sort by

136 publications mentioning mmu-mir-19b-1 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-19b-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 328
As shown in Fig. 4D and E, the ectopic expression of miR-19b-3p significantly repressed RNF11 mRNA and protein levels, whereas miR-19b-3p inhibitors restored RNF11 expression, indicating that RNF11 expression could be squelched by miR-19b-3p via mRNA decay and translational suppression. [score:13]
However, knockdown of RNF11 rescued the inhibitory effects of miR-19b-3p inhibitors on NF-κB activity (Fig. 8), suggesting that miR-19b-3p activates NF-κB activity via targeting RNF11. [score:8]
Overexpression of miR-19b-3p markedly diminished RNF11 mRNA and protein levels, whereas treatment with miR-19b-3p inhibitors restored RNF11 expression. [score:7]
Similar to our in vitro findings, brain tissues from JEV-infected mice demonstrated an inverse relationship between the expression patterns of miR-19b-3p and its target, RNF11; i. e., higher miR-19b-3p expression was correlated with a reduced level of RNF11 (Fig. 9A to C). [score:7]
To further substantiate that RNF11 is indeed a target of miR-19b-3p, endogenous RNF11 expression was determined in U251 cells treated with miR-19b-3p mimics or inhibitors. [score:7]
Moreover, silencing of RNF11 rescued the inhibitory effect of miR-19b-3p inhibitors on JEV -induced expression of inflammatory cytokines. [score:7]
These results strongly demonstrate that miR-19b-3p expression is upregulated after JEV infection. [score:6]
miR-19b-3p regulates JEV -induced inflammatory cytokine expression by targeting RNF11. [score:6]
In addition to its oncogenic effects, the miR-19 regulon is reported to control NF-κB signaling by targeting members of the ubiquitin-editing protein complex in the cells stimulated with purified bacterial product (47), suggesting that targeting this miRNA regulon could regulate the activity of NF-κB signaling in inflammation. [score:6]
Of these miRNAs, miR-19b-3p was found to be statistically well upregulated upon viral infection, and it was expressed at high levels in the cells (unpublished data). [score:6]
This upsurge of inflammatory cytokines was achieved through suppression of RNF11, a direct target of miR-19b-3p. [score:6]
Thus, these data suggest that RNF11 is a direct target of miR-19b-3p and that its expression is modulated by miR-19b-3p. [score:6]
On the basis of the characterization of RNF11 in monocytic cell lines (69), its role in Parkinson's disease (65), its differential expression in neurons and glial cells (70), and our confirmed analysis of the upregulation of miR-19b-3p after JEV infection, we hypothesized that RNF11 may also have a role in inducing the JEV -mediated inflammatory response. [score:6]
In contrast, treatment of cells with miR-19b-3p inhibitors significantly inhibited the nuclear translocation of NF-κB in JEV-infected U251 cells (Fig. 7B). [score:5]
Importantly, silencing of RNF11 rescued the suppressive effect of miR-19b-3p inhibitors on these cytokines (Fig. 6C). [score:5]
Their sequences were as follows: miR-19b-3p mimics, 5′-UGUGCAAAUCCAUGCAAAACUGA-3′ (forward) and 5′-AGUUUUGCAUGGAUUUGCACAUU-3′ (reverse); mimic controls, 5′-UUCUCCGAACGUGUCACGUTT-3′ (forward) and 5′-ACGUGACACGUUCGGAGAATT-3′ (reverse); miR-19b-3p inhibitors, 5′-UCAGUUUUGCAUGGAUUUGCACA-3′; inhibitor controls, 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:5]
Since our deep-sequencing data revealed that miR-19b-3p is upregulated after JEV infection, we hypothesized that miR-19b-3p may have a crucial role in regulating the JEV -induced inflammatory response. [score:5]
We also demonstrated that miR-19b-3p positively regulates the JEV -induced inflammatory response in vitro and in vivo via targeting RNF11, a negative regulator of NF-κB signaling (60). [score:5]
In line with previous data, JEV -induced expression of TNF-α, IL-6, IL-1β, and CCL5 was decreased by miR-19b-3p inhibitors. [score:5]
FIG 3Inhibition of miR-19b-3p suppresses JEV -mediated production of inflammatory cytokines. [score:5]
miR-19b-3p belongs to the miR-17/92 cluster of miRNAs, and this miRNA cluster has been found to have divergent roles in the development of tumors and other diseases (61, 62). [score:4]
To substantiate that miR-19b-3p is indeed involved in the regulation of NF-κB signaling through RNF11, U251 cells were cotransfected with miR-19b-3p inhibitors or control oligonucleotides and siRNF11 or a nonspecific control siRNA and subsequently infected with JEV. [score:4]
Knockdown of RNF11 significantly increased the production of inflammatory cytokines, which means that RNF11 silencing produces effects similar to those of miR-19b-3p overexpression (Fig. 6C). [score:4]
Upregulation of miR-19b-3p upon JEV infection. [score:4]
The results revealed that miR-19b-3p was significantly upregulated in a time -dependent (Fig. 1A) and dose -dependent (Fig. 1B) manner. [score:4]
Mechanistically, miR-19b-3p modulated the JEV -induced inflammatory response via targeting ring finger protein 11, a negative regulator of nuclear factor kappa B signaling. [score:4]
In the present study, we found that miR-19b-3p is upregulated in JEV-infected U251 and BV2 cells and that it reinforces the production of inflammatory cytokines such as TNF-α, IL-6, IL-1β, and CCL5. [score:4]
Taken together, our findings demonstrate that miR-19b-3p positively regulates JEV -induced inflammatory cytokine production by targeting RNF11. [score:4]
The data demonstrated that miR-19b-3p is upregulated in cultured cells and mouse brain tissues during JEV infection. [score:4]
Moreover, the 4-bp mutation of in the miR-19b-3p seed region led to a complete abrogation of the negative effect of miR-19b-3p on expression of RNF11 3′ UTR reporter constructs (Fig. 4C). [score:4]
Interestingly, we also observed that overall expression levels of inflammatory cytokines in BV2 cells were lower than those in U251 cells, suggesting that astrocytes may react more effectively than microglia in regulating the miR-19b-3p -mediated inflammatory response upon JEV infection. [score:4]
In contrast to these findings, UV-irradiated inactivated JEV infection failed to induce miR-19b-3p upregulation in U251 cells (Fig. 1C), suggesting possible involvement of miR-19b-3p in a JEV -induced inflammatory response in brain astrocytes. [score:4]
Interestingly, certain cytokines of JEV -induced neuroinflammation, such as TNF-α, IL-6, IL-1β, and CCL5 (9, 36), were found to be significantly upregulated upon transfection of miR-19b-3p mimics in both infected and uninfected U251 cells (Fig. 2B). [score:4]
The antagomir-19b-3p, a chemically modified antisense oligonucleotide, was administered intravenously into mice at 24 and 36 h postinfection to knock down the expression of endogenous miR-19b-3p. [score:4]
Overexpression of miR-19b-3p led to increased production of inflammatory cytokines, including tumor necrosis factor alpha, interleukin-6, interleukin-1β, and chemokine (C-C motif) ligand 5, after JEV infection, whereas knockdown of miR-19b-3p had completely opposite effects. [score:4]
miR-19b-3p mimics (double-stranded RNA oligonucleotides), inhibitors (single-stranded chemically modified oligonucleotides), and control oligonucleotides were commercially purchased from GenePharma. [score:3]
The sequences of miR-19b-3p and its target site in the 3′ UTR of RNF11 were aligned with those from different species, and these sequences are shown to be highly conserved among species (Fig. 4A). [score:3]
We found that treatment of cells with miR-19b-3p mimics enhances the translocation of NF-κB from the cytoplasm to the nucleus, whereas miR-19b-3p inhibitors hinder the nuclear translocation of NF-κB. [score:3]
A marked reduction in luciferase activity was observed in U251 cells cotransfected with miR-19b-3p mimics and the RNF11 wild-type 3′ UTR carrying a binding site, whereas significantly increased luciferase activity was detected following application of miR-19b-3p inhibitors (Fig. 4C). [score:3]
U251 cells were transfected with miR-19b-3p mimics, inhibitors, or their controls (final concentration, 50 nM) for 24 h and subsequently infected with JEV at an MOI of 5. At 12, 24, and 36 h postinfection, cell supernatants were harvested, serially diluted, and then used to inoculate monolayers of U251 cells. [score:3]
In contrast, the inhibition of endogenous miR-19b-3p significantly repressed JEV-triggered cytokine production (Fig. 3B). [score:3]
Furthermore, we found that treatment of miR-19b-3p mimics or inhibitors did not produce any antiviral activity in JEV-infected U251 cells as viral titers were similar to those in control cells (Fig. 2C and 3C). [score:3]
In JEV-infected mice, treatment of antagomir-19b-3p caused a specific reduction in miR-19b-3p expression and rescued the alterations in RNF11 levels (Fig. 9A to C). [score:3]
First, we evaluated the consequences of synthetic miR-19b-3p mimics and inhibitors on the expression pattern of miR-19b-3p. [score:3]
Therefore, inhibition of miR-19b-3p may be an intriguing approach for the advancement of curative interventions. [score:3]
The psiCheck-2 dual-luciferase reporter vector (Promega) harboring the 3′ untranslated region (UTR) of RNF11 inserted into the XhoI and PmeI restriction sites at the 3′ end of Renilla luciferase was used to check the effect of miR-19b-3p on Renilla luciferase activity. [score:3]
In this study, we showed that astrocytes expressed high levels of miR-19b-3p upon JEV infection. [score:3]
The corroboration of miR-19b-3p expression patterns in JEV-infected U251 cells was scrutinized by quantitative real-time PCR. [score:3]
The lower panel shows the alignment of miR-19b-3p and its target site in the 3′ UTR of RNF11. [score:3]
As expected, transfection of miR-19b-3p mimics increased miR-19b-3p levels significantly in mock- or JEV-infected glial cells at 36 h postinfection (Fig. 2A and D), whereas miR-19b-3p inhibitors diminished its levels (Fig. 3A and D). [score:3]
RNF11 is a potential target of miR-19b-3p. [score:3]
These results demonstrate that the nucleotide sequence in the 3′ UTR of RNF11 is a potential miR-19b-3p targeting site. [score:3]
The effects of miR-19b-3p mimics and inhibitors on inflammatory cytokine production were also examined in BV2 cells, and the results were analogous to those observed in U251 cells (Fig. 2E and 3E). [score:3]
Similar to our previous data, JEV -induced nuclear translocation of NF-κB was decreased by miR-19b-3p inhibitors. [score:3]
Thus, miR-19b-3p targeting may constitute a thought-provoking approach to rein in JEV -induced inflammation. [score:3]
In JEV-infected mouse brain tissues, miR-19b-3p showed a reciprocal expression pattern with RNF11, which further supports a functional interplay between miRNA and mRNA in vivo. [score:3]
Lewis A, Mehta S, Hanna LN, Rogalski LA, Jeffery R, Nijhuis A, Kumagai T, Biancheri P, Bundy JG, Bishop CL, Feakins R, Di Sabatino A, Lee JC, Lindsay JO, Silver A 2015 Low serum levels of microRNA-19 are associated with a stricturing Crohn's disease phenotype. [score:3]
U251 cells were cotransfected with miR-19b-3p inhibitors or control oligonucleotides and siRNF11 or a nonspecific control siRNA (final concentration, 50 nM) for 24 h and then infected with JEV at an MOI of 5 for 36 h. The cytosolic extracts (upper panel) and nuclear extracts (lower panel) were isolated and subjected to immunoblotting with antibodies against RNF11, NF-κB p65, lamin A, and GAPDH. [score:3]
miR-19b-3p activates NF-κB signaling via targeting RNF11 in JEV-infected astrocytes. [score:3]
The cells were cotransfected with miR-19b-3p inhibitors or control oligonucleotides and siRNF11 or a nonspecific control siRNA and then infected with JEV. [score:3]
In vivo silencing of miR-19b-3p by a specific antagomir reinvigorates the expression level of RNF11, which in turn reduces the production of inflammatory cytokines, abrogates gliosis and neuronal cell death, and eventually improves the survival rate in the mouse mo del. [score:3]
As expected, silencing of RNF11 significantly enhanced the accumulation of NF-κB in the nucleus, and these effects were concordant with miR-19b-3p overexpression (Fig. 8). [score:3]
The present study reveals that miR-19b-3p targets ring finger protein 11 in glia and promotes inflammatory cytokine production by enhancing nuclear factor kappa B activity in these cells. [score:3]
First, we confirmed the expression of miR-19b-3p in the transfected cells (Fig. 6B). [score:3]
Cholesterol-conjugated and chemically modified miR-19b-3p inhibitors (antagomir-19b-3p) were synthesized by GenePharma. [score:3]
To determine whether the observed effects of miR-19b-3p on inflammatory cytokine production in response to JEV infection were, at least partially, mediated through RNF11, we analyzed the effects of silencing RNF11 expression by siRNA in U251 cells. [score:3]
miR-19b-3p expression activates the NF-κB pathway in JEV-infected astrocytes. [score:3]
A previous study has reported RNF11 as a potential target for miR-19b-3p (47). [score:3]
U251 cells were cotransfected with 100 ng of the constructed luciferase reporter plasmid along with miR-19b-3p mimics, inhibitors, or controls (final concentration, 50 nM). [score:3]
Huhn D, Kousholt AN, Sorensen CS, Sartori AA 2015 miR-19, a component of the oncogenic miR-17 approximately 92 cluster, targets the DNA-end resection factor CtIP. [score:3]
We also found that inhibition of ring finger protein 11 by miR-19b-3p resulted in accumulation of nuclear factor kappa B in the nucleus, which in turn led to higher production of inflammatory cytokines. [score:3]
Further investigations revealed that miR-19b-3p augments the inflammatory response via targeting ring finger protein 11 (RNF11), a negative regulator of nuclear factor kappa B (NF-κB) activity. [score:2]
To determine if RNF11 mRNA is indeed repressed by miR-19b-3p in the context of virus infection, a dual-luciferase reporter plasmid containing a putative binding site for miR-19b-3p and a mutant construct harboring the miR-19b-3p seed region with a 4-bp mutation were generated (Fig. 4B). [score:2]
In summary, this study provides evidence that miR-19b-3p acts as a positive regulator of JEV -induced neuroinflammation by enhancing NF-κB signaling, resulting in increased production of TNF-α, IL-6, IL-1β, and CCL5. [score:2]
Collectively, our results demonstrate that miR-19b-3p positively regulates the JEV -induced inflammatory response. [score:2]
