as described previously [51, 52]. [score:3]
Furthermore, re -expression of CD151 alleviated miR-124 -induced cardiac dysfunction in Ang II -treated mice. [score:3]
Moreover, the level of miR-124 has been reported to be associated with numerous cardiovascular diseases. [score:3]
Cells were transfected with miR-124 mimics (100 nM, similarly hereafter), miR-124 inhibitor (100 nM), siRNA against human CD151 (100 nM), or their negative control (100 nM), using Lipo 2000 reagent according the manufacturer's protocol. [score:3]
Overexpression of miR-124 impaired endothelial cell angiogenesis in vitro. [score:3]
Increased miR-124 expression levels were observed in patients with occluded infarct-related arteries in acute coronary syndrome, and may be an indicator for urgent coronary revascularization [23]. [score:3]
Here, the rAAV system was applied to manipulate the expression of miR-124 and CD151 in vivo. [score:3]
Re-expressed CD151 eliminated the miR-124 -induced cardiac dysfunction and cardiac microvascular injury in Ang II -treated mice. [score:3]
Thus, the aggravated role of miR-124 in failing hearts might also comprise the direct effects of miR-124 on cardiac myocytes. [score:2]
miR-124 is one of the five most abundant miRNAs (miR-99a-5p, miR-128, miR-124, miR-22-3p, and miR-99b-5p) embedded in the human circulating vesicles [36], which suggests a high priority in the regulation of ECs’ behaviors. [score:2]
These data support the notion that miR-124 may act as a novel regulator in the transition of adaptive cardiac hypertrophy to HF. [score:2]
The primers for miR-124 and U6 real-time PCR, miR-124 mimics, miR-124 inhibitor, CD151 siRNA, and their controls were purchased from RiboBio (Guangzhou, China). [score:2]
However, the role of miR-124 in the regulation between cardiac angiogenesis and HF remains unknown. [score:2]
The resultant rAAVs were designated as rAAV-miR-124, rAAV-miR-124 TuDs, and rAAV-CD151, respectively. [score:1]
Transfection of miR-124 mimics promoted HUVECs apoptosis and reduced HUVECs viability, migration, tube formation, and NO release in vitro. [score:1]
U6 small nuclear RNA was used as endogenous control to miR-124. [score:1]
Real-time PCR showed that cardiac miR-124 was consistently increased in both Ang II- and TAC -induced HF (Figure 1B and 1C). [score:1]
Together, these data demonstrate the anti-angiogenic effects of miR-124. [score:1]
The expression levels of miR-124 in heart samples from eight traffic accident victims and 12 recipients of heart transplants who suffered with end-stage HF were measured by real-time PCR. [score:1]
The oligonucleotides were designed as miR-124 TuDs (5′- GATCCGACGGCGCTAGGATCATCAA CGGCATTCACCATCTGCGTGCCTTACAAGTATTCT GGTCAACAGAATACAACGGCATTCACCATCTGC GTGCCTTACAAGATGATCCTAGCGCCGTCTTCCG C-3′). [score:1]
Restored CD151 eliminated the miR-124 -induced cardiac dysfunction and cardiac microvascular injury in Ang II -treated mice. [score:1]
Blockade of miR-124 attenuated abnormalities of cardiac angiogenesis and cardiac dysfunction in Ang II -treated mice. [score:1]
It was reported previously that miR-124 aggravated the hypertrophic response of cardiomyocytes to Ang II, probably by increasing endoplasmic reticulum stress in vitro [31]. [score:1]
In addition, restored CD151 alleviated the rAAV-miR-124 -induced increased cardiomyocyte size in Ang II-infused mice (Figure 6D). [score:1]
Figure 1(A) Relative cardiac miR-124 expression in patients with HF as measured by real-time PCR. [score:1]
To investigate the role of miR-124 in cultured ECs, gain/loss-of-function analyses were conducted by transfection of miR-124 mimics or inhibitor. [score:1]
The results showed that miR-124 was significantly elevated in human heart samples of HF (Figure 1A). [score:1]
Recently, some researchers focused on the effects of miR-124 in different vascular cell types. [score:1]
However, few reports have examined the role of miR-124 in ECs’ function. [score:1]
In the present study, the destructive effects of miR-124/CD151 on cardiac angiogenesis and HF may be due to the attenuated activation of eNOS phosphorylation and NO production. [score:1]
Ang II + rAAV-miR-124. [score:1]
In the present study, CD151 silencing by siRNA transfection disrupted cultured ECs’ function, viability, and apoptosis control, consistent with the effects of miR-124 transfection. [score:1]
In contrast, these declines were reversed in the rAAV-miR-124 TuDs group (Figure 2F). [score:1]
C57BL/6 mice were randomly divided into different groups (n > 7 per group), as follows: Control, Ang II, Ang II + rAAV-GFP, Ang II + rAAV-miR-124, Ang II + rAAV-miR-124 TuDs, and Ang II + rAAV-miR-124 + rAAV-CD151. [score:1]
Here, we present substantial evidence supporting the anti-angiogenesis effects of miR-124 in the hypertrophic heart. [score:1]
Circulating miR-124 was identified as a prognostic indicator for outcomes after cardiac arrest [25]. [score:1]
Consistently, HUVEC with miR-124 transfection exhibited impaired cell migration, tube formation, and NO release (Figure 3C–3E). [score:1]
Figure 4(A) Sequence alignment between miR-124 and the 3′ UTR of CD151 among several species. [score:1]
miR-124 reduced angiogenesis of HUVECs in vitro. [score:1]
At the same time, miR-124 mimics or miR-con were co -transfected with those reporter plasmids at a final concentration of 100 nM. [score:1]
[1 to 20 of 97 sentences]
11
[+] score: 281
f of B4GALT1 expression in K562 and KU812 cells after they were transduced with miR-124-3p expression mimic or miR-124-3p inhibitor for 48 h. β-Actin was served as an internal control (n = 3) To confirm that miR-124-3p targets the 3‘UTR region of B4GALT1 in CML cells, HEK293 cells were co-transduced with miR-124-3p expression or control vector along with either the full-length 3‘UTR of B4GALT1(Luci-B4GALT1) or mutated Luci-B4GALT1 reporter vectors bearing deletions of the 3‘UTR target regions (△Luci-B4GALT1) (Fig.   7b). [score:13]
f of B4GALT1 expression in K562 and KU812 cells after they were transduced with miR-124-3p expression mimic or miR-124-3p inhibitor for 48 h. β-Actin was served as an internal control (n = 3)To confirm that miR-124-3p targets the 3‘UTR region of B4GALT1 in CML cells, HEK293 cells were co-transduced with miR-124-3p expression or control vector along with either the full-length 3‘UTR of B4GALT1(Luci-B4GALT1) or mutated Luci-B4GALT1 reporter vectors bearing deletions of the 3‘UTR target regions (△Luci-B4GALT1) (Fig.   7b). [score:13]
The results showed that SOCS3 over -expression enhanced the expression of miR-124-3p, and that SOCS3 knock-down inhibited the expression of miR-124-3p in both cell lines (Fig.   5 a, b). [score:10]
Over -expression of SOCS3 in K562 cells inhibited the expression of leukemia-specific genes and promoted the expression of some miRNAs, among which miR-124-3p was the highest. [score:9]
Moreover, we over-expressed or inhibited the expression of miR-124-3p in K562 and KU812 cells and determined the endogenous expression of B4GALT1 at both the protein and mRNA level. [score:9]
In addition, we found that B4GALT1 protein expression was significantly down-regulated by miR-124-3p over -expression in CML cells. [score:8]
These data indicated that B4GALT1 was the target gene of miR-124-3p in CML cells, and miR-124-3p suppressed B4GALT1 gene expression at the post-transcriptional level. [score:7]
In addition, imatinib treatment resulted in a significant increase of miR-124-3p in CML cell lines, while up-regulation of miR-124-3p induced by imatinib was inhibited by SOCS3 knock-down in K562 and KU812 cells (Fig.   5c). [score:7]
b of B4GALT1 expression in K562 cells stably expressing SOCS3 after transduction with the miR-124-3p inhibitor or negative control. [score:7]
The expression levels of miR-124-3p or B4GALT1 in K562 and KU812 cells were analyzed by qPCR after they were transduced with miR-124-3p expression mimic (d) or inhibitor (e). [score:7]
For example, miR-124-3p was obviously up-regulated by SOCS3 over -expression. [score:6]
Down-regulated SOCS3 in CML cells was associated with low level of miR-124-3p, then could not exert enough repressive effect on B4GALT1, resulting in the proliferation of CML cells and targeted drugs resistance. [score:6]
We further found that SOCS3 -induced down-regulation of B4GALT1 was attenuated by the presence of the miR-124-3p inhibitor (Fig.   8b). [score:6]
Thus, we analyzed the effect of SOCS3 on the expression of B4GALT1 and proved that SOCS3 modulated the expression of B4GALT1 by miR-124-3p and, in turn, B4GALT1 could rescue SOCS3 -induced chemo-sensitivity alterations in K562 cells. [score:5]
We found that luciferase activity of HEK293 cells was significantly decreased after co-transduction of miR-124-3p expression vector and a 3‘UTR vector containing the B4GALT1/miR-124-3p target sequence (Fig.   7c). [score:5]
Consistently, the tumor suppressing effects of SOCS3 were partially neutralized by the miR-124-3p inhibitor. [score:5]
However, imatinib treatment still induced miR-124-3p increase in the absence of SOCS3 and SOCS3 could inhibit colony formation, regardless of the presence of miR-124-3p inhibitor, which implied other signal pathways may be involved. [score:5]
The gene expression bead array results indicated that miR-124-3p, a tumor suppressor [24– 26], was significantly affected by SOCS3. [score:5]
In addition, we also found that some miRNAs were significantly affected by SOCS3 over -expression and that the expression of miR-124-3p was the highest in these miRNAs (data not shown). [score:5]
Using TargetScan and miRanda online search programs, we identified B4GALT1 as a potential target of miR-124-3p. [score:5]
The miR-124-3p inhibitor and control were transduced into K562 and KU812 cells that were stably transduced with SOCS3 over -expression vector. [score:5]
The hsa-miR-124-3p mimic or control sequence, and hsa-miR-124-3p inhibitor and hsa-miR-124-3p inhibitor negative control were all purchased from GenePharma (Shanghai, China). [score:5]
3’-UTR, 3’-untranslated region; BMNCs, bone marrow mononuclear cells; CML, chronic myeloid leukemia; CMPD, chronic myeloproliferative disorders; FACS, fluorescence - activated cell sorting; GFP, green fluorescent protein; miR-124-3p, microRNA-124-3p; miRNAs, microRNAs; qPCR, quantitative real-time PCR; siRNA, small interfering RNA; SOCS3, suppressor of cytokine signaling 3; WB, Western blotting Additional file 1: Figure S1. [score:5]
SOCS3 over -expression enhanced the expression of miR-124-3p and vice versa. [score:5]
These findings suggested the presence of a dysregulated molecular network involving SOCS3, miR-124-3p, and B4GALT1, which may provide novel insights into tumor biology and present a useful target for therapeutic interference of CML under certain circumstances. [score:4]
In our study, we found that miR-124-3p expression in CML cell lines was regulated by SOCS3. [score:4]
MiR-124-3p inhibitor and negative control were transduced into K562 and KU812 cells that were stably transduced by SOCS3 over -expression vector. [score:4]
SOCS3 miR-124 B4GALT1 Leukemogenesis Chemo-sensitivity Suppressor of cytokine signaling (SOCS) is a protein family of eight members (SOCS1–7 and CIS) that form a classical negative feedback system to regulate cytokine signal transduction [1]. [score:4]
Fig. 5SOCS3 regulated the expression of miR-124-3p in CML cells. [score:4]
The relative mRNA levels of SOCS3 or miR-124-3p in K562 and KU812 cells were analyzed by q-PCR after SOCS3 over -expression (a) or knock-down (b). [score:4]
B4GALT1 is a target of miR-124-3p in CML cells. [score:3]
Furthermore, we confirmed that B4GALT1, a multidrug resistance gene, was the target gene of the SOCS3/miR-124-3p axis. [score:3]
As shown in Fig.   5d, when the relative expression levels of miR-124-3p were plotted against that of SOCS3 in each patient, a significant positive correlation was found (miR-124-3p vs. [score:3]
miR-124-3p expression levels were quantified using U6 as the internal control (GenePharm). [score:3]
We further confirmed the effect of SOCS3 on the expression of miR-124-3p in K562 and KU812 cell lines by q-PCR. [score:3]
The human pre-miR-124 sequence was amplified and cloned into pcDNA3.1 constructs (Invitrogen) to generate the pcDNA3.1-miR-124 expression vector. [score:3]
However, B4GALT1 protein was markedly reduced after transduction with miR-124-3p expression vector, and vice versa (Fig.   7f). [score:3]
Data are expressed as the mean ± SD Next we explored the correlation between SOCS3 and miR-124-3p in BMNCs from CML patients (n = 30). [score:3]
SOCS3 promoted miR-124-3p expression in CML cells. [score:3]
Here, we first demonstrated that B4GALT1 was a target gene of miR-124-3p as predicted by bioinformatics, verified the conserved region in the B4GALT1 3‘UTR was binding to miR-124-3p. [score:3]
And, the inhibitory effect of SOCS3 on CML cell proliferation was attenuated in the absence of miR-124-3p. [score:3]
miR-124 radiosensitizes human esophageal cancer cell TE-1 by targeting CDK4. [score:3]
The correlation between the mRNA expression of SOCS3 and miR-124-3p in BMNCs from 30 CML patients was tested by qPCR and analyzed by Pearson correlation and linear regression analysis. [score:3]
d Statistically significant correlation between miR-124-3p and SOCS3 expression was observed by Pearson’s method. [score:3]
Data are expressed as the mean ± SDNext we explored the correlation between SOCS3 and miR-124-3p in BMNCs from CML patients (n = 30). [score:3]
In turn, alterations of miR-124-3p expression levels influenced the effect of SOCS3 on CML cells. [score:3]
As expected, the cell proliferation assay and clonogenic assay showed that the miR-124-3p inhibitor partially neutralized the inhibiting effects of SOCS3 (Fig.   6). [score:3]
Data represented three independent experiments and were shown as the mean ± SD (n = 3), * P < 0.05; compared with empty vector or inhibitor Next, we searched for potential genes regulated by miR-124-3p in leukemogenesis. [score:3]
Moreover, Shi et al. found that miR-124-3p could inhibit the proliferation of prostate cancer cells [28]. [score:3]
miR-124-3p mimic and inhibitor. [score:3]
Fig. 7B4GALT1 was a target of miR-124-3p. [score:3]
Fowler et al demonstrated that over -expression of miR-124 in GBM cells was associated with diminished tumor cell migration and invasion [27]. [score:3]
The vectors were co-transduced with control or pcDNA3.1-miR-124 expression vectors into K562 cells. [score:3]
The mRNA expression of miR-124-3p and SOCS3 in BMNCs from 30 CML patients was positively correlated. [score:3]
All these data indicated that miR-124-3p play an important role in SOCS3 -mediated growth inhibition. [score:3]
Our results showed SOCS-3 regulated miR-124-3p/B4GALT1 pathway played an important role in the pathogenesis of CML. [score:2]
Fig. 8B4GALT1 was regulated by SOCS3/miR-124-3p axis. [score:2]
B4GALT1 was regulated by the SOCS3/miR-124-3p axis. [score:2]
B4GALT1 was downstream of miR-124-3p and regulated by SOCS3/miR-124-3p in vitro. [score:2]
The potential target of miR-124-3p in CML cells was explored using the luciferase reporter assay, qPCR, and WB. [score:2]
We next investigated whether SOCS3 regulated CML cell function by up -regulating miR-124-3p. [score:1]
The effects of miR-124-3p on cell growth (a) and colony formation (b) were determined. [score:1]
a Bioinformatics analysis of the predicted interactions of miR-124-3p and its binding sites within the 3’UTR of B4GALT1. [score:1]
c Relative mRNA levels of miR-124-3p in K562 and KU812 cells that were stably transduced with shSOCS3 or shControl vector were examined at 48 h following imatinib treatment. [score:1]
The y-axis or x-axis represented the relative mRNA levels of miR-124-3p or SOCS3 in BMNCs from 30 CML patients, which were normalized against internal control RNU6-2 or β-Actin. [score:1]
We found that the mRNA level of B4GALT1 was not significantly affected by miR-124-3p in comparison with the control in both K562 and KU812 cells (Fig.   7d, e). [score:1]
SOCS3/miR-124-3p/B4GALT1 axis plays an important role in the pathogenesis of CML. [score:1]
In conclusion, SOCS3/miR-124-3p/B4GALT1 signaling pathway plays an important role in the pathophysiology of CML. [score:1]
A significant positive correlation between miR-124-3p and SOCS3 was observed. [score:1]
[1 to 20 of 69 sentences]
12
[+] score: 247
In line with our in vitro results, miR-124 up-regulation induced a significant and specific down-regulation of Synpo expression (Fig.   3A and D, −47.03%, P < 0.001, Mann-Whitney). [score:9]
Here, we report, for the first time the expression of Synpo in the spinal cord and its up-regulation in pain in response to miR-124 down-regulation. [score:9]
Moreover, this miR-124 up-regulation was associated with a significant down-regulation of Synpo (Fig.   5A, −35%, P < 0.01, Mann-Whitney) but with no change in Capn1 and Tpm4 expression levels (Fig.   5A). [score:9]
Indeed, we show that in cancer conditions, miR-124 is down-regulated in the spinal cord, thereby inducing a specific up-regulation Synpo, a key protein for synaptic transmission and pain processing. [score:7]
Thus, we demonstrated at the molecular level the ability of miR-124 to target and inhibit the translation of Capn1, Tpm4 and Synpo through binding their 3′UTR. [score:7]
These results suggest that the up-regulation of Synpo in response to miR-124 down-regulation is one of the mechanisms of cancer pain. [score:7]
Wang, L. et al. The tumor suppressor miR-124 inhibits cell proliferation and invasion by targeting B7-H3 in osteosarcoma. [score:7]
Since miR-124 was down-regulated in the spinal cord in cancer animals, thereby making it responsible for the pain-related up-regulation of Synpo, we investigated the effect of intrathecal administration of miR-124 mimics on Synpo expression and the nociceptive behavior in cancer-pain mice. [score:7]
In the present study, we show that miR-124 is down-regulated in the spinal cord of cancerous mice and identified Synpo as a primary endogenous target of miR-124. [score:6]
Second, among miR-124 targets (Supp Table  2), mRNA screening showed that 44 genes involved in neuronal physiology were up-regulated in cancer-pain conditions. [score:6]
Second, among the miR-124 targets, mRNA screening revealed 44 genes that are involved in neuronal physiology and are up-regulated in cancer-pain conditions. [score:6]
miR-124 expression level in cancerous mice was found to be strongly down-regulated (42.26% of control, Fig.   3A, P < 0.01, Student’s t test). [score:6]
Indeed, we used a miR-124 supplementation technique which constrained the over -expression of miR-124 to the spinal cord, a method used previously to restrict miRNA expression to the spinal cord thanks to the blood-brain barrier [42]. [score:5]
Thus, miR-124 over -expressing cells also express GFP. [score:5]
In the cancer cells, miR-124 might target ROR2 -mediated Wnt signaling and B7-H3, a T cell co-stimulatory molecule, to produce its anti-tumor action, while it might target Synpo to produce its analgesic effect in the spinal cord. [score:5]
This potential is reinforced by our observation that miR-124 is significantly down-regulated in the CSF of bone-cancer patients who developed pain. [score:4]
To confirm the relevance of our in vitro analysis of miR-124 targeting, we tested the potential of miR-124 to regulate endogenous Synpo. [score:4]
First, miR-124 is one of the most regulated miRNAs in the spinal cord in bone-cancer-pain conditions, since its expression was 70% lower than in the control group (Supp Table  1). [score:4]
To confirm miR-124 targeting predictions and to rule out the possibility that the opposite expression of miR-124 and the four candidate genes is just random, we ran a luciferase assay. [score:4]
Interestingly, and in line with the results from the animal mo del, miR-124 was significantly down-regulated in the CSF of bone cancer patients who developed pain (Fig.   5C, P < 0.01, Mann-Whitney). [score:4]
However, these results suggest that miR-124 regulates Synpo expression in the spinal cord of mice and plays a causal role in bone-cancer pain. [score:4]
Zhang C Hu Y Wan J He H MicroRNA-124 suppresses the migration and invasion of osteosarcoma cells via targeting ROR2 -mediated non-canonical Wnt signalingOncol. [score:4]
Unfortunately, the target of miR-124 regulating microglia activation was not identified. [score:4]
miR-124 modulates bone cancer-pain by regulating synaptopodin expression. [score:4]
miR-124 targets identification. [score:3]
In addition, miR-124 is linked to cancer mechanisms since it has been identified as a tumor suppressor miRNA in osteosarcoma cells 54– 56. [score:3]
To determine cells expressing this miR-124 encoding plasmid, we added a GFP-coding sequence to the construct under the control of an IRES. [score:3]
As expected, RT-qPCR analysis of spinal cord tissue at day 14 showed a significant up-regulation of miR-124 in miR-124 -injected mice when compared to Cel-miR-67 -injected animals (Figs  5A, +113.50%, P < 0.05, Mann-Whitney). [score:3]
To over-express miR-124, we cloned the pre-miRNA sequence of miR-124 into a plasmid. [score:3]
The transition from acute to persistent hyperalgesia in LysM-GRK2 + /− mice is linked to a decreased in the expression of miR-124 in the spinal cord. [score:3]
Intrathecal injections of miR-124 in cancer mice efficiently normalized Synpo expression and alleviated cancer pain. [score:3]
Thus, miR-124 has a protective effect against cancer pain, by normalizing Synpo expression. [score:3]
This pleiotropic effect of miR-124 might reflect a major feature of the miRNA system, the targeting of multiple mRNA by a single miRNA. [score:3]
To this end, we increased miR-124 expression in the spinal cord of naive mice by intrathecal injections of miR-124 -mimics, accordingly to a previously published protocol [42]. [score:3]
Intrathecal injections of miR-124 induced a reduction in Synpo expression in the spinal cord and had an analgesic effect. [score:3]
Interestingly, the reduction observed with Synpo 3′UTR was by far the greatest (54.82% of control) and suggests efficient targeting of Synpo by miR-124 in vivo. [score:3]
Measurement of synaptopodin stained area reveals ability of miR-124 to inhibit endogenous Synpo expression (20/3 and 17/3 denotes number of sections/animals for control and miR-124 -injected mice, respectively, ***P < 0.001, Mann-Whitney). [score:3]
To confirm the miRNA screening results, we used RT-qPCR to assess miR-124 expression in all animals under study. [score:3]
Neo WH MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expressionJ. [score:3]
We purified exosomes from patients’ CSF and quantified miR-124 expression using RT-qPCR. [score:3]
Furthermore, miR-124 is one of the most enriched miRNAs of the central nervous system [30] and is involved in many physiological processes including development 31– 35, plasticity 36, 37 and pathology 38– 40. [score:2]
We already knew that miR-124 is highly enriched in the brain [30] and, plays a pivotal role in many physiological aspects of the nervous system, including its development 31– 35, plasticity 36, 37 and pathology 38– 40. [score:2]
Therefore, we needed to reduce the number of candidates so we screened the miRNA-mRNA pairs to find miRNAs that could regulate multiple mRNAs implicated in pain perception and finally selected miR-124. [score:2]
For candidate genes with more than one binding site for miR-124, the regulatory effect was assessed by cloning each seed region in a separate construct. [score:2]
For the assay, 50ng of candidate gene Renilla reporter or mutated form were co -transfected with 750ng of either pcDNA3.1 plasmid expressing miR-124 or empty pcDNA3.1 plasmid, and Firefly control plasmid (pGL3, Promega) into HEK-293T cells. [score:2]
In vitro, we show that miR-124 is a sequence specific regulator of Synpo. [score:2]
The first criterion for choosing miR-124 is that it is one of the most regulated miRNAs in bone-cancer-pain conditions. [score:2]
Figure 5Regulation of synaptopodin by miR-124 has analgesic properties. [score:2]
To estimate the involvement of this new regulatory pathway in cancer pain mechanisms, we tested the analgesic effect of miR-124. [score:2]
As a conclusion, the authors suggested that the effect observed is due to the regulation of microglia activation by miR-124. [score:2]
miR-124 induced decrease in luciferase expression compared to miR-Ctl (***P < 0.001, one-way ANOVA followed by Bonferroni post-test). [score:2]
These results confirm that miR-124 is an endogenous and specific regulator of Synpo in the spinal cord. [score:2]
We next investigated the ability of miR-124 to regulate the expression of each of these four genes. [score:2]
miR-124 is an endogenous regulator of synaptopodin. [score:2]
The latter result confirms that miR-124 is an endogenous regulator of Synpo. [score:2]
Sun K Neurophysiological defects and neuronal gene deregulation in Drosophila mir-124 mutantsPLoS Genet. [score:2]
Ho VM GluA2 mRNA distribution and regulation by miR-124 in hippocampal neuronsMol. [score:2]
This analysis of our screening highlighted miR-124 for several reasons. [score:1]
HEK-293 cells were transfected with luciferase reporter together with control miRNA (miR-Ctl) or miR-124. [score:1]
Briefly, we performed 3 injections, one every second day, of either miR-124 mimics or control, sacrificed the animals and then immunostained Synpo in the spinal cord (Fig.   3C). [score:1]
As proof, histological analysis of the tumor in cancer mice treated with intrathecal miR-124 showed tumor growth comparable to that of non -treated cancerous mice (Supp Fig.   7). [score:1]
Owing to the lack of internal reference for exosomal RNA, miR-124 expression values were normalized to the volume of CSF and then the difference between the two groups was calculated. [score:1]
For each candidate gene, a wild type 3′UTR reporter construct was obtained by annealing 47–49 bp synthesized oligonucleotides containing the putative miR-124 binding site. [score:1]
Interestingly, miR-124 has been implicated in the establishment and progression of chronic inflammatory and neuropathic pain [41]. [score:1]
We treated bone-cancer mice (n = 5) with an intrathecal injection of 2 µg of miR-124 mimics every two days for 14 days. [score:1]
Finally, it would be interesting to test the effects of miR-124 on both tumor growth and cancer pain. [score:1]
Therefore, we focused our analysis on the role of miR-124 in the spinal cord in cancer-pain conditions. [score:1]
A moderate but significant reduction in the luciferase signal was mediated by one of the two miR-124 seed regions in Tpm4 3′UTR and by both miR-124 binding sites in Capn1 3′UTR (Supp Fig.   6, P < 0.01 and P < 0.001, respectively, one-way ANOVA followed by Bonferroni post-test). [score:1]
These effects are solely due to the analgesic effect of miR-124 and not to its anti-tumor effect. [score:1]
This in vitro experiment evaluates the capacity of miR-124 to bind the 3′UTR of each candidate genes and to repress its expression. [score:1]
In addition, analysis of patients’ cerebrospinal fluid showed miR-124 to be a cancer-pain biomarker, suggesting its therapeutic potential for pain relief in cancer patients. [score:1]
In contrast, intrathecal administration of miR-124 alleviated nociceptive behavior since the weight borne by miR-124 -injected mice was not significantly altered until day 9 of the experiment (Fig.   5B). [score:1]
These results provide further evidence of the involvement of miR-124 in the etiology of bone cancer pain. [score:1]
Dutta R Hippocampal demyelination and memory dysfunction are associated with increased levels of the neuronal microRNA miR-124 and reduced AMPA receptorsAnn. [score:1]
Thus, miR-124 could have both an anti-tumoral effect on bone cancer and an analgesic effect on bone-cancer pain. [score:1]
Indeed, miR-124 supplementation reduced tumor cell migration and invasion. [score:1]
The protective effect of miR-124 injections against the onset of cancer pain suggests its clinical potential as a preventive analgesic. [score:1]
To test the therapeutic potential of miRNAs, miR-124 and C. elegans-specific Cel-miR-67 purified mature mimics were obtained from Eurogentec. [score:1]
Willemen et al. showed that miR-124 plays an important role in microglia activation in pain conditions. [score:1]
Further studies will aim at defining the most effective technique for miR-124 supplementation in the spinal cord of mice as well as the optimal time course of the treatment. [score:1]
Indeed, previous studies have demonstrated the beneficial effect of miR-124 supplementation on tumor aggressiveness 54– 56. [score:1]
Mutated 3′UTR constructs were obtained by using the same 47–49 bp synthesized oligonucleotides, although the putative miR-124 binding site was replaced with antisense nucleotides. [score:1]
As for miR-124 supplementation, we performed 3 injections, one every second day. [score:1]
In addition, intrathecal injection of miR-124 totally prevented pain from becoming chronic in these mice. [score:1]
In line with this hypothesis, we tested the analgesic potential of miR-124. [score:1]
[1 to 20 of 85 sentences]
13
[+] score: 236
The results showed that MALAT1 knockdown markedly improved miR-124 expression, while MALAT1 overexpression distinctly suppressed miR-124 expression in SH-SY5Y cells (Fig.   3c). [score:10]
Parkinson disease MALAT1 miR-124 Apoptosis Parkinson’s disease (PD) is a progressive neurological disorder altering the movement abilities in adults, and has become the second most frequent chronic and systemic neurodegenerative disease, ranking only second to Alzheimer’s disease (AD) [1]. [score:9]
MALAT1 was up-regulated and miR-124 was down-regulated in MPTP -induced PD mouse mo del and in MPP [+]-intoxicated SH-SY5Y cellsFirstly, qRT-PCR was performed to determine the expressions of MALAT1 and miR-124 in the midbrain of MPTP -induced PD mouse mo del and MPP [+]-intoxicated SH-SY5Y cells. [score:9]
control group MALAT1 knockdown improved miR-124 expression in MPTP -induced PD mouse mo del and in MPP [+]-intoxicated SH-SY5Y cellsqRT-PCR was performed to further confirm the effect of MALAT1 knockdown on the expression of miR-124 in in vivo and in vitro mo del of PD. [score:7]
As demonstrated by flow cytometry, MALAT1 knockdown significantly inhibited MPP [+] -induced apoptosis in SH-SY5Y cells, conversely, downregulation of miR-124 reversed this effect (Fig.   4a). [score:7]
The luciferase activities of pGL3-MALAT1-WT were significantly inhibited in miR-124 -overexpressing HEK293 cells but miR-124 transfection exhibited no inhibitory effect on luciferase activities of pGL3-MALAT1-MUT (Fig.   3b). [score:7]
MALAT1 was up-regulated and miR-124 was down-regulated in MPTP -induced PD mouse mo del and in MPP [+]-intoxicated SH-SY5Y cells. [score:7]
In summary, our study demonstrated that MALAT1 was up-regulated and miR-124 was down-regulated in MPTP/MPP [+] mo dels. [score:7]
Additionally, TargetScan software prediction and luciferase reporter system demonstrated that MALAT1 could directly bind to miR-124 and negatively regulate its expression. [score:7]
Consistently, transfection of si-MALAT1 dramatically abated down-regulation of miR-124 induced by MPP [+] in SH-SY5Y cells (Fig.   5b), suggesting that MALAT1 could negatively regulate miR-124 expression in MPTP -induced PD mouse mo del and MPP [+]-intoxicated SH-SY5Y cells. [score:7]
MALAT1 was up-regulated and miR-124 was down-regulated in MPTP -induced PD mice and MPP [+] -treated SH-SY5Y cells. [score:7]
MALAT1 knockdown suppressed MPP [+] -induced apoptosis in SH-SY5Y cells, while miR-124 downregulation abrogated this effect. [score:7]
These results suggested that MALAT1 knockdown inhibited apoptosis of DA neurons in MPTP -induced PD mice, as well as suppressed apoptosis of MPP [+] -treated SH-SY5Y cells by sponging miR-124. [score:6]
Similarly, western blot analysis showed that MALAT1 knockdown dramatically inhibited the expression of Cleaved Caspase3 level in MPP [+]-intoxicated SH-SY5Y cells, while cotransfection of si-MALAT1 and anti-miR-124 rescued this effect (Fig.   4c, d). [score:6]
Also, MALAT1 knockdown conspicuously reversed MPTP/MPP [+] induced miR-124 expression suppression in in vivo and in vitro mo del of PD. [score:6]