To the best of our knowledge, our data suggest for the first time that miR-19b-3p -mediated regulation of RNF11 participates in the induction of an inflammatory response in the context of viral infections. [score:2]
In the present study, we found that miR-19b-3p is involved in regulating the JEV -induced inflammatory response in vitro and in vivo and that miR-19b-3p enhances the production of inflammatory cytokines in cultured cells and mouse brain tissues. [score:2]
To examine whether miR-19b-3p is involved in the JEV -mediated inflammatory process, the effect of miR-19b-3p on the regulation of inflammatory cytokine production after JEV infection was determined. [score:2]
Here, we found the involvement of miR-19b-3p in regulating the JEV -induced inflammatory response in vitro and in vivo. [score:2]
Thus, these findings demonstrated that miR-19b-3p appears to regulate inflammatory cytokine production by enhancing the activation of NF-κB signaling in JEV-infected astrocytes. [score:2]
Thus, these data indicate that miR-19b-3p participates in regulating JEV -mediated inflammation. [score:2]
FIG 6Regulation of JEV -induced production of inflammatory cytokines by miR-19b-3p is achieved through RNF11. [score:2]
Gantier MP, Stunden HJ, McCoy CE, Behlke MA, Wang D, Kaparakis-Liaskos M, Sarvestani ST, Yang YH, Xu D, Corr SC, Morand EF, Williams BR 2012 A miR-19 regulon that controls NF-kappaB signaling. [score:1]
Transfection of miR-19b-3p mimics increased the translocation of NF-κB from the cytoplasm to the nucleus (Fig. 7A). [score:1]
We also investigated the expression of miR-19b-3p in JEV-infected microglial BV2 cells (Fig. 1D and E). [score:1]
These results suggest that silencing of RNF11 phenocopied the proinflammatory effect of miR-19b-3p and counteracted the effect of anti-miR-19b-3p. [score:1]
Thus, these findings illustrate that JEV -induced miR-19b-3p potentiates NF-κB signaling through RNF11. [score:1]
In this regard, a JEV-infected mouse mo del was established to substantiate the effects of miR-19b-3p in vivo. [score:1]
Effects of miR-19b-3p on the JEV-triggered inflammatory cytokine production. [score:1]
The levels of miR-19b-3p were detected by quantitative real-time PCR (upper panels). [score:1]
To date, no study has reported the role of the miR-19 regulon in the context of any virus -mediated inflammatory response. [score:1]
To delineate the significance of miR-19b-3p in JEV-caused encephalitis in vivo, a mouse mo del for JEV infection was established. [score:1]
Moreover, administration of an miR-19b-3p-specific antagomir in JEV-infected mice reduces neuroinflammation and lethality. [score:1]
Genetic anatomization of the relative contribution of the individual miRNAs of this cluster has demonstrated that miR-19 recapitulated on its own the oncogenic effects of the full cluster (63). [score:1]
[1 to 20 of 94 sentences]
2
[+] score: 310
Other miRNAs from this paper: mmu-mir-151, mmu-mir-182, mmu-mir-19b-2, mmu-mir-19a, mmu-mir-494
On the contrary, inhibition of miR-19b expression could significantly up-regulate the E-Cadherin expression level, but down-regulate the expression levels of ICAM-1 and Integrin β1 (* p < 0.05, ** p < 0.01) (Figure 3A). [score:15]
The results showed that over -expression of miR-19b could significantly down-regulate the E-Cadherin expression level, but up-regulate the expression levels of ICAM-1 and Integrin β1. [score:13]
Conversely, inhibition of miR-19b expression could significantly up-regulate the MYLIP protein expression (* p < 0.05, *** p < 0.001, **** p < 0.0001) (Figure 2C, 2D). [score:10]
The date demonstrated that the expression level of miR-19b was significantly up-regulated in miR-19b agomir group (*** p < 0.001) (Figure 5E), and the expression level of MYLIP was significantly down-regulated in miR-19b agomir group compared with agomir control group (** p < 0.01) (Figure 5F). [score:10]
The IHC scores suggested that the expression levels of MYLIP and E-Cadherin were significantly down-regulated, but the expression levels of ICAM-1 and Integrin β1 were significantly up-regulated in miR-19b agomir group compared with agomir control group (* p < 0.05, ** p < 0.01, *** p < 0.001) (Figure 5H, 5I). [score:10]
miR-19b directly targets MYLIP gene and down-regulates its expression in breast cancer cells. [score:9]
In this article, we mainly illustrated the regulatory mechanisms of miR-19b promoting breast cancer metastasis through directly targeting MYLIP expression and affecting the expression levels of cell adhesion molecules (including E-Cadherin, ICAM-1 and Integrin β1) (Figure 7). [score:9]
Figure 7 Through inhibiting the expressions of MYLIP and E-Cadherin, or up -regulating the expressions of ICAM-1 and Integrin β1 (accompanied by activating the Ras-MAPK and PI3K-AKT pathways), miR-19b exerts its essential roles in breast cancer cell adhesion, migration and metastasis. [score:8]
The results demonstrated that over -expression of miR-19b could significantly down-regulate the MYLIP protein expression. [score:8]
The data indicated that over -expression of miR-19b could significantly up-regulate the expression levels of key genes in Ras-MAPK pathway (including FAK, Ras, Raf, MEK and ERK) and PI3K-AKT pathway (including PIK3CA, PIK3CB, PIP3 and AKT1) (* p < 0.05, ** p < 0.01) (Figure 3C, 3D). [score:8]
The data hinted that the relative luciferase activity was significantly suppressed in the MYLIP 3′-UTR WT group compared with MYLIP 3′-UTR MUT group when transfected with miR-19b mimic (*** p < 0.001) (Figure 2F), which suggested that miR-19b could directly regulate the expression of MYLIP gene through targeting its 3′-UTR region. [score:8]
Through inhibiting the expressions of MYLIP and E-Cadherin, or up -regulating the expressions of ICAM-1 and Integrin β1 (accompanied by activating the Ras-MAPK and PI3K-AKT pathways), miR-19b exerts its essential roles in breast cancer cell adhesion, migration and metastasis. [score:8]
With the development of bioinformatics technologies, we can make the best use of multiple databases to compare miR-19b expression levels in different cancer types, predict their putative targets, set up the interaction networks for potential targets, analyze their downstream biological functions, and draw the survival curves to indicate their risk factors [31]. [score:8]
Through down -regulating E-Cadherin expression and up -regulating ICAM-1 and Integrin β1 expressions, miR-19b could obviously promote breast tumor growth and facilitate cancer metastasis. [score:7]
Nevertheless, there is no study focused on the significant role of MYLIP in cancer development and progression processes nowadays, so in this paper we will try to fully discuss the potential mechanisms of miR-19b regulating MYLIP and its related cell adhesion molecules expressions, and their biological functions in breast cancer metastasis, finally paving new avenues for searching useful therapeutic targets of breast cancer. [score:7]
Using the bioinformatics databases to predict the downstream targets of miR-19b, we noticed that a novel target gene, myosin regulatory light chain interacting protein (MYLIP), has the high score ranks and might participate in the processes of cancer metastasis. [score:6]
Then we tested the expression levels of miR-19b in these cell lines after the above treatments to confirm the miR-19b over -expression and knock-down efficiency (** p < 0.01, *** p < 0.001) (Figure 2A, 2B). [score:6]
Figure 3 (A) The protein expression levels of E-Cadherin, ICAM-1, Integrin β1 and their integrated optical densities (IOD) in MCF7 cell line when transfected with miR-19b mimic, miR-19b inhibitor and their negative controls. [score:5]
Figure 6 (A) The survival curve of hsa-miR-19b in breast cancer patients, among them the low expression group (n=73) and high expression group (n=66). [score:5]
The primary expression data for drawing the survival curves ofhsa-miR-19b, MYLIP and cell adhesion molecules (E-Cadherin, ICAM-1 and Integrin β1) in breast cancer patients, were downloaded from the TCGA database, SurvExpress database (http://bioinformatica. [score:5]
Meanwhile, the recent publications have showed that miR-19b could suppress the expression level of protein tyrosine phosphatase receptor type G (PTPRG) so as to increase cell proliferation, reduce apoptosis and finally promote breast tumorigenesis [11]. [score:5]
Next, we detected the protein expression levels of MYLIP in MCF7 and MDA-MB-231 cell lines after transfected with miR-19b mimic, miR-19b inhibitor and their negative controls. [score:5]
The data showed that hsa-miR-19b expression level was significantly up-regulated in breast cancer samples compared with normal breast tissues (*** p < 0.001) (Figure 1A, Supplementary Figure 1A). [score:5]
Over -expression of miR-19b and inhibition of MYLIP facilitate the migration and metastasis of breast cancer cells. [score:5]
The data indicated that the expression of hsa-miR-19b was negatively correlated with MYLIP expression in breast cancer patient samples. [score:5]
ThemiR-19b mimic, mimic control, miR-19b inhibitor, inhibitor control, siRNA-MYLIP-633, siRNA-MYLIP-850, siRNA-MYLIP-1118 and siRNA control were all synthesized by GeneChem, Shanghai, China. [score:5]
Figure 2 (A) The relative expression levels of miR-19b in MCF7 cell line when transfected with miR-19b mimic, miR-19b inhibitor and their negative controls. [score:5]
Using the TargetScan, miRecords, miRanda, PITA and RNAhybrid databases, we predicted that MYLIP might be a putative downstream target of miR-19b. [score:5]
The primary hsa-miR-19b expression data (log2) and MYLIP mRNA expression data (log2) in breast cancer patients were downloaded from the TCGA database. [score:5]
The expression of miR-19b is negatively correlated with MYLIP expression in breast cancer patient samples. [score:5]
To investigate whether miR-19b could also affect the expressions of other cell adhesion molecules apart from MYLIP, we tested the protein expression levels of E-Cadherin, ICAM-1, and Integrin β1 in MCF7 cell line after transfected with miR-19b mimic, miR-19b inhibitor and their negative controls. [score:5]
miR-19b promotes breast tumor growth and affects the expressions of cell adhesion molecules in vivoTo further validate the essential role of miR-19b in breast cancer development in vivo, we used the BALB/c nude mice as animal mo dels, and injected them by MCF7 cells (1×10 [6]) transfected with miR-19b agomir and agomir control respectively. [score:4]
In order to further verify that MYLIP is a direct target of miR-19b, we used the MCF7 and MDA-MB-231 breast cancer cell lines as mo dels. [score:4]
The data showed that over -expression of miR-19b and inhibition of MYLIP could significantly reduce the relative gap distances at 48h compared with the control groups (* p < 0.05, ** p < 0.01) (Figure 4B, 4C), which facilitates the migration capacities of breast cancer cells. [score:4]
The curves indicated that the high expression levels of hsa-miR-19b, ICAM-1 and Integrin β1 (ITGB1) could significantly lower the survival rates for breast cancer patients compared with their low expression groups (p = 0.0092 for hsa-miR-19b curve, p = 0.0086 for ICAM-1 curve, p = 0.0062 for ITGB1 curve) (Figure 6A, 6D, 6E). [score:4]
The results indicated that over -expression of miR-19b and inhibition of MYLIP could significantly increase the relative invasive cell numbers compared with the control groups (* p < 0.05, ** p < 0.01) (Figure 4D, 4E), which promotes the metastasis of breast cancer cells. [score:4]
In our previous research, we found that miR-19b can be positively regulated by DEAD-box RNA helicase DDX3X and has significant expression difference in breast cancer [10]. [score:4]
In order to further explore the effect of miR-19b on the Integrin β downstream signaling pathway genes, we conducted the RT-PCR experiment to check the relative expression levels of key genes in these two pathways in MCF7 cell line when transfected with miR-19b mimic and mimic control. [score:3]
In our research, we mainly explored the downstream effects of miR-19b and its target MYLIP in breast cancer metastasis from the aspects of cell adhesion molecules. [score:3]
To further validate the inverse correlation between hsa-miR-19b and MYLIP, we conducted the correlation analysis to test the expression levels of hsa-miR-19b and MYLIP in breast cancer samples at the same time. [score:3]
The putative targets of miR-19b were predicted using the following six respective databases: miRecords (http://mirecords. [score:3]
Figure 1 (A) The hsa-miR-19b expression level in breast cancer samples (n=28) and adjacent normal breast tissues (n=9). [score:3]
Then we extracted the RNA from the tumor tissues and tested the relative expression levels of miR-19b and MYLIP in miR-19b agomir group and agomir control group respectively. [score:3]
The primary hsa-miR-19b expression data (log2) in breast cancer patients were downloaded from the TCGA database. [score:3]
Figure 5miR-19b promotes breast tumor growth and affects the expressions of cell adhesion molecules in vivo (A) The tumor volumes of BALB/c nude mice injected by MCF7 cells (1×10 [6]) transfected with miR-19b agomir and agomir control respectively at different timepoints. [score:3]
First, we transfected these two cell lines with miR-19b mimic, miR-19b inhibitor and their negative controls. [score:3]
The expression levels of hsa-miR-19b and MYLIP in breast cancer samples versus their adjacent normal breast tissues were analyzed by The Cancer Genome Atlas (TCGA) database (https://cancergenome. [score:3]
miR-19b promotes breast tumor growth and affects the expressions of cell adhesion molecules in vivo. [score:3]
Firstly, we used the TCGA (The Cancer Genome Atlas) database to analyze the expression level of hsa-miR-19b in breast cancer samples and adjacent normal breast tissues. [score:3]
Additionally, using the primary expression data of breast cancer patients from the TCGA database, we drew the overall survival curves for hsa-miR-19b, MYLIP and cell adhesion molecules (E-Cadherin, ICAM-1 and Integrin β1) respectively. [score:3]
So in the next step, with the aid of exosome technologies, we can further explore miR-19b as a promising biomarker in the body fluid to assist tumor early detection and develop more of its downstream genes as therapeutic targets for breast cancer treatment. [score:3]
miR-19b affects the expressions of cell adhesion molecules (E-Cadherin, ICAM-1, Integrin β1) and the Integrin β downstream signaling pathways. [score:3]
3′-UTR sequences and the mutant sequences of MYLIP containing the putative miR-19b target sites were cloned in the plasmid SV40-Luc-MCS-pMIR-report-Vector (GeneChem, Shanghai, China). [score:3]