Further studies revealed miR-124 inhibitor abolished inhibitory effect on apoptosis triggered by MALAT1 knockdown in MPP [+] -treated SH-SY5Y cells. [score:6]
Caspase3 kit assay indicated that the MALAT1 knockdown restrained increase of Caspase3 activity evoked by MPP iodide in SH-SY5Y cells, however, miR-124 inhibitor restored MALAT1 knockdown -suppressed Caspase3 activity (Fig.   4b). [score:6]
Taken together, MALAT1 directly interacted with miR-124 and negatively regulated its expression. [score:5]
Likely, MPP iodide also resulted in an obvious improvement of MALAT1 expression (Fig.   1c) and a remarkable reduction of miR-124 expression (Fig.   1d) in SH-SY5Y cells. [score:5]
As shown in Fig.   1a, b, intraperitoneal injection of MPTP significantly increased MALAT1 expression and decreased miR-124 expression in mouse midbrains. [score:5]
Fig.  5Effects of MALAT1 knockdown on expression of miR-124 in MPTP -induced PD mouse mo del and in MPP [+]-intoxicated SH-SY5Y cells. [score:4]
control group qRT-PCR was performed to further confirm the effect of MALAT1 knockdown on the expression of miR-124 in in vivo and in vitro mo del of PD. [score:4]
Taken together, MALAT1 knockdown inhibited apoptosis by antagonizing miR-124 in MPP [+]-intoxicated SH-SY5Y cells. [score:4]
Besides, miR-124 was reported to be down-regulated in neurons from MPTP -induced PD [33]. [score:4]
Additionally, miR-124 has been illustrated to regulate apoptosis and autophagy in MPTP mo del of PD by targeting Bim [21]. [score:4]
MALAT1 interacted with miR-124 to negatively regulate its expression. [score:4]
MALAT1 knockdown improved miR-124 expression in MPTP -induced PD mouse mo del and in MPP [+]-intoxicated SH-SY5Y cells. [score:4]
MALAT1 knockdown suppressed apoptosis of MPP [+]-intoxicated SH-SY5Y cells by sponging miR-124. [score:4]
The results suggested that sh-MALAT1 transfection significantly relieved down-regulation of miR-124 induced by MPTP in mice (Fig.   5a). [score:4]
MALAT1 negatively regulated miR-124 expression in HEK293 cells. [score:4]
Moreover, MALAT1 knockdown improved miR-124 expression in MPTP/MPP [+] induced mo dels of PD. [score:4]
Our study confirmed the reduced expression of miR-124 in MPTP/MPP [+] mo dels. [score:3]
To mutate the potential miR-124 binding sites in MALAT1 gene, a QuikChange Site-Directed Mutagenesis kit (Agilent Technologies, Palo Alto, CA, USA) was used for nucleotide-substitution mutation analysis following the manufacturer’s instructions. [score:3]
MALAT1 was reported to be an endogenous regulator of breast cancer progression by down -regulating miR-124 and activating the CDK4/E2F1 signaling pathway [23]. [score:3]
MALAT1 could modulate GRB2 expression via competing miR-124 to promote high-risk human papillomavirus (HR-HPV) -positive cervical cancer cell growth and invasion [30]. [score:3]
a The putative recognition sequence of miR-124 in MALAT1 was predicted by Targetscan. [score:3]
miR-124, a brain-enriched miRNA, has been demonstrated to play a neuroprotective role in some central nervous system diseases, such as autoimmune encephalomyelitis and stroke [19, 20]. [score:3]
siRNA against MALAT1 (si-MALAT1), siRNA control (si-control), pcDNA-MALAT1, pcDNA empty vector (vector), miR-124 mimics (miR-124), miRNA control (miR-control), miR-124 inhibitor (anti-miR-124) and negative control (anti-miR-control) were purchased from Ambion (Foster City, CA, USA). [score:3]
control group Firstly, qRT-PCR was performed to determine the expressions of MALAT1 and miR-124 in the midbrain of MPTP -induced PD mouse mo del and MPP [+]-intoxicated SH-SY5Y cells. [score:3]
Convincing evidence shows that miR-124 alteration is implicated in many CNS diseases, such as medulloblastoma, injured hypoglossal motor neurons and cerebral ischemic stroke [20, 31, 32]. [score:3]
a, b The expressions of MALAT1 and miR-124 were examined by qRT-PCR in MPTP -induced PD mouse mo del. [score:3]
Fig.  1Expressions of MALAT1 and miR-124 in MPTP -induced PD mouse mo del and in MPP [+]-intoxicated SH-SY5Y cells. [score:3]
Furthermore, qRT-PCR was carried out to detect the expression of miR-124 in SH-SY5Y cells transfected with si-MALAT1 or pcDNA-MALAT1. [score:3]
The expression of miR-124 was examined by qRT-PCR in MPTP -induced PD mouse mo del transfected with sh-MALAT1 or sh-control (a) and in MPP [+]-intoxicated SH-SY5Y cells transfected with si-MALAT1 or si-control (b). [score:3]
Ponomarev ED Veremeyko T Barteneva N Krichevsky AM Weiner HL MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU. [score:2]
TargetScan software and luciferase reporter assay were used to explore the relationship between MALAT1 and miR-124. [score:2]
To further verify the interaction between MALAT1 and miR-124, we established luciferase reporter plasmids containing the wild-type or miR-124 -binding site-mutant MALAT1 to co-transfect with miR-124 mimics or miR-control into HEK293 cells. [score:1]
Fig.  3Interaction between MALAT1 and miR-124. [score:1]
Fig.  4Effects of si-MALAT1 and anti-miR-124 on apoptosis of MPP [+]-intoxicated SH-SY5Y cells. [score:1]
As displayed in Fig.   3a, there were two putative binding sites of miR-124 in MALAT1 transcripts. [score:1]
b Luciferase activity was detected in HEK293 cells co -transfected with pGL3-MALAT1-WT or pGL3-MALAT1-MUT(1+2) and miR-124 or miR-control. [score:1]
The sequence of MALAT1 containing the predicted wild type of miR-124 was synthesized from Sangon (Shanghai, China) and cloned into the downstream of the Renilla luciferase gene of pGL3 vectors (Promega, Madison, WI, USA) to form the reporter vector pGL3-MALAT1-WT. [score:1]
The expressions of MALAT1 and miR-124 were evaluated by qRT-PCR. [score:1]
c, d The levels of MALAT1 and miR-124 were assessed by qRT-PCR in SH-SY5Y cells treated with 1 mM MPP [+] for 24 h. * P < 0.05 vs. [score:1]
MALAT1 contributed to apoptosis of DA neurons by sponging miR-124 in mouse mo dels of PD and in vitro mo del of PD, providing a potential theoretical foundation for the clinical application of MALAT1 against PD. [score:1]
SH-SY5Y cells were transfected with si-MATAL1 or in combination with anti-miR-124, followed by the treatment of 1 mM MPP [+] solution for 24 h. a was performed to examine apoptosis in treated SH-SY5Y cells. [score:1]
HEK293 cells were co -transfected with 50 ng recombinant luciferase vectors, 10 ng pRL-TK vectors and 50 nM miR-124 or miR-control by Lipofectamine 2000 (Invitrogen). [score:1]
MALAT1 promotes the apoptosis by sponging miR-124 in mouse mo dels of PD and in vitro mo del of PD, providing a potential theoretical foundation for the clinical application of MALAT1 against PD. [score:1]
c qRT-PCR was performed to evaluate miR-124 expression in SH-SY5Y cells transfected with si-MALAT1, pcDNA-MALAT1 or matched controls. [score:1]
[1 to 20 of 59 sentences]
14
[+] score: 205
The down-regulation of RE1 silencing transcription factor (REST) inhibiting the expression of neuronal genes in non-neuronal cells leads to induce miR-124 expression in neural progenitor cells. [score:10]
In vivo bioluminescence images were correlated with miR-124 expression on real-time PCR in brain developmental process and while luciferase was expressed variably in the major organs of transgenic mice, luciferase activity of the brain was correlated inversely with endogenous miR-124 expression. [score:8]
MiR-124 suppresses expression of target mRNAs such as an anti-neural factor SCP1, transcription factors Sox9, Notch ligand Jagged1, and the BAF53a subunit of the chromatin-remo deling complex, and induces neurogenesis during the neural development (Visvanathan et al., 2007; Cheng et al., 2009; Yoo et al., 2009; Liu et al., 2011). [score:7]
This implies that the lower luciferase expression of the brain at E16 than at E13 but yet higher than adult periods is sufficient to show further suppression of reporter transgene expression by the extraneous abundant miR-124. [score:7]
This ex vivo study showed that luciferase was expressed in other organs with the least miR-124 expression and luciferase was suppressed in the brain (and liver) in young adult periods. [score:7]
We propose that comparison of quantified bioluminescence after directly injected or targeted delivery of miR-124 enable the therapeutic efficacy of this targeted action using this effluc-eGFP-miR-124_3 × PT Tg mice. [score:6]
The miR-124 inhibitor is chemically modified single-stranded RNA molecule to bind endogenous miRNA-124 and enable miRNA functional analysis by down-regulation of miRNA activity. [score:6]
FIGURE 4 Developmental stage -dependent miR-124 expression regulates luciferase signal. [score:5]
The luciferase activity of glial cells, which do not express miR-124, may contribute to the minimal bioluminescence of the brain during young adult period (Figure 4A) when the expression of miR-124 was maximal in brain mainly in neurons (Figures 3A and 4D). [score:5]
On real-time PCR of miR-124 and immunohistochemical analysis of luciferase, young adult transgenic mouse showed high expression of miR-124 and low expression of luciferase in the brain (Figures 3A,C). [score:5]
This allowed miR-124 to suppress the expression of two reporter proteins (Figure 1A). [score:5]
But, in another mo del of line 18, all the internal organs expressed almost no luciferase which could either mean silencing of CMV promoter or suppression of luciferase by high miR-124 in these organs. [score:5]
The lentiviral construct consists of CMV promoter, effluc, IRES, and 3 × PT (triple perfect targets) including three repeat perfect target sequences complementary to mature miR-124. [score:5]
Viral vector for miR-124 overexpression experiment was derived from pSMPUW-miR-GFP/Puro Lentiviral Expression Vector (Cell Biolabs, San Diego, CA, USA). [score:5]
In neurogenesis, miR-124 down-regulates polypyrimidine tract binding protein 1 (PTBP1) and Sox9 in the subventricular zone (SVZ) (Makeyev et al., 2007; Cheng et al., 2009). [score:4]
Using this miR-124 reporter mouse, miR-124 was expressed in a changing fashion during development in utero and after birth, which recapitulated previous studies about the role of miR-124 in neurogenesis. [score:4]
Knockdown of endogenous miR-124 maintains purified SVZ stem cells as dividing precursors, whereas ectopic expression leads to precocious and increased neuron formation formation (Cheng et al., 2009; Åkerblom et al., 2012). [score:4]
They also showed that the inhibition of miR-124 via sponge expression blocks neurogenesis, leading to the development of ectopic cells with astrocyte characteristics in the olfactory bulb (Åkerblom et al., 2012). [score:4]
Comparison of Luciferase Bioluminescence and miR-124 Expression in the Brain during Development. [score:4]
MiR-124 sequence was obtained from miR-124 precursor sequence including the 100 base flank sequences on both ends of the stem loop from mouse genomic DNA by PCR and clone the blunt-end PCR fragment into the PshA I site of the expression vector. [score:3]
After administration of miR-124 to these cells, luciferase of these cells was suppressed and thus, we could know that the luciferase transgene mRNAs were under the control of the exogenous miR-124 (Figure 5). [score:3]
The effluc-eGFP-miR-124_3 × PT vector was modified by inserting eGFP into Thy1.1 between BamHI and BglII (Clontech, Mountain View, CA, USA) and 3 tandem repeats of miR-124 perfect target sequences (TTAAGGCACGCGGTGAATGCC) into XhoI site. [score:3]
Whisker of each point represents S. D. ’s of miR-124 expression (abscissa) and luciferase activity (ordinate). [score:3]
We observed changing expressions of miR-124 in their brain of each developmental stage by bioluminescence imaging, lysate luciferase assay and real-time PCR. [score:3]
Expression of miR-124 and Luciferase in the Brain and the Other Organs of Transgenic Mice. [score:3]
We also found that the organs with lower miR-124 expression than the brain showed variable levels of luciferase on immunohistochemistry at E16 and in young adult period (Figures 3B,C). [score:3]
There was no difference in miR-124 expression between wt and transgenic mice in their various areas of the brains on in situ hybridization analysis (Supplementary Figure S1). [score:3]
This mo del can also be used for proving the success of miRNA or siRNA delivery to the neurons by observing the action of miRNA/siRNA against miR-124 targets in vivo. [score:3]
Real-time PCR was done with the total RNA of the brain and other organs to determine the expression of miR-124. [score:3]
FIGURE 2 Bioluminescence images of candidate miR-124 reporter -expressing transgenic mice. [score:3]
FIGURE 3 Validation of luciferase expression of a miR-124 reporter transgenic mouse. [score:3]
It has also been reported that miR-124 is expressed specifically in the nervous system (Conaco et al., 2006; Makeyev et al., 2007; Visvanathan et al., 2007; Cheng et al., 2009) and starts to increase in the brain at E10 period of mice (Krichevsky et al., 2003; Farrell et al., 2011). [score:3]
Åkerblom et al. (2012) have demonstrated a miR-124 sensor transgenic mouse containing GFP-miR-124 4 × PT and used this transgenic mo del to show that miR-124 overexpression induces neuronal differentiation from neural stem cells, promoting neurogenesis in SVZ. [score:3]
Another target of miR-124 is PTBP1 which has been recognized as a global repressor of alternative pre-mRNA splicing in non-neuronal cells. [score:3]
Considering absent expression of miR-124 in other organs (Figure 3A), CMV promoter of the transgenes would have been silenced in line 18 as well as in the other failed cases of transgenic mouse production. [score:3]
What, we have shown more in this investigation is that by observing miR-124 action using luciferase bioluminescence, miR-124 really acted as mature microRNA to suppress its target proteins including our transgenes. [score:3]
The cells were transiently transfected with 50 nM scramble, precursor miR-124 or miR-124 inhibitor (Ambion, Austin, TX, USA) using Lipofectamin 2000 (Invitrogen, New York, NY, USA). [score:3]
MiR-124 inhibitor did not change (increase) luciferase activity. [score:2]
We found that miR-124 overexpression significantly affected luciferase activity of effluc-eGFP-miR-124_3 × PT-infected cells by luciferase assay (5.37 ± 1.85%, p < 0.01, Figure 1B). [score:2]
In young adult mouse, miR-124 expression was approximately 100-fold higher in the brain, compared to the other organs (lung, heart, liver, kidney, and spleen) (Figure 3A). [score:2]
2016.00052 FIGURE S1 MiR-124 was expressed well after reporter insertion in the brain of transgenic mouse at young adult period. [score:2]
The pattern of miR-124 expression and luciferase reporter bioluminescence was compared using brain tissues in each period of E13, E16, P10, young and old adult with ex vivo luminescence imaging. [score:2]
When these cortical neurons were transfected with scramble, miR-124 or miR-124 inhibitor for 24 h, miR-124 transfection alone significantly decreased the luciferase activity by 55.3%, compared to scramble transfection (Figure 5C). [score:2]
The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development. [score:2]
MiR-124 induces neuronal differentiation and inhibits glial differentiation of embryonic stem cells during this transition of neurogenesis (Conaco et al., 2006; Makeyev et al., 2007; Visvanathan et al., 2007; Åkerblom et al., 2012). [score:2]
The observed action of miR-124 on the 3′UTR of transgene transcript in this study proves that our transcript worked to produce functionally active luciferase protein under the expected regulation by endogenous miR-124 (Figure 4E). [score:2]
miR-124 regulates adult neurogenesis in the subventricular zone stem cell niche. [score:2]
Generation of miR-124 Reporter-Harboring Transgenic Mice. [score:1]
In our study, miR-124 expression reached the maximum in young adult period and this increase was represented inversely well with measurement of luciferase activity in tissue lysates (Figures 4C,D). [score:1]
Most importantly, in vivo action of miR-124 was represented by luciferase bioluminescence imaging associated with quantification. [score:1]
Production of miR-124 Action Reporter Vector and Its Validation In vitroIn order to produce reporter construct for monitoring miR-124 action (previous ID: miR-124a), we generated a construct containing three copies of a miR-124-perfectly matched sequence (miR-124_3 × PT) with the enhanced firefly luciferase (effluc) and enhanced GFP (eGFP) reporter genes in its 3′UTR. [score:1]
This changing pattern of neurogenesis associated with miR-124 is further supported by our results, demonstrating an increase of the amount of miR-124 at E13 via E16 to the peak at young adult period (Figure 4D). [score:1]
In order to produce reporter construct for monitoring miR-124 action (previous ID: miR-124a), we generated a construct containing three copies of a miR-124-perfectly matched sequence (miR-124_3 × PT) with the enhanced firefly luciferase (effluc) and enhanced GFP (eGFP) reporter genes in its 3′UTR. [score:1]
Cortical Neurons Extracted from the Transgenic Mouse Responded to Transfected miR-124. [score:1]
Here, we produced a miR-124 reporter transgenic mouse containing miR-124-sensing luciferase reporter gene for tracing the miR-124 action. [score:1]
When the relationship between ex vivo concentration of miR-124 and luciferase activity was plotted, it was found to be inverse-log-log-proportional (Figure 4E). [score:1]
Production of miR-124 Action Reporter Vector and Its Validation In vitro. [score:1]
We propose that unlike miR-124-sensing GFP transgenic mice, we could quantify luciferase activity using bioluminescence imaging which was inversely correlated with miR-124 level in the brain. [score:1]
We propose that in vivo bioluminescence imaging can also predict the amount of miR-124 transcript in vivo without sacrifice of the animal. [score:1]
Using the same lysates, on quantitative real-time PCR for miR-124, miR-124 concentration was lowest at E13 and increased continuously via E16 to the young adult period (Figure 4D). [score:1]
In order to design a construct that gets modulated by miR-124, we inserted three repeats of perfectly matching complementary sequences of mature miR-124 to the downstream of reporter gene under the CMV promoter (Figure 1A). [score:1]
The luciferase signal of miR-124 reporter gene was significantly decreased by induction of exogenous miR-124 in vitro. [score:1]
Initially high and later dramatic decrease of the bioluminescence in the brain of these transgenic mice are proposed to represent the action of endogenous mature miRNA, i. e., miR-124 in neurons. [score:1]
In fact, in vitro real-time PCR yields only the amount of miR-124 but not the action of mature miR-124 in vivo and thus, we could say that luciferase bioluminescence or activity represent the miR-124 action in situ as well as the amount of miR-124. [score:1]
This miR-124 degrades small C-terminal domain phosphatase 1 (SCP1) which is a protein of anti-neural function (Conaco et al., 2006; Visvanathan et al., 2007). [score:1]
We think that transgenic mouse and derived cells are under good control of miR-124 and luciferase transgene would work well to report the action of mature miR-124. [score:1]
To generate transgenic (Tg) mouse, we cut the effluc-eGFP-miR-124 3 × PT construct with NdeI and SalI, and ∼4.9 kb transgene which included the 5′UTR and 3′UTR that was obtained from vector. [score:1]
MiR-124 is a well-known regulator responsible for differentiation of progenitor cells to mature neurons. [score:1]
We produced a reporter transgenic mouse mo del harboring effluc-eGFP-miR-124_3 × PT transgene to visualize miR-124 action which plays an important role in neurogenesis under physiological conditions. [score:1]
Line 67 was used for further experiment of miR-124 imaging. [score:1]
In order to validate the constructs, HeLa cells were co -transfected with reporter construct and synthetic scramble or miR-124 precursors. [score:1]
The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. [score:1]
[1 to 20 of 72 sentences]
15
[+] score: 197
Doxycycline -induced expression of Vim, from a lentiviral vector that does not harbor the 3′UTR and hence is not inhibited by miR-124, upregulated Vim mRNA and protein levels (Fig.   5a,b, Sup. [score:8]
To characterize the targets and pathways that are regulated by miR-124, we intersected the list of mRNAs that were repressed more than twofold by miR-124 overexpression in the NGS data, with the list of predicted miR-124 targets (TargetScan [48]). [score:8]
Our analysis reveals that miR-124 overexpression may be disadvantageous to primary motor neurons, in accordance with reported miR-124 upregulation in late ALS stages in mouse brains [61] and with injurious miR-124 overexpression in adult hippocampus/prefrontal cortex [66]. [score:8]
The cluster of mitochondrial genes that responded to miR-124 overexpression was not particularly enriched in direct targets of miR-124, suggesting indirect regulation. [score:8]
Figure 4Vimentin regulates neuron morphology and mitochondria function (a) Venn diagram of predicted miR-124 targets (TargetScan) and transcripts that were experimentally repressed >2 fold by miR-124 overexpression in primary motor neurons, relative to control conditions. [score:8]
Sorted 6500 mRNAs expressed in primary motor neurons, ranked from down- to up-regulated after overexpressing of miR-124, or control mimic. [score:8]
Ptbp1, an established miR-124 target [49], and Mdk were downregulated to ~1/2 their expression level (Fig.   4b). [score:8]
Hierarchical clustering analysis of mRNA expression depicted a unique expression profile for neurons that overexpressed miR-124, which was distinguishable from cells transfected with scrambled control oligos (dendrogram of Pearson correlation coefficient, Fig.   2a). [score:7]
Gene ontology (GO) analysis was carried out for approximately 1100 mRNAs that were significantly up- or downregulated, following miR-124 overexpression (corrected P-value < 0.05), using DAVID [46]. [score:6]
Interestingly, miR-124 overexpression inhibited TMRE and Mitotracker signals reminiscent of Oligomycin A, leading us to conclude that miR-124 regulates mitochondrial function (Fig.   3). [score:6]
Three genes that harbor conserved miR-124 binding sites, were also downregulated more than twofold by miR-124 overexpression, namely, Polypyrimidine Tract Binding Protein 1 (Ptbp1, MGI:97791), Midkine (Mdk, MGI:96949) and Vimentin (Vim, MGI:98932; Fig.   4a). [score:6]
Furthermore, we identified molecular evidence for direct interactions of miR-124 with the target Vim, in Argonaute CLIP studies 50, 51 and a Vim 3′UTR reporter was inhibited by miR-124 mimics in hepatocellular carcinoma cells [52]. [score:6]
Therefore, the soma compartment may be less amendable to manipulation, whereas, in the axon, where the miRNA is expressed at lower levels, the effects of miR-124 overexpression were consistent across all observations. [score:5]
We conclude that miR-124 overexpression had a widespread and specific impact on motor neuron mRNA expression profile. [score:5]
This analysis revealed an enrichment for mitochondrial-related genes and is further described in Table  1. Sylamer analysis [45] of 6500 expressed mRNAs, from neurons expressing scrambled control mimics or miR-124, uncovered two enriched motifs, which matched the miR-124 ‘seed’ sequence. [score:5]
Primary motor neurons of control, miR-124 overexpression alone or transduced in addition with lentiviral vector for Doxycyclin -dependent expression of Vim (>80% transduction efficacy, transduction 24 hrs. [score:5]
Primary motor neurons of control, miR-124 overexpression alone or transduced in addition with lentiviral vector for Doxycycline -dependent expression of Vim (>80% transduction efficacy, performed 24 hrs. [score:5]
Vim knockdown by other means, pheno-copied miR-124 overexpression and an exogenous Vim that does not harbor miR-124 binding sites, rescued the mitochondrial phenotype. [score:4]
In summary, we propose that miR-124 expression levels should be tightly kept within defined margins and that a novel miR-124 - Vim pathway reveals a mechanism, by which miRNAs regulate of axonal mitochondria transport. [score:4]
qPCR study validated that miR-124 overexpression inhibited Vim to ~1/3 its levels compared with control cells that were treated with scrambled oligos. [score:4]
Oligomycin A (1 µM) or miR-124 overexpression diminished mitochondrial activity. [score:3]
Exogenous Vim was also sufficient to alleviate miR-124 -dependent inhibition of mitochondrial function, relative to miR-124 alone (Fig.   5c–e). [score:3]
We sought to inhibit Vim independently of miR-124, and test its effect on cell morphology and mitochondria activity. [score:3]
Bar graphs quantification of (g) axonal mitochondria density/μm and (h) mean TMRE intensity in control axons (n = 48), miR-124 overexpression alone (n = 52), miR-124 and Vim without Dox (n = 34) or with Dox (n = 34). [score:3]
While most miRNAs tested did not alter neuronal morphology, miR-124 overexpression caused a significant decrease in axon outgrowth and in the number of branches (Fig.   1d). [score:3]
Minin et al., have shown that Vim regulates mitochondria activity and motility 31, 32, 60 in other cell types, which is consistent with the discovery of a new miR-124 - Vim axis for unidirectional control of mitochondria transport in axons. [score:3]
By performing next generation sequencing and molecular studies, we identified the intermediate filament Vimentin (Vim) as an important target of miR-124 in this new pathway. [score:3]
This may explain the re-distribution of mitochondria after overexpression of miR-124 and relative axonal depletion. [score:3]
Figure 2Unbiased bioinformatics analysis of miR-124 targets. [score:3]
Confocal immunofluorescence of the mitochondrial marker, ATP5A, and an ultrastructural study with transmission electron microscopy (TEM), revealed depletion of mitochondria in primary motor neuron axons, which overexpressed miR-124, relative to controls. [score:3]
We demonstrate that miR-124 overexpression impacts motor neuron morphology and mitochondrial activity. [score:3]
Finally, we used live imaging microscopy to test if the new miR-124-Vim axis regulates mitochondria motility in axons. [score:2]
Interestingly, Vim is a known regulator of mitochondria localization and activity 31, 32, with miR-124 binding sites that are conserved across several vertebrate species (Fig.   4c). [score:2]
Accordingly, high content image analysis of Vim knockdown depicted reduction in neurite outgrowth and branching (Fig.   4f), recapitulating miR-124 activity. [score:2]
We therefore further hypothesized that miR-124 plays a role in the regulation of mitochondrial functions. [score:2]
Therefore, miR-124 regulates mitochondria position and activity in motor neurons. [score:2]
Our study reveals that Vim functions as a regulator of mitochondrial activity in motor neurons, downstream of miR-124. [score:2]
We demonstrated that miR-124 regulates mitochondrial activity and localization. [score:2]
Based on the above observations, we hypothesized that Vim is a novel effector of miR-124 in a pathway that regulates mitochondria function. [score:2]
We show that a new miR-124-Vim pathway regulates mitochondria function and localization, at least in part via control of axonal transport. [score:2]
Here, we tested the impact of miRNAs on motor neuron morphology and function, which led us to discover a new pathway for regulation of mitochondria activity, downstream of miR-124. [score:2]
miR-124 is one of the most abundant miRNA in many neuronal subtypes and is conserved from insects to mammals. [score:1]
Next generation sequencing was performed on RNA extracted from primary motor neurons transfected with either miR-124 mimics (N = 3) or control mimics (N = 6). [score:1]
In this pathway, Vim, functions as an important effector of miR-124, revealing a surprising mechanism for controlling energy metabolism in motor neurons by neuronal miRNAs and intermediate filaments. [score:1]
Intriguingly, miR-124 caused mitochondria to pause more frequently on anterograde route, than in control samples, but did not affect retrograde transport. [score:1]
There is noticeable overrepresentation of gene ontology terms related to mitochondria structure or function in response to miR-124. [score:1]
In conclusion, Vim pheno-copies miR-124 functions, further suggesting that both genes are engaged in the same pathway. [score:1]
Differences in the effect of miR-124 on soma may be the result of transfection efficiency. [score:1]
Intriguingly, many of the gene ontology terms highlighted the potential relevance of mitochondria-related structure or function in response to miR-124 (Table  1, Fig.   2c). [score:1]
miR-124 drives neuronal differentiation, promoting neuroblasts cell-cycle exit 41, 55, neuron-specific alternative splicing and chromatin remo deling via silencing of Ptbp11 [49] and Actin like 6 A/BAF53a [56], respectively. [score:1]
miR-124 was the only miRNA to reduce mean axonal outgrowth per cell and mean number of branches per cell. [score:1]
Furthermore, miR-124 levels remain high in postmitotic neurons, suggesting that it plays a role also in maintenance of the differentiated state of neurons. [score:1]
To uncover the underlying molecular mechanism responsible for miR-124 activity, we performed transcriptome profiling, using next generation sequencing (NGS). [score:1]
The intermediate filament Vim is a key effector of miR-124 upstream of mitochondria function and localization. [score:1]
An initial screen led us to focus on miR-124, which was the only miRNA that exhibited abnormal axonal morphology, out of nine miRNAs that were tested. [score:1]
Figure 1High content image analysis reveals the impact of miR-124 on primary motor neuron morphology. [score:1]
Assessment of over- and under-represented miRNA recognition sequences (seed-matches) for all known miRNAs, identified two enriched motifs, both matching the miR-124 ‘seed’ sequence (blue, 7mer–2; light blue, 7mer-1A). [score:1]
Intriguingly, miR-124 is primarily peri-nuclear [54]. [score:1]
miR-124 and Vim asymmetric action is further evocative of kinesins and dynein motor proteins that reciprocally serve anterograde and retrograde transport. [score:1]
We conclude that the mechanism for control of mitochondria running/pausing propensities in motor neurons involves Vim and miR-124 in a fashion affecting anterograde but not retrograde transport. [score:1]
Parameters of run length and mean speed, were not changed by miR-124 and Vim (Sup. [score:1]
[1 to 20 of 61 sentences]
16
[+] score: 194
HIF1α therefore up-regulates P4HA1 expression through multiple mechanisms; by directly binding to its promoter and transactivating P4HA1 promoter or binding to miR-124 promoter and repressing its expression and thereby indirectly sustaining P4HA1 levels. [score:10]
Additionally, we show here that transcriptional co-repressor CtBP1, which has been shown to repress LCN2 (Lipocalin-2) and ARHGDIB (Rho GDP Dissociation Inhibitor Beta) expression in prostate cancer [16], regulates miR-124 expression. [score:8]
Thus, our study indicates a dual role of HIF1α in regulating P4HA1 expression both as a transactivator and indirectly by acting as a repressor of miR-124 expression. [score:7]
MiR124 expression dramatically inhibited proliferation of DU145 and PC3 cells compared to control non -targeting miR (Figure 3E; Supplementary Fig. S4E). [score:6]
CtBP1, EZH2 or HIF-1α induces P4HA1 expression and maintains its expression by down -regulating miR-124. [score:6]
Furthermore, ectopic over -expression of miR-124 in DU145 (Figure 3F) and PC3 cells (Supplementary Fig. S4G) significantly reduced the ability of these cells to invade through matrigel compared to the cells expressing control non -targeting miR. [score:6]
miR-124 targets and down-regulates P4HA1. [score:6]
Our data suggest that miR-124 targets P4HA1 and acts as tumor suppressor miR in prostate cancer. [score:5]
We observed an up-regulation of miR-124 in DU145 and PC3 cells upon stable knockdown of CtBP1 and EZH2 (Figures 5A, B) and a decrease in P4HA1 mRNA (Supplementary Fig. S8A, B) and protein (Figure 5C). [score:5]