In the next step, we conducted the immunohistochemical (IHC) staining for tumor samples to detect the expressions of MYLIP and cell adhesion molecules (E-Cadherin, ICAM-1 and Integrin β1) (Figure 5G) and let the pathologists to determine their relative IHC scores in miR-19b agomir and agomir control groups. [score:3]
However, the potential roles of miR-19b in breast cancer metastasis are rarely studied and largely unknown until now, thus we launch this study for thoroughly discovering the regulatory mechanisms of miR-19b in the metastasis of breast cancer cells. [score:2]
The schematic mo del of the regulatory mechanisms of miR-19b in breast cancer metastasis. [score:2]
Although numerous researches focused on breast cancer metastasis have already been carried out recently, the most striking findings and novelties for our study are that we verified the regulatory relationship between miR-19b and MYLIP, and testified their essential biological effects on breast cancer metastasis for the first time. [score:2]
To further validate the essential role of miR-19b in breast cancer development in vivo, we used the BALB/c nude mice as animal mo dels, and injected them by MCF7 cells (1×10 [6]) transfected with miR-19b agomir and agomir control respectively. [score:2]
Also, curcumin could modulate the miR-19/PTEN/AKT/p53 axis to exhibit its protective effects against bisphenol A (BPA) -induced breast cancer cell proliferation [12]. [score:1]
After BALB/c nude mice were anaesthetized and the skins were incised, MCF7 cells (1×10 [6]) transfected with miR-19b agomir and agomir control (Ribobio, Guangzhou, China) in 20μl phosphate-buffered saline mixed with 1:1 ratio growth factor reduced Matrigel (BD Biosciences, CA, USA) were orthotopically injected into mammary fat pads. [score:1]
Furthermore, we constructed the MYLIP 3′-UTR WT (wild type) and MUT (mutant) vectors according to their binding sites with hsa-miR-19b seed sequences (highlighted in red) (Figure 2E), and co -transfected them with miR-19b mimic and mimic control in HEK293 cell line. [score:1]
The graphs revealed that the tumor volumes of miR-19b agomir group were significantly larger than agomir control group, especially at the 22 and 25 days (* p < 0.05, ** p < 0.01) (Figure 5A), however, the body weights of these two groups didn't show significant differences (Figure 5B). [score:1]
The results showed that the tumors formed in miR-19b agomir group were much bigger than agomir control group (Figure 5C), and its tumor weights were significantly heavier than agomir control group (** p < 0.01) (Figure 5D). [score:1]
The survival curves for miR-19b, MYLIP and cell adhesion molecules in breast cancer patients. [score:1]
These data hinted that miR-19b could effectively promote breast tumor growth in vivo, but didn't have much obvious effect on the body weights of nude mice. [score:1]
[1 to 20 of 65 sentences]
3
[+] score: 187
c Western blot showed that protein level of Sox6 was low from day 0 to 6, and was significantly upregulated from day 8 to 12. d The Sox6 protein levels were significantly down- and up-regulated respectively in P19CL6 cells transfected with miR-19b and anti-miR-19b at day 10. e shH19 inhibited the Sox6 expression significantly, but miR-19b enhanced the inhibitory effect of shH19 on Sox6 expression and anti-miR-19b reversed the influence of shH19 on Sox6 expression at day 10 after transfection. [score:17]
The result showed that knockdown H19 inhibited the Sox6 expression significantly, while miR-19b enhanced the inhibitory effect of knockdown H19 on Sox6 expression, and anti-miR-19b reversed the influence of knockdown H19 on Sox6 expression (Fig.   4e). [score:14]
Downregulation of H19 promoted cell proliferation and inhibited cell apoptosis during late-stage cardiac differentiation by regulating the negative role of miR-19b in Sox6 expression, which suggested that the manipulation of H19 expression could serve as a potential strategy for heart disease. [score:13]
The expression levels of α-MHC, MLC-2v and H19 were upregulated, and miR-19b was downregulated significantly in mouse P19CL6 cells at the late stage of cardiac differentiation. [score:9]
H19 suppressed miR-19b expression and miR-19b targeted Sox6, which inhibited cell proliferation and promoted apoptosis in P19CL6 cells during late-stage cardiac differentiation. [score:9]
Fig.  1The expression levels of GATA4, Nkx-2.5, α-MHC, MLC-2v and H19 are significantly upregulated and miR-19b was downregulated at indicated time points. [score:9]
Furthermore, we also confirmed that miR-19b could target directly Sox6 and inhibited its expression. [score:8]
Thus, our data indicated that H19 could inhibit miR-19b expression, and miR-19b targets Sox6, regulating cell proliferation and apoptosis during late stage of cardiomyocyte differentiation. [score:8]
The results showed that the protein level of Sox6 was significantly down-regulated in P19CL6 cells transfected with miR-19b and significantly up-regulated in P19CL6 cells transfected with anti-miR-19b (Fig.   4d). [score:7]
Fig.  3H19 targets and inhibits miR-19b expression. [score:7]
H19 targets miR-19b to regulate the expression of Sox6. [score:6]
In addition, luciferase reporter assay indicated that miR-19b significantly suppressed luciferase expression of the wild type Sox6 reporter (Sox6-WT) but not the mutant reporter (Sox6-Mut) (Fig.   4b), confirming that Sox6 was a target of miR-19b. [score:6]
All these results suggested that knockdown of H19 inhibited the Sox6 expression by modulating miR-19b. [score:6]
In this study, H19 suppressed the expression of miR-19b. [score:5]
miR-19b mimics were capable of significantly inhibiting luciferase expression of H19-WT reporter plasmid but not the H19-Mut reporter plasmid. [score:5]
A previous study showed that miR-19b overexpression promoted cell proliferation and suppressed apoptosis of mouse embryonic carcinoma cells (P19 cells) [14]. [score:5]
H19 inhibited miR-19b expression. [score:5]
Furthermore, Sox6, as a miR-19b target, could inhibit P19CL6 cells proliferation and promoted apoptosis. [score:5]
In conclusion, we defined that H19 knockdown promoted P19CL6 cells proliferation and inhibited apoptosis by modulating miR-19b. [score:4]
The reporter assay indicated that miR-19b mimics were capable of significantly inhibiting luciferase expression of the Sox6-WT reporter plasmid but not the Sox6-Mut reporter plasmid. [score:4]
c miR-19b levels were significantly up- or downregulated in P19CL6 cells transfected with shH19 or H19, respectively. [score:4]
We further predicted the binding sequence of H19 and miR-19b by online softwares starBase v2.0 and TargetScan. [score:3]
Moreover, the expression level of miR-19b was significantly increased in cells transfected with shH19, whereas significantly reduced in cells with pcDNA-H19. [score:3]
These results indicated that H19 negatively modulated miR-19b expression. [score:3]
Furtherly, the luciferase report assay indicated that miR-19b mimics inhibited luciferase activity of the wild type H19 reporter (H19-WT), but no change was observed for the luciferase activity in the mutant reporter (H19-Mut) (Fig.   3b). [score:2]
Furthermore, we transfected H19-knockdown P19CL6 cells with miR-19b mimics or anti-miR-19b. [score:2]
IncRNA H19 Cardiac differentiation miR-19b Sox6 The heart comes into being by undergoing many developmental events such as determination of the cardiac field in the mesoderm, differentiation of cardiac precursor cells into cardiomyocytes, and morphogenesis of the chambered heart [1]. [score:2]
miR-19b is part of the miR-17-92 group which encodes miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a-1, and promotes the development of heart, lung, blood vessel and immune system [13]. [score:2]
Then we defined the biological effect of H19 in regulating cell proliferation and apoptosis during cardiac differentiation by modulating miR-19b. [score:2]
The reporter vectors and miR-19b mimics or miR-NC were co -transfected into 293T cells using Lipofectamine 2000 (Invitrogen). [score:1]
Online software starBase v2.0 predicted H19 contains binding sequences complementary to miR-19b seed regions, as shown in Fig.   3a. [score:1]
miR-NC, miR-19b mimics, miR-NC and anti-miR-19b were chemically synthesized by Genechem Company. [score:1]
Then we transfected P19CL6 cells with miR-19b mimics, miR-NC, anti-miR-19b or anti-miR-NC. [score:1]
a The sketch map of the mmu-miR-19b-3p site in H19 3′-UTR. [score:1]
a The sketch map of the mmu-miR-19b-3p site in Sox6 3′-UTR. [score:1]
Moreover, the level of miR-19b was significantly reduced from day 8 to day 12, suggesting that H19 and miR-19b might play some biological roles during the late stage of cardiac differentiation of P19CL6 cells (Fig.   1f). [score:1]
In our study, our aim was to define the connection between H19 and miR-19b and its biological effect on P19CL6 during late-stage cardiomyocyte differentiation. [score:1]
The levels of lncRNA H19 and miR-19b were detected by qRT-PCR. [score:1]
Thus, miR-19b may functionally be connected with cardiogenic processes, although its exact role remains poorly understood. [score:1]
The wild-type H19-3′UTR (WT), mutant H19-3′UTR (MUT), wild-type Sox6-3′UTR (WT) and mutant Sox6-3′UTR (MUT) containing the putative binding site of miR-19b were established and cloned in pmirGLO dual luciferase miRNA reporter vectors (Promega, Madison, WI, USA). [score:1]
a mRNA levels of early cardiac-specific markers (GATA4 and Nkx-2.5α-MHC) were increased significantly in P19CL6 cells at day 4 and 6. b Protein levels of GATA4 and Nkx-2.5α-MHC were augmented significantly in P19CL6 cells at day 4 and 6. c mRNA levels of cardiac contractile protein genes (α-MHC and MLC-2v) were increased significantly in P19CL6 cells at day 10 and 12. d Protein levels of α-MHC and MLC-2v were elevated significantly in P19CL6 cells at day 10 and 12. e Level of H19 was augmented significantly from day 8 to day 12. f Level of miR-19b was dropped significantly from day 8 to day 12. [score:1]
[1 to 20 of 41 sentences]
4
[+] score: 177
Meanwhile, miR-19b overexpression led to increased expression of Bcl-2, decreased expression of Bax, and reduced cleaved-Caspase 3 to Caspase 3 ratio at protein levels, while miR-19b inhibition had inverse effects (Figure 3C). [score:9]
To overexpress or inhibit miR-19b expression, miR-19b mimic (50 nM), inhibitor (100 nM), or respective negative controls was transfected to H9C2 cardiomyocytes for 48 h using lipofectamine 2000 (Invitrogen, USA). [score:9]
Furthermore, our data demonstrated that miR-19b overexpression reduced H [2]O [2] -induced apoptosis and improved cell survival in H9C2 cardiomyocytes, accompanied with increased expression of Bcl-2 and decreased expression of Bax and cleaved-Caspase 3/Caspase 3 ratio, indicating that miR-19b overexpression might provide protective effects against oxidative stress-related cellular apoptosis. [score:9]
Meanwhile, miR-19b was also downregulated in H [2]O [2] -treated H9C2 cardiomyocytes, and miR-19b overexpression was sufficient to reduce H [2]O [2] -induced cardiomyocyte apoptosis. [score:6]
Besides the reduction of miR-19b expression in infarct area of heart samples from I-R mice, we also found that miR-19b was downregulated in H [2]O [2] -treated H9C2 cardiomyocytes. [score:6]
B. Flow cytometry analysis for necrosis, apoptosis, and survival of H [2]O [2] -treated H9C2 cardiomyocytes with miR-19b overexpression or inhibition (n = 4). [score:5]
C. Immunoblot analysis for Bcl-2, Bax, cleaved-Caspase 3 to Caspase 3 ratio in H [2]O [2] -treated H9C2 cardiomyocytes with miR-19b overexpression or inhibition (n = 3). [score:5]
miR-19b mimic was found to be sufficient to increase relative miR-19b level, while miR-19b inhibitor had inverse effect, confirming that miR-19b mimic and inhibitor took effects in H9C2 cardiomyocytes (Figure 3A). [score:5]
Figure 4PTEN is a target gene of miR-19b controlling H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes A. Immunoblot analysis for PTEN protein level in H9C2 cardiomyocytes transfected with miR-19b mimic, inhibitor, or respective negative controls (n = 3). [score:5]
Moreover, silencing PTEN alone led to reduced apoptosis and improved cell survival in H [2]O [2] -treated H9C2 cardiomyocytes, while co-transfection of PTEN-siRNA and miR-19b inhibitor could totally abolish the aggravated effect of miR-19b inhibitor on cell apoptosis in H9C2 cardiomyocytes treated with H [2]O [2] (Figure 4D–4E). [score:5]
The time-course change of miR-19b was determined and miR-19b was found to be downregulated in H [2]O [2] -treated H9C2 cardiomyocytes at 2 h but remained unchanged at 5 min, 15 min, 30 min and 60 min (Figure 2C). [score:4]
Using qRT-PCR, miR-19b was found to be the only one in the miR-17-92 cluster that was downregulated in infarct area of heart samples from a murine mo del of I-R injury (Figure 1B). [score:4]
Here, we found that miR-19b was markedly downregulated in infarct area heart samples from a murine mo del of I-R injury. [score:4]
PTEN is a well-known target gene of miR-19b, which mainly regulates cancer cell growth and proliferation [37– 40]. [score:4]
To the best of our knowledge, we firstly reported a downregulation of miR-19b in myocardial I-R injury, which promoted us to further determine the underlying mechanisms. [score:4]
Here we showed that miR-19b was the only member of the miR-17-92 cluster that was downregulated in infarct area of heart samples from a murine mo del of I-R injury. [score:4]
miR-19b is downregulated in the infarct area of myocardial ischemia-reperfusion mice. [score:4]
Therefore, miR-19b overexpression might be a novel therapy for myocardial I-R injury. [score:3]
miR-19b inhibitor. [score:3]
PTEN is a downstream target of miR-19b controlling H [2]O [2] -induced apoptosis in H9C2 cardiomyocytesHow miR-19b modulates H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes was examined. [score:3]
After transfected with miR-19b mimic, inhibitor, or respective controls for 48 h, cell apoptosis and necrosis were analyzed using Annexin V-FITC and propidium iodide (PI) kit (Dojindo, Japan) according to the manufacturer's instruction, followed by flow cytometry analysis (Beckman Coulter, USA). [score:3]
Importantly, silencing PTEN could abolish the aggravated apoptotic effect of miR-19b inhibitor in H [2]O [2] -treated H9C2 cardiomyocytes. [score:3]
Moreover, hypoxia treatment (0% O [2]) was also conducted in H9C2 cardiomyocytes for 8 h. The miR-19b mimic, inhibitor, and their negative controls, as well as PTEN-siRNAs, were all purchased from RiboBio (Guangzhou, China). [score:3]