qPCR analysis in prostate cancer cell lines showed that benign prostate epithelial cell line PrEC expressed greater amounts of miR-124 and lower P4HA1 levels in contrast to aggressive prostate cancer cell lines DU145 and PC3 that express lower miR-124 and higher P4HA1 levels (Supplementary Fig. S4C). [score:5]
These results indicate that P4HA1 is a direct target of miR-124. [score:4]
These data support the roles of CtBP1 and EZH2 in maintaining P4HA1 expression by down -regulating miR-124. [score:4]
CtBP1 and EZH2 maintain P4HA1 expression by down -regulating miR-124. [score:4]
HIF1α modulates P4HA1 expression by down -regulating miR-124. [score:4]
F, miR-124 is down-regulated under hypoxia -mimicking conditions. [score:4]
MicroRNA miR-124 targets P4HA1 and is down regulated in prostate cancer. [score:4]
We hypothesized that EZH2 and CtBP1 may regulate P4HA1 expression by repressing miR-124. [score:4]
Further studies to identify HIF1α interacting partners will elucidate the mechanism of miR-124 down-regulation. [score:4]
Previous studies demonstrated that miR-124 is down-regulated by epigenetic mechanisms, including DNA methylation and histone modification in various cancers [32- 35]. [score:4]
Transcriptional repressors EZH2 and CtBP1 regulate miR-124 expression. [score:4]
A, Integrated prediction algorithms displayed as a Venn diagram showing miRNAs computationally predicted to target P4HA1 including miR-124. [score:3]
This effect is reversed by mutating miR-124 target site (Supplementary Fig. S4A, B; Figure 3C). [score:3]
In summary, our study uncovers a complex regulatory axis involving the transcription factor HIF1α, transcriptional repressors CtBP1 and EZH2 that regulate P4HA1 via miR-124 (Figure 7F). [score:3]
Similarly, we observed decrease in cell proliferation in androgen -dependent LnCaP cells, suggesting a broad role for miR-124 and its target P4HA1 in both castration-resistant and hormone-sensitive prostate cancer cells (Supplementary Fig. S4F). [score:3]
As shown in Figure 3D, miR-124 -treated cell showed significant reduction in P4HA1 protein level, while the control miR precursors did not alter the P4HA1 expression. [score:3]
Based on these results we hypothesized that miR-124 acts as tumor suppressor in prostate cancer. [score:3]
In addition, we showed that P4HA1 is a miR-124 target gene. [score:3]
HEK-293 cells were transfected either with pre-miR-124 or non -targeting pre-miR (NT-pre-miR) along with either P4HA1-3′UTR wild-type, mutant-1 or mutant-2 luciferase constructs. [score:3]
Hypoxia inducible factor HIF1α regulates P4HA1 by regulating miR-124. [score:3]
SET domain mutant EZH2 (EZH2ΔSET) or control adenoviruses did not repress the miR-124 expression. [score:3]
MiR-124 in turn is regulated by transcriptional repressor Enhancer of Zeste Homolog 2 (Drosophila) EZH2 and transcriptional co-repressor C-terminal binding protein 1 (CtBP1), genes that are overexpressed in aggressive prostate cancer [7, 16]. [score:3]
Overexpression of CtBP1 and EZH2 resulted in repression of miR-124 (Figure 5D) and a concomitant increase in P4HA1 transcript (Supplementary Fig. S8C) and protein (Figure 5E). [score:3]
It is possible that the binding of HIF1α to the HRE recruits histone modification complex or other corepressors to miR-124 promoter and suppresses its transcription. [score:3]
To determine whether HIF1α, apart from directly regulating P4HA1, also regulates miR-124, we performed chromatin immunoprecipitation (ChIP) assays with antibody against HIF1α in PC3 and RWPE cells following treatment with 100 μM CoCl [2] for 12 h. The schematic showing P4HA1, GLUT-1(Glucose transporter 1) and VEGFA (Vascular endothelial growth factor A) chromosomal loci and ChIP amplicons is depicted in Supplementary Fig. S6A. [score:3]
As expected, hypoxia increased the expression of HIF1α, P4HA1, CtBP1 and EZH2 as shown by immunoblot (Figure 4D) and qPCR analysis (Supplementary Fig. S5A), and also significantly repressed miR-124 levels (Supplementary Fig. S5B (p=0.0004)). [score:3]
Since miR-124 had earlier been implicated as tumor-suppressor, we sought to determine its role in P4HA1 regulation by 3′-UTR luciferase assay. [score:3]
However, the mechanism of HIF1α -mediated repression of miR-124 gene expression is not completely elucidated. [score:3]
Figure 3A, Integrated prediction algorithms displayed as a Venn diagram showing miRNAs computationally predicted to target P4HA1 including miR-124. [score:3]
B and C, qPCR analysis of miR-124 in HIF1α-stable knockdown DU145 and PC3 cells. [score:2]
HEK-293 cells co -transfected with miR-124 and pMir-REPORT-P4HA1 3′-UTR plasmids showed substantial reduction in luciferase reporter activity compared to non -targeting control miR (Figure 3C). [score:2]
Consistent with the results from cancer cell lines, metastatic prostate cancer tissue samples also expressed low miR-124 and high P4HA1 mRNA compared to benign samples (Supplementary Fig. S4D). [score:2]
Our investigation also indicated a role for histone methyltransferase EZH2 in regulating miR-124 expression. [score:2]
A and B, qPCR analysis of miR-124 and C, Immunoblot analysis of P4HA1 in CtBP1 and EZH2 stable knockdown DU145 and PC3 cells. [score:2]
Figure 5A and B, qPCR analysis of miR-124 and C, Immunoblot analysis of P4HA1 in CtBP1 and EZH2 stable knockdown DU145 and PC3 cells. [score:2]
To demonstrate that CtBP1 and EZH2 target the miR-124 promoter region, we performed ChIP assays with anti-CtBP1, EZH2 and H3K27me3 antibodies (a mark of EZH2 -mediated trimethylation of histone H3 on lysine 27) in DU145 and PC3 cells. [score:2]
F, Proposed mo del of P4HA1, HIF1α and miR-124 regulatory axis in prostate cancer progression. [score:2]
Furthermore, we observed HREs in miR-124-1,-2 and -3 promoters. [score:1]
Here we investigated the effect of HIF1α on P4HA1 and miR-124 expression. [score:1]
B, The predicted miR-124 binding sites in the 3′-UTRs of P4HA1. [score:1]
These data suggest that miR-124 is transcriptionally repressed in prostate cancer. [score:1]
We screened the human P4HA1, VEGFA, GLUT-1, miR-124-1, -2 and -3 promoters with Genomatix MatInspector and detected several HIF1α -binding sites. [score:1]
As expected, CtBP1 (Figure 5F; Supplementary Fig. S9A-C), EZH2 (Figure 5G; Supplementary Fig. S9A-C) and H3K27me3 (Supplementary Fig. S10A-D) showed enrichment at miR-124-1 as well as at miR-124-2 and miR-124-3 promoter regions. [score:1]
Moreover, miR-124 levels were increased in these samples as assessed by qPCR (Figure 4B, C). [score:1]
Cell proliferation was measured in DU145 cells ectopically over -expressing either pre-miR-124 or NT-pre-miR. [score:1]
The binding site for miR-124 at 3′-UTR of P4HA1 is depicted (Figure 3B). [score:1]
qPCR analysis of miR-124 in samples from (E); ns, not significant. [score:1]
Next, to determine whether miR-124 represses P4HA1 expression, we treated prostate cancer cells with precursor miRs, miR-124 as well as other miRs such as miR-23a, 23b, 29a, 29b, 29c, 122, and 499a and measured P4HA1 protein levels. [score:1]
This explains the enrichment of miR-124 promoter regions with HIF1α, CtBP1 and EZH2 as well as H3K27me3 mark in the ChIP DNA. [score:1]
Inset: Schematic representation of the miR-124-1 genomic region on chromosome 8 showing gene and amplicon positions. [score:1]
F, Conventional Chromatin immunoprecipitation (ChIP)-PCR analysis for the CtBP1 and G, EZH2 occupancy on miR-124-1 promoter in PC3 cells. [score:1]
G, Conventional Chromatin immunoprecipitation (ChIP)-PCR analysis for the HIF1α occupancy on miR-124-1 promoter in PC3 cells following induction with 100 μM CoCl [2] for 12 h. All bar graphs are shown with ± SEM. [score:1]
D, qPCR analysis of miR-124 and E, Immunoblot analysis of P4HA1, CtBP1 and EZH2 in RWPE cells following infection with control, lacZ adenovirus or CtBP1, EZH2 or EZH2ΔSET mutant adenovirus for 48 h (Asterisk indicates truncated (EZH2 [SET])). [score:1]
We next examined the functional role of miR-124 using DU145 and PC3 cancer cells that were transiently transfected with miR-124 precursor. [score:1]
Similar to RWPE, PrEC cells showed lower levels of miR-124 in hypoxic condition (Figure 4F). [score:1]
E, miR-124 reduces prostate cancer cell proliferation. [score:1]
Using UCSC (University of California Santa Cruz) genome browser, we detected H3K27me3 marks and EZH2 binding sites on miR-124-1, -2 and -3 promoters [51]. [score:1]
[1 to 20 of 66 sentences]
17
[+] score: 178
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-2, mmu-mir-124b
It is thought that miR-124 regulates microglia/macrophage activity by downregulating the expression of CCAAT-enhancer -binding protein (C/EBP)-α, a transcription factor regulating myeloid cell differentiation [1, 21, 22]. [score:8]
This mo del is supported by our findings that treatment with intrathecal administration of miR-124 normalized the expression of M1 and M2 markers in LysM-GRK2 [+/−] mice and inhibited the development of IL-1β -induced persistent hyperalgesia in these mice. [score:6]
We next addressed the question of whether low GRK2 and decreased expression of miR-124 in spinal cord microglia are related to differences in the expression of microglia/macrophage activation markers in the spinal cord. [score:5]
We found that intraplantar IL-1β administration to LysM-GRK2 [+/−] mice, which induces persistent hyperalgesia, decreased the level of miR-124 in spinal cord microglia, increased expression of M1 type phenotypic markers and pro-inflammatory cytokines, and decreased expression of anti-inflammatory cytokines and M2 markers. [score:5]
The current in vivo data are in line with the results from in vitro studies reported by Ponomarev et al, who found that in vitro miR-124 treatment reduces expression of iNOS and increases TGF-β, arginase I and Fizz expression by activated bone marrow-derived macrophages [1]. [score:5]
Based on these and our present findings it is unlikely that the inhibition of persistent hyperalgesia by miR-124 treatment in our study is mediated by inhibition of neuronal hypersensitivity or by impaired motor function. [score:5]
These findings indicate that neuronal signals can directly regulate the expression of miR-124 in macrophage- like cells. [score:5]
At baseline (n = 9) and 24 hours (n = 6) after IL-1β injection, lumbar (L2 to L5) spinal cord microglia were isolated to determine (B) miR-124 expression (normalized for small nucleolar (sno)RNA55) and (C) the lumbar and thoracic mRNA expression of C/EBP-α normalized for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and actin) in control WT (n = 6) and LysM-GRK2 [+/−] (n = 6) mice. [score:5]
The miR-124 expression (mmu-miR-124a, 001182) was normalized for snoRNA55 (001228) expression. [score:5]
At the functional level, we showed that the decrease in miR-124 in LysM-GRK2 [+/−] spinal cord microglia in response to intraplantar IL-1β was associated with increased expression of the pro-inflammatory cytokine IL-1β and the pro-inflammatory enzyme iNOS, and with decreased expression of the anti-inflammatory cytokine TGF-β in spinal-cord microglia. [score:5]
The clinical relevance is further supported by the current data showing that miR-124 treatment inhibited the development of hyperalgesia in the SNI mo del of neuropathic pain supports. [score:4]
Indeed, the data clearly showed that miR-124 treatment regulates the M1/M2 balance; the intrathecal miR-124 reversed the difference in the expression of M1 and M2 phenotypic markers between WT and LysM-GRK2 [+/−] mice in response to intraplantar IL-1β injection (Figure  5). [score:4]
In line with data in the literature, the basal expression of miR-124 was lower in peripheral macrophages than in spinal cord microglia [1]. [score:3]
Finally, we found that miR-124 treatment completely inhibits mechanical allodynia in the SNI mo del of chronic neuropathic pain. [score:3]
Intraplantar IL-1β administration did not have any effect on miR-124 expression in spinal cord microglia from control WT mice, whereas it significantly reduced miR-124 levels in microglia from LysM-GRK2 [+/−] mice. [score:3]
It has been shown recently that intracranial injection of a miR-124 antisense oligonucleotide inhibitor induced activation of cerebral microglia [1]. [score:3]
In the current study, we found that intraplantar IL-1β injection in mice with low microglial/macrophage GRK2 levels induced a reduction in miR-124 expression, leading to a change in the M1/M2 balance towards a more pro-inflammatory phenotype and persistent hyperalgesia. [score:3]
This finding indicates that low GRK2 in microglia/macrophages sensitizes these cells for an intraplantar IL-1β -induced decrease in miR-124 expression in spinal cord microglia. [score:3]
We determined spinal cord microglia/macrophage miR-124 expression and levels of pro-inflammatory M1 and anti-inflammatory M2 activation markers. [score:3]
Brandenburger et al. reported that total spinal cord miR-124 was not changed in the chronic constriction injury mo del of neuropathic pain [30]; however, because miR-124 is expressed at a high level in neurons, a potential change in microglial miR-124 may well have been masked in that study. [score:3]
In addition, in vitro bone marrow-derived macrophages transfected with miR-124 produced reduced levels of iNOS and increased levels of TGF-β in conjunction with decreased C/EBP-α expression. [score:3]
Thus, also increased signaling independently of GPCRs in GRK2 -deficient spinal cord microglia/macrophages may contribute to the seen decrease in miR-124 expression in microglia/macrophages from LysM-GRK2 [+/−] mice after intraplantar IL-1β. [score:3]
We hypothesized that miR-124 treatment would normalize the expression of the M1 and M2 markers in LysM-GRK2 [+/−] mice. [score:3]
The miR-124 treatment also normalized expression of spinal M1/M2 markers of LysM-GRK2 [+/−] mice. [score:3]
At baseline (without stimulus), no difference was seen between WT and LysM-GRK2 [+/−] mice in miR-124 expression in microglia from spinal cord or in macrophages from the peritoneal cavity (Figure  1B). [score:3]
Collectively, our findings support the notion that the decreased miR-124 expression seen in conditions of low GRK2 promotes spinal cord microglial/macrophage activation, leading to an increased M1:M2 ratio and prolonged inflammatory hyperalgesia. [score:3]
The broader relevance of our results is supported by our finding that miR-124 treatment reversed persistent hyperalgesia induced by a high dose of carrageenan and prevented development of hyperalgesia in the SNI mo del of chronic neuropathic pain. [score:2]
In addition, peripheral macrophages, which have an activated phenotype, express low levels of miR-124 compared with isolated naive microglia from brain and spinal cord. [score:2]
Because we injected miR-124 intrathecally, we cannot completely exclude that miR-124 also directly affects other cells in the spinal cord, including sensory neurons. [score:2]
Figure 1 MicroRNA-124 and CCAAT-enhancer -binding protein (C/EBP)-α expression after intraplantar interleukin (IL)-1β in wild-type (WT) and LysM-G protein–coupled receptor kinase (GRK)2 [+/−] mice. [score:2]
We propose that low spinal microglia/macrophage GRK2 levels promote a transition to persistent hyperalgesia via impaired microglial miR-124 regulation, and consequently an impaired spinal M1/M2 balance. [score:2]
Bai et al. showed that miR-124 levels were significantly reduced in the trigeminal ganglion in a mo del of carrageenan -induced muscle pain, indicating that inflammatory activity regulates miR-124 in multiple pain mo dels [29]. [score:2]
Moreover, intrathecal miR-124 treatment reversed the persistent hyperalgesia induced by carrageenan in WT mice and prevented development of mechanical allodynia in the spared nerve injury mo del of chronic neuropathic pain in WT mice. [score:2]
In this paper, we present a previously unreported role of miR-124 in the regulation of chronic inflammatory and neuropathic pain. [score:2]
MicroRNA-124 and mRNA expression analysis. [score:2]
Role of miR-124 in regulating spinal cord M1/M2 phenotype. [score:2]
MicroRNA-124 expression in spinal cord microglia and in peripheral macrophages. [score:2]
At the same time, C/EBP-α, a ‘master’ transcription factor regulated by miR-124, was increased in spinal cord microglia from LysM-GRK2 [+/−] mice after intraplantar injection of IL-1β. [score:2]
The miR-124 treatment did not affect spontaneous locomotor activity of SNI mice as determined in an open field 3 days after SNI (Figure  7C). [score:1]
There was no significant difference in miR-124 mRNA between microglia isolated from thoracic spinal (T6 to T10) cord of WT and LysM-GRK2 [+/−] mice after intraplantar IL-1β (data not shown). [score:1]
In conclusion, miR-124 might represent a novel option for the treatment of chronic pain. [score:1]
Collectively, our findings indicate for that miR-124 could represent a novel treatment for chronic pain. [score:1]
In addition, baseline thermal sensitivity was not affected by miRNA administration either (decrease in heat withdrawal latency; WT plus control miRNA 2.6 ± 1.9%; WT plus miR-124 1.8 ± 3.7%; LysM-GRK2 [+/−] plus control miRNA 2.0 ± 3.25%; LysM-GRK2 [+/−] plus miR-124 0.7 ± 3.2%; n = 4). [score:1]
We also determined whether miR-124 can be used to treat persistent hyperalgesia in mo dels of chronic inflammatory and neuropathic pain in WT mice. [score:1]
Interestingly, in vitro it has been shown that co-culture of bone marrow derived macrophages with primary neurons reduces the level of macrophage miR-124 [1]. [score:1]
Therefore, we propose that miR-124 treatment reverses hyperalgesia by restoring the ratio of M1:M2 microglia/macrophages. [score:1]
To our knowledge, this is the first study to describe a beneficial effect of miR-124 treatment on inflammatory pain and a decrease in spinal cord microglial miR-124 in a mo del of persistent hyperalgesia. [score:1]
Notably, however, in control WT mice we did not observe any effect of miR-124 treatment on the magnitude or duration of IL-1β -induced hyperalgesia. [score:1]
It has recently been reported that high levels of the miRNA miR-124 are present in resident microglia in brain and spinal cord. [score:1]
Moreover, this is the first study, to our knowledge, to show that intrathecal miR-124 treatment reverses persistent carrageenan -induced hyperalgesia in WT mice. [score:1]
The miR-124 or control miRNA was injected intrathecally once every day, starting 1 day after SNI surgery. [score:1]
Effect of microRNA-124 in a mo del of neuropathic pain. [score:1]
In addition, we show for the first time that persistent hyperalgesia in GRK2 -deficient mice is associated with an increased ratio of M1/M2 type markers in spinal cord microglia/macrophages, which is restored by miR-124 treatment. [score:1]
Indeed, our present findings show that miR-124 treatment also abrogates the existing persistent hyperalgesia induced by carrageenan in WT mice. [score:1]
Intrathecal treatment with miR-124 at day 6 rapidly attenuated this persistent carrageenan -induced thermal hyperalgesia (Figure  6). [score:1]
The effect of intrathecal miR-124 treatment on IL-1β -induced hyperalgesia and spinal M1/M2 phenotype, and on carrageenan -induced and spared nerve injury -induced chronic hyperalgesia in WT mice was analyzed. [score:1]
At 24 hours after intraplantar injection of IL-1β, the level of miR-124 in microglia isolated from the lumbar spinal cord of LysM-GRK2 [+/−] mice was significantly lower than that of spinal microglia from WT mice (Figure  1B). [score:1]
We propose that intrathecal miR-124 treatment might be a powerful novel treatment for pathological chronic pain with persistent microglia activation. [score:1]
The microRNA miR-124 is thought to keep microglia/macrophages in brain and spinal cord in a quiescent state. [score:1]
whereas intrathecal administration of 100 ng negative control miRNA or the lowest dose of miR-124 tested (20 ng) did not have any effect on the course of hyperalgesia in LysM-GRK2 [+/−] mice (Figure  4A). [score:1]
Therefore, it is conceivable that concomitantly, neuronal signals transmitted to the spinal cord induce a reduction in miR-124 and thereby induce a M1 type spinal cord microglia activation. [score:1]
In this study we investigated whether low levels of microglial/macrophage GRK2 promote the transition to chronic hyperalgesia via a miR-124 -mediated pathway in spinal microglia/macrophages, and whether low GRK2 is associated with the expression of the M1 and M2 phenotype in spinal-cord microglia. [score:1]
The next question we addressed is whether intrathecal miR-124 treatment can also reverse the persistent hyperalgesia that develops in WT mice after intraplantar injection of carrageenan [8, 9, 27, 28]. [score:1]
Transition from acute to persistent hyperalgesia in LysM-GRK2 [+/−] mice is associated with reduced spinal cord microglia miR-124 levels. [score:1]
We present the first evidence that intrathecal miR-124 treatment can be used to prevent and treat persistent inflammatory and neuropathic pain. [score:1]
Mice received an intrathecal injection of 100 ng miR-124 the day before intraplantar injection of 1 ng IL-1β. [score:1]
Effect of microRNA-124 on carrageenan -induced inflammatory hyperalgesia in wild-type mice. [score:1]
To examine the contribution of miR-124 to the course of hyperalgesia, we treated WT and LysM-GRK2 [+/−] mice with an intrathecal injection of miR-124, and monitored its effect on intraplantar IL-1β -induced hyperalgesia. [score:1]
A few recent studies investigated miR-124 expression in other pain mo dels. [score:1]
MicroRNA-124 treatment prevents transition to persistent hyperalgesia in LysM-GRK2 [+/−] miceTo examine the contribution of miR-124 to the course of hyperalgesia, we treated WT and LysM-GRK2 [+/−] mice with an intrathecal injection of miR-124, and monitored its effect on intraplantar IL-1β -induced hyperalgesia. [score:1]
Moreover, intrathecal administration of miR-124 did not affect thermal sensitivity at baseline or mechanical sensitivity in the contralateral paw in the SNI mo del and did not affect spontaneous locomotor activity. [score:1]
In WT mice, intrathecal administration of 20 to 100 ng miR-124 did not have any effect on IL-1β -induced hyperalgesia (Figure  4B). [score:1]
Our finding that only in mice with low GRK2 in microglia/macrophages miR-124 levels in spinal cord microglia are reduced in response to intraplantar IL-1β may point to a contribution of a GPCR -mediated signal to nociceptor-to-microglia signaling. [score:1]
The miR-124 treatment completely prevented the mechanical allodynia that develops in the ipsilateral paw in response to SNI (Figure  7A), but did not affect mechanical sensitivity in the contralateral paw (Figure  7B). [score:1]
Figure 7 Effect of miR-124 treatment on SNI -induced mechanical allodynia in WT mice. [score:1]
We also showed that intrathecal administration of miR-124 normalized the M1:M2 ratio and prevented transition to persistent IL-1β -induced hyperalgesia in GRK2 -deficient mice. [score:1]
At this time point, mice received an intrathecal injection of 100 ng miR-124 or control miRNA, and the percentage change in heat withdrawal latency was determined (miR-124 n = 8; control miRNA n = 4). [score:1]
The miRNA-124 (2 μg in 50 μl PBS, PM10691Applied Biosystems, Carlsbad, CA, USA) or control miRNA (2 μg in 50 μl PBS,AM17110; Applied Biosystems) was mixed with transfection reagent (Lipofectamine 2000; Invitrogen, Paisley, UK), diluted to the appropriate concentration (3 μl in 50 μl PBS) and applied intrathecally (5 μl/mouse) while the animals were under light isoflurane anesthesia. [score:1]
First, we examined whether the transition from acute IL-1β -induced hyperalgesia to persistent hyperalgesia in LysM-GRK2 [+/−] mice is associated with changes in the level of miR-124 in spinal cord microglia. [score:1]
The current study is the first, to our knowledge, to show that miR-124 treatment prevents transition to persistent hyperalgesia in mice with low GRK2 levels in microglia/macrophages. [score:1]
Intrathecal administration of miR-124 completely prevented the transition to persistent pain in response to IL-1β in LysM-GRK2 [+/−] mice. [score:1]
The question arises how intraplantar administration of IL-1β induces a decrease in microglial miR-124 levels. [score:1]
Ponomarev et al. showed that microglia activated in vitro and in vivo have low levels of miR-124. [score:1]
However, it is not known whether microglial miR-124 contributes to chronic pain. [score:1]
Intrathecal administration of 50 ng and 100 ng miR-124 completely prevented the transition from acute to persistent IL-1β -induced hyperalgesia in LysM-GRK2 [+/−] mice (Figure  4A). [score:1]
Based on such findings, it has been suggested that high levels of miR-124 are required to keep microglia in a quiescent state [1]. [score:1]
In the present study, by contrast, miR-124 levels were quantified in isolated spinal microglia. [score:1]
Spared nerve injury was performed on WT mice and mice were treated daily with 100 ng miR-124 or control miRNA intrathecally (n = 7 per group). [score:1]
[1 to 20 of 88 sentences]
18
[+] score: 159
To further characterise how direct miR-124 targets are affected by miR-124 inhibition, we selected genes with reduced enrichment in AGO2 binding that also have conserved, predicted miR-124 target sites (TargetScan). [score:8]
miR-125 is highly expressed in neurons, however in contrast to miR-124, also present in glia 30 where distinct genes are likely to be targeted, making bioinformatical approaches to identify miR-125 targets complicated. [score:7]
Inhibition of miR-125 reveals distinct targets but similar dynamics of miRNA regulation compared to miR-124. [score:5]
However, the majority of the genes displaying reduced AGO2 binding upon miR-125 inhibition were different to when inhibiting miR-124 (Fig. 5E). [score:5]
In line with this, Nr4a1 demonstrated a prominent reduction in AGO2 binding (middle panel) and an increased mRNA expression after miR-124 inhibition (right panel; mean ± SEM; **p < 0.01; unpaired t-test). [score:5]
When comparing our data set with in silico predicted and conserved miR-124 targets (TargetScan) we found that around 10% of the genes overlap. [score:5]
However, it is worth noting that inhibition of miR-124 or miR-125 did not affect AGO2 -binding of several validated miR-124 and miR-125 targets (Supplementary Fig. 3). [score:5]
Inhibition of miR-124 alters the miRNA-targetome. [score:5]
In line with the fact that miR-124 is highly expressed in hippocampal neurons, we found that miR-124 inhibition led to major changes in the mRNA-composition of the RISC. [score:5]
We selected the 300 miRNA target genes displaying the greatest decrease in relative enrichment of AGO2 binding following miR-124 inhibition (Fig. 4B; red bars) and investigated whether loss of AGO2 binding correlated with changes in gene expression levels. [score:5]
This provided us with 28 genes of which some have been previously experimentally validated as miR-124 targets, including nuclear receptor subfamily 4, group A, member 1 (Nr4a1), which displayed both reduced AGO2 binding and increased mRNA levels after miR-124 inhibition (Fig. 4E). [score:5]
It is worth noting that several well-defined miR-124 targets such as PTBP1 and Sox9 39 were not identified in our analysis since these genes are very lowly expressed in the adult hippocampus. [score:5]
Similar to when miR-124 was inhibited, the inhibition of miR-125 also led to major changes in the mRNA composition of the RISC where mRNAs from 384 out of the 2177 AGO2-bound genes were lost from the RISC (Fig. 5B). [score:5]
Predicted target genes of three miRNAs (miR-124, miR-125 and let-7) known to be expressed in hippocampal neurons, were found to be highly enriched in the fraction of AGO2-bound mRNAs (Supplementary Fig. S1A, three left-most graphs). [score:5]
Taken together, these data suggest a mo del for sponge-function in which miR-sponge vectors do not act by preventing the targeted mature miRNA to be loaded into the RISC, but rather occupies the RISC at the site that would otherwise be destined for the mRNA of miR-124 target genes, resulting in their release and de-repression (Fig. 3G). [score:5]
We found that inhibition of miR-124, which is highly and specifically expressed in neurons 13, led to significant changes in the composition of mRNAs bound to the RISC. [score:5]
We found that reduced enrichment in AGO2 binding following miR-124 inhibition resulted in increased mRNA expression level as monitored by mRNA-seq (Fig. 4C, ****p < 0.0001 Kolmogorov-Smirnov Z test). [score:5]
To analyse the contribution of miR-124 to miRNA regulation in hippocampal neurons, we generated AAV5 vectors that express a miR-sponge for miR-124 in combination with a GFP-AGO2 fusion protein (AAV5-GFP-AGO2. [score:4]
Genes with reduced AGO2 binding after inhibition of miR-124 were enriched for functions related to transcription, nerve development and metabolic processes (Fig. 4F). [score:4]
In line with this it is interesting to note that dysregulation of both miR-124 and miR-125 have been implicated in Alzheimer´s disease 40 41. [score:4]
In addition, GO analysis of genes with reduced AGO2 binding after inhibition of miR-124 and miR-125 respectively (Figs 4F), confirmed that these two miRNAs regulate separate sets of genes. [score:4]
We performed gene ontology and network analysis on the top 300 genes displaying the greatest decrease in AGO2 binding following inhibition of miR-124. [score:3]
In this figure, GFP expression is not detected in hippocampal neurons (NeuN; red) of GFP miR-124 sensor mice, as miR-124 activity degrades the GFP transcript. [score:3]
miR-125 is a brain-enriched miRNA family, unrelated to miR-124, that is also highly expressed and active in hippocampal neurons but also present in other cells of the brain such as glia 30. [score:3]
We inhibited miR-125 in hippocampal neurons by the same approach used for miR-124 and performed RIP-seq analysis (Fig. 5A). [score:3]
Data are represented as mean ± SEM (E) Inhibition of miR-125 resulted in reduction in AGO2 binding in a different set of genes than that of miR-124. [score:3]
In summary, these data show that decreased AGO2 binding following inhibition of miR-124 is associated with a modest but significant increase in mRNA levels. [score:3]
To probe this issue, we inhibited miR-124 and miR-125 using so-called AAV-sponge vectors. [score:3]
Genes showing the greatest reduction in relative AGO2 binding after miR-124 inhibition (red, dotted graph, n = 263)) were significantly different from that of all other genes (black graph; ****p < 0.0001; Kolmogorov-Smirnov Z test, n = 11026). [score:3]
We also found that mature miR-124 levels in the RISC were only slightly decreased by the expression of AAV5-GFP-AGO2. [score:3]
miR-124 is an evolutionarily conserved miRNA that is highly expressed in the brain 18. [score:3]
miR292sp were used to produce cumulative graphs (x-axis) comparing the presence of a computationally predicted and evolutionary conserved target site for five separate miRNAs (miR-124, miR-125, let-7, miR-21, miR-292). [score:3]
In order to investigate the composition of RISC-bound mRNAs after inhibiting miR-124, we performed RIP-seq experiments on hippocampal neurons expressing AAV5. [score:3]
miR-124 inhibition causes prominent changes in AGO2 binding and de-repression of mRNAs. [score:3]
The expression of miR-124 is initiated in neural progenitors and reaches high levels in mature neurons 13 19. [score:3]
We have also previously demonstrated that the miR-124 and miR-125 sponge sequences used in the current study efficiently de-repress target transcripts using luciferase assays 13 30. [score:2]
Together, these 28 genes showed a slightly higher degree of increased mRNA levels after miR-124 inhibition when compared to the top 300 genes showing the most decrease in relative enrichment of AGO2 binding, although this difference did not reach significance (Fig. 4D; fold change 1.1+/− 0.05 SEM, p = 0.0573). [score:2]
A similar alteration of miR-124 level was detected in the INPUT fractions, which corresponds to all mature miR-124 in the hippocampus (Fig. 3F). [score:1]
The cellular networks controlled by miR-124 and miR-125 are largely separate, yet both networks indicate important functions for these miRNAs in the adult mouse hippocampus. [score:1]