PTEN is a target gene of miR-19b, responsible for the anti-apoptosis effect of miR-19b. [score:3]
Figure 3miR-19b reduces H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes A. qRT-PCR analysis for miR-19b level in H9C2 cardiomyocytes transfected with miR-19b mimic, inhibitor, or respective negative controls (n = 4). [score:3]
Moreover, PTEN was identified as a target gene of miR-19b that was responsible for its anti-apoptosis effects. [score:3]
PTEN is a downstream target of miR-19b controlling H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes. [score:3]
Therefore, our data suggest that miR-19b might be a novel therapeutic target for reducing early cellular apoptosis during myocardial I-R injury. [score:3]
Overexpression of miR-19b led to decreased apoptosis and improved survival of H [2]O [2] -treated H9C2 cardiomyocytes. [score:3]
To further examine the functional effect of miR-19b in H [2]O [2] -treated H9C2 cardiomyocytes, transfection of miR-19b mimic, inhibitor, or their negative controls, were conducted. [score:3]
PTEN is a target gene of miR-19b controlling H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes. [score:3]
Furthermore, PTEN was identified as a downstream target of miR-19b controlling apoptosis in H [2]O [2] -treated cardiomyocytes. [score:3]
E. Flow cytometry analysis for necrosis, apoptosis, and survival of H [2]O [2] -treated H9C2 cardiomyocytes with miR-19b inhibition and/or PTEN silence (n = 4). [score:3]
PTEN is a well-known target gene of miR-19b [25– 27]. [score:3]
Flow cytometry showed that miR-19b mimic reduced H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes, while miR-19b inhibitor aggravated that (Figure 3B). [score:3]
A. qRT-PCR analysis for miR-19b level in H9C2 cardiomyocytes transfected with miR-19b mimic, inhibitor, or respective negative controls (n = 4). [score:3]
In conclusion, miR-19b overexpression is able to attenuate apoptosis in H [2]O [2] -treated H9C2 cardiomyocytes. [score:3]
Figure 5Proposed mechanisms by which miR-19b protects apoptosis induced by H [2]O [2] in H9C2 cardiomyocytes A. Immunoblot analysis for PTEN protein level in H9C2 cardiomyocytes transfected with miR-19b mimic, inhibitor, or respective negative controls (n = 3). [score:3]
As expected, PTEN was negatively regulated by miR-19b at the protein level in H9C2 cardiomyocytes. [score:2]
In the current study, immunoblot analysis showed that PTEN was inversely regulated by miR-19b in H9C2 cells (Figure 4A). [score:2]
miR-19b reduces H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes. [score:1]
As a key functional member of miR-17-92 cluster, miR-19b has emerging roles implicated in cardiac physiology and pathophysiology changes [15– 19]. [score:1]
Knowing that during the early stage (first 24 h after ischemia) of myocardial I-R injury, production of reactive oxidative species triggers and further enhances cardiomyocyte apoptosis, we continued to determine the functional roles of miR-19b on H [2]O [2] -induced apoptosis in rat H9C2 cardiomyocytes. [score:1]
Interestingly, hypoxia treatment for 8 h also decreased miR-19b (Figure 2D). [score:1]
These data provide evidence that increasing miR-19b might be a novel therapeutic strategy for reducing cellular apoptosis during myocardial IRI. [score:1]
Proposed mechanisms by which miR-19b protects apoptosis induced by H [2]O [2] in H9C2 cardiomyocytes. [score:1]
These data suggest that PTEN is a downstream effector of miR-19b controlling cardiomyocyte apoptosis -induced by H [2]O [2]. [score:1]
Figure 5Proposed mechanisms by which miR-19b protects apoptosis induced by H [2]O [2] in H9C2 cardiomyocytes Coronary artery ligation for 30 min followed by reperfusion until 24 h was conducted to induce I-R injury in mice. [score:1]
miR-19b is decreased in infarct area of myocardial ischemia-reperfusion mice. [score:1]
These data suggest that PTEN is responsbile for the effects of miR-19b in H2O2 -induced apoptosis in H9C2 cardiomyocytes (Figure 5). [score:1]
How miR-19b modulates H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes was examined. [score:1]
C. The time-course change of miR-19b as determined by qRT-PCRs in H [2]O [2] -treated H9C2 cardiomyocytes. [score:1]
miR-19b is decreased in H [2]O [2] -treated H9C2 cardiomyocytes. [score:1]
*, P < 0.05. miR-19b is decreased in H [2]O [2] -treated H9C2 cardiomyocytesAs a common reactive oxygen species, H [2]O [2] is usually used to mimic I-R injury in in vitro experiments. [score:1]
In addition, to determine the time-course of miR-19b changes, H9C2 cardiomyocytes were also treated with 600 μM H [2]O [2] from 0 min to 120 min. [score:1]
In the present study, we found that miR-19b was the only one among the miR-17-92 cluster that was decreased in infarct area of heart samples from a murine mo del of I-R injury. [score:1]
These data indicate a protective effect of miR-19b against H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes. [score:1]
Meanwhile, decreased miR-19b was also detected in H9C2 cardiomyocytes treated with hydrogen peroxide (H [2]O [2]) mimicking myocardial IRI in vitro. [score:1]
[1 to 20 of 58 sentences]
5
[+] score: 175
Given that miRNAs negatively regulate their targets, miR-19b knockdown should upregulate its potential targets. [score:10]
In the present study, following the successful knockdown of miR-19b, which normally acts on the 3′-UTR of Wnt1, the levels of Wnt1 protein expression significantly increased, thereby activating Wnt/β-catenin signaling and inhibiting myocardial cell development. [score:7]
Previous studies have determined that the miR-17–92 cluster, which includes mir-19b, is important in a number of diseases and miR-19b expression may correlate with the incidence of cardiovascular diseases and cardiogenesis (15). [score:7]
Although the expression of all the marker genes (cTnT, GATA4 and NKX2.5) gradually increased during differentiation, only cTnT in miR-19b-knockdown cells showed significantly lower expression levels than those in the control cells at days 4, 10 and 12. [score:6]
This indicates that overexpression of miR-19b or miR-19b knockdown may influence morphogenesis in the embryonic heart by inhibiting excessive apoptosis in the myocardium. [score:6]
Gao et al (16) found that the downregulation of miR-19b contributes to angiotensin II -induced overexpression of connective tissue growth factor in cardiomyocytes. [score:6]
At the protein level, the expression levels of Wnt in the miR-19b-knockdown group were significantly higher than those in the vector group at days 0, 10 and 12, those of β-catenin were significantly higher than those in the vector group at days 8 and 12, those of GSK3β were significantly higher than those in the vector group at day 4, and the trend in the levels of β-catenin expression was similar to that of Wnt1 (Fig. 8B and C, P<0.05). [score:6]
Notably, a previous study found that the overexpression of miR-19b could increase proliferation, inhibit apoptosis and promote differentiation of P19 cells into mature cardiac cells (18). [score:5]
Expression levels of all the marker genes gradually increased during the process of differentiation, however, in the miR-19b-knockdown cells only cTnT showed significantly lower expression levels compared with those observed in the control cells at days 4, 10 and 12. [score:5]
In the present study, miR-19b knockdown affected differentiation by increasing the activation of the Wnt/β-catenin signaling pathway via an essential upstream target of Wnt1. [score:4]
MiR-19b knockdown results in an increase in Wnt expression levels, which activates the Wnt/β-catenin signaling pathway in P19 cells, and may regulate the cardiomyocyte differentiation of P19 cells. [score:4]
miR-19b knockdown inhibits cellular proliferation. [score:4]
It was observed that miR-19b knockdown does not significantly affect the differentiation of P19 cells into cardiomyocytes, indicated by the lack of morphological changes and the normal expression of cardiomyogenesis-specific molecular markers. [score:4]
A previous study revealed that miR-19b may indirectly target Wnt1 mRNA through its 3′-UTR (16). [score:4]
These results indicate that miR-19b overexpression and knockdown leads to an imbalance between proliferation and apoptosis, which may result in embryonic cardiac malformations. [score:4]
These results indicate that miR-19b knockdown inhibits serum deprivation -induced apoptosis in P19 cells. [score:4]
Hence, the results clearly demonstrate that miR-19b knockdown inhibits apoptosis, accompanied by mitochondrial dysfunction in P19 cells. [score:4]
The results of the present study, including those from the and cell cycle analysis, indicate that miR-19b knockdown inhibits the proliferation of P19 cells by significantly reducing the percentage of cells in the S phase, however, the specific mechanism by which this occurs remains to be determined. [score:4]
In conclusion, the results of the present study demonstrate that miR-19b knockdown significantly inhibits the proliferation and apoptosis of P19 cells. [score:4]
In the current study, miR-19b knockdown was determined to significantly inhibit serum starvation -induced apoptosis. [score:4]
Previous studies have confirmed that the 3′-UTR of Wnt1 is a target of miR-19b. [score:3]
The stable cell lines which were established with the miR-19b silencing expression plasmid or vector were seeded in 96-well plates and maintained in α-MEM supplemented with 10% FBS, 100 U/ml penicillin and 100 mg/ml streptomycin for seven consecutive days. [score:3]
The result of the luciferase activity assay indirectly revealed that miR-19b was knocked down, demonstrating that the miR-19b-knockdown vector was constructed successfully. [score:3]
In the present study, the results of the luciferase assay indicate that miR-19b knockdown rescued Wnt1 expression by removing its interaction with its cognate miRNA. [score:3]
Plasmids pGLV3/H1/eGFP/Puro-miR-19b-3p -inhibitor sponge and pGLV3/H1/eGFP/Puro-miR-vector were transiently transfected into P19 cells. [score:3]
MiR-19b knockdown inhibited proliferation and apoptosis in the P19 cells. [score:3]
Lipofectamine 2000 was used to transfect the plasmids (pGLV3/H1/eGFP/Puro-miR-19b-3p -inhibitor sponge and pGLV3/H1/eGFP/Puro-miR-vector; GenePharma, Shanghai, China) into P19 cells. [score:3]
In addition, miR-19b-knockdown also affected the cell cycle. [score:2]
The recombinant vector or pGL3-Basic vector (GenePharma, Shanghai, China) were cotransfected with the pRL-CMV vector (GenePharma) containing a Renilla luciferase reporter gene (as a normalizing control) into either the miR-19b knockdown or control stable P19 cells. [score:2]
Effect of miR-19b knockdown on the Wnt/β-catenin signaling pathway. [score:2]
It may be hypothesized that miR-19b knockdown cells generate more ATP to compensate for lost ATP production, which correlates with the increased level of mitochondrial DNA. [score:2]
Cellular ATP production increases upon miR-19b knockdown. [score:2]
The was used to assess the growth of miR-19b-knockdown and control P19 cells. [score:2]
Transfection of P19 cells with the miR-19b knockdown vector. [score:2]
The levels of ROS in the miR-19b-knockdown cells were much lower than those in the control cells (Fig. 6A), as indicated by less intense fluorescent signals in the presence of the H [2]-DCFDA (Fig. 6B). [score:2]
Effects of miR-19b knockdown on mtDNA copy number in P19 cells. [score:2]
However, whether miR-19b knockdown affects the cardiac lineage commitment and differentiation through Wnt/β-catenin signaling remains to be determined. [score:2]
However, no differences were observed in the cell morphology or the time taken for the appearance of beating cell clusters between the miR-19b-knockdown cells and the control cells. [score:2]
At days 1, 2 and 4, the optical density (OD) values of the miR-19b-knockdown and control cells showed no significant differences. [score:2]
In order to knockdown miR-19b (5′-UGUGCAAAUCCAUGCAAAACUGA-3′), complementary binding sites (5′-TCAGTTTTGCATGGATT TGCACA-3′) were inverted into the plasmid which were perfectly complementary with the sponge RNA (5′-GATCCT CAGTTTTGCATGGATTTGCACACTAGTCAGTTTTGCA TGGATTTGCACATTACCATCAGTTTTGCATGGATTTG CACAGAATTCAGTTTTGCATGGATTTGCACATTTTTT GAATT-3′). [score:2]
However, at days 5, 6 and 7, the OD values of the miR-19b-knockdown cells were significantly lower than those of the control cells. [score:2]
Previous studies indicate that endogenous miR-19b may have a key regulatory role in constraining the production of pro-inflammatory cytokines and chemokines by fibroblast-like synoviocytes and hence contribute to the pathology of inflammation (33). [score:2]
Binding experiments with Annexin V-FITC indicated that miR-19b knockdown reduced the number of apoptotic cells in response to serum deprivation (Fig. 3A; P<0.05). [score:2]
However, the molecular mechanisms that mediate the balance between proliferation and apoptosis in response to miR-19b knockdown or overexpression require further investigation. [score:2]
As expected, miR-19b knockdown significantly rescued the luciferase activity of the pGL3-wnt-3′-UTR reporter but not the mutated construct (mu-pGL3-Wnt-′3-UTR) (Fig. 1B and C; P<0.01). [score:2]
MiR-19b is also a novel regulator of fibrotic TGF-β signaling and the loss of miR-19b following hepatic stellate cell (HSC) activation perpetuates the fibrotic response (34). [score:2]
Effects of miR-19b knockdown on intracellular ROS levels. [score:2]
MiR-19b knockdown has no clear effect on the morphology of P19 cells during differentiation. [score:1]
MicroRNA-19b (miR-19b) is part of the miR-17–92 cluster, which encodes miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a-1. The miR-17–92 cluster is required to induce cardiomyocyte proliferation in postnatal and adult hearts (4). [score:1]
As P19 cells can differentiate into cardiomyocytes, the present study investigated the underlying mechanisms of heart development by analyzing the proliferation, apoptosis and differentiation of P19 miR-19b-knockdown cells. [score:1]
A previous study has observed specific changes in miRNA abundance and activity in a broad range of human aging mo dels and suggested the use of miR-17, miR-19b, miR-20a and miR-106 as novel biomarkers of cellular aging (6). [score:1]
Thus, a reduced growth rate of the miR-19b-knockdown cells was observed compared with that observed in the control cells (Fig. 2A; P<0.05 and P<0.01). [score:1]
The results of the current study revealed that the total cellular production levels of ATP were increased in the miR-19b knockdown cells compared with those in the control cells (Fig. 5; P<0.01). [score:1]
Additionally, the caspase-3 activity assay (Fig. 3B; P<0.01) revealed that miR-19b knockdown reduced the number of apoptotic cells in response to serum deprivation. [score:1]
This study of miR-19b provides insight into novel therapeutic strategies for CHD. [score:1]
qPCR revealed that the mtDNA copy number was significantly higher in the miR-19b knockdown group compared with that in the vector group (Fig. 4; P<0.05). [score:1]
Furthermore, the results of the present study demonstrate that miR-19b does affect the Wnt/β-catenin signaling pathway. [score:1]
of the cell cycle distribution detected a significantly lower percentage of miR-19b-knockdown P19 cells in the S phase of the cell cycle compared with that of the control cells (Fig. 2B; P<0.01). [score:1]
MiR-19b knockdown reduces the levels of apoptosis in P19 cells. [score:1]
[1 to 20 of 59 sentences]
6
[+] score: 129
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-17, mmu-mir-19a
Compared with the saline group, miR-19b expression was downregulated, and TSLP and Stat3 were upregulated in the OVA-sensitized group (all P<0.05; Figure 3A). [score:8]
Figure 10Statistical analyses of: miR-19b expression (A); TSLP expression (B); Stat3 expression (C) Experiments were repeated three times for each group, with 12 mice in the saline and the OVA-sensitized groups and 8 in other groups. [score:7]
Statistical analyses of: miR-19b expression (A); TSLP expression (B); Stat3 expression (C) Experiments were repeated three times for each group, with 12 mice in the saline and the OVA-sensitized groups and 8 in other groups. [score:7]
TSLP and Stat3 mRNA levels were downregulated in the saline + anti-TSLP and saline + miR-19b mimics groups, and upregulated in the OVA-sensitized groups as compared to the saline group (all P<0.05). [score:6]
miR-19b mRNA was upregulated in the saline + miR-19b mimics group as compared to the saline and saline + anti-TSLP groups, and was upregulated in the OVA-sensitized group (all P<0.05; Figure 10). [score:6]
Initially, compared with the saline group, miR-19b was downregulated, and both TSLP and Stat3 were upregulated in the OVA-sensitized group. [score:6]
This suggests that miR-19b specifically binds the TSLP-3’-UTR region and downregulates TSLP expression at the post-transcriptional level. [score:6]
Pearson correlation analysis showed that miR-19b expression was negatively correlated with that of both TSLP (r=-0.430, P=0.036) and Stat3 (r=-0.658, P<0.001), while TSLP expression was positively correlated with that of Stat3 (r=0.490, P=0.015; Figure 3B–3D). [score:5]
This study explored the effects of TSLP downregulation via miR-19b on airway remo deling, airway inflammation, and oxidative stress in OVA-sensitized mice. [score:4]
org website was used to verify whether TSLP was a direct target of miR-19b. [score:4]
It appears that miR-19b inhibits production of a variety of cytokines via negative regulation of TSLP. [score:4]
to verify TSLP as a target gene of miR-19b. [score:3]
miR-19b, TSLP and Stat3 expression in the saline and OVA-sensitized groups (A) The experiment was repeated three times for each group. [score:3]
miR-19b targets TSLP. [score:3]
miR-19b targets TSLPThe microRNA. [score:3]
miR-19b, TSLP and Stat3 expression and correlational analysis. [score:3]
miR-19b, TSLP, and Stat3 expression in mouse airway tissues. [score:3]
miR-19b mRNA was upregulated in the OVA-sensitized + miR-19b mimics group as compared with the OVA-sensitized group (P<0.05), while no difference was observed among the OVA-sensitized + mimics scramble, OVA-sensitized + anti-TSLP, and OVA-sensitized + lgG2a groups (all P>0.05). [score:3]
miR-19b expression was negatively correlated with that of TSLP and Stat3. [score:3]
Pearson correlation analysis results showed that miR-19b expression is negatively correlated with that of Stat3, although potential interaction mechanisms are still unclear. [score:3]
Our results indicated that miR-19b reduces airway remo deling, airway inflammation, and degree of oxidative stress in OVA-sensitized mice by inhibiting the Stat3 signaling pathway through TSLP. [score:3]
miR-19b, TSLP, and Stat3 expression in mice. [score:3]
org website predicted that miR-19b targets TSLP (Figure 2A), and we verified these findings via dual luciferase reporter gene assay (Figure 2B). [score:2]
miR-19b negatively regulates TSLP by binding the TSLP upstream, non-coding region [13]. [score:2]
Compared with the NC group, TSLP-WT 3'UTR luciferase activity was inhibited in the miR-19b mimics group (P<0.05), while TSLP-MUT 3'UTR luciferase activity was not (P>0.05). [score:2]
These symptoms were slightly improved in the OVA-sensitized + miR-19b mimics and OVA-sensitized + anti-TSLP groups, and were similar to those in the saline + miR-19b mimics and saline + anti-TSLP groups (Figure 5). [score:1]
This 3’UTR was also used to computationally predict miR-19b binding sites. [score:1]
Our study was designed to explore the effects of miR-19b on airway remo deling, airway inflammation, and degree of oxidative stress in OVA-sensitized mice. [score:1]
The 72 mice were randomly distributed into: a saline group (n=12), OVA-sensitized group (n=12), saline + miR-19b mimics group (n=8), saline + anti-TSLP group (n=8), OVA-sensitized + miR-19b mimics group (n=8), OVA-sensitized + mimics scramble group (n=8), OVA-sensitized + anti-TSLP group (n=8), and OVA-sensitized + IgG2a group (n=8). [score:1]
HE staining (Figure 4) showed clear pulmonary alveoli and alveolar walls, smooth bronchial walls, complete airway epithelium, no secretion in lung tissues, air flue or lung cavities, and no obvious hydroncus or inflammatory cell infiltration in the saline, saline + miR-19b mimics, and saline + anti-TSLP groups. [score:1]
miR-19b mimics and NC were transfected into HEK-293T cells with wild-type (WT) and mutant (MUT) luciferase reporter vectors, respectively. [score:1]
No differences were observed among the OVA, OVA-sensitized + mimics scramble, and OVA-sensitized + IgG2a groups, or between the saline + miR-19b mimics and saline + anti-TSLP groups (P>0.05) (Table 2, Figure 7). [score:1]
U6 was used as an internal reference for miR-19b, and β-actin was employed for other assessed genes. [score:1]
No difference was observed among the saline, saline + miR-19b mimics, and saline + anti-TSLP groups (all P>0.05; Table 1). [score:1]
No difference was observed in MDA level or SOD activity among the saline, saline + miR-19b mimics, and saline + anti-TSLP groups (all P>0.05; Figure 9). [score:1]
Mild inflammatory cell infiltration around small airways and in the alveolar septum, no obvious differences in the tracheole wall, no visible intracavity secretions, and decreased airway inflammatory reactions were observed in the OVA-sensitized + miR-19b mimics and OVA-sensitized + anti-TSLP groups. [score:1]
Simpson, et al. reported that miRNA-19 (miR-19), the primary component of the miR-17~92 cluster, accelerates Th2 cytokine production and simultaneously amplifies the JAK-STAT signaling pathway, which drives pathogenic inflammation in asthma [9]. [score:1]
Figure 5Groups: saline (A); OVA-sensitized (B); saline + miR-19b mimics (C); OVA-sensitized + miR-19b mimics (D); OVA-sensitized + mimics scramble (E); saline + anti-TSLP (F); OVA + anti-TSLP (G); OVA-sensitized + IgG2a (H) Experiments were repeated three times for each group, with 12 mice in the saline and the OVA-sensitized groups and 8 in other groups. [score:1]
No difference was observed between the OVA-sensitized + miR-19b mimics and OVA-sensitized + anti-TSLP groups (all P>0.05), or between the OVA, OVA-sensitized + mimics scramble, and OVA-sensitized + IgG2a groups (all P>0.05). [score:1]
OVA, OVA-sensitized + mimics scramble and OVA-sensitized + IgG2a groups scored higher than the OVA-sensitized + miR-19b mimics and OVA-sensitized + anti-TSLP groups (all P<0.05). [score:1]
The airway mucosa and mucus secretion levels were approximately the same, and there were no obvious abnormalities in the saline, saline + miR-19b mimics, and saline + anti-TSLP groups. [score:1]
Rare inflammatory cells in the peripheral bronchus were seen in the saline, saline + miR-19b mimics, and saline + anti-TSLP groups. [score:1]
Figure 6Groups: saline (A); OVA-sensitized (B); saline + miR-19b mimics (C); OVA-sensitized + miR-19b mimics (D); OVA-sensitized + mimics scramble (E); saline + anti-TSLP (F); OVA + anti-TSLP (G); OVA-sensitized + IgG2a (H) PAS scores (I) Experiments were repeated three times for each group, with 12 mice in the saline and the OVA-sensitized groups and 8 in other groups. [score:1]
Mice in the OVA-sensitized + miR-19b mimics group and the OVA-sensitized + mimics scramble group were administered with 40 ul of 20 ug miR-19b mimic (5′-UGUGCAAAUCCAUGCAAAACUGA-3′) or miR-19b scramble (5′-UUCUCCGAACGUGUCACGUTT-3′) (Sangon Biotech Co. [score:1]
Increased SOD activity and decreased MDA levels were observed in the OVA-sensitized + miR-19b mimics and OVA-sensitized + anti-TSLP groups as comparison to the OVA-sensitized group (all P<0.05). [score:1]
Further investigation of the precise activities of miR-19b -targeted genes in chronic asthma -associated lung remo deling and inflammation is still needed. [score:1]
Obvious goblet cell hyperplasia and airway mucus secretions were observed in the airway mucosa of mice in the OVA, OVA-sensitized + mimics scramble, and OVA-sensitized + IgG2a groups, and to a lesser degree in the OVA-sensitized + miR-19b mimics and OVA-sensitized + anti-TSLP groups (P<0.05; Figure 6A–6H). [score:1]
Correlations between miR-19b and TSLP (B), miR-19b and Stat3 (C), and TSLP and Stat3 levels (D) in the saline and OVA-sensitized groups. [score:1]
PAS staining showed goblet cell hyperplasia in the airway mucosa of mice in the saline, saline + miR-19b mimics, and saline + anti-TSLP groups. [score:1]
Groups: saline (A); OVA-sensitized (B); saline + miR-19b mimics (C); OVA-sensitized + miR-19b mimics (D); OVA-sensitized + mimics scramble (E); saline + anti-TSLP (F); OVA + anti-TSLP (G); OVA-sensitized + IgG2a (H) PAS scores (I) Experiments were repeated three times for each group, with 12 mice in the saline and the OVA-sensitized groups and 8 in other groups. [score:1]
These effects of OVA sensitization were reversed in the OVA-sensitized + miR-19b mimics and OVA-sensitized + anti-TSLP groups. [score:1]
Groups: saline (A); OVA-sensitized (B); saline + miR-19b mimics (C); OVA-sensitized + miR-19b mimics (D); OVA-sensitized + mimics scramble (E); saline + anti-TSLP (F); OVA + anti-TSLP (G); OVA-sensitized + IgG2a (H) Experiments were repeated three times for each group, with 12 mice in the saline and the OVA-sensitized groups and 8 in other groups. [score:1]
[1 to 20 of 52 sentences]
7
[+] score: 119
In line with reduced expression levels in failing hearts of old mice, decreased miR-18a, miR-19a, and miR-19b expression was associated with severe heart failure at old age (Fig. 3A), while miRNA expression in old patients with a preserved function was not different from young ICM patients (Fig. 3A). [score:7]
In contrast, collagen 1A1 and 3A1 transcription was not affected by either miR-18a and miR-19b overexpression or inhibition in neonatal rat cardiomyocytes and cardiac fibroblasts (NRCFs), indicating that collagen expression in cardiac fibroblasts is unrelated to these miRNAs (Fig. 6B). [score:7]
For the overexpression or inhibition of miR-18a and miR-19b, NRCMs and NRCFs were transfected with 80 nm miRIDIAN hairpin inhibitor (antagomiR) miR-18a (#IH-300487-06) or miR-19b (#IH-300489-05), or with miRIDIAN mimic miR-18a (#C-300487-05), or miR-19b (#C-300489-03) (Dharmacon, Colorado, CO, USA). [score:7]
Together, these data suggest that regulation of CTGF and TSP-1 is the result of the shared expression of miR-18a, miR-19a, and miR19b, enabling modest changes in miRNA expression to control transcriptional repression. [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
In cardiac fibroblasts, overexpression of miR-18a and miR-19b also decreased CTGF and TSP-1 transcription; however, inhibition of these miRNAs was not sufficient to increase CTGF and TSP-1. This may be attributed to the fact that a fibroblast produces large amounts of CTGF and TSP-1 while it contains relatively low amounts of miR-18a and miR-19b. [score:5]
Overexpression of miR-18a and miR-19b, using miRNA mimics, resulted in significant repression of CTGF and TSP-1 mRNA and protein expression in cardiomyocytes (Fig. 5F and G; Supporting information Fig. S3A). [score:5]
In conclusion, our study is the first to show that miRNA expression of the miR-17–92 cluster changes with cardiac aging and associates decreased miR-18a, miR-19a, and miR-19b expression with age-related remo deling in the heart. [score:5]
Here, miRNA mimics of miR-18a and miR-19b blunted the expression of CTGF and TSP-1, and vice versa, inhibition of these miRNAs enhanced CTGF and TSP-1 levels. [score:5]
Indeed, overexpression of miR18a and miR-19b in cardiomyocytes repressed collagen 1A1 and 3A1 mRNA levels, while inhibition of these miRNAs using antagomirs significantly enhanced collagen transcription (Fig. 6A). [score:5]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
These results imply that the age-related regulation of CTGF and TSP-1 expression by miR-18a and miR-19b in the heart is uniquely restricted to the cardiomyocyte to control its surrounding ECM. [score:4]
Fig. 5MiR-18a and miR-19b regulate CTGF and TSP-1 expression in cardiomyocytes. [score:4]
Our in vitro results support a role for miR-18a, miR-19a, and miR-19b in regulating CTGF and TSP-1 expression in the aged cardiomyocyte. [score:4]
MiR-18a and miR-19b are abundantly expressed in the adult mouse heart and are predominantly localized in the perinuclear area of cardiomyocytes (Fig. 5A–C). [score:3]
Importantly, the abundant expression of miR-18a and miR-19b in cardiomyocytes coincides with low levels of CTGF and TSP-1, whereas in cardiac fibroblasts, relatively low levels of miR-18a and miR-19b were associated with high CTGF and TSP-1 transcription (Fig. 5E). [score:3]
These findings confirm the expression profiles in aged HF-prone mice and again suggest that miR-18a, miR-19a, and miR-19b could transcriptionally repress CTGF and TSP-1 levels in cardiomyocyte aging and HF at old age. [score:3]