The sponge sequences contained 8 imperfectly complementary binding sites for miR-292 (ACACTCAAAACCCACGGCACTT),miR-124(TTAAGGCACGTATGAATGCCA) and miR-125 (TCACAAGTTTAGTCTCAGGGA). [score:1]
For the miR-124 experiment, we used 3 mice injected with AAV5-GFP. [score:1]
Our GO analysis shows that miR-124 controls genes related to transcriptional control and metabolic processes in hippocampal neurons. [score:1]
We then set out to identify the function of the genetic network controlled by miR-124 in hippocampal neurons. [score:1]
Fluorescence in situ hybridisation (FISH) was conducted as previously described 13 using the miRCURY LNA [TM] detection probes for miR-124 and miR-125 (5′-DIG and 3′-DIG-labeled; Exiqon). [score:1]
[1 to 20 of 44 sentences]
19
[+] score: 155
Taken together these data suggest that mir-135a inhibits Nr3c2 mRNA translation by binding to either one or two sites present in the Nr3c2 3’ UTR; indirect effects of miR-124 on the MR endogenous protein expression have been observed both in N2a cells and CGN. [score:8]
Interestingly, in Aplysia sensory neurons miR-124 expression was found to be regulated by a modulatory neurotransmission important for plasticity [47], suggesting a possible regulatory role of neurotransmission in stress -induced changes in miRNA expression. [score:7]
Moreover, we found a strong reduction of the MR expression after the combined overexpression of plasmids encoding for miR-135a and miR-124 (MR expression 60% of vector control transfection). [score:7]
A mutant reporter lacking the seed matches for miR-124 is unaffected by miR-124 overexpression, as expected, and is more than 60% inhibited by miR-135a overexpression. [score:7]
This complex scenario of the MR expression control might account for the indirect negative regulation of the MR expression by miR-124. [score:7]
Next, to better understand the possible role of mir-135a and miR-124 downregulation in the context of the stress response, we searched for predicted mRNA targets. [score:6]
Here we show that acute stress downregulates miR-135a and miR-124 expression in the amygdala. [score:6]
For endogenous protein expression analysis, N2a cells and CGN (6 DIV) were transfected in 6-well plates with 4 µg of miRNA expression vectors or 100 nM LNA (scramble, LNA anti miR-135a or LNA anti miR-124 (Exiqon), respectively). [score:5]
However, the expression of Nr3c2 reporter was not altered by miR-124 overexpression (Figure 3B). [score:5]
Conversely to miRNA overexpression, the inhibition of endogenous miR-135a and miR-124 in CGN by LNA modified oligonucleotide transfections led to a statistically significant increase in the levels of endogenous MR protein (Figure 4C and D). [score:5]
Finally, we established miR-124 and miR-135a as regulators of the MR expression in mouse N2a cells and CGN. [score:4]
In the present study we focused on the stress -induced downregulation of the brain-specific miR-135a and miR-124, and their possible role in the context of stress response. [score:4]
Importantly, miR-124 was recently identified as a regulator of GR expression [52]. [score:4]
It will be interesting to study whether miR-124 and miR-135a dysregulation is implicated in stress-related or major depressive disorders where a decreased expression of the amygdala MR was found [56]. [score:4]
miR-135a and miR-124 regulate the expression of the endogenous MR protein. [score:4]
Therefore, the observed MR protein increase, related to miR-135a and miR-124 down-regulation, might be instrumental for the MR functional activation in response to the stress -induced increase of CORT levels. [score:4]
miR-135a and miR-124 regulate Nr3c2 mRNA expression. [score:4]
Acute stress induces miR-135a and miR-124 downregulation in the amygdala. [score:4]
In addition, knocking down endogenous miR-135a and miR-124 in CGN we were able to confirm the ability of both these miRNAs to affect the expression of the MR in a different cell system. [score:4]
Figure S5 U1 promoter -driven miR-135a and miR-124 overexpression in Hela and N2a cells. [score:3]
Demonstrating that miR-135a and miR-124 are able to affect the MR expression, we suggest their functional role in the initial stress reaction by the activation of the corticosteroid signaling. [score:3]
These plasmids allow us to obtain high levels of U1 promoter -driven miR-135a and miR-124 expression, as shown by northern blot analysis (Figure S5). [score:3]
To validate the functionality of these putative interactions, the complete mouse Nr3c2 3’ UTR was cloned dowstream of the firefly luciferase coding sequence (Nr3c2 3’ UTR) and this construct was transiently transfected into Hela cells along with miR-135a and miR-124 expression vectors (p135a and p124). [score:3]
As shown in Figure 5A acute stress induced a three-fold increase in the amygdala MR protein levels, this negatively parallels stress -induced alterations in miR-124 and miR-135a expression. [score:3]
0073385.g004 Figure 4(A) N2a cells were transfected with miR-135a (p135a) and miR-124(p124) overexpressing vectors as indicated. [score:3]
These findings demonstrate that mir-135a and mir-124 are able to negatively affect the expression of the endogenous MR. [score:3]
Interestingly, a previous study aimed to the identification of miRNAs involved in kidney water–salt balance and blood pressure regulation, indicated the human NR3C2 gene as a potential target of miR-135a and miR-124 by mean of luciferase assays [41]. [score:3]
Positions of mir-135a and miR-124 target sequences in the mouse annotated Nr3c2 3’ UTR and details of miRNA/mRNA base pairing are indicated. [score:3]
No expression of miR-135a and miR-124 was found in N2a cells (Figure S5, see empty vector lanes). [score:3]
Interestingly, the overexpression of mir-124 determined a 40% decrease on MR protein levels (Figure 4B). [score:3]
Thus, we conclude that mir-135a and mir-124 expression levels are sensitive to stress, as indicated by qRT-PCR for miR-124, and by both microarray and qRT-PCR for miR-135a. [score:3]
We demonstrated that the overexpression in N2a cells of miR-135a and miR-124 determines a reduction of MR protein levels. [score:3]
These reporter experiments indicate a direct functional interaction between miR-135a and the Nr3c2 3’ UTR and a no direct functional interaction between miR-124 and the Nr3c2 3’ UTR. [score:3]
The expression of miR-124 in the nervous system has been broadly investigated, both in the development and in the adult mouse CNS. [score:2]
Hence, we tested the validity of miR-135a and miR-124 binding sites, ascertained by reporter assays from our and others labs, by further experiments on mouse cells expressing the MR protein. [score:2]
We show that after two hours of mouse restraint miR-135a and miR-124 are negatively regulated. [score:2]
However, by luciferase experiments we were not able to confirm a direct interaction between miR-124 and the mouse Nr3c2 3’ UTR. [score:2]
To generate Nr3c2 mutant constructs Nr3c2 m135a and Nr3c2 m124, mutations of seed binding sites for miR-135a (Nr3c2 m135a) or miR-124 (Nr3c2 m124) were introduced into the Nr3c2 3’ UTR using synthetic oligonucleotides, by generating partially complementary PCR fragments. [score:2]
Figure S4 Sequence conservation of the miR-135a and miR-124 binding sites within the Nr3c2 3’ UTR. [score:1]
In summary, we report that miR-135a and miR-124 are important components of the stress signaling response in the brain. [score:1]
Beneath miRNA sequences, nucleotides mutated at the level of miRNA binding sites in the mutant constructs Nr3c2 m135a (mutated at both miR-135a seed binding sites) and Nr3c2 m124 (mutated at both miR-124 seed binding sites), are indicated (nts in bold). [score:1]
Two binding sites for miR-124 are also predicted (Figure 3A), the first conserved in 14 different species (Figure S4). [score:1]
[1 to 20 of 42 sentences]
20
[+] score: 152
According to the information above, we aimed to assess the hypothesis that miR-124 could downregulate the expression of flotillin-2 via targeted binding to its 3’UTR region, and could therefore affect the vesicular transport via regulation of caveolin-1 expression, ultimately leading to acrosome abnormalities. [score:11]
MiR-124 was found to be a negative factor which downregulated the expression of flotillin-2. MiR-124 was delivered to the testes of three-week-old male mice by intratesticular injection and analysis via qRT-PCR and western blot confirmed that miR-124 downregulated the expression of flotillin-2. Sperm morphology was analyzed by ordinary optical microscopy and transmission electron microscopy three weeks later. [score:11]
MiR-124 downregulated flotillin-2 expression through directly targeting its 3ʹ-UTR. [score:8]
MiR-124 downregulates flotillin-2 expression by directly targeting its 3ʹ-UTR in mouse testicular tissue. [score:8]
In order to illustrate the molecular mechanism responsible for flotillin-2 regulation, an online tool named TargetScan was used to search for putative miRNAs targeted to flotillin-2. MiR-124 was selected as one of the candidate regulators of flotillin-2, which was highly conserved among different species and whose 3ʹ-UTR of mRNA contained a complementary site for the seed region of miR-124 (Fig 1A). [score:7]
In addition, the expression of caveolin-1 protein was suppressed 48 h after injection of miR-124 and the expression of flotillin-1 protein had no significant difference between the two groups. [score:7]
Western blotting of seminiferous tubule lysate demonstrated that the expression of flotillin-2 and caveolin-1 protein were consistently suppressed 48h after injection of miR-124, while the expression level of flotillin-1 protein was no significantly different between the two groups (Fig 2D). [score:7]
Although miR-124 has been reported to downregulate flotillin-1 expression in breast cancer[43], this phenomenon was not observed in the current study. [score:6]
The results showed that miR-124 downregulated the luciferase activity of the flotillin-2 3ʹ-UTR construct, whereas luciferase activity was not significantly decreased in the target region of the mutated mut 3ʹ-UTR construct (Fig 1C). [score:6]
S1 Fig According to the algorithms of TargetScan 5.1, the flotillin-2 gene was predicted to be a potential direct target of miR-124. [score:6]
Analysis of miR-124 predicted targets was determined using the algorithms of TargetScan 5.1 (http://www. [score:5]
The results from this study indicate that miR-124 might play a role in caveolin-independent vesicle trafficking through downregulating flotillin-2. However, the mechanism of caveolin-1 regulation of acrosomal biogenesis requires elucidation in future work. [score:5]
In the current study, bioinformatics analysis was used to predict that miR-124 was a direct and functional target of flotillin-2 via binding to its 3ʹ-UTR. [score:4]
According to the algorithms, the flotillin-2 gene was predicted to be a potential direct target of miR-124. [score:4]
This study was designed to analyze the contribution of miR-124 in the regulation of flotillin-2 expression during acrosome biogenesis in mouse testes. [score:4]
predicted that miR-124 potentially regulates the expression of flotillin-2. The effect of miR-124 on flotillin-2 expression was investigated in vitro using a dual luciferase reporter assay system and in vivo using intratesticular injection into 3-week-old male mice. [score:3]
In addition, miR-124 expression of the seminiferous tubule lysate was analyzed using qRT-PCR to verify the efficiency of miRNA in vivo. [score:3]
The relationship between the flotillin-2 protein and miR-124 expression level was analyzed in vivo by intratesticular injection into mouse testes. [score:3]
A dual luciferase reporter assay was performed to test whether flotillin-2 was a direct target of miR-124 during spermatogenesis. [score:3]
MiR-124, a brain-enriched miRNA, was first found to be involved in stem cell regulation and neurodevelopment[21, 22]. [score:3]
This study provides insights into a novel molecular mechanism of miR-124, with an influence on flotillin-2 expression and involvement in caveolin-independent vesicle trafficking during mouse acrosome biogenesis. [score:3]
This study has revealed, for the first time, that miR-124 modulates the expression of flotillin-2 during spermatogenesis. [score:3]
The results showed faint expression of miR-124 in adult mouse testes (Fig 1D). [score:3]
All these observations led to the conclusion that miR-124 could potentially play an important role in flotillin-2 expression, especially in sperm acrosome biogenesis. [score:3]
These data suggested that the regulation of miR-124 on flotillin-2 depends on the specific seed region sequence. [score:2]
A dual luciferase reporter assay system was performed in order to identify the effects of miR-124 on Flotillin-2 expression. [score:2]
Primers of miR-124 and 5S rRNA used in this study are listed as follows: miR-124 stem-loop RT: 5’-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGCATTC -3’; miR-124 forward: 5’-GGTAAGGCACGCGGT-3’; miR-124 reverse: 5’-CAGTGCGTGTCGTGGAGT-3’; 5S rRNA stem-loop RT: 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGCG-3’; 5S rRNA forward: 5’-CTGGTTAGTACTTGGACGGGAGAC-3’; 5S rRNA reverse: 5’-GTGCAGGGTCCGAGGT-3’ Flotillin-2 forward: 5’- GGAGGCTGTTGTGGTTCTGA-3’ Flotillin-2 reverse: 5’- GTCTCTACGTCCTCACAGCG-3’ β-actin forward: 5’- CCGTAAAGACCTCTATGCC-3’ β-actin reverse: 5’- CTCAGTAACAGTCCGCCTA-3’ The testes of male ICR mice were solubilized in lysis buffer (7 mol/L urea, 2 mol/L thiourea, 4% (W/V) CHAPS and 2% (W/V) DTT), in the presence of 1% (W/V) protease inhibitor cocktail (Pierce Biotechnology, Rockford, IL,USA), and were then homogenized and sonicated. [score:2]
Primers of miR-124 and 5S rRNA used in this study are listed as follows: miR-124 stem-loop RT: 5’-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGCATTC -3’; miR-124 forward: 5’-GGTAAGGCACGCGGT-3’; miR-124 reverse: 5’-CAGTGCGTGTCGTGGAGT-3’; 5S rRNA stem-loop RT: 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGCG-3’; 5S rRNA forward: 5’-CTGGTTAGTACTTGGACGGGAGAC-3’; 5S rRNA reverse: 5’-GTGCAGGGTCCGAGGT-3’ Flotillin-2 forward: 5’- GGAGGCTGTTGTGGTTCTGA-3’ Flotillin-2 reverse: 5’- GTCTCTACGTCCTCACAGCG-3’ β-actin forward: 5’- CCGTAAAGACCTCTATGCC-3’ β-actin reverse: 5’- CTCAGTAACAGTCCGCCTA-3’ The testes of male ICR mice were solubilized in lysis buffer (7 mol/L urea, 2 mol/L thiourea, 4% (W/V) CHAPS and 2% (W/V) DTT), in the presence of 1% (W/V) protease inhibitor cocktail (Pierce Biotechnology, Rockford, IL,USA), and were then homogenized and sonicated. [score:2]
The results demonstrate that miR-124 expression was significantly higher in the miR-124 injected group compared to the negative control group (Fig 2C). [score:2]
Sperm were collected from the caudal epididymis for analysis 3 weeks after miR-124 injection. [score:1]
Approximately 3–5 μL of 0.1 pM miR-124 mimic or a negative control miRNA (Shenzhen Huaanpingkang Biotechnology Company, Shenzhen, China) mixed with indicator (0.4% trypan blue) was injected into the seminiferous tubules via rete testis injection. [score:1]
Equal amounts of miR-124 mimic or control miRNA were separately injected into each of the paired testes from each mouse in the same manner. [score:1]
Approximately 19.9% of sperm were abnormal in the control group; by contrast, nearly 28.5% of sperm were abnormal in the miR-124 injected group (p = 4.68*10 [−5] vs. [score:1]
0136671.g003 Fig 3Paired testes from the same 3 week-old mouse were injected with miR-124 mimic or negative control miRNA, respectively. [score:1]
Function of miR-124 in mouse testes during acrosome biogenesis is a negative factor. [score:1]
A large number of sperm from the caudal epididymis of mice treated with miR-124 mimic had abnormal head morphology. [score:1]
The caudal epididymis that corresponding to the testes treated with miR-124 mimic, sperm with acrosome malformations (b, e), or significant acrosome deficiencies (c, f) were observed. [score:1]
A number of sperm in mice treated with a miR-124 mimic had abnormal acrosome morphologies. [score:1]
Sperm with obvious deformed heads in the miR-124 mimic group demonstrated acrosome abnormalities. [score:1]
The following day, cells were transfected with either miR-124 mimics or a non-specific miRNA negative control (sequences shown in S2 Fig) according to the manufacturer’s protocol. [score:1]
Reverse transcriptase PCR (RT-PCR) was used to investigate whether miR-124 is expressed in mouse testicular tissue. [score:1]
However, in the caudal epididymis that corresponded to the testes treated with miR-124 mimic, sperm with acrosome malformation, or a large number of acrosomal deficiencies were observed (Fig 5). [score:1]
Paired testes from the same 3 week-old mouse were injected with miR-124 mimic or negative control miRNA, respectively. [score:1]
The proportion of sperm head abnormalities increased markedly to 20.7% in the miR-124 mimic group, which was significantly higher than that of the control group (13.7%, p = 0.025). [score:1]
These constructed reporter vectors were co -transfected with miR-124 mimics or a non-specific miRNA negative control (miR-Ctrl) into GC2-spd cells. [score:1]
[1 to 20 of 45 sentences]
21
[+] score: 141
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-2, mmu-mir-124b
Lenti-virus particles are used to overexpress or inhibit miR-124 expression in islets; and lenti-virus particles containing shRNA are used to suppress the expression of iGluR2/3 expression. [score:13]
Figure 4Lenti-virus particles are used to overexpress or inhibit miR-124 expression in islets; and lenti-virus particles containing shRNA are used to suppress the expression of iGluR2/3 expression. [score:13]
As is shown in Figure 4C and 4D, the overexpression of miR-124-3p apparently suppressed iGluR2/3 levels, and iGluR2 and iGluR3 were reduced by 65% and 60%, respectively; the inhibition of miR-124-3p showed only a slight increase in the expression of the two proteins. [score:9]
Co-transfection with miR-124-3p mimics the reporter plasmid containing WT iGluR2 3’UTR in cells, resulting in a nearly 50% decrease in luciferase activity, and miR-124-3p mimics also reduced the luciferase signal by 40% when co -transfected with iGluR3 3’UTR-containing plasmids; the luciferase signal showed a slight increase when miR-124-3p expression was down-regulated (Figure 3C and 3D). [score:6]
In the present study, we confirmed that glucotoxicity enhanced glucagon secretion from islet α cells, with increased expression of iGluR2/3 and down-regulation of miR-124-3p. [score:6]
Subsequent experiments suggested that miR-124-3p simultaneously regulates the expression of iGluR2 and iGluR3 through direct binding with the mRNA 3’UTR, thereby reducing glucagon release. [score:5]
Both glutamate and kainite were demonstrated as effective stimulators of α cell function, and miR-124-3p largely reduced glucagon secretion levels via the synchronous suppression of iGluR2 and iGluR3 expression. [score:5]
The overexpression of miR-124-3p also decreased iGluR2/3, effectively suppressing the secretion of glucagon. [score:5]
The levels of these miRNAs in islets of fasted mice are detected by qRT-PCR, and it is showed that miR-124 expression is suppressed (Figure 2C). [score:5]
Therefore, miR-124-3p is involved in α cell function through the simultaneous regulation of iGluR2 and iGluR3 expression. [score:4]
Therefore, the results of the present study provided information concerning the network that regulates glucagon release, and miR-124-3p is a potential therapeutic drug target for the reduction of glucagon in diabetes mellitus. [score:4]
GluR2 and iGluR3 are direct targets of miR-124-3p. [score:4]
Consistent with the results obtained from bioinformatics, miR-124-3p is the upstream regulator of both iGluR2 and iGluR3, and the concentration of this molecule was strongly inhibited in the islets of mice after fasting. [score:4]
Islets cultured in high glucose also showed lower iGluRs expression, and miR-124-3p was a common regulator of both iGluR2 and iGluR3, which are specifically distributed in α cells but not in β cells. [score:4]
miR-124-3p regulates glucagon release though the repression of iGluR2/3 expression. [score:4]
Both proteins increased two-fold at 48 h and nearly three-fold at 72 h (Figure 5A) but remained unchanged in 5.6 mM glucose (Figure 5C), while miR-124-3p was strongly inhibited under prolonged high glucose (Figure 5D). [score:3]
These data showed that miR-124-3p simultaneously targets the 3’UTR of iGluR2 and iGluR3. [score:3]
Identification of iGluR2/3 as direct targets of miR-124-3p using luciferase assays. [score:3]
Effects of glucotoxicity on the expression of miR-124-3p and iGluR2/3. [score:3]
The luciferase assays confirmed that miR-124-3p directly targets the 3’UTR of iGluR2/3. [score:3]
Role of miR-124-3p in glucagon release through iGluR2/3 targeting. [score:3]
However, the glutamate-sensitive glucagon release was blocked when iGluR2 and iGluR3 were strongly inhibited through either siRNA or miR-124-3p (Figure 4E). [score:3]
C and D. The expression of iGluR2 (C) and iGluR3 (D) in isolated islets transfected with shRNA or pre/anti-miR-124-3p mediated through lentiviral particles (n=5). [score:3]
We used a lentivirus containing a pre/anti-miRNA sequence to suppress the miR-124-3p level in islets. [score:3]
D. The expression of miR-124-3p in islets cultured under long-term high glucose (n=5). [score:3]
In the present study, mouse islets were cultured in medium containing 25 and 5.6 mM glucose for 72 h, and the expression of both iGluR2/3 and miR-124-3p was detected. [score:3]
C-D. Direct recognition of iGluR2/3 through miR-124-3p (n=5). [score:2]
B. miR-124-3p is the common regulator of iGluR2 and iGluR3. [score:2]
Herein, we demonstrated that miR-124-3p is the common upstream regulator of iGluR2 and iGluR3, thus governing the physiological process of glucagon secretion. [score:2]
Figure 3 A-B. Schematic description of the hypothetical duplexes formed by interactions between miR-124-3p and the 3’UTR of iGluR2 (A) and iGluR3 (B). [score:1]
Lentiviral particles containing the shRNAs of iGluR2 and iGluR3 were obtained from Santa Cruz (sc-35488-V and sc-35490-V); lentiviral particles containing pre-miR-124-3p and anti-miR-124-3p were synthesized at GenePharm (Shanghai). [score:1]
The miR-124-3p-iGluRs pathway was also implicated in enhanced glucagon secretion from islets treated long-term under high glucose, an effect referred to as glucotoxicity, which leads to the dysfunction of both α and β cells in type II diabetes. [score:1]
A. relative levels of miR-124 in islets treated with pre- or anti-miR-124 (n=3). [score:1]
Thus, it has been suggested that the pathway comprising miR-124-3p and iGluR2/3 contributes to the functional disorder of α cells in type II diabetes. [score:1]
The effects of glucotoxicity on miR-124-3p and iGluR2/3. [score:1]
The predicted upstream miRNAs of iGluR2/3 are listed in Figure 2A, and miR-124-3p was shared between both iGluR2 and iGluR3 (Figure 2B). [score:1]
A-B. Schematic description of the hypothetical duplexes formed by interactions between miR-124-3p and the 3’UTR of iGluR2 (A) and iGluR3 (B). [score:1]
E-G. Glutamate and kainite-stimulated glucagon release from islets transfected with iGluR2/3 shRNAs or pre/anti-miR-124-3p (n=5). [score:1]
The miR-124-3p-iGluR2/3 pathway might also be involved in α cell dysfunction. [score:1]
This observation suggested that the miR-124-3p-iGluR pathway also contributed to the high glucagon secretion in type II diabetes. [score:1]
[1 to 20 of 40 sentences]
22
[+] score: 120
Other miRNAs from this paper: mmu-mir-124-3, cel-mir-124, mmu-mir-124-2, mmu-mir-375, mmu-mir-124b
As miR-124 will affect protein expression by destabilizing RNA levels of target genes or by inhibiting translation of target mRNAs, the next step is to perform large scale proteomic analyses to identify proteins in our Mus musculus and C. elegans animal mo dels involved in the insulin signaling pathway, redox balance, energy homeostasis, and healthy aging. [score:11]
We next validated the differential expression of the seven miRNAs listed in Table 1 using the liver tissues of four different Wrn [Dhel/Dhel]mutant and four wild type mice (three months of age) Of the seven miRNAs tested, only miR-375 and miR-124 showed significant differential expressions in Wrn [Dhel/Dhel] mutant compared to wild type animals (Figure 1A and Supplementary Figure S1). [score:4]
These results indicate that miR-124 expression is decreased in both Mus musculus and C. elegans during aging and in animals with a mutation in the WRN helicase ortholog. [score:4]
To our knowledge, this is the first study showing a significant altered expression of miR-124 in the liver of aging mice. [score:3]
These results indicate that the expression of miR-124 correlates inversely with age in the liver of mice (Figure 1B). [score:3]
The impact of the Wrn helicase on miR-124 expression is conserved in C. elegansWe next determine whether the observed alteration of the miRNAs in mice could be a global phenomenon during aging by studying these miRNAs in the nematode C. elegans. [score:3]
miR-124 has a role in premature aging through the loss of a functional WRN ortholog helicase activity, although the mechanism by which the loss of WRN affects miR-124 expression remains somewhat unknown. [score:3]
More precisely, the expression of miR-124 in the mouse brain is associated with the differentiation status of neuronal cells [38]. [score:3]
The impact of the Wrn helicase on miR-124 expression is conserved in C. elegans. [score:3]
Expression of mir-124 in C. elegans. [score:3]
Of relevance to our study, miR-124 is also expressed in the normal human liver [42]. [score:3]
These results indicate that the miR-124 expression signature in the liver of young Wrn [Δ] [hel/] [Δ] [hel] mice corresponds to the miR-124 signature in old wild type animals. [score:3]
Expression of mir-124 in C. elegansThree hundred 7-days old adult worms (post-larval L4 stage) were sorted by size to exclude remaining larvae using a COPAS BIOSORT instrument (Union Biometrica, Inc. [score:3]
Furthermore, the loss of miR-124 expression is associated with the lack of WRN helicase function in both species. [score:3]
However, miR-124 is expressed in cell types other than neurons [40, 41]. [score:3]
Furthermore, we found that mir-124 expression is also reduced in older wild type worms (seven days after L4 stage) compared to young worms (at the L4-larvae developmental stage) (Figure 1D). [score:3]
To determine whether miR-375 and miR-124 were also differentially expressed during aging, quantitative RT-PCR was performed on the liver tissues of four young (three months) and four old (21 months) wild type mice. [score:3]
As miR-124 is a regulator of several proteins involved in insulin exocytosis and intracellular signaling in pancreatic beta cell lines [40, 41], it is possible that miR-124 may alter insulin action in vivo directly impacting on organismal homeostasis and aging. [score:3]
The liver of Wrn [Δ] [hel/] [Δ] [hel] mice show differential expression of miR-375 and miR-124. [score:3]
All these phenotypes could be reversed in mir-124 mutation strains after vitamin C treatment. [score:2]
miR-375 was up regulated more than three-fold and miR-124 was down regulated by ten-fold in the liver of Wrn [Dhel/Dhel] mutant mice compared to the liver of wild type animals (Figure 1A). [score:2]
Among them, one conserved miRNA in animals (miR-124) was down regulated in both the liver of Wrn [Dhel/Dhel] mice and in whole wrn-1 C. elegans mutants. [score:2]
Finally, the progeroid phenotypes associated with either WRN or miR-124 mutations can be reversed by vitamin C treatment. [score:2]
Interestingly, we observed that the expression of the conserved miR-124 is significantly reduced by 20% in the wrn-1(gk99) animals (unpaired Student's t-test: P = 0.048) compared to the wild type strain (Figure 1C). [score:2]
Both wrn-1(gk99) and mir-124(n4255) strains obtained from the C. elegans Genetics Center (University of Minnesota, St Paul, MN) were out-crossed four times with the wild type N2 strain to remove possible unrelated mutations. [score:2]
However, the amount of ATP in vitamin C treated wrn-1;mir-124 double mutant worms was still lower than untreated wild type animals (P = 0.0440). [score:1]
The loss of wrn-1 and mir-124 lead to an increase of the aging marker lipofuscinTo determine whether the reduced life span observed in mir-124(n4255) worms was due to a progeroid phenotype, accumulation of the aging marker lipofuscin was examined. [score:1]
Thus, vitamin C did not normalized the amount of ATP in mir-124(n4255) worms to the wild type levels. [score:1]
To conclude, our data indicate that miR-124 is a conserved miRNA that is involved in the aging phenotype across mouse and worm species. [score:1]
The miR-124 has been shown to be involved in neurogenesis not only in mouse but also in C. elegans [38, 39]. [score:1]
Finally, we determined the life span of double mutant wrn-1;mir-124 worms treated with vitamin C. While vitamin C did extend the lifespan of these double mutant worms from 6.6 days to 8.4 days (Figure 5C, P = 3.1 × 10 [−6]), it was not as a dramatic effect as observed for the single mutant worms. [score:1]
The expression of miR-124 was not only reduced in the livers of young Wrn [Δ] [hel/] [Δ] [hel] mice compared to age-matched wild type mice, but it was also reduced in the livers of old wild type mice compared to young wild type mice. [score:1]
In this study, we show that vitamin C also rescued the shorter life span of both wrn-1(gk99) and the mir-124(n4255) mutant animals. [score:1]
We first determined if the modulation of miR-124 is also conserved in C. elegans animals carrying a loss-of-function deletion of the wrn-1 gene (wrn-1(gk99) allele) that encodes the human WRN helicase ortholog [32]. [score:1]
Similarly, the lipofuscin fluorescence observed in mir-124(n4255) mutant worms was also stronger than in the wild type animals. [score:1]
To determine whether the reduced life span observed in mir-124(n4255) worms was due to a progeroid phenotype, accumulation of the aging marker lipofuscin was examined. [score:1]
Deletion of mir-124 in C. elegans resulted in a decrease in life span, an increase in reactive oxygen species (ROS) production, a decrease in ATP levels, and an increase in the aging marker lipofuscin. [score:1]
wild type; **P = 0.00222 for mir-124(n4255) vs. [score:1]
The median life span of mir-124(n4255) mutant worms was also significantly increased to a level similar to wild type animals upon vitamin C supplementation (Figure 5B; log-rank test: P = 3.0 × 10 [−9]). [score:1]
wild type; and *** P = 0.00078 for wrn-1;mir-124 vs. [score:1]
The loss of mir-124, in return, led to a significant increase in overall ROS levels (16% increase; P = 0.0442). [score:1]
In this study, we identified miR-124 as a conserved miRNA in both mouse and worm animal mo dels. [score:1]
Finally, there was a synergic effect on the accumulation of lipofuscin in the double mutant wrn-1;mir-124 worms (Figure 4). [score:1]
Previous studies have not shown an alteration of miR-124 during normal hepatic aging in mice or rats, or in the long-lived Ames dwarf mice [24, 27, 36]. [score:1]
untreated mir-124(n4255) worms: P = 3.0 × 10 [−9]; vitamin C treated wrn-1(gk99) vs. [score:1]
Nevertheless, we demonstrate that a deletion of the mir-124 gene ortholog in C. elegans results in reduced life span, increased whole body ROS levels, and reduced ATP levels. [score:1]
These results indicate that the animals lacking either wrn-1 or mir-124 exhibit a progeroid phenotype that is exacerbated by the loss of both genes. [score:1]
org) revealed that miR-124 is conserved in the short-lived C. elegans but not the miR-375. [score:1]
The loss of mir-124 causes a reduction of life span in C. elegans. [score:1]
The loss of wrn-1 and mir-124 leads to an increase in reactive oxygen species (ROS) generation and a reduction in ATP levels. [score:1]
untreated wrn-1;mir-124 worms: P = 3.1 × 10 [−6]; vitamin C treated wrn-1;mir-124 vs. [score:1]
Because total inactivation of both wrn-1 and mir-124 genes had a greater negative impact on ROS and ATP levels than inactivating wrn-1 alone, these results suggest that the decrease of the miR-124 miRNA can contribute to several key biological processes affected in Wrn [Dhel/Dhel] mice [15, 16, 34]. [score:1]