This, together with miR-18 and miR-19 targeting CTGF and TSP-1 and the fact that ECM proteins are crucial for healthy cardiac aging, has led us to hypothesize that these miRNAs play a role in age-related cardiac remo deling. [score:3]
Therefore, we investigated whether age-related changes in miR-18a, miR-19a, and miR-19b expression regulate CTGF, TSP-1, and collagen levels in rodent mo dels of aging -associated heart failure and in the human failing heart. [score:2]
Fig. S3 CTGF and TSP-1 transcripts are regulated by miR-18a and miR-19b in cardiomyocytes. [score:2]
Next, we performed a series of functional studies to determine the role of miR-18a and miR-19b in the regulation of CTGF and TSP-1 and collagen production in cardiomyocytes and cardiac fibroblasts. [score:2]
These results show that regulation of CTGF and TSP-1 by miR-18a and miR-19b is uniquely restricted to the cardiomyocyte. [score:2]
The three miR-17–92 cluster members miR-18a, miR-19a, and miR-19b specifically target the ECM proteins CTGF and TSP-1. To investigate the role of these genes in human HF, we studied their expression profiles in cardiac biopsies of idiopathic cardiomyopathy (ICM) patients at old age with a moderately decreased or preserved systolic function (ejection fraction (EF) between 40 and 55%) (Paulus et al., 2007) and severely impaired cardiac function (EF < 30%) and compared them to young ICM subjects. [score:2]
This was corroborated by the finding that miR-18a and miR-19b expression was higher in cardiomyocytes compared to cardiac fibroblasts (Fig. 5D). [score:2]
RT-PCR analysis of miR-18a, miR-19a, miR-19b, CTGF, and TSP-1 transcript levels in myocardial biopsies from idiopathic cardiomyopathy (ICM) patients at older age with normal (n = 5) and severely impaired (n = 9) cardiac function. [score:1]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
CTGF, TSP-1, miR-18a, miR-19a, and miR-19b levels in aged HF-resistant (12 weeks, n = 8; 52 weeks, n = 8; and 104 weeks, n = 9) and HF-prone mice (12 weeks, n = 6; 52 weeks, n = 11; and 104 weeks, n = 9). [score:1]
Importantly, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs. [score:1]
RT-PCR analysis for the induction collagen 1A1 (COL1A1) and collagen 3A1 (COL3A1) in cultured neonatal rat cardiomyocytes and cardiac fibroblasts after manipulation with miR-18a and miR-19b mimics and antagomirs. [score:1]
From the six members of the miR-17–92 cluster, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs in aged cardiomyocytes and hearts of old failure-prone mice. [score:1]
Vice versa, blunting of miR-18a and miR-19b using antagomirs was sufficient to increase CTGF and TSP-1 transcript and protein levels in cardiomyocytes (Fig. 5F, G; Supporting information Fig. S3A). [score:1]
Cardiac fibroblasts demonstrated decreased CTGF and TSP-1 transcript levels upon introduction of miR-18a and miR-19b; however, this did not result in reduced protein levels (Fig. 5H, I). [score:1]
Double DIG-labeled locked nucleic acid (LNA) hybridization probes complementary to mouse mature miR-18a (5DIGN/CTATCTGCACTAGATGCACCTTA/3DIG_N) (#38462-15), miR-19b (5DIGN/TCAGTTTTGCATGGATTTGCACA/3DIG_N) (#38092-15), and a scrambled probe (5DIGN/GTGTAACACGTCTATACGCCCA/3DIG_N) (#99004-15) were purchased from Exiqon (Vedbaek, Denmark). [score:1]
[1 to 20 of 35 sentences]
8
[+] score: 69
Finally, we showed that miR-19b suppression can phenocopy the morphological effects of inhibiting mTOR signaling by over -expressing TSC1 and 2, two proteins known to regulate of mTOR [45]. [score:8]
To confirm that fear conditioning induced miRNAs that regulate mTOR signaling, we reduced the level of mature miR-19b expression in hippocampal neurons using a complementary sequence -based modified oligonucleotide inhibitor (locked nucleic acid, LNA) of miR-19b. [score:6]
Therefore, their induction should lead to increases in mTOR signaling activity and, in fact, when one of them (miR-19b) was suppressed, its known target PTEN was increased and mTOR activity decreased. [score:5]
We confirmed that we could reduce expression of miR-19b to less than 0.1%, and inhibition lasted more than 4 days in culture (Figure 8B). [score:5]
For example, miR-106b, miR-21, miR- 22, miR-19b and miR-25 are known to regulate PTEN and miR-27 and miR-139 repress FoxO1 translation through direct binding to the 3′-UTR [31], [32], [33], [34], [35], [36], [37], [38]. [score:5]
Among the up-regulated miRNAs, miR-106b, miR-25 and miR-19b share the same primary transcripts, and miR-24 and miR-27 share primary transcripts. [score:4]
Reducing miR-19b expression increased level of PTEN protein as reported previously [37] and down regulated phosphorylation of the S6 ribosomal subunit, which is thought to reflect mTORC1 activity (Figure 8A and C). [score:4]
In contrast, reducing miR-19b expression did not change the phosphorylation of PKCa, which reflects mTORC2 activity (Figure 8C). [score:3]
Inhibition of miR-19b didn’t change phospho-PKCa/PKCa ratio, representing mTORC2 activity. [score:3]
Suppression of miR-19b also reduced neurite outgrowth in DIV5 hippocampal neurons consistent with decreased mTOR activity. [score:3]
Inhibition of miR-19b reduced phospho-S6/S6 ratio representing mTORC1 activity. [score:3]
0024682.g008 Figure 8 Cultured hippocampal neurons were transiently transfected with either complementary sequence based locked nucleic acid inhibitors of miR-19b or a scrambled control in DIV1 (50 nM). [score:3]
Cultured hippocampal neurons were transiently transfected with either complementary sequence based locked nucleic acid inhibitors of miR-19b or a scrambled control in DIV1 (50 nM). [score:3]
We transiently transfected LNA inhibitors to DIV1 neurons and inhibition of miR-19b was measured using real time PCR. [score:3]
Rat hippocampal neurons at DIV5 have extended a set of neuritis; however, miR-19b was knocked down, early neurite outgrowth was significantly impaired (Figure 8D). [score:2]
Longest and total neurite lengths were reduced in miR-19b knock down neurons. [score:2]
miR-19b regulates mTORC1 activity in neurons. [score:2]
About 30% of protein is increased in miR-19b knock down neurons. [score:2]
We measured inhibition of miR-19b using real time PCR. [score:1]
miR-19b changes mTOR activity in hippocampal neurons. [score:1]
PTEN (#9559, 1∶500 dilution, Cell Signaling), Phospho-S6 (#2211, 1∶1000 dilution, Cell Signaling), S6 (#2317, 1∶1000 dilution, Cell Signaling), phospho-PKCa (06-822, 1∶1000 dilution, Millipore), PKCa (#2056, 1∶1000 dilution, Cell Signaling) antibodies were used to measure miR-19b target and mTOR activity. [score:1]
[1 to 20 of 21 sentences]
9
[+] score: 69
We first confirmed miR-19 antagomir activity using a β-galactosidase (β-Gal) reporter containing multiple miR-19 binding sites within the 3′UTR that allow translational suppression in the presence of miR-19. [score:5]
Based on the partial residual expression of the miR-17 and miR-92 families (Figure 7B, 7C), and the generally very low expression of the miR-18 family (Figure 7D, note y axis units), we hypothesized that loss of the miR-19 family was responsible for the defective invasion of 17KPC cell lines. [score:5]
TIMP2, CST3, and TGM2 are all predicted targets of miR-19 that are also suppressors of invasion [37, 39, 62, 63] and could potentially explain the reduced invasiveness of 17KPC cell lines. [score:5]
In contrast, miR-19 family miRNAs can only be expressed from the mir-17~92 and mir-106a~363 clusters, and 17KPC lines were found to completely lack expression of this miRNA family (Figure 7E). [score:5]
In addition, expression profiling and proteomic studies will be required to identify the mechanisms through which miR-19 miRNAs regulate invadopodia formation and function. [score:4]
To validate that miR-19 family miRNAs play an important role in invasion, we utilized antagomirs–short oligonucleotides that bind and inactivate miRNAs–to specifically knock down miR-19 function in KPC lines with high invasive capacity and varying levels of miR-19 expression [56]. [score:4]
miR-19 family expression is absent in 17KPC cell lines. [score:3]
Invadopodia rosette formation (G) and FITC-gelatin degradation (H) in the KPC cell lines 9910#1 and 9248#1 treated with control or miR-19 -targeting antagomirs. [score:3]
The human pancreatic cancer cell lines MIA Paca-2 and PANC-1 are also invasive and express relatively high levels of miR-19 (Figure 8F). [score:3]
Figure 8(A) Transwell invasion through Matrigel of KPC cell lines treated with control or miR-19 -targeting antagomirs at the indicated concentrations. [score:3]
Indeed, the cell line with the highest expression of miR-19, 9415#2, was resistant to antagomirs at a concentration of 50 nM, but responded when treated with antagomirs at 100 nM (Figure 8A, 8C). [score:3]
PDAC cell line invasion and invadopodia formation is suppressed by miR-19 antagomirs. [score:3]
This response inversely correlated with the level of endogenous miR-19 family expression, suggesting a dosage response (Figure 8C). [score:3]
MiR-19 antagomirs significantly inhibited KPC cell line invasion, but not migration, consistent with an invasion-specific effect for miR-19 family miRNAs (Figure 8A, 8B). [score:3]
These data demonstrate that miR-19 miRNAs regulate PDAC cell invasion. [score:2]
We next ascertained whether miR-19 regulates invasion in human PDAC cells. [score:2]
In addition, we find that mir-17~92 miRNAs, in particular miR-19 family miRNAs, promote PDAC cell invasion by regulating the formation of extracellular matrix-degrading invadopodia rosettes. [score:2]
Furthermore, treatment with miR-19 antagomirs was sufficient to reduce the number of invadopodia rosettes formed in KPC cells (Figure 8G, Supplementary Figure 10) and also decreased the gelatin degradation capacity of these cell lines (Figure 8H, Supplementary Figure 11). [score:1]
Indeed, TGM2 is linked to miR-19 -mediated invasion in colorectal cancer cells [37]. [score:1]
Given that our data point to a major effect of miR-19 on invadopodia formation and/or stability, and since none of the above factors are known to influence invadopodia, these negative findings are perhaps not surprising. [score:1]
Thus, we have identified a novel role for miR-19 in pancreatic cancer cells. [score:1]
In fact, few studies exist that link miR-19 to cancer cell invasion in any tumor type [36, 37]. [score:1]
miR-19 promotes invadopodia formation and the invasiveness of pancreatic cancer cell lines. [score:1]
Pooled antagomirs against miR-19a and miR-19b enhanced reporter activity in a KPC cell line, but not in a 17KPC cell line (Supplementary Figure 9). [score:1]
Using antagomirs against miR-19, we demonstrated that miR-19 family miRNAs are key drivers of invadopodia formation and the invasive capacity of human and murine pancreatic cancer cells. [score:1]
Future studies will be required to validate the significance of miR-19 family miRNAs in the invasive phenotype of PDAC in vivo. [score:1]
Of note, the miR-19 microRNAs have been associated with tumor cell invasion and metastasis in gastric cancer [35], lung cancer [36] and colon cancer [37]. [score:1]
Some miRNAs share sufficient sequence similarity that standard oligonucleotides amplify both species equally (e. g. miR-19a and miR-19b), and therefore not all miRNAs are individually plotted. [score:1]
[1 to 20 of 28 sentences]
10
[+] score: 52
xlsx”): Column 1: predicted target gene list used for GSEA; Column 2: subset list of predicted target genes present on microaarray; Column 3: leading edge subset of genes that were found to be either up or downregulated by comparing −H−D vs +H+D (normalized p value indicated on the top of the column); Column 4: leading edge subset gene list that were found to be either up or downregulated by comparing −H−D vs +H+D (normalized p value indicated on the top of the column); Column 5: intersection between leading edge gene lists in columns 3 and 4. Lists of leading edge common targets for miR-17 and miR-20 (intersection of the four gene lists in columns 3 and 4 on sheets miR-17 and miR-20), miR-19a and miR19b (intersection of the four gene lists in columns 3 and 4 on sheets miR-19a and miR-19b) as well as for miR-451 (intersection of gene lists in columns 3 and 4 in sheet miR-451) that have been used to generate the histograms presented in Figure 3B, C and D are given in sheet named «Gene list profile». [score:13]
During this study, we found that several other known miR-17-92 targets such as PTEN (miR-19 and miR-17/20a target) [24], TxNIP/VDUP (miR-17/20a target) [44] E2F1 (miR-17/20a) [45], [46] and P21 (miR-17/20a target) [45], [47] were surprisingly not regulated in response to miR-17-92 expression variations in NN10#5 and 745A#44 cells. [score:12]
This analysis (Figure 3A) revealed that genes belonging to the predicted targets lists of miR-17, miR-20a, miR-19a and miR19b but not to those of miR-18a or miR-92a were significantly over-represented among genes up-regulated in response to HMBA and Dox (resulting in down regulation of miR-17-92 cluster). [score:7]
We also compared mean expression levels of genes in the leading edge subsets of common miR-17/miR-20a, common miR-19a/miR-19b and miR-451 targets identified in response to HMBA in the other two conditions (+Dox only or +HMBA only) which are associated with intermediate pri-miR-17-92 expression levels (Figure 1). [score:6]
In summary, these analyses indicated that miR-17-92 cluster in 745A#44 cells is mainly involved in the down-regulation of predicted targets of miR-17/miR-20a and miR-19a/miR-19b rather than miR-18a or miR-92a. [score:6]
As expected from authentic target genes, variations in the levels of miR-17/miR-20a and of miR-19a/miR-19b targets were inversely correlated with the variations of pri-miR-17-92a levels (compare Figure 3B with pri-miR-17-92a and miRNAs profiles in Figure 1A). [score:5]
Given the very high similarity between miR-17 and miR-20a or miR-19a and miR-19b, this retrospective analysis was performed on the intersection of the leading edge subset of miR-17 and miR-20a or miR-19a and miR-19b, respectively. [score:1]
Identification of miR-17/miR-20a and miR-19a/miR-19b signatures in the transcriptome of 745A#44 cells displaying decreased levels of miR-17-92 cluster. [score:1]
Figure S4 Comparison of miR-17, miR18, miR-19a, miR19b and miR92 levels between NN10#5, 745A#44 and K16 erythroleukemic cells. [score:1]
[1 to 20 of 9 sentences]
11
[+] score: 51
A miRNA array analysis revealed that among the miRNAs that are downregulated during osteoblastic differentiation, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a seemed most likely to target the osteogenesis-related transcription factors Dlx5 and Msx2, acting as potential inhibitors of osteogenesis by directly targeting these osteogenesis-related transcription factors. [score:11]