The mir-124(n4255) strain contains a 212 bps deletion that spans the entire mir-124 sequence. [score:1]
Vitamin C restores the normal life span of wrn-1(gk99) and mir-124(n4255) mutant strainsPreviously, we reported that vitamin C restored the normal life span of Wrn [Dhel/Dhel] mice [16]. [score:1]
The loss of wrn-1 and mir-124 lead to an increase of the aging marker lipofuscin. [score:1]
In addition, the deletion of mir-124 accelerated the accumulation of the aging marker lipofuscin in C. elegans and thus highlights the importance of this miRNA in the progeroid phenotype. [score:1]
Interestingly, the level of miR-124 has also been reported to be down regulated in skeletal muscle of old mice compared to young mice [25]. [score:1]
These results indicate that vitamin C normalized lipofuscin accumulation in wrn-1(gk99), mir-124(n4255), and wrn-1;mir-124 worms. [score:1]
Representative photographs of wild type (N2), wrn-1(gk99), mir-124(n4255), and wrn-1;mir-124 double mutant worms at three days into adulthood. [score:1]
The mir-124 sequence is localized in an intron of the trpa-1 gene. [score:1]
Vitamin C normalizes the life span of mutant wrn-1 and mir-124 strains We recently found that Vitamin C supplementation rescued the shorter mean life span of Wrn [Dhel/Dhel] mice and reversed several age-related abnormalities in adipose, cardiac, and liver tissues [16]. [score:1]
These results implicate a role for the conserved miR-124 in aging in C. elegans. [score:1]
Our observation of a significant decrease in miR-124 levels in aging C. elegans further supports the role of this conserved miRNA in the molecular signature of aging in different animal species. [score:1]
These results indicate that the loss of both wrn-1 and mir-124 functions significantly affect ATP levels in C. elegans. [score:1]
Vitamin C restores the normal life span of wrn-1(gk99) and mir-124(n4255) mutant strains. [score:1]
These results indicate that vitamin C significantly increased the life span of animals lacking the wrn-1 or mir-124 genes. [score:1]
[1 to 20 of 66 sentences]
23
[+] score: 114
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-2, mmu-mir-124b
We demonstrated that miR-124 directly targeted TRB3, and led to activation of AKT and up-regulation of lipogenic genes. [score:7]
Of note, restoration of hepatic TRB3 expression almost completely abrogated the effect of miR-124 on lipids homeostasis, indicating that TRB3 might be the primary target of miR-124 in the regulation of liver TG metabolism. [score:6]
Here, we focus on miR-124 because up-regulation of miR-124 was one of the most pronounced changes among differential expressed miRNAs (Fig. 3A). [score:6]
To clarify whether TRB3 mediates the effect of miR-124 on hepatic lipogenesis, we restored TRB3 (Ad-TRB3) expression in the liver in which adenoviral miR-124 was overexpressed (Fig. 6A). [score:5]
Overexpression of miR-124 also led to a decrease in TRB3 expression and an increase in Akt phosphorylation in HepG2 and Hepa1-6 cells (Fig. 5B,C). [score:5]
Consistently, our data show that overexpression of miR-124 causes increased expression of SREBP1-c and TG accumulation in the liver. [score:5]
miR-124 regulates TRB3 expression. [score:4]
Up-regulation of miR-124 in short term HFD mice. [score:4]
TRB3 is a direct target of miR-124. [score:4]
To further determine whether TRB3 is a direct target gene of miR-124, we constructed a luciferase reporter containing the TRB3 3′UTR and co -transfected with pri-miR-124 or the control into HEK293T and HepG2 cells. [score:4]
Thus, our data clearly indicate that TRB3 is a direct target gene of miR-124 in the liver. [score:4]
Therefore, our data support the notion that miR-124 mediated TRB3 down-regulation plays a critical role in hepatic lipogenesis and TG accumulation. [score:4]
U6 was used for normalization of miR-124 expression. [score:3]
Each mutation attenuated the reduction of luciferase activity by miR-124 (Fig. 5G), while mutation of all three binding sites resulted in abolished repression in luciferase activity (Fig. 5G). [score:3]
miR-124 expression is elevated in short term HFD mice. [score:3]
As predicted, protein levels of TRB3 were decreased in the liver overexpressing miR-124 (Fig. 5A). [score:3]
Thus, our findings suggest that manipulating miR-124 expression might provide an alternative approach for amelioration of hepatic TG accumulation. [score:3]
Our screen revealed a pronounced up-regulation of miR-124 in the livers of 3 days HFD mice compared to ND mice (Fig. 3A), which was further confirmed by qPCR (Fig. 3B). [score:3]
Overexpression of miR-124 increases hepatic lipogenesis. [score:3]
Using a stringent bioinformatics approach, we identified several putative murine miR-124 target genes, among which the gene encoding tribbles homolog 3 (TRB3) harboured a miR-124 binding site. [score:3]
In agreement, mRNA levels of lipogenic genes, SREBP-1C and Fasn, were elevated and correlated well with the expression of miR-124 (Fig. 4F,G). [score:3]
As shown in Fig. 4A, miR-124 expression levels were elevated in livers of mice infected with adenoviral miR-124 (Ad-miR-124). [score:3]
Recombinant adenovirus expressing mouse miR-124 and TRB3 (Ad-miR-124, Ad-TRB3) was generated using the pAd-Easy system according to the manufacturer’s instructions. [score:3]
As expected, overexpression of miR-124 resulted in a marked increase in TG contents and liver weights (Fig. 4B,C), as well as serum TG levels (Fig. 4D). [score:3]
TRB3 overexpression alleviates miR-124 induced TG retention. [score:3]
At the molecular level, we functionally validate TRB3 as a miR-124 target. [score:3]
In the current study, we for the first time identified miR-124 as a regulator in hepatic TG homeostasis. [score:2]
Given that activation of Akt signaling could promote lipogenesis and hepatic TG accumulation 33, we hypothesized that miR-124 may regulate TG metabolism through a TRB3-AKT pathway. [score:2]
How to cite this article: Liu, X. et al. MicroRNA-124 promotes hepatic triglyceride accumulation through targeting tribbles homolog 3. Sci. [score:2]
Therefore, miR-124 was chosen for further experiments. [score:1]
TRB3 restoration abolishes the effect of miR-124. [score:1]
Next, to elucidate the role of miR-124 in the liver, adenovirus containing miR-124 or negative control (NC) were administered into C57BL/6 mice via tail vein injection. [score:1]
miR-124 promotes hepatic TG accumulation. [score:1]
Taken together, our study uncovers a novel miRNA, miR-124, that is responsible for early hepatic TG accumulation, preceding the systemic metabolic disorders. [score:1]
As expected, miR-124 markedly repressed the luciferase reporter activity in both cells (Fig. 5D,E). [score:1]
The primary miR-124 (pri-miR-124) sequence was amplified from the mouse genomic DNA and inserted into pcDNA3.1 vector (Invitrogen, USA). [score:1]
The complete 3′ UTR of murine TRB3 containing either the wildtype or mutated miR-124 binding sites was cloned and inserted into pRL -null vector (Promega, USA). [score:1]
[1 to 20 of 37 sentences]
24
[+] score: 110
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-2, mmu-mir-124b
In contrast, others have demonstrated that downregulation of miR-124 resulted in lower infarct volumes while no changes in terms of infarct volumes have been observed after overexpression of miR-124 [18, 19]. [score:6]
The authors verified that miR-124 overexpression resulted in the production of pro-inflammatory cytokines by targeting the aryl hydrocarbon receptor [54]. [score:5]
For example, in epilepsy Brennan et al. have proved that status epilepticus leads to suppressed miR-124 expression, while administration of synthetic miR-124 significantly augments microglia activation and inflammatory cytokines, including IL-1β, TNF-α and IL-6. In fact, they observed a similar effect (higher microglia reactivity) also in control mice treated with miR-124 [53]. [score:5]
In stroke patients, downregulation of plasma levels of miR-124 within the first 24 h was negatively associated with infarct size [12]. [score:4]
We have also shown that administration of miR-124 NPs increased the number of new neurons in the lesioned area associated with amelioration of Parkinson’s disease-related motor deficits [21]. [score:3]
On the other hand, infusion of an inhibitor of miR-124 (antagomir) into the lateral ventricle of rats prior to transient MCAO resulted in smaller infarct volumes with a significant reduction of TUNEL -positive cells [18]. [score:3]
All data are expressed as medians with the 1 [st] and 3 [rd] quartile values, with the following number of animals included in each experimental group: sham n = 11, PT saline n = 6, PT void NPs n = 6, PT scramble-miR NPs n = 8, PT miR-124 NPs n = 8. *p < 0.05 versus sham group and **p < 0.01 versus sham group. [score:3]
IL-4/IL-13 -dependent and independent expression of miR-124 and its contribution to M2 phenotype of monocytic cells in normal conditions and during allergic inflammation. [score:3]
As so, if around 0,1% of miR-124 NPs reached the brain parenchyma we would have around 4 pmol of miR-124 within the brain, 8-times more miR-124 than the amount locally administered in a Parkinson’s disease mouse mo del [21]. [score:3]
In Crohn’s disease miR-124 promotes intestinal inflammation. [score:3]
Data are expressed as medians with the 1 [st] and 3 [rd] quartile with the following number of animals included in each experimental group: PT saline n = 6, PT void NPs n = 6, PT scramble-miR NPs n = 8, PT miR-124 NPs n = 8. F) Representative images of the infarct area (white) in coronal sections stained with NeuN of mice treated with saline (left) or miR-124 NPs (right). [score:3]
In stroke mo dels, overexpression of miR-124 prior to stroke decreased infarct volume, reduced microglial activation and improved neurogenesis via ubiquitin-specific protease (Usp)14 -dependent REST degradation [14, 15]. [score:3]
Therefore, modifications that improve the blood circulation time, increase cargo protection (mainly against RNases), reduce opsonization, decrease peripheral accumulation and enhance delivery of miR into particular brain regions, such as addiction of polyethylene glycol, surfactant agents or even a targeting molecule, may increase bioavailability of the miR-124 [39]. [score:3]
MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-α–PU. [score:2]
However, miR-124 NPs did not improve functional outcome after the insult. [score:1]
For the systemic delivery of miR-124 NPs we took advantage of the BBB breakdown caused by the PT stroke to facilitate the passage of miR-124 NPs into the brain parenchyma [41, 42, 56]. [score:1]
These results indicate that miR-124 NPs may not only have a neurogenic potential but are also neuroprotective after OGD in vitro. [score:1]
The total levels of BrdU -positive cells were not altered by the exposure to OGD per se nor by the presence of miR-124 NPs after OGD (Fig 1C). [score:1]
A polymeric NP formulation was used as a carrier to deliver miR-124 into SVZ cells. [score:1]
On the other hand, administration of miR-124 NPs to mice subjected to PT did not affect the levels of IL-1β, IFNγ and TNF-α. [score:1]
Neurogenesis is not affected by miR-124 NPs treatment. [score:1]
These results may indicate that lack of efficiency might be due to dosage, timing and route of administration of miR-124 important for its bioavailability and need. [score:1]
SVZ cultures obtained from post-natal C57BL/6 J mice were exposed to OGD for 1 h followed by a reoxygenation period of 24 h with either fresh medium (non -treated cells) or fresh medium containing miR-124 NPs or scramble-miR NPs or void NPs. [score:1]
SVZ cell cultures were then incubated in fresh medium (OGD non -treated cells) or transfected with 1 μg/mL of final concentration of NPs alone or complexed with 200 nM (60 pmol) of miR-124 or scramble-miR (under reoxygenation) in SFM devoid of growth factors for 24 h. A non-OGD control was also used to compare the response of SVZ cells in physiological versus OGD conditions. [score:1]
These proof-of-principle experiments unequivocally demonstrate the delivery of miR-124 loaded NPs into the post-ischemic brain. [score:1]
This is in contrast to what has been observed before and may rather support a pro-inflammatory role of miR-124 as reported in mo dels of epilepsy [53]. [score:1]
3.3 SVZ Neurogenesis after miR-124 NPs treatment in PT mice. [score:1]
From these results, we conclude that stroke induced neurogenesis does not exist in our experimental conditions and that a single intravenous injection of miR-124 NPs was unable to elicit an increase in SVZ neurogenesis neither in the healthy nor in post-stroke brain. [score:1]
miR-124 is the most abundant microRNA in the adult brain [36] and it is a well described inductor of SVZ neurogenesis [37, 38]. [score:1]
3.2 Treatment with miR-124 NPs does not affect lesion volume and functional outcome after photothrombosis. [score:1]
0193609.g004 Fig 4(A-C) Rotating pole test scores of mice subjected to sham surgery or PT surgery and treated either with saline, void NPs, scramble-miR NPs or miR-124 NPs administered intravenously immediately after PT. [score:1]
Moreover, we sought to identify the role of miR-124 on post-stroke inflammatory response and neurogenesis. [score:1]
Effects of miR-124 NPs on levels of pro-inflammatory cytokines in the ischemic territory and serum. [score:1]
All data are represented as medians with the 1 [st] and 3 [rd] quartile with 6 to 11 animals per group: sham n = 11, PT saline n = 6, PT void NPs n = 6, PT scramble-miR NPs n = 7, PT miR-124 NPs n = 8. Abbreviations: NPs, nanoparticles; PT, photothrombosis. [score:1]
In fact, as mentioned before we have observed that a intracerebroventricular injection of miR-124 NPs results in enhancement of olfactory bulb neuroblasts under physiological conditions in mice four weeks after injection [21]. [score:1]
miR-124 reduction is needed in order to shift the resting state of microglia to a reactive state [32]. [score:1]
Our results do not support our initial hypothesis that miR-124 NPs could improve functional outcome following PT, with no changes in behavioral tests observed in this study. [score:1]
miR-124 does not affect neurological function after photothrombosis. [score:1]
Another study even reports that intraventricular administration of miR-124 in mice immediately after MCAO resulted in a non-significant increase of infarct volumes 24 h after stroke [19]. [score:1]
In the present study, we showed that a single intravenous injection of miR-124 NPs immediately after PT does not affect neurological deficits 14 days following the insult. [score:1]
These alterations may aid the miR-124 NPs passage through the BBB. [score:1]
In addition to protective effects, injection of liposomated miR-124 into the striatum of mice two days after transient MCAO promoted an anti-inflammatory state (M2 state) of microglia/macrophages and conversely reduced their pro-inflammatory state (M1 state) correlated with a better functional outcome during the first week after stroke onset [16, 17]. [score:1]
Despite some reports suggesting the migration of SVZ neuroblasts into the peri-infarcted area [30, 31] we found very few DCX -positive cells in this area (Fig 5H; PT saline 0.00 ± 0.00; PT void NPs 1.17 ± 0.79; PT scramble-mIR NPs 0.75 ± 0.49; PT miR-124 NPs 0.38 ± 0.38; medians with the 1st and 3rd quartile). [score:1]
miR-124 is predicted to attenuate inflammatory pathways, since a reduction in the miR-124 is needed to obtain a reactive microglial state [32]. [score:1]
Indeed, we have recently shown that the delivery of miR-124 into the lateral ventricles potentiated SVZ neurogenic potential leading to the amelioration of motor symptoms in mice lesioned with 6-hydroxydopamine [21]. [score:1]
It seems that the route of administration of miR-124 is critical to achieve biological effects of miR-124 in the post-ischemic brain. [score:1]
As shown in Fig 3F representative coronal sections show similar infarct areas in mice treated either with saline or miR-124 NPs, indicating that miR-124 NPs do not contribute to a reduction of the ischemic lesion. [score:1]
miR-124 seems to be essential for the activation and maintenance of the M2 inflammatory state of microglia, through the modulation of the C/EBP-α-PU. [score:1]
With some reservations, it seems that miR-124 is rather efficient in transient stroke mo dels than in permanent mo dels. [score:1]
In contrast, another study showed increased plasma levels of miR-124 and those were correlated with higher mortality during the first 3 months after stroke and a worse outcome based on post-stroke modified Rankin Score (mRS) [13]. [score:1]
Effect of miR-124 NPs treatment on SVZ cell cultures after OGD. [score:1]
Therefore, effects of miR-124 on lesion volumes at an early stage following stroke i. e. 24 h might be due to effects on multiple processes i. e. brain edema without consequences for the final ischemic lesion and function [44]. [score:1]
Immediately after, mice were placed in a restrainer and injected in the tail vein with a total volume of 150 μL of either saline solution, void NPs, scramble-miR NPs or miR-124 NPs, respectively. [score:1]
Previously, it has been shown that viral administration of miR-124 for 21 days prior to MCAO resulted in a decrease of infarct volumes, reduced microglial activation and enhanced motor behavior [14]. [score:1]
These results prompted us to test the efficacy of miR-124 NPs in vivo in a permanent focal photothrombosis mouse mo del for ischemia. [score:1]
Importantly, the only pro-inflammatory cytokine modulated by miR-124 NPs after PT was IL-6. Elevated levels were exclusively found in miR-124 NPs animals following PT suggesting a specific miR-124 mediated effect. [score:1]
No differences were found among sham-operated animal treated with saline, void NPs, scramble-miR NPs or miR-124 NPs. [score:1]
Previous reports showed that miR-124 levels were decreased in neural progenitor cells of the subventricular zone (SVZ) and in the ischemic core [8, 9], but seemed to be elevated in the plasma of rodents subjected to permanent occlusion of the middle cerebral artery (MCAO) [10, 11]. [score:1]
The PT group was then subdivided into 4 subgroups in which mice were treated with an intravenous injection in the tail vein of saline, void NPs, scramble-miR NPs or miR-124 NPs (total of 5 different groups) immediately after surgery. [score:1]
3.1 miR-124 NPs protect SVZ cells and stimulate their differentiation after OGD. [score:1]
In this study, the miR-124 NPs were administered systemically since the intracerebroventricular injection of drugs is not a viable option for the majority of stroke patients. [score:1]
Finally, we studied the miR-124 NPs neurogenic potential after OGD by staining the cultures with the mature neuronal marker NeuN (Fig 1D and 1E). [score:1]
However, studies have shown that miR-124 does not always act as a repressor for microglia activation [53, 54]. [score:1]
Herein, we first showed that SVZ cells, which were exposed to OGD, and then treated with miR-124 NPs were protected and prone to differentiate towards a neuronal phenotype. [score:1]
Moreover, local injection of miR-124 in the striatum of mice subjected to transient MCAO two days after stroke resulted in a reduction of lesions and better functional outcome [17]. [score:1]
3.4 Effects of miR-124 on the post-ischemic inflammatory response. [score:1]
miR-124 NPs do not affect infarct volume of PT mice. [score:1]
Regarding the PT mice, the number of BrdU positive cells was elevated in all the groups independent of the treatment (Fig 5G; PT saline 91.33 ± 11.90; PT void NPs 94.17 ± 8.77; PT scramble-miR NPs 95.25 ± 8.90; PT miR-124 NPs 94.75 ± 6.88; medians with the 1st and 3rd quartile). [score:1]
Also, further studies need to elucidate the exact role of miR-124 antagonism in the post-ischemic brain. [score:1]
Data are shown as mean ± SEM with the following number of animals included in each experimental group: sham n = 10, PT saline n = 4, PT void NPs n = 4, PT scramble-miR NPs n = 3, PT miR-124 NPs n = 4. ** indicates p < 0.01 and *** indicates p < 0.001 versus sham group, [##] indicates p < 0.01 versus all other experimental conditions after PT. [score:1]
Mice were divided into 5 different experimental groups: i) Sham-operated mice (n = 22); ii) PT-operated saline mice (n = 16, 0.9% NaCl); iii) PT-operated void NPs mice (n = 11, 1 mg of NPs); iv) PT-operated scramble-miR NPs mice (n = 12, 1 mg NPs and 4 nmol Scramble-miR); v) PT-operated miR-124 NPs mice (n = 12, 1 mg NPs and 4 nmol miR-124). [score:1]
Exposure to OGD for 1 h led to a significant 1.7-fold increase in the cell death of SVZ cultures, being this effect reverted in cultures transfected with miR-124 NPs after the OGD insult (Fig 1B; non-control OGD 8.82 ± 0.76, non -treated cells 1 h OGD 15.36 ± 1.19, miR-124 NPs 1 h OGD 9.10 ± 0.65, ***p<0.001, ###p<0.001; data are presented as percentages of total number of cells). [score:1]
For example, we demonstrated, using this formulation, that intracerebroventricular delivery of miR-124 -loaded NPs (miR-124 NPs) promotes SVZ neurogenesis in mice both in physiological conditions and after 6-hydroxydopamine lesions. [score:1]
PLGA-PS NPs (6.6 mg) were coated with 4 nmol oligonucleotide (similar length as miR-124) for 1 h, at 37°C, and resuspended in 0.9% NaCl solution (1 mL). [score:1]
For in vitro experiments NPs were dissolved to a final concentration of 1 μg/mL in SVZ cell culture medium devoid of growth factors and complexed with a total of 200 nM of miR (50 pmol of miR-124 or scramble-miR, both from GE Healthcare Dharmacon Inc. [score:1]
[1 to 20 of 75 sentences]
25
[+] score: 98
However, our results show upregulation by miR-124 in melanoma cells, rather than downregulation. [score:7]
When the 124/506B binding site was mutated, miR-124 still upregulated lucifease expression to 240% (p = 0.0030). [score:6]
When both binding sites were mutated, miR-124 did not result in increased expression of the luciferase reporter, at least not as effectively as when both potential binding sites were functional (146% expression, p = 0.1864). [score:5]
Similar to what we observed using the luciferase-reporter assay, miR-124 was able to upregulate MITF expression in the MeWo cells. [score:5]
miR-148 and affect expression of the endogenous MITF In order to test if these miRNAs affect the level of endogenous MITF mRNA in melanoma cells, we used qRT-PCR to determine MITF mRNA expression after transfecting MeWo melanoma cells with the miRNAs miR-124, and miR-148. [score:5]
The possible role of miR-124 in regulating the expression of Mitf during eye development needs to be tested further. [score:5]
At present, it is not clear how miR-124 mediates this upregulation. [score:4]
The mechanisms that mediate this downregulation have not been described and may involve miR-124. [score:4]
miR-124 is interesting considering its expression in the retina [54], as Mitf plays an important role in eye development. [score:4]
When both binding sites are functional, miR-124 positively affects luciferase expression up to 3 fold compared to expression from the vector alone in HEK293 cells (p = 0.0086) (Fig. 3C). [score:4]
A. Expression of human MITF mRNA in MeWo cells transfected with miR-124,, miR-148 or and miR-148 combined. [score:3]
We therefore can not definitely conclude anything about the expression of miR-124 in our samples. [score:3]
miR-124, however resulted in significant increase in reporter gene expression. [score:3]
When the 124/506A binding site was mutated, miR-124 no longer affected expression of the reporter gene. [score:3]
In order to test if these miRNAs affect the level of endogenous MITF mRNA in melanoma cells, we used qRT-PCR to determine MITF mRNA expression after transfecting MeWo melanoma cells with the miRNAs miR-124, and miR-148. [score:3]
miR-124 resulted in increased luciferase expression as seen using the reporter gene construct in HEK293 cells. [score:3]
Role of the miR-124/506 target sites. [score:3]
miR-124 is predominantly expressed in the brain, specifically in differentiating and mature neurons [51], [52], [53]. [score:3]
and miR-124/506 affect m Mitf RNA in HEK293 cellsThe luciferase assay experiments were also performed in human embryonic kidney cells (HEK293), which do not express Mitf at significant levels. [score:2]
The level of miR-124 expression was considered to be too low to be detected in all cell types. [score:2]
In addition, both and miR-124 induced differentiation of adult mouse neural stem cells and were able to induce cell cycle arrest of glioblastoma multiforme cells [47]. [score:1]
The binding sites for microRNAs miR-124/506 are very well conserved in the Mitf 3′UTR sequence. [score:1]
Also, when miR-124 was combined with other miRNAs, the effects were always equal to the effects observed with miR-124 alone. [score:1]
We tested the effects of microRNAs which have conserved binding sites in the 3′UTR region of Mitf, including miR-27a (located at 229–235 in the mouse Mitf 3′UTR sequence), miR-25/32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR-124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931–2937) (Fig. 1A and 1B). [score:1]
There are two binding sites for miR-124/506 in the mouse Mitf 3′UTR sequence. [score:1]
When miR-124 and were combined, the same effect was observed as when was transfected alone (Fig. 2C). [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
These results suggest that miR-124 leads to positive effects on the Mitf mRNA by binding to the 124/506A binding site. [score:1]
Some miRNAs seem to have a tissue-specific function like miR-124 in neurons wheras other miRNAs are found more universally. [score:1]
B. analysis on MITF protein levels in MeWo cells, when transfected with miR-124,, miR-148 or and miR-148 combined. [score:1]
miR-124 and miR-506. [score:1]
and miR-124/506 affect m Mitf RNA in HEK293 cells. [score:1]
The effects of miR-124 might be an artifact of the reporter system. [score:1]
miR-124/506 also has a less conserved binding site at 548–554, and was therefore also tested in our study. [score:1]
Also, when miR-124 was transfected, higher MITF protein levels were observed (Fig. 4B). [score:1]
It has not been shown previously that miR-124 and/or miR-506 can affect Mitf mRNA. [score:1]
C. Effects of miR-124 on the mouseMitf-3′UTR-luciferase reporter when the potential binding sites are mutated. [score:1]
ND (1/9) ND (0/9) 34.69 (7/9) 37.39 (1/3) miR-124 34.37 (9/9) 34.73 (5/9) 35.09 (2/9) 32.68 (3/3) miR-506 35.19 (2/9) 34.73 (3/9) 32.87 (9/9) ND (0/9) miR-148a 27.90 (9/9) 28.29 (9/9) 28.82 (9/9) 33.12 (3/3) miR-148b 28.37 (9/9) 28.65 (9/9) 29.37 (9/9) 35.19 (1/3) miR-152 34.08 (9/9) 35.12 (9/9) 34.26 (9/9) 35.05 (2/3) miR-16 contr. [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
Ten vertebrate species contain both miR-124/506 binding site; the Loxodonta africana sequence only contains 124/506B. [score:1]
P-values are: Scramble  = 0.0396; miR-124 = 0.2228; = 0.0069; miR-148 = 0.0051;+148 = 0.0051. [score:1]
[1 to 20 of 41 sentences]
26
[+] score: 85
Use of miR-124 target sites restricts transgene expression to murine RPE in vivo To restrict AAV2/5-CMV -mediated transgene expression to the RPE, we exploited miR-124, a miRNA abundantly expressed in differentiated neurons [30]. [score:9]
To check whether the high number of miRTs could perturb the capacity of miRNAs to regulate their physiological target genes, we analyzed the expression levels of VAMP3 and RDH10, two direct targets of miR-124 [39], [40] in retinal samples of animals (n = 4) injected with high doses of either the control AAV2/5-CMV- EGFP or the construct bearing the miR-124 binding sites. [score:9]
In particular, constructs harboring miR-124 binding sites can efficiently de-target reporter expression from the PRs, while the presence of miR-204 sites induces elimination of transgene expression from the RPE. [score:7]
Finally, to exclude that the presence of exogenous miRNA target sequences can interfere with the physiological function of the PRs, we performed electroretinograms (ERG) on mice injected at a high dose (2.6×10 [9] GC/eye) with the AAV2/5 vectors harboring the miR-124 or miR-204 target sequences and the control EGFP construct. [score:5]
Although this does not appear to be a problem as we did not observe any retinal toxic effect so far [21], ideally we could have tailored RPE65 expression to RPE if we had included miR-124 target sites in our AAV vector. [score:5]
Our results demonstrate that miR-124 and miR-204 target sequences can efficiently restrict AAV2/5 -mediated transgene expression to retinal pigment epithelium and photoreceptors, respectively, in mice and pigs. [score:5]
As shown in Figure 3, the use of target sequences for miR-204 (Figures 3c,d ) and miR-124 (Figures 3e,f ) efficiently restricted AAV2/5 mediated EGFP expression to the PRs and RPE of the porcine retina, respectively. [score:5]
Use of miR-124 target sites restricts transgene expression to murine RPE in vivo. [score:5]
To this end, we generated AAV2/5 vectors expressing EGFP and containing four tandem copies of miR-124 or miR-204 complementary sequences in the 3′UTR of the transgene expression cassette. [score:5]
To restrict AAV2/5-CMV -mediated transgene expression to the RPE, we exploited miR-124, a miRNA abundantly expressed in differentiated neurons [30]. [score:5]
The latter is strongly expressed in the neural retina, predominantly in PRs [25], [26], and, to our current knowledge, is unlikely to either be under the direct control of any of the miRNAs tested or have affinity for the miR-204 and miR-124 miRTs. [score:4]
In particular, we analyzed the expression levels of miR-204 and miR-124, as well as of miR-182. [score:3]
miR-124 and miR-204 expression in retina supports the use of AAV vectors harboring corresponding miRTs. [score:3]
Given the highly conserved cellular distribution of these two miRNAs across species [26], [34], [35], we assumed that miR-124 and miR-204 are likely to be expressed in the same porcine retinal layers. [score:3]
miR-124, a neuronal-specific miRNA, is expressed in all layers of the neural retina but is not detected in the RPE. [score:3]
0022166.g001 Figure 1(a) Expression profile of miR-204 and miR-124 in retina sections of adult, albino (CD1) mouse as revealed by ISH using LNA -modified probes. [score:3]
To generate the standard curve, serial amounts (ranging from 10 [2] to 10 [8] copies) of a synthetic RNA oligonucleotide corresponding to miR-124 (5′-UAAGGCACGCGGUGAAUGCC-3′; Sigma–Aldrich, St. [score:1]
Similarly, the cassette containing four copies of a sequence which is perfectly complementary to miR-124 (in capital letters) was constructed by annealing the following two sets of oligonucleotides: 5′-ctagatctGGCATTCACCGCGTGCCTTAcgatGGCATTCACCGCGTGCCTTAaagctt-3′, 5′-TAAGGCACGCGGTGAATGCCatcgTAAGGCACGCGGTGAATGCCagat-3′ and ′-GGCATTCACCGCGTGCCTTAtcacGGCATTCACCGCGTGCCTTAagatc-3′5, 5′-tcgagatctTAAGGCACGCGGTGAATGCCgtgaTAAGGCACGCGGTGAATGCCaagctt-3′. [score:1]
The mature sequence of miR-124 and miR-204 is identical in pigs and mouse (miRBase, http://www. [score:1]
Therefore, we cloned four tandem copies of a sequence that is perfectly complementary to the mature miR-124 downstream of the WPRE element in the pAAV2.1-CMV- EGFP plasmid (Figure 1b ). [score:1]
Four tandem copies (4xmiRT) of a sequence perfectly complementary to the sequence of the mature miR-124 or miR-204 (see alignments) were cloned downstream of the WPRE element in the pAAV2.1-CMV- EGFP plasmid. [score:1]
We and others have shown by ISH that miR-124 stains strongly all retinal cell layers, but is not detected in the RPE [26], [31] (Figure 1a ). [score:1]
[1 to 20 of 22 sentences]
27
[+] score: 82
Therefore, we generated detargeted viruses by inserting two tandem copies of miR-124, miR-125b, or either miR-142-3p target sequences immediately preceding the pCT in the 5′ NCR or two copies each of miR-133b and miR-208a [133/208(2×)] target sequences or four copies of miR-142-3p target sequences in the 3′ NCR of vMC [24]. [score:9]
A dual-detargeted virus named vMC [24]-NC, with miR-124 targets in the 5′ NCR and miR-133 plus miR-208 targets in the 3′ NCR, showed the suppression of replication in both nervous and cardiac tissues but retained full oncolytic potency when administered by intratumoral (10 [6] 50% tissue culture infectious doses [TCID [50]]) or intravenous (10 [7] to 10 [8] TCID [50]) injection into BALB/c mice bearing MPC-11 plasmacytomas. [score:9]
In vivo toxicity testing confirmed that miR-124 targets within the 5′ NCR suppressed virus replication in the central nervous system while miR-133 and miR-208 targets in the 3′ NCR suppressed viral replication in cardiac tissue. [score:9]
This decrease may be the result of low levels of miR-124 being expressed, binding of the repeated miR-124 target sequences by another miRNA with partial complementarity, and/or an insert -mediated inhibition of an important host-cell virus interaction. [score:7]
We also generated detargeted viruses containing two copies each of either miR-124 or miR-125b target sequences prior to the pCT in the 5′ NCR and the 133/208(2×) insert in the 3′ NCR. [score:5]
miR-134 is also highly expressed in the hippocampus, a major site of mengovirus pathology, and may serve as an additional alternative to miR-124 or miR-125 targets, expanding the versatility of this virotherapy. [score:5]
In contrast, miR-124 is absent or expressed at low levels in peripheral macrophages but is expressed within microglia (56, 57). [score:5]
No changes were observed in either of the miR-124 target sequences in the 5′ NCR, and only one of the clones had a single base mutation in the region preceding the insert site (Fig. 4A). [score:4]
Virus isolated from the spinal cord of one mouse had several single-nucleotide insertions in the first miR-124 target sequence; however, no mutations were observed in the second. [score:4]
Three of the four mice had no mutations in the miR-124 target sequences isolated from the spinal cord. [score:4]
One of the mice had no mutations in the miR-124 target sequences amplified from the heart tissue. [score:4]
We also constructed a virus with three copies of the miR-124 targets upstream of the pCT in the 5′ NCR and the 133/208(2×) insert in the 3′ NCR. [score:3]
miR-125b is ubiquitously expressed in all cell lineages of the brain, whereas miR-124 is highly enriched in neurons (28 – 33). [score:3]
Following nested PCR, sequences with large deletions of the miR-124 target sequences were amplified in three of the four mice. [score:3]
To enhance its safety profile, microRNA target sequences complementary to miR-124 or miR-125 (enriched in nervous tissue), miR-133 and miR-208 (enriched in cardiac tissue), or miR-142 (control; enriched in hematopoietic tissues) were inserted into the vMC [24] NCRs. [score:3]
Ponomarev ED, Veremeyko T, Barteneva N, Krichevsky AM, Weiner HL 2011 MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU. [score:2]
Cheng LC, Pastrana E, Tavazoie M, Doetsch F 2009 miR-124 regulates adult neurogenesis in the subventricular zone stem cell niche. [score:2]
Sequences complementary to miR-142, miR-124, miR-125, miR-133, and miR-208 were successfully incorporated (individually or in combination) into the 5′ and 3′ NCRs of the vMC [24] genome. [score:1]
[1 to 20 of 18 sentences]
28
[+] score: 80
Highly expressed miRNAs included miR-124, miR-125a, miR-125b, miR-204 and miR-9. Over -expression of three miRNAs with significant predicted effects upon global mRNA levels resulted in a decrease in mRNA expression of five out of six individual predicted target genes assayed. [score:8]
The identity and expression pattern of those miRNAs which were detected by analysis of target gene expression, such as miR-124, miR-125 and miR-9, provides further evidence that miRNAs play a central role in neuronal differentiation during retinal development. [score:8]
The expression of each individual miRNA corresponded broadly with its predicted effects upon target gene expression (e. g. miR-25 highest at P4 and miR-124 absent in CE-RSCs but present in P4 and adult mouse retina). [score:7]
ELOVL4 has been implicated in Stargardts disease and macular dystrophy [32] and is expressed in photoreceptor inner segments [33], in agreement with the ISH localisation of miR-124 (Figure 5), its predicted regulator. [score:6]
Six genes targeted by three miRNAs with the highest expression and greatest predicted effects (miR-124; miR-125 and miR-9. ) were selected for validation: ACCN2; ETS1; KLF13; LIN28B; NFIB and SH2B3. [score:5]
Not surprisingly, these effects were related to the expression level of the miRNA; those with extremely significant effects, such as miR-125, miR-124 and miR-9 were amongst the most highly expressed in the P4 and adult murine retina. [score:5]
For example, miR-125, miR-124 and miR-9 have all been independently reported to be highly expressed in the retina [9- 11]. [score:3]
C: In the adult retina, miR-124 was expressed in all layers with the highest intensity in the photoreceptor inner segments (arrows) and cells in the INL (arrowheads). [score:3]
The following miRNAs had highly significant predicted effects on target mRNA levels and were selected for analysis by: miR-124, miR-125, miR-9, and miR-24. [score:3]
Our ISH for miR-124 in the adult retina confirmed previous reports [9] and showed miR-124 expression in all retinal layers, with particularly high levels in photoreceptor inner segments. [score:3]
In mouse brain miR-124 expression is restricted to mature neurons [46] and it promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing [47]. [score:3]
Furthermore, miR-124 is highly expressed in P4 and adult retina in accordance with its predicted effects. [score:3]
Expression of miR-124 in the immature retina (P4) was lower than that in the adult retina and the ISH signal at P4 mainly corresponded to early differentiating neurons, retinal ganglion and amacrine cells. [score:3]
Expression of miR-9 was not detected in CE-RSCs, but in contrast to miR-124 it peaked in the P4 retina. [score:3]
Following transfection of HEK293 cells with a pool of miR-124, miR-125 and miR-9 miRNA mimics the mRNA expression of 5 of these 6 genes was significantly reduced (Figure 6). [score:3]
The reported absence of miR-124 in neural and retinal stem/progenitor cells in vivo [9, 48, 49] concurs with the lack of detectable expression in the CE-RSC spheres. [score:3]
B: Expression of miR-124 at P4 corresponded to the location of amacrine (arrows) and ganglion cells (arrowheads). [score:3]
Expression in the adult murine retina of the well-characterised neural miRNA miR-124 concurred with published reports [9]. [score:1]
In P4 retina, miR-124 positive signal was mainly colocalised with ganglion and amacrine cells. [score:1]
For example, miR-124 has been associated with the transition from neural progenitor to differentiated neuron in the zebrafish brain [45]. [score:1]
Together with miR-124 and miR-9, miR-125b is also induced during neural differentiation of embryonic stem cells [51]. [score:1]
A: No positive signal was detected for miR-124 in CE-RSC neurospheres. [score:1]
In the adult retina miR-124 and miR-125 were again prominent, but others, including miR-24, miR-326, miR-370, miR-96 and let-7 also had highly significant predicted effects. [score:1]
Pools of miR-124, miR-125 and miR-9 miRNA mimics (miRNAs) or scrambled controls (Scrambled) were transfected into HEK293 cells. [score:1]
At P4 many miRNAs had highly significant effects, with miR-124, miR-125 and miR-9 being particularly significant (Figure 1, Table 1 and Additional file 1: Table S1). [score:1]
[1 to 20 of 25 sentences]
29
[+] score: 79
To identify critical potential miRNA:mRNA interactions that regulate switching from the M0 to the M2a phenotype we performed correlation analysis on the following up-regulated miRNAs: miR-449a, - 295, -145, -297-5p, and -214 and the following down-regulated miRNAs: miR-124, -154*, -2133, -384-5p, -2135, -3473, -326, -2132, -133, -383, -2861, -2138, -762, -1224 and -711. [score:8]
For M2-skewed activation, the down-regulation of miRNAs is critical in ‘releasing’ primary microglia from their M0 state, through down regulation of miR-711 and miR-124, and up-regulation of miR-145 may facilitate establishing the M2a-alternatively activated state. [score:8]
M1-skewing of microglia yielded four up-regulated miRNAs: miR-155, -297b-5p, -10b, and -376a and six down-regulated miRNAs: miR-124, -2132, -2133, -700, -689, and -762. [score:7]
Interestingly, down-regulation of miR-711 or mir-124 are as significant as up-regulation of either miR-145 or miR-449a in establishing the M2a phenotype based on –log(p-value) score (Fig 4D and Table S5). [score:7]
Interestingly, down-regulation of miR-689 and miR-124 appears to have more impact on these gene transcriptional networks than the up-regulation of miR-155 based on the –log (p-value) from the IPA enrichment analysis (Fig. 4C and Table S3). [score:7]
We applied this methodology to the following up-regulated miRNAs under LPS stimulation: miR-155, -297-5p, -302c, -10b, -495, -7a, -376a, -539, and -876-5p and the following down-regulated miRNAs under LPS stimulation: miR-124, -2132, -2122, -143, -219, -700, -689, -762, -1901, -466b-3p, -192, -383, -3474 and -1928. [score:7]
Further, our second IPA analysis identified that down-regulation of miR-711 or miR-124 may play a key role in ‘releasing’ microglia from the M0 state, and up-regulation of miR-145 may contribute to establishment of the M2a state. [score:7]
Overall, our data suggests that down-regulation of miRNAs, e. g. miR-689 and miR-124, may ‘release’ microglia from the M0 state, and up-regulation of miR-155 contribute to the establishment of the M1-skewing. [score:7]
Further, our second IPA analysis identified down-regulation of both miR-689 and miR-124 as playing potential key roles in M1-activation of microglia. [score:4]
Specifically, during M2a-skewing down-regulation of miR-711 and miR-124 may work in coordination to release microglia from the resting state. [score:4]
As observed with in M1, down-regulation in miR-124 and miR-711 appears to be important for release from the M0-phenotype and transition to the M2 status. [score:4]
Recently, Ponomarev et al. demonstrated a key role of miR-124 in microglial differentiation and its ability to suppress inflammatory response of infiltrating macrophages in an experimental autoimmune encephalitis mouse mo del [27]. [score:3]
At the M0 state (top), resting microglia function in a surveillance and detection mode, which appears to be regulated by various nuclear receptor pathways and select miRNAs: miR-124, miR-689 and miR-711. [score:2]
Further, miR-124, a miRNA known to alter microglial phenotypes [27], was identified as potentially regulating ELK4, NCOA3, NFE2L2, and STAT1 transcriptional networks in this analysis. [score:2]
To establish the M1-skewed activation of microglia, reductions of both miR-689 and miR-124 release microglia from resting (M0) state, and facilitate canonical TLR signal pathways and NF-κB-RelA effector pathways, enabling the initial pro-inflammatory “recruitment” M1 phenotype. [score:1]
The M1 phenotype is the “classic activation” status and prominently induces canonical M1 marker genes, e. g. IL-1β, TNF-α and IL-6. miR-124 and miR-689 are critical in initiation of the transition from the M0 to the M1 state. [score:1]
[1 to 20 of 16 sentences]
30
[+] score: 73
Based on these observations, we concluded that for the most effective attenuation of LGTV replication in the CNS and to ensure the highest stability of viral genome, targets for two different brain-expressed miRNAs (mir-9 and mir-124) should be expressed simultaneously at two (or more) genome regions. [score:7]
Moreover, the most effective virus suppression in the brain was achieved when these cassettes included targets for 2 heterologous miRNAs (mir-124 and mir-9) broadly expressed in the CNS. [score:7]
This likely indicates that combined expression of targets for two different miRNAs (mir-124 and mir-9) in C(mir) and 3′(mir) results in a stronger virus attenuation in the CNS as compared to the targeting for only mir-124 inserted in the E(mir) genome. [score:6]
To confirm that attenuation of C(mir), E(mir) and 3′(mir) viruses was due to the presence of targets for vertebrate brain-specific mir-124 and/or mir-9 and not due to the presence of targets for tick-specific mir-1 (see Fig. 4A), we compared growth rates in the mouse brain for 3′(1/1/1), 3′(9/9/9) and 3′(124/124/124) viruses carrying of three target copies for homologous mir-1, mir-9, or mir-124 miRNA (see Fig. S4A). [score:6]
This demonstrates that presence of intact target sequences for mir-124 and mir-9 in C(mir), E(mir) and 3′(mir) viruses likely resulted only in a negligible effect on viruses attenuation in ISE6 cells, suggesting that LGTV targeting for CNS-specific miRNAs alone does not result in invertebrate-specific host range restriction. [score:5]
To generate 3′(mir) clone carrying sequences complementary to tick- and CNS-specific miRNAs (Fig. 4A), a fused mir-1/mir-9 target sequence was inserted at nt position 10, and two copies of mir-124 target were introduced at nt positions 14 and 244 of the 3′ NCR of LGTV clone E5. [score:5]
To assure concurrent restriction of LGTV neurotropism in vertebrate host and replication in its tick vectors, targets for tick-specific mir-1 and/or mir-275 were inserted in tandem with sequences complementary to CNS-specific mir-124 and/or mir-9 into either dCGR, dE/NS1R, or 3′ NCR and three miRNA -targeted C(mir), E(mir) and 3′(mir) viruses were generated, respectively (Fig. 4A). [score:5]
Similarly, to generate E(mir) clone, a miRNA targeting cassette containing targets for mir-124/mir-1/mir-124/mir-275/mir-124 was fused with duplicated E/NS1 stem-anchor region and inserted at nt position 2489 of E5 genome. [score:5]
To generate 3′(9/9/9), 3′(124/124/124) and 3′(gf/gf/gf) viruses, three target sequences for mir-1 in 3′(1/1/1) construct were replaced with targets for CNS-specific mir-9 or mir-124, or with sequence corresponding to position 241–260 nts of eGFP coding sequence 37. [score:5]
There is a possibility that insertion of targets for tick-specific miRNAs (mir-1 and mir-275) in combination with targets for CNS-specific miRNAs (mir-124 and mir-9) might prevent microRNA -induced silencing complex (RISC) -dependent attenuation of LGTV replication in the CNS of vertebrates. [score:5]
A translational frame (ORF) was restored by inserting a targeting cassette for mir-9, mir-124, mir-1, and mir-124 miRNAs downstream of 5′ promoter region. [score:5]
To verify these results, we constructed viruses carrying of three target copies for homologous mir-1, mir-9, or mir-124 miRNA (Fig. S4A) and found that replication of LGTV containing three targets for CNS-specific mir-124 or mir-9 in the 3′ NCR was indistinguishable (p > 0.5; 2-way ANOVA) as compared to replication of LGTV control virus with three copies of random sequences in ISE6 cells (Fig. S4A,B). [score:4]
However, infection with the same dose of C(mir)/E (mir) or E(mir)/3′(mir) virus (both have only mir-124 targets in the dE/NS1R) resulted in 20% and 40% mortality, respectively (Fig. 6F). [score:3]
In contrast, the genome targeting for only mir-124 in E(mir) was far less efficient for virus attenuation in the CNS (Fig. 6), which is in an agreement with earlier observations 23 33. [score:3]
However, growth of 3′(1/1/1) virus was significantly higher (p < 0.0001; 2-way ANOVA) as compared to that of 3′(124/124/124) and 3′(9/9/9), which carry target copies for CNS-specific mir-124 or mir-9 in the 3′ NCR (Fig. S4C). [score:2]
[1 to 20 of 15 sentences]
31
[+] score: 72
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-18a, mmu-mir-124-2, mmu-mir-18b, mmu-mir-124b
Here we have studied the impact of long term exercise and housing conditions on: a) hippocampal expression of glucocorticoid receptor (Nr3c1), b) epigenetic regulation of Nr3c1 (DNA methylation at the Nr3c1-1F promoter and miR-124 expression), c) anxiety (elevated plus maze, EPM), and d) adrenal gland weight and adrenocorticotropic hormone receptor (Mc2r) expression. [score:8]
While miR-18 is expressed in multiple tissues, miR-124 is particularly enriched in the brain [21] and has been shown to inhibit Nr3c1 expression in cultured cells and in vivo [22]. [score:7]
Thus, the aim of this study was to investigate the impact of exercise and housing conditions on: a) Nr3c1 expression in the hippocampus, in particular Nr3c1-1F, b) Nr3c1 epigenetic regulation (miR-124 expression and DNA methylation at the promoter region of Nr3c1-1F), c) anxiety and d) adrenal gland weight and Mc2r expression. [score:6]
This increase was correlated with a downregulation of miR-124, a known epigenetic regulator of Nr3c1. [score:5]
Since miR-124 has previously been shown to regulate Nr3c1 [22], it could be hypothesized that the negative correlation between Nr3c1 and miR-124 levels is due to a direct effect of decreased miRNA-124 on Nr3c1 expression. [score:5]
Interestingly, miR-124 expression in the hippocampus peaks during the stress hyporesponsive period, when mild stressors do not produce elevation in glucocorticoid levels in neonates [22]. [score:3]
miR-124, a highly conserved microRNA (Fig.   4a) that is particularly enriched in the brain, was shown to repress Nr3c1 expression both in vitro and in vivo [22]. [score:3]
Post hoc comparisons indicated that sedentary single-housed mice had significantly higher miR-124 expression than mice that exercised [t (14) = 2.485 p = 0.026] (Fig.   4b) and sedentary pair-housed mice [t (11) = −3.295 p = 0.007] (Fig.   4b). [score:3]
a The mature sequence of miR-124 and the 3′ untranslated region of Nr3c1 are highly conserved across species, suggesting a critical functional link between them (miRNA seed sequence shown in capitals). [score:3]
Thus we studied whether exercise and/or housing conditions affected miR-124 expression in the hippocampus. [score:3]
b Expression of miR-124 for single-housed mice and pair-housed that exercised or remained sedentary. [score:3]
We found that the effects of exercise and housing on miR-124 expression follow a pattern opposite to the one for Nr3c1. [score:3]
Pair-housing reduced both Nr3c1 and miR-124 expression in the hippocampus. [score:3]
The 3′ untranslated region of the Nr3c1 gene contains multiple microRNAs’ seed regions, including miR-124 and miR-18 [20]. [score:3]
Pair-housed animals expressed lower levels of miR-124 [Two-way ANOVA, F (1,25) = 4.604 p < 0.042] (Fig.   4b). [score:3]
These results suggest that exercise exerts a positive impact on stress resilience in single-housed mice that could be mediated by decreasing miR-124 and increasing Nr3c1 expression in the hippocampus. [score:3]
Exercise increased Nr3c1 and Nr3c1-1F expression and decreased miR-124 levels in the hippocampus in single-housed mice, suggesting enhanced resilience to stress. [score:3]
miR-124 analysis. [score:1]
This could lead to different effects of housing on Nr3c1 and miR-124 as, in the hippocampus, transient release of glucocorticoids promotes neurogenesis, learning and memory [42, 43]. [score:1]
The effect of exercise on hippocampal miR-124 levels differs depending on the housing conditions. [score:1]
Additionally, Nr3c1 and miR-124 levels were negatively correlated in the single-housed group [Pearson’s r (15) = −0.525, p = 0.045] but not in the pair-housed group [Pearson’s r (11) = 0.046, p = 0.892]. [score:1]
Fig. 4Impact of exercise and housing conditions on miR-124 levels at the hippocampus. [score:1]
[1 to 20 of 22 sentences]
32
[+] score: 68
Conversely, predicted target genes of miR-124 promote cell cycle progression and are upregulated during satellite cell activation when miR-124 is downregulated (Figure 8). [score:9]
In contrast, inhibition of miR-124 increased the percentage of Pax7+/MyoD- ‘reserve’ cells at 3 and 5 days of culture, as did inhibition of miR-106b (Figure 7A-F). [score:5]
Comparing relative levels in muscle tissue and satellite cells revealed that miR-124 is likely only expressed in satellite cells, while miR-16, miR-93, and miR-106b are most likely expressed in satellite cells and in differentiated muscle fibers. [score:5]
The four candidate miRNAs (miR-16, miR-93, miR-106b, and miR-124) that displayed dynamic expression in satellite cells were inhibited in myofiber -associated satellite cells prior to the first cell division. [score:5]
Inhibition of two miRNAs, miR-106b and miR-124, increased the relative number of progenitor or ‘reserve’ satellite cells (Pax7+/MyoD-) relative to a control, suggesting that these miRNAs participate in the regulation of satellite cell fate and satellite cell self-renewal. [score:4]
Moreover, miR-124 was expressed at levels 10-fold greater in quiescent satellite cells than in uninjured skeletal muscle (compare Figure 6I and 6B, Figure 6J; Table 8), suggesting that the primary source of miR-124 in uninjured muscle is the satellite cell population. [score:3]
Moreover, four of the six miRNAs were expressed in satellite cells (miR-16, miR-93, miR-106b, and miR-124), while two were likely present only in differentiated muscle (miR-107 and miR-200b). [score:3]
The predicted target genes of miR-16, miR-93, miR-106b, and miR-124 were identified using Ingenuity® Systems (http://www. [score:3]
Inhibition of two miRNAs, miR-106b and miR-124, resulted in a dramatic increase in quiescent satellite cells by 3 days post myofiber isolation (E) that remains consistent through 5 days post isolation (F). [score:3]
Remarkably, we found that miR-124 was expressed 35-fold higher in quiescent satellite cells than in freshly isolated or proliferating satellite cells (Figure 6I, J; Table 8). [score:3]
This increase in satellite cells following at 5 days was observed in both proliferating satellite cells (D) and quiescent satellite cells (F) for miR-16, miR-106b, and miR-124 while inhibition of miR-93 resulted in a specific increase in proliferating satellite cells at 5 days (D). [score:3]
200nM miRIDIAN hairpin inhibitors (Dharmacon) against miR-16, miR-93, miR-106b, and miR-124 were co -transfected with pEGFP-C1-H2B. [score:3]
We further examined the role of miRNAs in satellite cell activation using Ingenuity® System’s IPA and identified PTEN signaling and Cell Cycle Regulation by BTG Family Proteins as the top canonical pathway regulated by miR-16, miR-93, miR-106b, and miR-124 in the transition of a quiescent satellite cell to a proliferating myoblasts (Figure 8). [score:3]
Here, we report global gene expression profiles and candidate miRNAs associated with quiescent and activated satellite cells as well as identify a novel function for miR-16, miR-106b, and miR-124 in satellite cell fate determination. [score:3]
Four of the identified miRNAs (miR-93, miR-107, miR-124, and miR-200b) changed expression levels by more than two-fold during the first 5 days following induced muscle injury (Figure 6B-F; Table 8). [score:3]
The same four micro RNAs (miR-16, miR-93, miR-106b, and miR-124) exhibit dynamic changes in relative expression when comparing activated satellite cells (G, J) to proliferating satellite cells (H, J) and quiescent satellite cells (I, J). [score:3]
miR-16, miR-106b, and miR-124 regulate satellite cell fate. [score:2]
The changes in relative levels of miR-16, miR-93, miR-106b, and miR-124 in satellite cells following a muscle injury suggests that these four miRNAs may play a role in the transition from a quiescent satellite cell to a proliferating myoblast. [score:1]
In the uninjured TA muscle, miR-200b decreased three-fold by 12 h post-injury, while miR-93 and miR-124 increased significantly 12 h post-muscle injury (Figure 6B, C, F; Table 8). [score:1]
miR-16, miR-93, miR-106b, miR-107, miR-124, and miR-200b are detected in satellite cells by in either primary satellite cells or in the satellite cell derived MM14 cell line. [score:1]
In contrast to miR-124, miR-16 and miR-93 are present at low to undetectable levels in quiescent satellite cells and are induced in freshly isolated satellite cells (Figure 6G, I). [score:1]
Within 48 h post-injury, the relative levels of miR-93, miR-107, and miR-124 had decreased levels well below those present in uninjured muscle and remained low at 5 days post-injury (Figure 6C-E). [score:1]
[1 to 20 of 22 sentences]
33
[+] score: 62
We demonstrated that REST, HuR, and PTB proteins are expressed predominantly in epithelial cells in mouse and rat lenses, and showed these factors are also replaced by the predominant expression of REST4, HuB/C/D and nPTB in post-mitotic fiber cells, together with miR-124 expression in vertebrate lenses. [score:7]
Thus, in post-mitotic neurons miR-124 is expressed and suppresses PTB and its non-neuronal alternative splicing activities. [score:5]
Conversely, REST repression of miR-124 in non-neural cells permits PTB expression that in turn suppresses nPTB and its neuronal splicing activities, and promotes PTB -dependent non-neuronal alternative splicing in non-neural cells. [score:5]
In post-mitotic neurons, REST repression of miR-124 expression is alleviated, allowing miR-124 to suppress hundreds of non-neuronal transcripts, including PTB. [score:5]
miR-124 was found to interact with hundreds of non-neuronal mRNAs in neuronal cells, as well as in miR-124 transfected non-neural tissue culture cells, and suppresses their expression [36]. [score:5]
Previously, we determined that miR-124 is also uniquely expressed in adult rat and mouse lenses [37], and subsequently others showed miR-124 is highly expressed in other eye tissues, as well as in the regenerating newt lens [38, 39]. [score:5]
We also demonstrated an additional key member of this regulatory network, miR-124, is expressed in fish as well as mammalian lenses. [score:4]
miR-124 was shown to be further integrated into this global regulatory network in studies that demonstrated that miR-124 gene expression is also repressed by REST in non-neuronal cells [15]. [score:4]
In neurons REST/NRSF transcription factors, HuR-HuB/C/D and PTB-nPTB RNA binding proteins, with miR-124 form a network that differentially regulates non-neural and neuron-specific alternative splicing and gene expression. [score:4]
Conaco et al. [15] showed the miR-124 gene is also a target of REST repression in non-neural cells. [score:3]
In post-mitotic neural cells, miR-124 suppresses PTB [8, 29] to allow neuronal alternative splicing (see diagram below) [2, 26]. [score:3]
miR-124 can also trigger neurogenesis due to its suppression of PTB. [score:3]
During neurogenesis these factors are replaced by what has been considered neuron-specific HuB/C/D, nPTB, and alternatively spliced REST (REST4), which work with miR-124 to activate this battery of genes, comprehensively reprogram neuronal alternative splicing, and maintain their exclusive expression in post-mitotic neurons. [score:2]
Here, we used northern blots to extend these findings and demonstrated miR-124 is produced in a wider array of vertebrate lenses (Figure 9). [score:1]
miR-124 in vertebrate lenses. [score:1]
Right: miR-124 detected with radiolabeled miR-124 probe. [score:1]
In brain, several studies had characterized miR-124 as neuron-specific and showed it suppresses hundreds of non-neuronal transcripts in post-mitotic neurons. [score:1]
Lower asterisk: ~22 bp nucleotide miR-124. [score:1]
Right: miR-124 detected with labeled probe. [score:1]
In a previous study, we demonstrated miR-124 is produced in rat and mouse lenses along with other brain-enriched miRNAs, and by contrast, muscle-specific miR-1 is not present in lenses [37]. [score:1]
[1 to 20 of 20 sentences]
34
[+] score: 57
Numerous miRNA target sites were enriched in the 3′untranslated region (3′UTR) of upregulated genes, the most significant corresponding to the miR-124 seed sequence. [score:8]
It is noteworthy that predicted miR-124 target genes are expressed at rather low levels (1.43x ±0.22) in the Dicer c KO mice (data not shown). [score:5]
It should be cautioned, however, that while several brain miRNAs (e. g., miR-124, miR-29, miR-134, miR-107, miR-9) are, as expected, downregulated in the neuronal Dicer c KO mice [33], not all miRNAs are quantitatively reduced in this mo del, as denoted recently by Babiarz et al. using RNA deep sequencing [34]. [score:4]
One of the most conserved and abundant brain miRNAs, miR-124, can stimulate neuronal differentiation both in vitro and in vivo by targeting the transcriptional repressor REST, a negative regulator of neurogenesis [16]– [19]. [score:4]
While a significant enrichment in miR-124 and various other miRNA seeds were observed in the absence of neuronal Dicer, we observed no particular enrichment in validated miRNA target genes in our subsets of misregulated genes (Table S7 and data not shown). [score:4]
Interestingly, our results suggest that, in addition to miR-124, a large fraction of the neuronal miRNome participates, by order of abundance, in coordinated gene expression regulation and neuronal maintenance. [score:4]
Notably, more than 60% of upregulated genes were enriched in specific miRNA seed sequences, including miR-124 as well as many other miRNAs, highlighting the potential physiological importance of these miRNAs in the neuron. [score:4]
of miR-124 in nonneuronal HeLa cells converts the overall gene -expression pattern to a neuronal one [20]. [score:3]
0044060.g004 Figure 4The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
The highest-ranking IPA networks associated with miR-124, miR-19, miR-29 and miR-20/17/106/93 predicted targets are depicted in Figure 4 and Figure S1. [score:3]
Conversely, inhibition of endogenous miR-124 in cultured primary neurons results in an accumulation of nonneuronal transcripts [17]. [score:3]
The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
Moreover, and importantly, our in silico analyses suggest that miR-124 functions in concert with a large fraction the miRNome to regulate neuronal homeostasis. [score:2]
This mo del displays decreased levels of mature miRNAs in the brain, including the neuron-specific miR-124, and shows no signs of apoptosis in the cortex, our region of interest. [score:1]
Overall, this study confirms and extends previous observations suggesting that miR-124 plays an important role in neuronal identity and maintenance in vivo. [score:1]
Taken together, our results strengthen the role for known miRNAs, such as miR-124, in neuronal identity and maintenance, but also suggest that most of the neuronal miRNome is important for neuronal homeostasis in mice and perhaps other mammals, including humans. [score:1]
Apart from miR-124, several miRNAs play significant roles in the neuron [21]. [score:1]
Whether miR-124 (and possibly REST) functions in neuronal maintenance in vivo remains unexplored. [score:1]
However, our in silico and bioinformatics analyses strongly suggest that additional miRNAs, up to 50% of the neuronal miRNome, function in concert with miR-124 to fine-tune neuronal functions and homeostasis. [score:1]
Combined with previous literature, our studies suggest that miR-124 likely functions as a “molecular hub” in neuronal specification, function and maintenance. [score:1]
[1 to 20 of 20 sentences]
35
[+] score: 51
Using specific antagomiRs we demonstrated that inhibition of miR-124 and let-7 expression decreased some of the inhibitory effect of phenformin on GSC self-renewal, whereas inhibition of miR-137 expression did not have a significant effect (Figure 2B). [score:11]
Since this miRNA has been reported to inhibit the self-renewal of GSCs [54] and the activation of STAT3 signaling [55], the differential effect of metformin and phenformin on miR-124 expression may be associated with the increased inhibitory effect of phenformin on GSCs self-renewal and mesenchymal transition. [score:7]
Inhibition of miR-124 and let-7 expression using specific antagomiRs abrogated the inhibitory effect of phenformin on GSC self-renewal in 10 days. [score:7]
In contrast to phenformin, metformin did not upregulate the expression of miR-124 in GSCs. [score:6]
We found that phenformin induced the upregulation of miR-124, miR-137 and let-7 in the GSCs and that let-7 and miR-124 played a role in the inhibitory effect of phenformin on the self-renewal of these cells. [score:6]
Using qPCR analysis, we found that the expression of miR-124, 137 and let-7 was significantly increased following phenformin treatment (Figure 2A), whereas metformin induced a significant increase only of let-7 and miR-137 expression (Supplementary Figure S2). [score:5]