In our preliminary experiment, transfection of anti-miR-124a and anti-miR-181a did not induce osteoblastic differentiation in mouse iPS cells (data not shown), suggesting that suppression of miR-124a and miR181a, which directly target Dlx5 and Msx2, is not sufficient to induce osteoblastic differentiation of mouse iPS cells, but that suppression of at least one miRNA of miR-10a, miR-10b, miR-9-3p and miR-19b besides miR-124a and miR-181a is required for osteoblastic differentiation. [score:8]
We focused on the 6 miRNAs, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a that were significantly downregulated during BMP-4 -induced osteoblastic differentiation, and they seemed to target the transcription factors Dlx5 and Msx2 and to be associated with osteoblast differentiation (Table 3). [score:6]
A miRNA array analysis revealed that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a were significantly downregulated. [score:4]
It is interesting that both miR-9-3p and miR-19b putatively target Id4, since Id4 has been reported to act as molecular switch promoting osteoblast differentiation [38]. [score:3]
The protocol shown in Fig. 5A was used to induce osteoblastic differentiation with 6 anti-miRNAs (anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-9-3p, and anti-miR-19b) targeting Msx2 or Dlx5 in iPS cells. [score:3]
Six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a putatively targeted Dlx5 and Msx2 mRNA (Table 3). [score:3]
0043800.g003 Figure 3 (A) Time course of miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a expression in differentiated iPS cells. [score:3]
Considering the putative target genes in Table 3, miR-10a, miR-10b, miR-19b and miR-9-3p may constitute a control mechanism for Dlx5 and Msx2. [score:3]
In the present study, we demonstrate that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a miRNAs, especially miR-124a and miR-181a, are important regulatory factors in osteoblastic differentiation of mouse iPS cells. [score:2]
Furthermore, miR-9-3p and miR-19b may affect JAK/STAT and MAPK pathways and MAPK and Wnt pathways, respectively. [score:1]
What are functions of these 6 miRNAs including miR-124a, miR-181a, miR-10a, miR-10b, miR-9-3p, and miR-19b in osteoblastic differentiation of mouse iPS cells? [score:1]
For functional studies examining the effects of the anti-miRNAs on cell differentiation, the mouse iPS cells were transfected on day 1 and day 8 after EB formation with anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p for 72 h, followed by culture in GMEM without osteogenic factor. [score:1]
0043800.g005 Figure 5(A) Schematic representation of the osteoblast differentiation protocol for iPS cells which were transfected with 6 anti-miRNAs including anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p. [score:1]
Although it has been reported that a number of miRNAs, miR-204/211 [13], miR-125b [14], miR-133 and miR-135 [15], miR-141 and miR-200a [16], and miR-29b [17], were involved in osteoblastic differentiation, a few papers have been reported with regard to the functions of miR-10a, miR-10b, miR-9-3p and miR-19b. [score:1]
[1 to 20 of 15 sentences]
12
[+] score: 47
Based on the experiments using specific miR inhibitors, the mechanisms of the effects of miR-18a-5p, miR-19a-3p, and miR-19b-3p on the up-regulation of activated STAT3 might be the suppression of genes for regulatory proteins of STAT3 such as protein inhibitor of activated STAT3 (PIAS3) and suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) [29– 32]. [score:13]
Interestingly, miRNA inhibitors targeted to miR-18a-5p, miR-19a-3p, and miR-19b-3p down-regulated the expression of BCL2, BCL2L1, BIRC5, and MMP9, target genes of STAT3, which implied the positive feedback loop of STAT3/miR-17-92 clusters (Fig. 7B-E). [score:12]
In particular, inhibition of miR-18a-5p, miR-19a-3p, and miR-19b-3p resulted in differential up-regulation of mRNA expressioin of PIAS3, SOCS1, and SOCS3, coding genes for regulatory proteins of STAT3 such as (Supplemental Fig. 6–8). [score:9]
In order to figure out feedback effects of miR-17-92 clusters on STAT3 activation, we evaluated the expression of target genes of STAT3 which demonstrated higher expression in Y79 cells than other retinal constituent cells: BCL2, BCL2L1, BIRC5, and MMP9 according to the treatment with specific miRNA inhibitors to components of miR-17-92 clusters: miR-18a-5p, miR-19a-3p, and miR-19b-3p. [score:7]
Interestingly, the inhibition of miR-18a-5p, miR-19-3p, and miR-19b-3p induced the decrease in the proportion of pSTAT3 -positive retinoblastoma cells. [score:3]
org demonstrated that sequences from 998 through 1020 in the 3′ UTR region of CCND1 are targets for miR-17 and miR-20a, those from 1770 through 1784 are those for miR-19a, and those from 1777 through 1782 are those for miR-19b. [score:3]
[1 to 20 of 6 sentences]
13
[+] score: 46
It is conceivable that these miRNAs act both in a MYCN negative regulatory feed-back loop as well as via repression of important neuroblastoma tumor suppressor genes: indeed, miR-19a-3p targets ESR1 [32], a ligand-inducible transcription factor implicated in neuronal differentiation, whereas miR-19b-3p represses DKK3 expression [33], a marker of tumor differentiation with elevated expression levels in favorable tumors. [score:10]
Interestingly, of the 5 MYCN -targeting miRNAs with positive correlation to MYCN expression or activity, 3 miRNAs, miR-19a-3p, miR-19b-3p and miR-494-3p, showed significantly increased expression during tumor development (Fig. 4B), further supporting the hypothesis that MYCN induces the expression of these miRNAs. [score:10]
Of the five MYCN -targeting miRNAs with positive correlation to MYCN expression or activity (Fig. 2A), three miRNAs, miR-19b-3p, miR-19a-3p and miR-34c-5p, showed induction of expression (Fig. 5), supporting the assumption that MYCN induces the expression of these miRNAs. [score:9]
Considering the 5 MYCN -induced miRNAs, the data in the LSL- MYCN;Dbh-iCre tumors again fully recapitulated the findings from the TH-MYCN progression mo del: miR-19a-3p, miR-19b-3p and miR-494-3p showed increased expression in tumors compared to wild-type control tissue (Fig. 4D), whereas miR-34c-5p and miR-449a are respectively significantly downregulated and not regulated in LSL- MYCN;Dbh-iCre tumors. [score:6]
Indeed, miR-19a-3p and miR-19b-3p, members of the oncogenic miR-17-92 cluster, have been shown to be direct transcriptional targets of MYCN in neuroblastoma cells [5, 24], and the region upstream to miR-494-3p contains E-box sequences (data not shown), suggesting that MYCN can induce its expression. [score:6]
Subsequent analysis of these miRNAs in in vivo MYCN mo del systems showed that activation of MYCN is associated to increased expression of miR-19a-3p, miR-19b-3p and miR-494-3p. [score:3]
Two of these miRNAs, miR-19a-3p and miR-19b-3p, are part of the oncogenic miR-17-92 cluster and were already known to be directly induced by MYCN in neuroblastoma cells [10]. [score:2]
[1 to 20 of 7 sentences]
14
[+] score: 36
Taking into account these previous studies about miR-19b and miR-181b as biomarkers in cardiac disease, we suggest the validation of their utilization as biomarkers for diabetic cardiomyopathy in a specific group of patients diagnosed with asymptomatic diabetes (related to obesity) without pre-existing coronary arterial disease in the context of primary prevention of cardiovascular disease. [score:7]
Regarding the role of miR-19b in diabetic cardiomyopathy, Costantino and colleagues reported that miR-19b expression is up-regulated in myocardium of diabetic mice induced by streptozotocin administration (type I diabetes mellitus) [36]. [score:6]
We suggest that different sources of metabolic dysregulation may explain the observed differences in miR-19b expression levels between type 1 and type 2 diabetes animal mo dels. [score:4]
On the contrary, we found miR-19b was downregulated in obese mice. [score:4]
We found 8 circulating miRNAs that were less abundant in the obese mice than in normal mice, indicating an association between their gene expression in myocardium: let-7f-5p (FC: 5.4), miR-10a-5p (FC: 2.3), miRNA-19b-3p (FC: 2.5), miR-25-3p (FC: 3.4), miR-140-5p (FC: 4.5), miR-146a-5p (FC: 3.3), miR-181b-5p (FC: 5.2) and miR-499-5p (FC: 2.2). [score:3]
Regarding circulating miRNAs as potential biomarkers of diabetic cardiomyopathy, we found an association between differential miRNA expressions in myocardium and plasma at 16 months in 8 miRNAs (let-7f-5p, miR-10a-5p, miR-19b-3p, miR-25-3p, miR-140-5p, miR-146a-5p, miR-181b-5p, miR-499-5p). [score:3]
At 16 months, all 15 miRNAs were significantly downregulated in heart tissue of obese mice compared to heart tissue of normal mice: let-7f-5p (FC: 3.3), miR-10a-5p (FC: 2.6), miRNA-19b-3p (FC: 5.0), miR-25-3p (FC: 2.6), miR30e-5p (FC: 5.6), miR-140-5p (FC: 5.0), miR-155-5p (FC: 1.7), miR-146a-5p (FC: 4.0), miR-181b-5p (3.0), miR-199a-3p (FC: 3.6), miR-322 (FC: 1.5), miR-451 (FC: 1.9), miR-499-5p (FC: 5.4), miR-669m-5p (FC: 1.7) and miR-3473b (FC: 3.4). [score:3]
In addition, Karakas and colleagues showed that miR-19b could be a useful tool to predict cardiovascular mortality in patients diagnosed with stable angina pectoris or acute coronary syndrome in a prognostic study with a median follow-up of 4 years [53]. [score:1]
In conclusion, we propose miR-19b and miR-181b as potential biomarkers for diabetic cardiomyopathy, with eventual application in clinical diagnosis to prevent metabolic and functional alteration in hearts of asymptomatic diabetic patients. [score:1]
Fang and colleagues demonstrated that 16 miRNAs, including miR-19b serve as potential biomarkers for diffuse myocardial fibrosis in patients with hypertrophic cardiomyopathy with aortic stenosis and heart 51, 52. [score:1]
Based on previous pre-clinic studies, the miRNAs validated by RT-qPCR in our study are involved in alteration of glucose and lipid metabolism via insulin pathways (let-7f-5p, miR-10a-5p, miR-322) 20– 22, in cardiomyocytes apoptosis (miR-19b-3p, miR-25-3p, miR-30e-5p, miR-140-5p, miR-199a-3p, miR-499) 23– 28, in mitochondrial function (miR-181a/b) [29], in pro-inflammatory signalling (miR-146a-5p, miR-155, miR-181b-3p, miR-3473b) 30– 33, and in cardiac hypertrophy (miR-451) [34] and myocardial fibrosis process (miR-19b) 35, 36. [score:1]
Supplementary materials miR-19b and miR-181b gene targerts miRNA Microarray Raw data We thank Dr. [score:1]
At 12 months we observed a reduction of their abundance in 4 circulating miRNAs: miR-25-3p (FC: 1.5), let-7f-5p (FC: 5.2), miR-181b-5p (FC: 2.0) and miR-19b-3p (FC: 3.4); plasmatic levels were reduced in obese mice during the dietary treatment (Fig.   6). [score:1]
[1 to 20 of 13 sentences]
15
[+] score: 29
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-18a
The inverse correlation observed between miR-18a and miR-19b levels with antithrombin mRNA, one potential target of these miRNAs, suggests that certain miRNAs may be involved in the regulation of selected hepatic haemostatic proteins during development by targeting mRNA coding for these proteins and be in part responsible of the observed decay in neonates [12]. [score:7]
We point out that miR-18a and miR-19b are also expressed in human liver where their expression pattern during development is similar to that observed in our study [16]. [score:6]
We were particularly interested to deepen in two miRNAs: miR-18a and miR-19b which are overexpressed 5.4 and 8.2-fold and both have antithrombin as a potential target. [score:5]
We next move to NIH3T3 cells that do express antithrombin and we performed transfection assays with oligonucleotide precursors and inhibitors (pre-miRs and antagomiRs from Applied Biosystems, Madrid, Spain) of miR-18a and miR-19b to evaluate their effect in the expression of antithrombin. [score:4]
Expression of antithrombin and miRNAs miR-18a and miR-19b during post-natal development in mouse. [score:4]
Finally, we sacrificed 3 mice from different litters, from neonate stage (day +1) to adult stage (day +50) each two days, to perform the quantification of antithrombin mRNA levels and miRNAs miR-18a and miR-19b levels, during post-natal development. [score:2]
Interestingly, when quantifying miR-18a, miR-19b, and antithrombin mRNA during the 19 days after birth, we found an inverse and significant correlation (miR-19b: R = 0.81; p = 0.03; miR-18a: R = 0.91; p<0.001) (Figure 3). [score:1]
[1 to 20 of 7 sentences]
16
[+] score: 25
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-22, mmu-mir-19a
As shown in Fig.   2c and Additional file 6: Figure S3C, miR-19a expression has a higher inverse correlation coefficient (R = -0.8224) with TIA1 expression than miR-19b (R = -0.6425). [score:5]
Among the 10 most upregulated miRNAs (Additional file 3: Table S3), miR-19a and miR-19b (miR-19a/b) were identified as the candidate regulators of TIA1. [score:5]
Above this threshold, we found another 22 significantly upregulated miRNAs, and miR-19b ranked first among these. [score:4]
miR-19b can also regulate TIA1 expression in CRC. [score:4]
miR-19a/b belong to the miR-19 family and only differ by a single nucleotide at position 11, a region minimally important for target recognition [42]. [score:3]
a Quantitative RT-PCR analysis of miR-19 levels in SW480, Caco2 and HT-29 cells. [score:1]
miR-19 level of SW480 was set as control. [score:1]
c Pearson’s correlation scatter plot of the level of miR-19 and TIA1 protein in SW480, Caco2 and HT-29 cells. [score:1]
The miR-19b seed sequence and the seed sequence binding sites in the TIA1 3’-UTR are indicated in red. [score:1]
[1 to 20 of 9 sentences]
17
[+] score: 24
Analysis of global profiles of miRNA expression in skeletal muscle with microarray shows that expression of 4 miRNAs (miR-29a, miR-29b, miR-29c and miR-150) are up-regulated [23], whereas expression of 11 miRNAs (miR-379, miR-127, miR299-5p, miR-434-3p, miR-335, miR130a, miR-19b, miR-451, miR-148a, miR-199a and miR-152) are down-regulated in skeletal muscle of type 2 diabetic rats [23]. [score:13]
For example, it has been shown that expression of 4 miRNAs (miR-29a, miR-29b, miR-29c and miR-150) is up-regulated [23], whereas expression of 11 miRNAs (miR-379, miR-127, miR299-5p, miR-434-3p, miR-335, miR130a, miR-19b, miR-451, miR-148a, miR-199a and miR-152) is down-regulated in skeletal muscle of type 2 diabetic rats [23]. [score:11]