In addition to the let-7 pathway, we also found that silencing of miR-124 abrogated some of phenformin effects on the expression of differentiation, stemness and mesenchymal markers (Figure 3H, 3I). [score:3]
Figure 2(A) The expression of miR-124, miR-137 and let-7 was analyzed in phenformin -treated GSCs by qPCR following 3 days of phenformin treatment. [score:3]
The effects of let-7 on additional pathways that regulate GSC function and survival and the role of miR-124 in phenformin effects are currently being studied. [score:2]
These results are summarized in a diagram that depicts the effects of phenformin on the stemness of GSCs via the H19/let-7/HMGA2 [45] and the miR-124 pathway (Figure 3J). [score:1]
[1 to 20 of 10 sentences]
36
[+] score: 49
Mmu-miR-695, mmu-miR-31, mmu-miR-190, mmu-miR-183, mmu-miR-182, and mmu-miR-194 were the most significantly downregulated miRNAs, whereas mmu-miR-34c and mmu-miR-124 were the most significantly upregulated miRNAs. [score:7]
The most significantly downregulated (mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, mmu-miR-190, mmu-miR-194) and upregulated miRNAs (mmu-miR-34c, mmu-miR-124, mmu-miR-142–3p, mmu-miR-706, mmu-miR-29c) were analyzed. [score:7]
Meanwhile, the expression of mmu-miR-34c and mmu-miR-124 markedly upregulated in the corneal endothelium of old mice compared to young mice. [score:5]
The results of the miRNA– messenger RNA regulatory networks indicated that the common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1); that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box -binding protein–associated factor (TAF4A); that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4); that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF); that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10); and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:5]
Lang reported that miR-124 suppresses cell proliferation in hepatocellular carcinoma by targeting PIK3CA [41]. [score:5]
The qRT-PCR results demonstrated a decrease in the expression of mmu-miR-31(34.2±13.4-fold), mmu-miR-695 (19.8±4.79-fold), mmu-miR-183 (26.6±2.53-fold), mmu-miR-182 (55.2±15.3-fold), mmu-miR-194 (42.6±10.2-fold) and mmu-miR-190 (37.1±2.78-fold) in the corneal endothelium of old mice compared to young mice, whereas the expression of mmu-miR-34c and mmu-miR-124 increased 26.4±5.28-fold and 62.7±2.54-fold, respectively (Figure 2). [score:4]
In this study, miR-124 was found to be upregulated in the corneal endothelium of old mice. [score:4]
The common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1), that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box binding protein (TBP) -associated factor (TAF4A), that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4), that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF), that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10), and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:4]
Moreover, miR-124 regulates early neurogenesis in the optic vesicle and forebrain by targeting NeuroD1 [42]. [score:4]
In addition, miR-124 was found to be involved in the regulation of cell differentiation, cell cycle arrest and apoptosis in neuroblastoma, hepatocellular carcinoma, and medulloblastoma [39]. [score:2]
These miRNAs include miR-29c, miR-34c, miR-124, miR-695, and miR-32. [score:1]
To validate the reproducibility of the results from the miRNA microarray, qRT-PCR analysis of (microRNAs come from mice) mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, mmu-miR-34c, mmu-miR-31, mmu-miR-190, and mmu-miR-124 was performed using the same extracted total RNA as the microarray analysis. [score:1]
[1 to 20 of 12 sentences]
37
[+] score: 44
In addition, an FGF 5′ UTR region and a 3′UTR containing the target sequence for miR124 are added to regulate expression of ICP4 for tumour-specific translation (Figure 1). [score:8]
Significantly downregulated ICP4 expression was observed in the presence of miR124 precursor (Figure 4A). [score:6]
Our results showed that combined with 5′UTR and 3′UTR miR124 translational regulators, survivin promoter -driven ICP4 expression was higher in tumour cells. [score:6]
To select an effective micro RNA target for our glioma-specific oncolytic virus, we studied miR124, miR143 and miR145 expression profiles in a panel of different human tissues and found that the miRNA 124 level is significantly higher in human brain tissue (Figure 3A). [score:5]
C. miR124 expression levels in the indicated gliomas and normal cells were detected by qRT-PCR. [score:3]
To that end, we further tested an HSV-1 vector, SU4-124 HSV-1, of which the ICP4 gene is controlled by the survivin promoter and FGF 5′UTR in addition to the miR124 target in the 3′ regions. [score:3]
Moreover, replication of CMV-124T HSV-1 in which the ICP4 gene is controlled by a 3′UTR region with an miR124 target, drastically decreased in miR124 precursor -transfected cells (Figure 4B). [score:3]
Moreover, its expression profile in different mouse tissues also confirmed the augmentation of miR124 in the brain (Figure 3B). [score:3]
Replication & cytotoxicity of miRNA124 targeted amplicon virus. [score:3]
Data are presented as means ± S. D. To evaluate the specificity of the miR124-regulated ICP4 expression, 293FT cells were co -transfected with different concentrations (20 ng, 50 ng and 200 ng) of miR124 precursor and CMV-124T plasmid. [score:2]
miR124 prevented the replication of miRNA regulated virus. [score:2]
[1 to 20 of 11 sentences]
38
[+] score: 44
Therefore, to explore if targeting of an ORF region of DEN4 by mosquito-specific miRNAs can result in specific viral attenuation in mosquitoes, targets for mosquito-expressed mir-184 and mir-275 as well as three targets for human neuron-specific mir-124 miRNA were introduced in the DEN4 genome between sequences encoding the two C-terminal stem-anchor domains of DEN4 E protein (D4-E virus; Fig 1). [score:9]
Both D4-E and D4-E-NCR1 viruses contained miRNA targets for mosquito-specific mir-184 and mir-275 and three copies of target sequences for vertebrate brain-specific mir-124 in the duplicated E/NS1 region (Fig 1). [score:5]
1004852.g001 Fig 1 Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
Another significant observation of this study was the fact that targeting of the DEN4 genome with mosquito specific miRNA does not interfere with the capacity of CNS-enriched mir-124 miRNA to restrict replication of mir-124 targeted DEN4 viruses in the brain of newborn mice (Fig 7). [score:5]
Target sequences for mosquito specific mir-1 (5’-CTCCATACTTCTTTACATTCCA-3’), mir-184 (5’-GCCCTTATCAGTTCTCCGTCCA-3’) and mir-275 (5’-GCGCTACTTCAGGTACCTGA-3’) or human brain-specific mir-124 (5’-GGCATTCACCGCGTGCCTTA-3’) were introduced into the 3’NCR of DEN4 genome between nts 10,277 and 10,278 (position 1, Fig 1) or 10,474 and 10,475 (position 2, Fig 1); these sites of target insertion are located 15 or 212 nts downstream of the TAA stop codon in the 3’NCR, respectively. [score:5]
As a control virus for comparative assessment in the CNS of mice, we generated a D4-E** virus based on D4-E that contained synonymous mutations in the third base position of each codon of the CNS-specific mir-124 target sequences. [score:4]
Specifically, the introduced sequence was inserted between nts 2451 and 2452 of DEN4 genome and contained five tandem targets for mir-124, mir-184 and mir-275 that were followed by a duplicated DEN4 E/NS1 region (nts from 2130 to 2451 of DEN4 genome) encoding 98 amino acids from the C-terminal end of the DEN4 E protein and 7 amino acids from the N-terminal end of the NS1 protein (Fig 1). [score:3]
Interestingly, D4-E** virus with scrambled mir-124 target sequences in the ORF had a lower titer in the brain at each time point as compared with D4 virus (Fig 7A, p<0.001; 2-way ANOVA) and only 25% of mice infected with D4-E** virus died during a 21-days observation period (Fig 7B, p = 0.0014; log-rank test). [score:2]
The effect of mir-124 targeting in limiting neurotropism of flaviviruses has been extensively characterized in our laboratory previously [34– 36]. [score:1]
[1 to 20 of 10 sentences]
39
[+] score: 41
From three known primary mir-124 transcripts pri -mir124-1 was most strongly upregulated 16 days after induction of neural differentiation and was significantly downregulated by VPA. [score:7]
In four independent differentiation procedures we could confirm the microarray data (Fig. 5A)–that is, a strong concentration -dependent induction of muscle-specific/abundant miRNA (mir-206, mir-10a, mir-214, mir-145, mir-143, mir-199a) and a significant downregulation of the expression of neuro-specific miRNAs (mir-124, mir-128, mir-137, mir-491, mir-383) in comparison to the solvent control. [score:6]
Mir-9 and mir-124, the two most abundant miRNAs in the CNS, showed different responses to VPA treatment: while mir-124 was downregulated, no effect on mir-9 expression could be observed after VPA exposure. [score:6]
Myogenesis regulating mir-206 is highly expressed in skeletal muscles in both species [62], [63] as is mir-124, mir-9, mir-128 and mir-137 in mouse and human brain where they are responsible for fine-tuning of neurogenesis [62] [64]. [score:4]
Mir-128 and mir-137 were downregulated, while mir-124 was not. [score:4]
For the same reason we did not observe any differences in the expression of neuron-specific miRNA in primary cultures (mir-124, mir-128, Fig. S3), which are known to play a significant role in earlier, but not later stages, of neurogenesis. [score:3]
mir-9 was strongly induced from day 9 of differentiation onwards, while mir-124 and mir-128 were induced later on reaching their maximum expression levels both on day 16 ([47] and Fig. S1F). [score:3]
These results suggest that VPA affects neural differentiation processes and pathways, which are specific for mir-124 but not mir-9. Exposure of differentiating mESCs to VPA also reduced expression of mir-128, which is an enhancer of neural differentiation [88]. [score:3]
F. Expression of neuronal specific markers mir-9, mir-124 and β-III-tubulin and neuro-progenitor specific marker nestin at different time points of neural differentiation. [score:3]
Most regulated miRNAs shown in our study are highly conserved between mice and humans (e. g. mir-206, mir-214, mir-10a, mir-124, mir-137, mir-128, mir-9) [61], [62]. [score:2]
[1 to 20 of 10 sentences]
40
[+] score: 39
Effects of Dicer1-mutation on telencephalic miRNA levelsTo confirm the anticipated effects of Dicer1 deletion on mature miRNA production, we examined the expression of the two most abundant miRNAs in the E11.5 brain [28], [29]: miR-124, whose expression is restricted to the post-mitotic neuronal population [22], [30] and miR-9, which is expressed in both the progenitor and postmitotic cells [31]. [score:8]
To confirm the anticipated effects of Dicer1 deletion on mature miRNA production, we examined the expression of the two most abundant miRNAs in the E11.5 brain [28], [29]: miR-124, whose expression is restricted to the post-mitotic neuronal population [22], [30] and miR-9, which is expressed in both the progenitor and postmitotic cells [31]. [score:7]
Nonetheless, direct targeting of Sox9 mRNA by miRNAs other than miR-124, such as miR-9, remains a formal possibility as miRNAs have been shown to have the capacity to promote protein expression through non-canonical pathways, although very few examples have so far been reported [60], [61]. [score:6]
Whereas in the forebrain of control Dicer1 [+/-] embryos we detect mature miR-124 in the post-mitotic cell layer (Figure 1 A, B, C), in Dicer1 [-/-]embryos miR-124 expression is absent from the telencephalon and retained only in postmitotic cells in the hypothalamus, which expresses low levels of Foxg1 (Figure 1 A', B'). [score:5]
In the case of Sox9 whose mRNA is targeted by miR-124 during postnatal neurogenesis [59] we found that the Sox9 protein is lost throughout the dorsal telencephalic progenitors while miR-124 is lost from the postmitotic layer by E11.5 [30]. [score:3]
At E11.5, mature miR-124 was expressed in the postmitotic layers (A, B). [score:3]
Mature miR-124 was not detected in Dicer1 [-/-] telencephalon but its expression was maintained in hypothalamus (A', B'). [score:3]
The following RNA probes were used for in situ hybridisations: Dlx2 (generous gift from John Rubenstein), Emx2 (generous gift from Antonio Simeone), Erbb2 (generous gift from Carmen Birchmeier), Foxg1 [37], generous gift from Thomas Theil), mmu-miR-124-1 (Exiqon, DK), mmu-miR-9 (Exiqon, DK), Ngn2 (generous gift from Thomas Theil). [score:1]
0023013.g001 Figure 1Loss of mature miR-124 and miR-9 in the telencephalon of Dicer1 [-/-] embryos. [score:1]
Two abundant brain miRNAs, miR-124 and miR-9 were detected using LNA in situ hybridisation. [score:1]
Loss of mature miR-124 and miR-9 in the telencephalon of Dicer1 [-/-] embryos. [score:1]
[1 to 20 of 11 sentences]
41
[+] score: 35
Lim et al. identified 96 genes that were significantly down-regulated (p-value < 0.001) at both 12 and 24 hours with miR-1 over -expression and 174 genes with miR-124 over -expression. [score:8]
Ensembl accession numbers of genes down-regulated in human HeLa cells with miR-124 over -expression. [score:6]
Both miR-1 and miR-124 are known for their tissue specificity in mammals, where the former is preferentially expressed in heart and skeletal muscle, while the latter is preferentially expressed in brain. [score:5]
Click here for file Accession numbers of miR-124 over -expression. [score:3]
Accession numbers of miR-124 over -expression. [score:3]
The motif cluster with the most significant p-value predicted by CompMoby was the target site of miR-1 (Figures 5A, 5B) and miR-124 (Figures 5A, 5C). [score:3]
The input sequence files for the miR-124 over -expression analysis used in the CompMoby analysis can be found at. [score:3]
Lim et al. generated the datasets by independently over -expressing miR-1 or miR-124 in human HeLa cells and then profiling the mRNA on whole genome microarrays. [score:3]
Also shown is the match between the predicted motif cluster to the miR-124 seed region. [score:1]
[1 to 20 of 9 sentences]
42
[+] score: 35
In support of this hypothesis, the lineage-specific segregation of miR-124 and miR-23a activity was clearly highlighted in vivo, where >90% of striatal neurons and >95% of parenchymal astrocytes downregulated GFP following direct injection of LV. [score:5]
miRT23a-transduced NSCs (Figure 3D, E ) confirmed the upregulation of miR-124 and miR-23a during neuronal and glial differentiation, respectively. [score:4]
miRT124-transduced NSC cultures confirmed previous data obtained using a transgenic miR-124 reporter mouse [15], demonstrating at the single cell level that SVZ-derived primary precursors lack detectable miR-124 activity, which is then upregulated in concomitance with neuronal commitment and in mature neurons. [score:4]
CTRL expressed comparable levels of GFP after normalization to mCherry protein (fold repression = 1), thus indicating absence of miR-124 activity in this cell population. [score:3]
Based on the available data and on our expression profile we selected miR-93 and miR-125b for further analysis, in order to assess their activity in stem/early progenitor cells and the cell-specific modulation during lineage commitment and differentiation, considering the neuronal-specific miR-124 [11], [43] and the astroglial-specific miR-23a [33] as reference. [score:3]
Among the most wi dely studied, miR-124 is a neuronal fate determinant in cell cultures [12], [13] and in the subventricular zone (SVZ) neurogenic niche [14], [15], while miR-125b promotes neuronal differentiation and regulation of synaptic function [16], [17], [18]. [score:2]
Quantitative PCR analysis confirmed that miR-125b and miR-93 are abundantly expressed in stem/precursor cells when compared to miR-23a and miR-124 (Figure 1B ). [score:2]
Surprisingly, this trend was not observed for miR-124 (Figure 1D ). [score:1]
Modulation of miR-124 and miR-23a Activity in NSC-derived Neurons and Astroglia. [score:1]
Activity of miR-124 and miR-23a in NSC-derived neurons and astrocytes. [score:1]
miRT-transduced NSC-derived populations were analyzed by FACS and by IF, using the same experimental protocol described for miR-23a and miR-124. [score:1]
miR-124 sense 2: tggcattcaccgcgtgccttaaatgcattggcattcaccgcgtgccttaac. [score:1]
Activity of miR-124, miR-23a, miR-125b and miR-93a in striatal cell types. [score:1]
miR-124 antisense 1: ttaaggcacgcggtgaatgccattcgaattaaggcacgcggtgaatgccattat. [score:1]
miR-124 sense 1: ctagataatggcattcaccgcgtgccttaattcgaatggcattcaccgcgtgccttaaacgcgt. [score:1]
miR-124 and miR-23a activity in NSCs monitored using LV. [score:1]
miRT-transduced NSC-derived cultures and brain tissue, in particular for miR-124 and miR-23a, whose activity is enriched in mature neurons and astrocytes, the most represented cell types in the adult striatal parenchyma. [score:1]
miR-124 antisense 2: ccgggttaaggcacgcggtgaatgccaatgcatttaaggcacgcggtgaatgccaacgcgt. [score:1]
By using (bd)LV sensor vectors we validated and extended previous results on the neuronal-specific miR-124 and provided new data on the activity of the astroglial-specific miR-23a. [score:1]
[1 to 20 of 19 sentences]
43
[+] score: 34
Previously, we showed that miRNA targeting of the LGTV genome with a combination of CNS-specific mir-124 and mir-9 targets is more effective for attenuation of virus neurovirulence than is insertion of only mir-124 targets (5). [score:7]
Insertion of mir-124(T) followed by IRES, C-trn* (which translates into the same protein as C-trn but contains synonymous mutations in every codon), ΔGFP, and 2A protease sequences into the 3′ NCR of Cap/nLuc has no effect on cap -dependent nLuc expression from the Cap/nLuc-IRES/ΔGFP replicon, compared to Cap/nLuc at 2 and 4 h post -RNA transfection. [score:5]
The target sequence for mir-124 is shown in red. [score:3]
We modified the E5 strain of LGTV by inserting three target (T) copies of brain-specific mir-124 miRNA into duplicated C gene regions (DCGR) using a strategy previously described (12). [score:3]
Yellow and red boxes denote the 2A protease gene of FMDV and mir-124 target (T) sequences, respectively. [score:3]
For that, the cDNA clone of IRES-124(4m) virus was modified by replacing miRNA(T)s located in the ORF with the sequence of the nLuc gene and by deletion of mir-124(T), IRES, and C-opt sequences in the 3′ NCR. [score:1]
To generate cap-C, C48-124(2)/9/1-E5 was modified by replacing a sequence for mir-9(T) with mir-124(T) and deleting mir-1(T) in the duplicated C gene region (DCGR). [score:1]
Red and blue boxes denote mir-124(T) and mir-9(T) sequences, respectively. [score:1]
mir-124(T) located between NS5 and the IRES was mutated using the identical “scrambled” sequences as both mir-124(T)s located in the ORF. [score:1]
IRES-124 was produced by inserting mir-124(T) after the 6th nt located downstream of the UAA stop codon of the NS5 gene of IRES-C. To generate IRES-124(3m), IRES-124 was subsequently modified by introducing substitutions, U→A at nt position 332 of the NS4A gene (resulting in an F [111]→Y change) and G→A at nt position 263 of the C-opt gene (resulting in a G [88]→D change), and by deletion of a single A residue (ΔA) at nt position 490 of the IRES sequence, generating IRES-124(3m). [score:1]
In addition, the mir-124(T)-IRES-C-trn*-nLuc-2A sequence from Cap/nLuc-IRES/nLuc was inserted into Cap/ΔGFP plasmid after the 6th nt of the 3′ NCR of LGTV. [score:1]
Striped boxes indicate scrambled (synonymous) sequence for mir-124(T) and mir-9(T). [score:1]
To increase the safety and stability of bicistronic LGTV in the CNS, IRES-C was modified by inserting an additional mir-124(T) sequence in the region between the NS5 gene and the 5′ end of the IRES to generate IRES-124. [score:1]
cap-124/9 was constructed by introducing mir-124(T) sequence into the 3′ NCR of C48-124(2)/9/1-E5 (5) at nt position 14 followed by deletion of mir-1(T) sequence in the DCGR. [score:1]
The remaining mir-124(T) and IRES-C-opt sequences in the Cap/nLuc-X plasmid were deleted to restore the authentic 3′ NCR of the LGTV. [score:1]
IRES-124(4m) was modified by replacing the 5′-terminal copy of the mir-124(T) sequence with that of mir-9(T), generating IRES-124/9(4m). [score:1]
02326-16.2 FIG S2 Insertion of an additional copy of mir-124(T) sequence between the NS5 gene and the 5′ end of IRES in IRES-C reduces mortality of newborn SW mice after i. c. infection with bicistronic LGTV. [score:1]
Therefore, we developed an additional virus in which one of the mir-124(T)s was replaced with mir-9(T) [see IRES-124/9(4m) in Fig.  2A]. [score:1]
[1 to 20 of 18 sentences]
44
[+] score: 31
miR-124 precursor expression was not different between SCZ and control individuals and the differentially expressed miR-137 target genes may only slightly be co-regulated by miR-124 and miR-128. [score:8]
miR-137 acts cooperatively and synergistically with miR-124 and miR-128 [7, 33, 34]; therefore, changes in the expression of these two microRNAs may interfere with the expression of miR-137 target genes. [score:7]
We analyzed miR-124 and miR-128, which act cooperatively with miR-137, and obtained no evidence that these two microRNAs influence the differential expression of miR-137 targets. [score:5]
MIR124-2HG (ENSG00000254377) expression was not different between SCZ and control individuals (P = 0.8487, expression level 5.948). [score:5]
Analysis of the 3′UTR of the differentially expressed miR-137 genes in the DLPFC between SCZ and control individuals for additional putative miR-124 and miR-128 binding sites. [score:3]
Several targets listed in Table  1 had putative binding sites for miR-124 (5 out of 16) and miR-128 (1 out of 16) (Additional file  1: Table S7). [score:3]
[1 to 20 of 6 sentences]
45
[+] score: 29
Recently, immune regulation by miR-124 was indicated to downregulate microglia activation (Ponomarev et al., 2011) in contrast with miR-155 that was shown to have a pro-inflammatory role in microglia (Cardoso et al., 2012), to be related with the M1 phenotype (Ponomarev et al., 2013) and to be up-regulated upon activation (Lu et al., 2011). [score:8]
The cells evidenced decreased expression of miR-155 and miR-124, reduced autophagic capacity, and increased miR-146a expression and SA-β-gal activity, consistent with the existence of senescent cells at 16 DIV in culture. [score:5]
Expression of miR-124 and miR-155, which has been related with microglia activation phenotype, was performed by qRT-PCR. [score:3]
We used several markers to assess microglia reactive ability, such as the concentration of glutamate and the activation of matrix metalloproteinase (MMP)-2 and MMP-9 in the extracellular media, together with the expression of TLR-2, TLR-4, miR-124 and miR-155. [score:3]
In addition the reduced miR-124 obtained in these cells, indicated as being associated to the M2a-alternatively activated state (Freilich et al., 2013) and to inhibit inflammation (Prinz and Priller, 2014), strengthen their dormant/senescent phenotype. [score:3]
Moreover, decreased miR-124 and miR-155 that revealed a negative correlation with age (Fichtlscherer et al., 2010; Noren Hooten et al., 2010; Smith-Vikos and Slack, 2012), parallelled by the enhanced miR-146a expression, further reinforce that 16 DIV microglia mainly represent aged-like microglia. [score:3]
MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU. [score:2]
Corroborating previous findings, the decreased expression of both miR-124 and miR-155 in 16 DIV microglia as compared to 2 DIV cells (~0.5- and 0.4-fold, respectively, p < 0.01, Figure 5D) further reinforce that the cells become irresponsive/senescent when maintained in culture. [score:2]
[1 to 20 of 8 sentences]
46
[+] score: 26
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
In addition, Kyoto Encyclopedia of Genes and Genomes (KEGG) database analysis recovered known associations of miR-124, miR-9 and miR-26 with glioma, including known and many novel targets (Supplementary Fig. 4). [score:3]
Detailed analysis of imperfect seed sites confirmed established patterns, such as the miR-124 target G bulge between miRNA positions 5 and 6 (Fig. 3e) 13. [score:3]
Critically, when such peaks overlapped miR-124 chimeras, repression was significantly greater. [score:1]
More detailed analysis was possible for miR-124 due to the large number of identified sites. [score:1]
miRNA seed sequences for miR-124 and miR-9 are shown below mismatch and miRNA bulge plots. [score:1]
For example, miR-124 was strongly enriched in groups 1 (P=1.6 × 10 [−245], Fisher's exact test) and 5 (P<1.6 × 10 [−245]), and marginally in group 2 (P=2.1 × 10 [−3]). [score:1]
miR-124 sites overlapping AGO -binding peaks, regardless of cluster size (N), were also plotted. [score:1]
Log [2]FC ratios (miR-124/control) were plotted as CDFs. [score:1]
Consistent with our prior studies, AGO peaks encompassing miR-124 seed matches predicted significant transcript repression in miR-124 -transfected cells (Fig. 2d) 22. [score:1]
To examine different types of miR-124 sites, we defined mutually exclusive sets of transcripts possessing only chimera-defined canonical miR-124 sites or only non-canonical sites. [score:1]
The control set (non-miR-124, black) for all analyses were sites from transcripts lacking miR-124 chimeras. [score:1]
Motif analysis also supported auxiliary pairing, showing an enriched 7mer motif complementary to miR-124 positions 14 to 20 (Fig. 3f). [score:1]
This pattern confirmed strong seed dependence for miR-124 binding and revealed distinct patterns of favoured auxiliary binding (Fig. 4b,d). [score:1]
Normalized microarray values for CAD neuroblastoma cells transfected with miR-124 or control mimics were obtained from GEO and processed as for miR-128 profiles 38. [score:1]
In contrast, miR-124 was strongly depleted in groups 3 (P<1.6 × 10 [−245]), 4 (P=3.7 × 10 [−140]) and 6 (P=1.1 × 10 [−174]). [score:1]
In Fig. 2d, CDFs were plotted for chimera-identified miR-124 sites, peak-identified sites overlapping miR-124 seed matches and the intersection of those sets. [score:1]
Non-canonical sites predicted only a small shift in RNA levels (Fig. 2f) due largely to bulged 8mer miR-124 sites, the only non-canonical group predicting significant transcript repression in this data set. [score:1]
In Fig. 2e,f, transcripts were divided into mutually exclusive sets based on the presence of only canonical miR-124 chimera sites (e) or only non-canonical sites (f) in 3′-UTRs. [score:1]
[1 to 20 of 19 sentences]
47
[+] score: 26
The down regulation of brain mRNAs by mir-124 in transfected HeLa cells suggests that this miRNA confers tissue specific expression. [score:4]
Mir-1 is known to have high expression levels in mammalian heart and muscle cells while mir-124 contributes to the cells of the nervous system [24]. [score:3]
Mir-124 has also been shown to promote neuronal differentiation by down regulating the general splice regulator PTB1 [25]. [score:2]
This motif was also found to be especially abundant in the upstream sequences of two old and biologically important miRNAs, mir-1 and mir-124, thus suggesting a connection between the number of motif instances in the upstream sequence close to a miRNA start site and a globally conserved function of the miRNA. [score:1]
The abundance and conservation of this motif in the upstream of two old and important miRNAs, mir-1 and mir-124 suggest a connection to miRNAs with global specialized function. [score:1]
Similar results were observed when looking at the occurrences of GANNNNGA in the mir-124 -family, where the putative promoter sequence of mir-124a-1 is the only one that includes a significant number of the motif in both species, 37 and 19, respectively. [score:1]
Figure 4The frequency diagrams of the motif GANNNNGA occurrences in sequences 1000 bp upstream of mir-1 (panel a) and mir-124 (panel b) family members in C. elegans, C. briggsae, human and mouse. [score:1]
The mir-1-1 and mir-124-a1 1000 bp upstream sequences of human and mouse contain similar number of occurrences of the motif GANNNNGA as the corresponding sequences in C. elegans and C. briggsae. [score:1]
In both cases, we chose mir-1-1 as the representative of mir-1 -family and mir-124a-1 for the representative of mir-124 -family for human and mouse. [score:1]
We found these motifs also from the mir-1 and mir-124 1000 bp upstream sequences in C. elegans and C. briggsae, thus strengthening the connection of these miRNAs with a muscle specific function in these two worms. [score:1]
To determine whether the motif GANNNGA is conserved in the upstream sequences of mir-1, mir-124 and mir-228 orthologs in other species, we located all its occurrences from 1000 bp upstream sequences of all miRNAs that, according to miRBase [17], belong to mir-1 or mir-124 family in human and mouse genomes. [score:1]
When comparing these results, we found that the motif GANNNNGA is especially abundant in the 1000 bp upstream sequences of miRNAs mir-1, mir-124 and mir-228 in both worms. [score:1]
The multiple sequence alignment of the mir-124 family upstream sequences of C. elegans, C. briggsae, human and mouse. [score:1]
In addition, this motif was observed to be most abundant in the upstream sequences of two important miRNAs, mir-1 and mir-124. [score:1]
We also found the frequency distribution of the motif in the upstream sequences from human and mouse orthologs of mir-1 and mir-124 to approximately follow its corresponding distributions in the two worms, thus confirming the conserved nature of the motif. [score:1]
Mir-228 is not found from these two genomes, and generally it is included in the mir-124 family [18]. [score:1]
The 1000 bp upstream sequences of human and mouse miRNAs that belong to mir-1 and mir-124 families were downloaded from UCSC Genome Browser [40], and the multiple sequence alignments for the mir-1 and mir-124 families upstream sequences were made with ClustalW [37]. [score:1]
Click here for file The multiple sequence alignment of the mir-124 family upstream sequences of C. elegans, C. briggsae, human and mouse. [score:1]
We draw the frequency diagrams of the motif GANNNNGA in the 1000 bp upstream sequences of mir-1 and mir-124 orthologs in these four species (Figure 4), and made the global alignments of mir-1 and mir-124 upstream sequences (Additional files 1 and 2). [score:1]
Prior to and independent from the current study, there has been keen interest in mir-1 and mir-124, two miRNAs with the most abundant GANNNNGA motifs. [score:1]
[1 to 20 of 20 sentences]
48
[+] score: 24
We further reported that the downregulation occurs through EVI1 -induced methylation of CpG dinucleotides located upstream of miR-124-3. This de novo methylation leads to miR-124 repression and to the upregulation of genes required for self-renewal and cell division such as Bmi1 and Cyclin D3 that are regulated by miR-124 [22]. [score:8]
We previously reported that the expression of EVI1 in murine HSC induces the upregulation of cell division and an enhancement of self-renewal as a result of miR-124 silencing through DNA methylation of miR-124 regulatory regions. [score:7]
Recently, we showed that EVI1 downregulates microRNA-124 (miR-124), a group of small genes that control differentiation and cell cycling of normal hematopoietic cells [22]. [score:4]
Dnmt3b and EVI1 form an enzymatically active complex that methylates DNA in vitro We previously reported that EVI1 induces DNA methylation in vivo leading to miR-124 repression [22] and here we have shown that EVI1 and Dnmt3b form a complex that interacts with a regulatory region of miR-124-3 required for repression of a stably integrated reporter gene. [score:2]
We previously reported that EVI1 induces DNA methylation in vivo leading to miR-124 repression [22] and here we have shown that EVI1 and Dnmt3b form a complex that interacts with a regulatory region of miR-124-3 required for repression of a stably integrated reporter gene. [score:2]
MiR-124 regulates these pathways [23]. [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 24
REST directly down-regulates a large number of genes at the transcriptional level, but also probably indirectly activates the expression of other genes at the post-transcriptional level via the repression of many noncoding targets (Conaco et al., 2006; Mortazavi et al., 2006; Wu and Xie, 2006; Visvanathan et al., 2007; Singh et al., 2008; Johnson et al., 2009), including several micro RNAs (miRNAs) considered to be brain-specific (such as miR9, miR124, miR132, miR135, miR139, and miR153; Figure 1). [score:9]
This system of large autoregulatory loops is controlled by another feedforward loop that involves the polypyrimidine-tract -binding (PTBP1) protein, which secures this system by competing at miR-124 targets (Xue et al., 2013; Figure 1). [score:4]
Furthermore, miR-124 and other neuronal-specific miRNAs target various components of the REST complex, including CTDSP1 and CoREST (Xue et al., 2013). [score:3]
REST represses miR-124, an miRNA that targets various REST components including CTDSP1 and CoREST (Xue et al., 2013). [score:3]
miR-124, another component of this double feedback loop, has reciprocal activity by inhibiting non neuronal transcripts (Conaco et al., 2006). [score:3]
The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development. [score:2]
[1 to 20 of 6 sentences]
50
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
In a study on the differential expression of miRNAs between cochlear and vestibular sensory epithelia, miR-124 was one of the most highly differentially expressed miRNAs, with eightfold higher expression in the cochlea. [score:7]
While more information regarding the targets of miR-124 to elucidate its role in the inner ear is required, this miRNA should clearly have significant influence on gene regulation. [score:4]
miR-124 is expressed in the inner ear in neuronal cells in the spiral and vestibular ganglia (Weston et al., 2006). [score:3]
This suggests a specific role and targets for miR-124 in the cochlear neurons of the inner ear (Elkan-Miller et al., 2011). [score:3]
miRNA-124 was found to be specifically reduced prior to loss of the neurosensory portions, suggesting this miRNA is required for normal neuronal development. [score:2]
miR-124 was one of four miRNAs that were significantly down regulated in both mouse strains at the age of 9 months, compared to postnatal day (P)21 (Zhang et al., 2013). [score:1]
Another well-characterized and highly expressing miRNA in the brain, miR-124 (Lagos-Quintana et al., 2002), appears to have an essential role in the inner ear. [score:1]
[1 to 20 of 7 sentences]
51
[+] score: 21
miR-124 is expressed abundantly in the mouse brain [49], specifically in the neurons and its expression is found to increase during development [50]– [52]. [score:6]
In the present study, increased neurogenesis observed correlated with increased expression of neuron specific miRNA, miR-124. [score:3]
Since hyperglycemia increased neurogenesis in NSCs, we analyzed the expression of miR-124, which has been wi dely shown to promote neurogenesis [31]. [score:3]
The increased expression of miR-124 correlated with increased neurogenesis in NSCs from diabetic pregnancy (Figs. 3D and 2M). [score:3]
The expression of mmu-miR-124 was increased significantly in NSCs from diabetic pregnancy (8.83±2.77 vs 1.00±0.40-folds, p<0.05) when compared to the control (Fig. 3D). [score:2]
Mean ± SD (n = 4), *p<0.05, **p<0.01 (D) Expression of neuron specific miRNA, miR-124 was significantly increased in NSCs from diabetic pregnancy (open bars) when compared to the control (filled bars). [score:2]
Several studies have demonstrated the role of miR-124 in promoting neurogenesis and neuronal differentiation [52]– [55]. [score:1]
Total RNA was converted to cDNA using the Universal cDNA synthesis kit (Exiqon, Vedbaek, Denmark) and the cDNA was used for quantification of miRNA-124. [score:1]
[1 to 20 of 8 sentences]
52
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
For example, in mouse [14], miR-10b is highly expressed in spinal cord; miR-124 is wi dely expressed in brain tissues; miR-200b, miR-128a, miR-128b, miR-429 are specifically expressed in olfactory bulb; miR-200a is highly expressed in olfactory bulb; miR-7b is highly expressed in hypothalamus. [score:11]
Moreover, miR-200b is enriched in zebrafish olfactory bulb; miR-124 and miR-9 expression are detected throughout adult brain [16]. [score:3]
In them, four miRNAs (miR-9, miR-124, miR-128a and miR-128b) were previously reported to be specifically expressed in the cortex and hippocampus in rat [18]. [score:3]
[1 to 20 of 3 sentences]
53
[+] score: 17
Similarly, microinjection in eggs of microRNA miR-1 resulted in overexpression of its target Cdk9 and that of miR-124 in increased expression of Sox9 during the preimplantation period. [score:7]
To extend our analysis to a second example of a mouse paramutation, we tested whether the lack of Dnmt2 would affect the epigenetic modulation of Sox9 which can be induced by microinjection of the cognate microRNA miR-124 and of Sox9 transcript fragments in Dnmt2 [+/+] embryos [4]. [score:2]
Dnmt2 requirement in the Sox9/miR-124 paramutation. [score:2]
Numeric values and results of Kit [tmlAlf1/+] intercrosses are shown in Table 1. B. The Sox9 paramutation induced by microinjection of miR-124 RNA. [score:2]
To minimize variations between foster mothers, controls (microinjected with unrelated RNAs) and miR-124 -treated embryos were in each series separately implanted in the two uterine horns of the same mothers. [score:1]
Microinjection of single-stranded miR-124 RNA was performed as previously described [4]. [score:1]
Following microinjection of miR-124 into Dnmt2 [−/−] fertilized eggs, E7.5 embryos were identical to controls (Figure 1B) and not oversized as the Dnmt2 [+/+] Sox9 paramutants. [score:1]
The miR-1/Cdk9 paramutants developed cardiac hypertrophy [4] and the miR-124/Sox9 variants a giant phenotype and twin pregnancies [10]. [score:1]
[1 to 20 of 8 sentences]
54
[+] score: 16
Protein expression of CGI-58 was, on average, reduced by 24% and 65% when OP9 adipocytes were treated with 50 and 100 nM miR-124a, respectively (Figure 1D), which was blocked by miR-124 inhibitor, once more, arguing for the specificity of the process (Figure 1C, Figure S2C,D). [score:5]
This indicates that miR-124 might play a role in the regulating of ATGL during fasting and re-feeding in murine liver and WAT and thus might be involved in the regulation of changes in lipolysis as well as body metabolism during feeding cycles. [score:3]
To test for biological relevance of these findings, we analyzed alterations in response to miR-124 on the levels of Atgl and Cgi-58 (mRNA) and protein expressions as well as their lipolytic activities. [score:3]
Ponomarev E. D. Veremeyko T. Barteneva N. Krichevsky A. M. Weiner H. L. MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-α-PU. [score:2]
miR-124a expression was analyzed by primers specific to miR-124 (LNA PCR primer set, Exiqon; Vedbaek, Denmark). [score:1]
Makeyev E. V. Zhang J. Carrasco M. A. Maniatis T. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing Mol. [score:1]
Lentiviral particles carrying either pre-miR-124 or control pre-miRNA were obtained from GeneCopoeia (Rockville, MD, USA). [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 16
We performed microarray analysis of miRNA expression of glioma cells silenced for TALNEC2 and found that silencing of TALNEC2 increased the expression of several tumor suppressor miRNAs such as miR-137, miR-124, miR-205, miR-7 and miR-492, whereas it decreased the expression of some oncomiRs such as miR-21, miR-155, miR-33b and miR-191. [score:9]
We found that silencing of TALNEC2 in U87 cells resulted in an increased expression of miRNAs associated with tumor suppression [38, 39] (e. g., let-7b, miR-7, miR-124, miR-137, miR-129-3p, miR-142-3p, miR-205, miR-376c, miR-492, miR-562 and miR-3144) and in a decrease in the expression of miRNAs associated with tumor promotion [38– 40] (e. g., miR-9, miR-21 miR-33b, miR-155, miR-191, miR-525-3p, and miR-767-3p). [score:7]
[1 to 20 of 2 sentences]
56
[+] score: 16
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-183, mmu-mir-96, mmu-mir-124-2, mmu-mir-124b
We then examined miR-124 expression, which is normally associated with neuronal differentiation [52], to determine whether it is misexpressed in hair cells in KI mice. [score:5]
However, miR-124 expression was not found in hair cells of heterozygous or homozygous KI mice. [score:3]
Neurog1 does not drive expression of miR-124 in hair cells. [score:3]
miR-124 is a neuronal marker expressed in all spiral ganglion cells (e-h). [score:3]
Analysis of neuronal markers such as Fgf10, Prox1, miR124 in the KI mice demonstrates survival of the spiral ganglia in middle turn of the cochlea which are almost completely lost in Atoh1 null [36] and in Atoh1 C KO mice [22]. [score:1]
Locked nucleic acid (LNA) probes for microRNAs (miR-96 and miR-124) were purchased and used as described previously (miRCURY LNA probes; Exiqon, Woburn, MA; [34]). [score:1]
[1 to 20 of 6 sentences]
57
[+] score: 15
Figure 1Prediction of potential miRNAs targeting at the 3′UTR of CCL2 gene(A and B) The potential target sites of miR-124 (A) or miR-33 (B) in the 3′UTR of CCL2 gene were conserved in human, mouse and rat species. [score:5]
Indeed, miR-124 was a well-documented suppressor of CCL2 in recent studies [20, 21]. [score:3]
We found that the potential binding sites for miR-124 (Figure 1A) and miR-33 (Figure 1B) were conserved in multiple species, indicating that those two miRNAs might be functional in CCL2 suppression. [score:3]
Most recently, CCL2 is reported to be regulated by miR-124 [20, 21]. [score:2]
The high-throughput screening technology should be used to select out those functional miRNAs besides miR-124 and miR-133 in the future. [score:1]
In the present study, we predicted and selected out the potential miRNAs of CCL2 by choosing the conserved ones, miR-124 and miR-133. [score:1]
[1 to 20 of 6 sentences]
58
[+] score: 15
In the context of a putative role of miRNA in pGE, it is noteworthy that several mRNAs, upregulated upon mTEC maturation, showed tissue-specific expression patterns, i. e. being restricted to brain (miR-124 and miR-129), heart (miR-499), testis (miR-202), skin (miR-203) or embryo (miR-467 and miR-302). [score:6]
Moreover, miR-124 and miR-203 have been shown to be upregulated upon terminal differentiation in neurons and keratinocytes, respectively [33, 34]. [score:4]
miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were stably expressed at two- to tenfold higher level in the mTEC [high] subset independent of the maturation marker used for sorting the cells (Fig. 1C). [score:3]
Interestingly, miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were differentially regulated in immature and mature Aire [neg] versus mature Aire [pos] mTEC subsets. [score:2]
[1 to 20 of 4 sentences]
59
[+] score: 14
Overexpression of miR-124 and miR-203 suppressed HCC cell growth in vitro. [score:5]
It has been reported recently that miR-124, and miR-203 may regulate iqgap1 expression in HCC [56]. [score:4]
This study characterized miR-124 and miR-203 as novel tumor-suppressive miRNAs in HCC and may provide an explanation for the observed upregulation of IQGAP1 in human HCC tumors [43]. [score:4]
MiR-124 and miR-203 were identified as epigenetically silenced in HCC as a result of assessment of the methylation status of 43 loci containing CpG islands around 39 mature miRNA genes in a panel of HCC cell lines and noncancerous liver tissues as controls. [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 14
Interestingly, both miR-124 (a highly brain-specific miRNA) and miR-9 (a highly functional miRNA in brain development) are expressed late in development and are significant when their non-coherent targets are compared with the non-target control gene set. [score:8]
Interestingly, enrichment of miRNA core motifs are reported in the 5′ UTR compared with non-target motifs, and particularly the enrichment of reverse complementary miRNA core motifs in the 5′ UTR appears more frequently in the co-expressed genes of miR-124 than that in 3′ UTR [43], which raises a question as to whether the miRNAs are likely to induce expression from the 5′UTR. [score:6]
[1 to 20 of 2 sentences]
61
[+] score: 13
A circRNA from the Zfyve9 gene (mm9_circ_014815) that was age -upregulated in hippocampus harbored several different microRNA target sites: 3 target sites for miR-9, a microRNA with roles in neural development and neural pathologies 32, 1 target site for miR-124, a highly abundant brain miRNA that is implicated in central nervous system disorders 33, and 1 miR-7 target site (Supplementary Table S13). [score:13]
[1 to 20 of 1 sentences]
62
[+] score: 13
The graph indicates a significant increase of miR-744, miR-431, and miR-21 in DRG after sciatic nerve crush, whereas the expression level of miR-124 and miR 29a did not change (* p < 0.05, ** p < 0.01, N = 3). [score:3]
At the same time, RT-qPCR experiments showed that miR-29a and miR-124 did not change their expression during regeneration. [score:3]
miR-124 regulates adult neurogenesis in the subventricular zone stem cell niche. [score:2]
We also included miR-744 and miR-21 as positive controls and miR-124 and miR-29a as non-regulated controls in our real-time PCR experiments. [score:2]
miR-21: 5′-TAGCTTATCAGACTGATGTTGA-3′ miR-431: 5′-CAGGCCGTCATGCAAA-3′ miR-744: 5′-GGGCTAGGGCTAACAGCA-3′ miR-124: 5′-GCGGTGAATGCCAAAAA-3′ miR-29a: 5′-TAGCACCATCTGAAATCGGTTA-3′ Kremen1: 5′-ACAGCCAACGGTGCAGATTAC-3′ and 5′-TGT TGTACGGATGCTGGAAAG-3′ GAP-43: 5′TGGTGTCAAGCCGGAAGATAA-3′ and 5′-GCTG GTGCATCACCCTTCT-3′ S-12: 5′-TGGCCCGGCCTTCTTTATG-3′ and 5′-CCTAAGCG GTGCATCTGGTT-3′ Data from multiple independent experiments were analyzed with GraphPad Prism version 5 for Windows (GraphPad Software, San Diego, CA, USA). [score:1]
miR-21: 5′-TAGCTTATCAGACTGATGTTGA-3′ miR-431: 5′-CAGGCCGTCATGCAAA-3′ miR-744: 5′-GGGCTAGGGCTAACAGCA-3′ miR-124: 5′-GCGGTGAATGCCAAAAA-3′ miR-29a: 5′-TAGCACCATCTGAAATCGGTTA-3′ Kremen1: 5′-ACAGCCAACGGTGCAGATTAC-3′ and 5′-TGT TGTACGGATGCTGGAAAG-3′ GAP-43: 5′TGGTGTCAAGCCGGAAGATAA-3′ and 5′-GCTG GTGCATCACCCTTCT-3′ S-12: 5′-TGGCCCGGCCTTCTTTATG-3′ and 5′-CCTAAGCG GTGCATCTGGTT-3′ Data from multiple independent experiments were analyzed with GraphPad Prism version 5 for Windows (GraphPad Software, San Diego, CA, USA). [score:1]
miR-21: 5′-TAGCTTATCAGACTGATGTTGA-3′ miR-431: 5′-CAGGCCGTCATGCAAA-3′ miR-744: 5′-GGGCTAGGGCTAACAGCA-3′ miR-124: 5′-GCGGTGAATGCCAAAAA-3′ miR-29a: 5′-TAGCACCATCTGAAATCGGTTA-3′ Kremen1: 5′-ACAGCCAACGGTGCAGATTAC-3′ and 5′-TGT TGTACGGATGCTGGAAAG-3′ GAP-43: 5′TGGTGTCAAGCCGGAAGATAA-3′ and 5′-GCTG GTGCATCACCCTTCT-3′ S-12: 5′-TGGCCCGGCCTTCTTTATG-3′ and 5′-CCTAAGCG GTGCATCTGGTT-3′Data from multiple independent experiments were analyzed with GraphPad Prism version 5 for Windows (GraphPad Software, San Diego, CA, USA). [score:1]
[1 to 20 of 7 sentences]
63
[+] score: 12
PF inhibited proliferation and invasion through suppressing Notch-1 signaling pathway in breast cancer cells [15], and inhibited human gastric carcinoma cell proliferation through up-regulation of microRNA-124 and suppression of PI3K/Akt and STAT3 signaling [16]. [score:12]
[1 to 20 of 1 sentences]
64
[+] score: 12
Ectopic up-regulation of miR-124 in glioma stem-like cells promoted T cell proliferation and regulatory T cell induction. [score:5]
MiR-124 has been reported as a potential tumor suppressor in diverse tumor types, such as colorectal cancer and prostate cancer [24]. [score:2]
In patients with glioblastoma, the expression of miR-124 is significantly reduced, compared to normal brain tissues [25]. [score:2]
As a result, systemic administration of miR-124 prolonged overall survival and decreased tumor incidence in a murine glioma mo del. [score:1]
Moreover, treatment of T cells from glioblastoma patients with miR-124 induced pro-inflammatory cytokines and chemokines [25]. [score:1]
In tumor bearing mice depleted of CD4+ or CD8+ cells, the immunotherapeutic effects of miR-124 was ablated [25]. [score:1]
[1 to 20 of 6 sentences]
65
[+] score: 12
MiR-124 and miR-34a showed similar expression trends in qPCR and deep sequencing data, but we were not able to detect large changes in expression of miR-17 with age using qPCR. [score:5]
While not the predominating miRNA, miR-124 is strongly represented in our set of aging brain-expressed miRNAs. [score:3]
For example, miR-124 was found by Lagos-Quintana and colleagues as dominating the population of brain-expressed miRNAs in young mice [14]. [score:3]
Probes for snRNA U6, miR-124 and miR-155 were used as controls for the qRT-PCR. [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 11
There are significant differences between high and low metastatic breast cancer cell lines in the expression levels of miR-124, miR-195 or miR-340 (Figure 3A-3E). [score:3]
Figure 3 (A-E) Expression of miR-17, miR-25, miR-124, miR-195 and miR-340 in a panel of four breast cancer cell lines by quantitative polymerase chain reaction analysis. [score:3]
The screening predicted five breast cancer-related miRNAs (miR-17, miR-25, miR-124, miR-195, and miR-340) to target MCU. [score:3]
Previous studies demonstrated several deregulated miRNAs may promote breast cancer proliferation and migration, including miR-340, miR-195 and miR-124 [21– 23]. [score:2]
[1 to 20 of 4 sentences]
67
[+] score: 11
Other experiments have shown that uPA promotes the stemness of pancreatic cancer cells through a mechanism involving the direct interaction of uPA with the transcription factors HOXA5 and Hey: particularly, uPA regulates Lhx-2 expression by suppressing expression of miR-124 and p53 expression by repressing its promoter by inactivating HOXA5 [162]. [score:11]
[1 to 20 of 1 sentences]
68
[+] score: 11
miR-124 is expressed in the mature neurons of adult mouse brain and is upregulated in differentiating neurons [5]. [score:6]
Another well-studied miRNA involved in brain development is miR-124. [score:2]
miR-124 was shown to promote neurogenesis in the cerebral cortex [34] and regulate neurite growth during neuronal differentiation [35]. [score:2]
miR-124 is recognized as a brain-specific miRNA and is the most abundant miRNA in the mouse brain [4]. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
The predicted genomic coordinates of pri-mir-124-1 are given in Additional file 1. We also identify promoter -associated regulatory features and DNase1 hypersensitive sites in the region 9800.9–9801.8 kb upstream of human mir-124a-1, overlapping with predicted TSS/CpG, and the corresponding region is found to be conserved in mouse and rat (Figure 5). [score:2]
The lower panel shows the promoter region and UCSC conservation scores along the length of predicted pri-hsa-mir-124-1. We annotate the boundaries of four pri-miRNAs conserved in 2 of the 3 genomes. [score:1]
The human has 15 tightly clustered 5'CAGE tags within 90 bp of the predicted TSS, strongly supporting the 5' end of pri-miRNA of hsa-mir-124-1 (Figure 5). [score:1]
mir-124-1 has the highest number of TSS predictions of all miRNAs in this study, the majority falling within 3,500 bp upstream of mir-124-1 in all 3 species. [score:1]
Figure 5 Transcription features mapped in the flanking regions surrounding mir-124-1 in human, mouse and rat. [score:1]
miR-23a~27a~24-2. miR-124-1. Group II pri-miRNAs. [score:1]
The lower panel shows the promoter region and UCSC conservation scores along the length of predicted pri-hsa-mir-124-1. The miRNA is conserved in all 3 species, located on chromosomes 12, 10 and 7 in human, mouse and rat respectively. [score:1]
In mouse, the predicted TSS/CpG is further supported by 3 overlapped ESTs (accessions: BY712882.1, BE994895.1 and AV159961.1) and 1 cDNA (accession AK132065.1), which are located 3900 bp upstream of mmu-miR-124-1 (Figure 5). [score:1]
The lower panel shows the promoter region and UCSC conservation scores along the length of predicted pri-hsa-mir-124-1. We annotate the boundaries of four pri-miRNAs conserved in 2 of the 3 genomes. [score:1]
[1 to 20 of 9 sentences]
70
[+] score: 10
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-2, mmu-mir-124b
They therefore had to combine the lentivirus targeting tool with the expression of miR124 to eliminate residual transduction of the lentivector into neurons. [score:5]
It will be interesting to combine our lentiviral -targeting tool with the expression of miR124 and further minimize non-specific transduction in microglia or neurons. [score:5]
[1 to 20 of 2 sentences]
71
[+] score: 10
i Expression of miRs 21-5p, Let7b-5p, 124-3p and 134-5p in the exosomal fraction of DRG neurons media treated with buffer control or CAPS for 3 h. Data are means ± S. E. M., n = 4 cultures; * P < 0.05, ** P < 0.01 and *** P < 0.001 compared to control, Student’s t test Expression analysis of miRs in the exosome fraction of cultured DRG media indicated that capsaicin significantly increased levels of miR-21-5p, let7b, miR-124, and miR-134 compared to control conditions (Fig.   2i). [score:3]
Expression of miR-21-5p was comparable to miR-let7b, miR-124, and miR-134, which were selected as positive-control miRs (Fig.   2a). [score:3]
i Expression of miRs 21-5p, Let7b-5p, 124-3p and 134-5p in the exosomal fraction of DRG neurons media treated with buffer control or CAPS for 3 h. Data are means ± S. E. M., n = 4 cultures; * P < 0.05, ** P < 0.01 and *** P < 0.001 compared to control, Student’s t test Expression analysis of miRs in the exosome fraction of cultured DRG media indicated that capsaicin significantly increased levels of miR-21-5p, let7b, miR-124, and miR-134 compared to control conditions (Fig.   2i). [score:3]
These miRs can modulate nociception and, for instance, intrathecal delivery of miR-124, miR-103, and miR-23b attenuates inflammatory and neuropathic pain by altering intracellular neuronal, astrocytic, and microglial functions 18– 20. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 10
Furthermore, it has also been reported that miR-9 and miR-124 are abundant in the brain and are involved in brain development [17, 25, 26]. [score:2]
Xu et al. [43] showed that the Fragile X protein family member FXR1P regulates the levels of brain-specific miR-9 and miR-124. [score:2]
Prenatal exposure to VPA at E12.5 immediately increased miR-132 levels, but not miR-9 or miR-124 levels, in the male embryonic brain. [score:1]
Prenatal VPA exposure at E12.5 increased miR-132 level, but not miR-9 and miR-124 levels, in mouse embryonic brain. [score:1]
The VPA exposure caused an approximately 2.5-fold increase in miR-132 levels, but it did not affect the levels of miR-9 or miR-124 (n = 5/group, Fig.   1). [score:1]
Fig. 1Effects of prenatal VPA exposure at E12.5 on levels of miR-9, miR-124 and miR-132 in the male mouse embryonic whole brain. [score:1]
It is noteworthy that analysis displayed no significant difference in miR-9 and miR-124 levels by the VPA exposure. [score:1]
We found that prenatal VPA exposure at E12.5 increased miR-132 levels, but not miR-9 or miR-124 levels, in the male mouse embryonic brain. [score:1]
[1 to 20 of 8 sentences]
73
[+] score: 10
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-137, mmu-mir-124-2, mmu-mir-124b
Previous studies have shown that certain miRNAs that target the 3′ untranslated region (UTR) of the Gria1 and Gria2 mRNAs, which encode the GluA1 and GluA2 subunits of AMPARs, respectively, are potent epigenetic regulators of LTP (miR-137: Olde Loohuis et al., 2015; miR-124: Gascon et al., 2014; Hou et al., 2015). [score:6]
MicroRNA miR124 is required for the expression of homeostatic synaptic plasticity. [score:3]
Alterations in microRNA-124 and AMPA receptors contribute to social behavioral deficits in frontotemporal dementia. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 9
These results are further supported by our previous studies which reveal that DLX3 mutation (Q178R) inhibits osteoclast differentiation in Raw 264.7 cells by up -regulating osteoclastogenesis inhibitor microRNA-124 expression 42. [score:9]
[1 to 20 of 1 sentences]
75
[+] score: 9
The observed effect on miR-124 expression, a highly abundant neuronal miRNA, required NMDA receptor activation as the competitive NMDA receptor antagonist completely blocks the effect of ECS on the change in miR-124 expression (Figure 5C). [score:5]
Following ECS, total hippocampal RNA was subjected to qRT-PCR for miR-124 expression and normalized to U6. [score:3]
Examples of both convergent and divergent qRT-PCR results are illustrated in Figure 6. In general, higher abundance miRNAs showed more concordant results (i. e. miR-124, miR-181a, miR-26a), while low abundance (miR-410) or miRNAs with multiple close-related family members (let-7f, miR-99b) showed more divergent results. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 9
MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation. [score:2]
miR-124-regulated RhoG reduces neuronal process complexity via ELMO/Dock180/Rac1 and Cdc42 signalling. [score:2]
The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development. [score:2]
miR-124 regulates adult neurogenesis in the subventricular zone stem cell niche. [score:2]
The microRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. [score:1]
[1 to 20 of 5 sentences]
77
[+] score: 8
Among this list, forty miRNAs showed significant down-regulation whereas four miRNAs, miR-29a, miR-29b, miR-34a and miR-124, were up-regulated. [score:7]
For example, miR-124 and the miR-183 family are necessary for neurosensory cell fate determination [14], [15], [17]. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 8
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-137, mmu-mir-124-2, mmu-mir-124b
RT-QPCR was performed on the same samples to validate expression levels of microRNA of interest (microRNA-124 and microRNA-137), normalized to RNU6B expression levels. [score:5]
As previously described in Schouten et al. [14], we found the RT-QPCR data to support the microRNA profiling data for the expression levels of microRNA-124 and microRNA-137. [score:3]
[1 to 20 of 2 sentences]
79
[+] score: 8
The most depleted (P < 2.85 e - 09) and the second most depleted (P < 3.28 e - 06) words in 3'UTRs of highly expressed genes were entirely or partially complementary to the seed region of mmu-miR-124 ("AAGGCAC"). [score:3]
The most significant depleted word "GTGCCTT" is complementary to positions 2 - 8 of mmu-miR-124. [score:1]
Many of the miRNAs that were previously linked to neuronal biology (e. g. mmu-miR-124, mmu-miR-125 family, mmu-miR-137, mmu-miR-128, mmu-miR-9 and mmu-let-7) [6, 25- 32, 57, 58] belong to this category. [score:1]
8) AUGCUGC mmu-miR-124 (2.. [score:1]
Our result adds to this notion by suggesting that the global function of these miRNAs in neuronal cultures is closely related and complementary to that of mmu-miR-124. [score:1]
The second most depleted word has a central 5-mer "TGCCT" which is complementary to positions 3 - 7 of mmu-miR-124. [score:1]
[1 to 20 of 6 sentences]
80
[+] score: 8
Of the 78 miRNAs that we probed by expression profiling only dme-miR263a and -263b displayed strong evidence of circadian regulation (with possible weak cycling for dme-miR-124). [score:4]
Likewise, miR-31a (Fig. 3F) might also exhibit low amplitude cycling similar to that of miR-124. [score:1]
Although the differences in daily levels for miR-124 in wildtype flies do not reach significance even when less stringent criteria was applied (p = 0.0813, ANOVA without FDR), it is possible that miR-124 undergoes low amplitude circadian oscillations in abundance. [score:1]
Finally, the D. melanogaster dme-miR-124 is similar to vertebrate miR-124a (Fig. 4D), which also cycled in the mouse retina [50]. [score:1]
Of these, dme-miR-124 showed a pattern very similar to that of dme-miR-263a and -263b, exhibiting trough levels during the mid-day that were followed by increases during the early to late-night in wildtype flies and constantly elevated levels in the cyc [0 ]mutant (Fig. 3B). [score:1]
[1 to 20 of 5 sentences]
81
[+] score: 7
We analyzed expression of miR-27b, miR-29b, miR-155, miR-124 and miR-223 in bone marrow-derived mouse macrophages differentiated in M0 (unstimulated), M1(LPS + IFN-γ) and M2(IL-4) conditions. [score:3]
MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-α-PU. [score:2]
miRNA expression was determined by Taqman Real-Time PCR using miR-27, miR-29b, miR-155, miR-223, miR-124 and sno-202 primer and probe sets (Life Technologies), according to manufacturer’s instructions. [score:2]
[1 to 20 of 3 sentences]
82
[+] score: 7
In the livers of LPD offspring, mmu-miR-615, mmu-miR-124, mmu-miR-376b, and mmu-let-7e were significantly downregulated (fold change ≤ −2 and p value < 0.05). [score:4]
The six miRNAs, including mmu-miR-615, mmu-miR-124, mmu-miR-376b, mmu-let-7e, mmu-miR-708, and mmu-miR-879 had a total of 349 validated target genes in the miRWalk database (Table 2). [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
For example, pre-let-7a hairpins in the four species had a consensus structure with a folding energy of –21.1 Kcal/mol, but pre-miR-124 hairpins in the four species had a much higher folding energy of the consensus structure (–10.5 Kcal/mol), indicating that pre-miR-124 hairpins were less conserved across the four species. [score:1]
Besides shifted seeds, many well-conserved 5′-isomiRs with the same or nearly identical seed regions had different arm abundances among the four species, exemplified by miR-124, miR-193, miR-210, miR-2 and miR-87 (Table 3). [score:1]
Beyond mammals, 20 miRNA families were found conserved across fruitfly, mouse and human, 8 were conserved between fruitfly and worm, and 4 families (let-7, miR-1, miR-34 and miR-124) were found conserved among all the 4 species. [score:1]
Similar observations were made for miR-124, miR-137, miR-193, miR-210, miR-2, miR-79 and miR87 across species, with miRNAs following the loop-counting rule having lower arm abundances of 5′-isomiRs. [score:1]
For instance, miR-124-3p family produced 22% and 27% of reads as 5′-isomiRs in human and mouse, respectively, but only the maximum of 0.69% of reads in fruitfly. [score:1]
Paralogous miRNAs in a family can make it difficult or even impossible to determine the origin of 5′-isomiRs, particularly when paralogs share nearly identical mature or precursor sequences, e. g. miR-124-1/2/3 and miR-133a-1/2. [score:1]
Interestingly, conserved pre-miRNAs with similar 5′-isomiR arm abundances (e. g. let-7 in Table 3) have more conserved secondary structures than those with large variations of 5′-isomiR arm abundances (e. g. miR-124 in Table 3), inferred by the folding energies of consensus structures (T-test P < 0.05, Figure 3A). [score:1]
[1 to 20 of 7 sentences]
84
[+] score: 7
Previous studies have found that miR-22 and miR-124 affect cortical neuron migration by targeting components of the coREST/REST complex, indirectly regulating DCX expression (Volvert et al., 2014). [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Another distinctive expression pattern was exhibited by miR-124, an abundantly expressed miRNA in the nervous system (Lagos-Quintana et al, 2002), which was found to be expressed in spiral and vestibular ganglia (Weston et al, 2006). [score:7]
[1 to 20 of 1 sentences]
86
[+] score: 7
D. Nocturnin protein expression in PBS, miR-122 ASO, or miR-124 ASO treated mouse liver (mean ± S. E. ) at ZT0 and ZT12. [score:3]
C. Representative Western blots of Nocturnin expression in PBS, miR-122 ASO, or miR-124 ASO treated mouse liver (two mice per group) at ZT0 and ZT12. [score:3]
In an independent set of animals we furthermore confirmed that injection of a control ASO, specific for the brain-specific miR-124, did not increase Nocturnin levels at the two time points tested, ZT0 or ZT12 (Fig. 6C). [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 7
Target gene Description miRNA ID Osteoblastic genes COL1A1 Type I collagen miR-29a, miR-150, miR-185 BGLAP Osteocalcin – RUNX2 Runt-related transcription factor – Chondrogenic genes COL2A2 Type II collagen miR-7, miR-29a, miR-29b COL10A1 Type X collagen miR-101 SOX9 SRY (sex determining region Y)-box 9 miR-101, miR-124 for the selected genes were carried out with TargetScan, PicTar, or miRanda miRNA target prediction tools. [score:7]
[1 to 20 of 1 sentences]
88