[1 to 20 of 2 sentences]
18
[+] score: 22
For example, we recently identified a network of miR-19 targets converging on the control of inflammation by virtue of regulating the expression of components of the NF-κB signalling pathway (27). [score:6]
Indeed, while miR-19a-3p did not have the predicted highly inhibitory motif, it was able to repress TLR7 sensing independently of miR-19 targeting in miR-19 -deficient cells (Figure 1). [score:5]
To distinguish the direct contribution of miR-19 and -92 in TLR7 sensing from a potential off-target effect of the 2′OMe AMOs used, experiments were replicated in BMMs from miR-17∼92 [flox/ flox] × LysMCre mice—where levels of mature miR-17-5p, miR-19a-3p and miR-92a-3p were decreased by ∼70% (Figure 1B). [score:4]
We have recently reported a positive regulatory role for miR-19 miRNAs (including both miR-19a-3p and miR-19b-3p) in the control of nuclear factor kappa B (NF-κB) signalling in several cell lines (27). [score:2]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
Gantier M. P. Stunden H. J. McCoy C. E. Behlke M. A. Wang D. Kaparakis-Liaskos M. Sarvestani S. T. Yang Y. H. Xu D. Corr S. C. A miR-19 regulon that controls NF-kappaB signalingNucleic Acids Res. [score:1]
In accord with our previous findings (27), we demonstrated that 2′OMe AMO -mediated blocking of miR-19 significantly reduced the production of TNF-α induced by immunostimulatory ssRNA in WT BMMs. [score:1]
However, this effect of the miR-19a-3p 2′OMe was mostly retained in BMMs depleted of miR-19a-3p and miR-19b-3p, indicative of a miRNA-independent effect (Figure 1). [score:1]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
[1 to 20 of 9 sentences]
19
[+] score: 22
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-330
The ability of GT and Q in combination with Doc to upregulate the expression of miR-15a and miR-330 and to balance miR-19b expression may partly contribute to the tumor inhibitory effect of the mixture in the present study. [score:10]
In contrast, miR-19b, a potential oncomiR, was found to be involved in the suppression of the tumor suppressor phosphatase and tensin homologue (PTEN) and promote the proliferation of prostate cancer cells [37]. [score:5]
The increased miR-19b expression under Doc treatment in the present study may suggest a role of miR-19b in development of Doc resistance. [score:4]
A significantly increased expression of the oncogenic miR-19b was observed with LD Doc alone compared to control, however, the level of miR-19b was reduced to the control level when combining LD Doc with GT and Q (Fig.   5). [score:2]
To investigate whether miRNAs are responsive to the combination treatment of GT, Q and Doc, we selected three candidate miRNAs that have been shown to be involved in prostate cancer, including two tumor suppressor miR-15a and miR-330 and an oncomiR miR-19b. [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 19
Our differential RNA-Seq analysis identified miR-19b and miR-29a as the two most abundant deregulated microRNAs in WD mice (Table 1). [score:2]
Indeed, some R1-miR19 displayed a relatively low body weight and a normal glucose regulation, whereas their respective R2-miR19 progeny displayed the full disorder (increased body weight, altered blood glucose levels and insulin tolerance). [score:2]
This phenomenon was made apparent by analysis of the progenies of individual R1-miR19 males crossed with control females, namely the R2-miR19 progenies (Fig. 4e). [score:1]
Induction of obesity by microinjection of the microRNA miR-19b into one-cell embryos. [score:1]
Synthetic microRNA, miR-19b (CUGUGCAAAUCCAUGCAAAACUGAC) and mir-29a (GACUGAUUUCUUUUGGUGUUCAGA)(purchased from Sigma, Saint-Louis, MO, USA) was prepared in filtered microinjection buffer (10 mM Tris, pH 7.4; 0.1 mM EDTA) at a concentration of 4,000,000 molecules/pl. [score:1]
The R1-miR19 fathers and their respective R2-miR19 progenies are indicated by grey-filled or red-filled circles. [score:1]
At 16 weeks of age, two R1-miR19 male were crossed with females to obtain the R2-miR19 progeny. [score:1]
The degree of glucose intolerance and insulin resistance was more variable, as only half of the obese R1-miR19b animals showed impaired glucose tolerance and insulin sensitivity (Fig. 4d,e). [score:1]
Further investigation on the miR-19 mice through the transcriptomic analysis of either early embryo and/or adipose-derived stem cells will provide additional insight into the mechanisms of miR-19 action and will help to identify genes involved in the development of obesity and/or metabolic disorders at the very early stages of development. [score:1]
Indeed, it is interesting to note that some R2-miR19 mice developed the full miR19 phenotypes despite the normal metabolic features of their R1-miR19 progenitors. [score:1]
We have identified miR-19b as one of these molecules, but further assessment of its specific role is complicated by the pleiotropic nature of its activity, spanning from lymphomagenesis 29 to the inflammatory response 30. [score:1]
Injections of miR-19b into one-cell embryos induced obesity and aspects of the diabetic phenotype. [score:1]
Strikingly, males and females born from miR19b-microinjected one-cell embryos (designated R1-miR19) had, in average, body weights greater than the controls (34.17g ± 6.5 vs. [score:1]
This individual variation was also evident in R1-miR19 mice. [score:1]
By quantitative RT-PCR analysis, we confirmed the deregulation of miR-182, miR-19a, miR-19b, miR-29a and miR-340 in testis and sperm RNA of the WD males compared to SD males (Table 1). [score:1]
None of the R1-miR19 mice, however, showed increased values of fasting glucose levels (Fig. 4c), which is at odds with the more complete pathology observed for the WD series, but is similar to the R1-sperm injected progenies and to the previously published reports of metabolic alterations without overt diabetes 10. [score:1]
Theses results suggest that upon RNA injection, epigenetic changes take place which can remain phenotypically silent but are later transmitted to the progeny (R2-miR19 obese males were born from R1-miR19 normal males) (Fig. 4). [score:1]
[1 to 20 of 17 sentences]
21
[+] score: 19
Our results have shown that miR-17 and miR-19 directly inhibit Pparα expression in cystic kidneys, but whether reducing Pparα gene dosage is sufficient to promote cyst growth is not known. [score:6]
miR-17 and miR-19 binding to Pparα 3′-UTR lead to reduced Pparα expression, which in turn affects mitochondrial metabolism in kidney epithelial cells. [score:3]
Similarly, deleting the miR-19 binding site abolished miR-19 -mediated, but not miR-17 -mediated, repression. [score:1]
Luciferase reporter assays revealed that compared with scramble, both miR-17 and miR-19 mimics suppressed wild-type Pparα 3′-UTR. [score:1]
Both miR-17 and miR-19 repressed Pparα 3′-UTR. [score:1]
The seed sequences for the miR-17 and the miR-19 binding sites were mutated in the WT-Pparα 3′-UTR construct to produce the Pparα 3′-UTR (Δ17) and Pparα 3′-UTR (Δ19) constructs. [score:1]
To test whether the binding sites are functional, we co -transfected mIMCD3 cells with a luciferase reporter plasmid containing Pparα 3′-UTR and miR-17, miR-19, or scramble mimics (Fig. 8b). [score:1]
Deleting the miR-17 binding site prevented miR-17 -mediated, but not miR-19 -mediated, repression. [score:1]
mIMCD3 cells were co -transfected with this plasmid and scramble (scr, black), miR-17 mimic (red) or miR-19 mimic (blue) (n=3). [score:1]
Watson-Crick base-pairing between miR-17/ PPARΑ 3′-UTR and miR-19/ PPARΑ 3′-UTR is shown. [score:1]
In the cytoplasm, the mature miRNAs (miR-17 and miR-19) bind to Pparα 3′-UTR. [score:1]
Pparα 3′-UTR harbours an evolutionarily conserved binding site for miR-17 and miR-19 families (Fig. 8a). [score:1]
[1 to 20 of 12 sentences]
22
[+] score: 18
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
In addition, the miR-17-19 cluster, which comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b, and miR-92-1) and promotes cell proliferation in various cancers, has been demonstrated to be significantly upregulated at the clonal expansion stage of adipocyte differentiation. [score:4]
[1 to 20 of 3 sentences]
23
[+] score: 18
The key reasons are as follows: Bim and Stat3 genes harbor miR-20a binding sites, and c-Kit and Socs3 genes harbor miR-19 binding sites, which are conserved across different phyla (ie, human, monkey, mouse, and rat) (Figures 8A, B and S7A, B); Bim is identified as direct targets of miR-17, 43, 44 miR-20a, [44] and miR-92a; [44] Stat3 is identified as direct targets of miR-17 45, 46 and miR-20a; 45, 46 Socs3 is identified as a direct target of miR-19a; [47] and Bim, Stat3, c-Kit, and Socs3 have been demonstrated to be implicated in the process of spermatogenesis. [score:10]
The miR-17-92 cluster and its 6 different mature microRNAs, including miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a, play important roles in embryo development, immune system, kidney and heart development, adipose differentiation, aging, and tumorigenicity. [score:3]
Wu Q Yang Z Wang F MiR-19b/20a/92a regulates the self-renewal and proliferation of gastric cancer stem cells. [score:1]
The 3’-UTRs of Bim and Stat3 mRNA contain complementary site for the seed region of miR-20a (Figure 8A and B), and the 3’-UTRs of c-Kit and Socs3 mRNA contain complementary site for the seed region of miR-19 (data not shown). [score:1]
[4] The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17 and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17-5p and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
Olive V Bennett MJ Walker JC miR-19 is a key oncogenic component of mir-17-92. [score:1]
[1 to 20 of 7 sentences]
24
[+] score: 17
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
There were also non significant trends towards preferential expression of miR-19b and miR-92 in the central memory cells. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
Considering the role of the miR-19~92 cluster in lymphocyte development and proliferation, it is tempting to speculate that its expression may be related to the greater proliferative potential and memory precursor-like capacity, characteristic of central memory cells compared to more differentiated subsets (in particular late effector memory cells). [score:1]
[1 to 20 of 5 sentences]
25
[+] score: 14
miR-19b was up-regulated in hippocampus (p < 0.05) and down-regulated in primary motor cortex and brainstem motor nuclei (p < 0.05 and p < 0.01, respectively) (Figure  2B). [score:7]
We found that miR-19b was down-regulated in motor cortex and the levels of predicted target Sox6 correlated negatively with miR-19b in this brain area. [score:6]
In the present study, we first investigated the expression of miR-9, miR-124a, miR-19a, miR-19b and miR-134 in the whole brain of G93A-SOD1 mice in comparison with that of B6. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 14
Furthermore, miR-19 targeting downregulates the expression of BIM, a proapoptotic gene, that has been described to be expressed under the control of 17~92 cluster in other malignancies [33]. [score:10]
SOCS-1 downregulation induces constitutive STAT3 phosphorylation, which is reversed when MM cell lines are transfected with anti miR-19. [score:4]
[1 to 20 of 2 sentences]
27
[+] score: 13
Surprisingly, miR-133a was upregulated (t [(8)]=2.59, P=0.0320) and miR-19b was downregulated (t [(8)]=2.75, P=0.0250) in the validation study. [score:7]
Bioinformatics analysis identified the key biochemical signaling and cellular plasticity pathways that are targeted by miR-19b, miR-133a and miR-455. [score:3]
Only one gene—trinucleotide repeat-containing gene 6B, Tnrc6b—was the common target of two or more miRNAs (miR-19b and miR-133a). [score:3]
[1 to 20 of 3 sentences]
28
[+] score: 13
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
But the relative expression levels of miR-18a, miR-19a, miR-19b-1, and miR-92a-1 did not show significantly changed after treatment with GEN (Figure 4). [score:3]
In this study, we found that in infertile male subjects, sperm motility was lower in relative higher GEN dose group (Group3) while the relative expression levels of seminal plasma miR-19b-1, miR-20a and miR-92a-1 were higher in corresponding groups. [score:3]
It is interesting that the relative expression levels of miR-19b-1, miR-20a and miR-92a-1 were higher in Group 3 compared to Group 1 (Figure 2, P < 0.05). [score:2]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 13
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Generation of miR-17~92 -expressing lentivirus was previously described (Hong et al., 2010). [score:3]
Importantly, transient transfection of cel-mir-67 did not alter the expression level and size of endogenous miRNAs, including miR-17, miR-18a, miR-19b, miR-92a, and miR-16 (Figure 2B). [score:3]
SNORD29 contains sequence region highly homologous to miR-19b and is detected in both non -transfected and miR-17~92 mix -transfected HeLa cells. [score:1]
HeLa cells were transfected with 100 nM unconjugated cel-mir-67 and analyzed by to detect cel-mir-67 (A) and endogenous miR-17, miR-18a, miR-19b, miR-92a, and miR-16 (B). [score:1]
At this transfection concentration, the cellular levels of miR-17 and miR-19 family miRNAs reached 10-fold of endogenous levels in 30 min post-transfection, peaked around 23-fold at 3–6 h, and started to decline afterwards (Figure 4A). [score:1]
For example, the probe mixture for the miR-17 subfamily contains probes for miR-17, miR-20a, miR-106a, miR-20b, miR-106b, and miR-93, the probe mixture for the miR-18 subfamily contains probes for miR-18a and miR-18b, the probe mixture for the miR-19 subfamily contains probes for miR-19a and miR-19b, and the probe mixture for the miR-92 subfamily contains probes for miR-92, miR-363, and miR-25. [score:1]
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Transfection of miR-17~92-expresing plasmid was previously described (Xiao et al., 2008). [score:1]
Since cel-mir-67 is a C. elegans miRNA that has no homolog in mammalian species, we decided to perform the same experiments using microRNA-17~92 (miR-17~92), a miRNA cluster encoding six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92). [score:1]
miR-17 and miR-20a belong to the miR-17 family, while miR-19a and miR-19b belong to the miR-19 family. [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 13
Moreover, circulating miR-19b levels have been associated with a worse disease progression in patients affected by NSCLC (30). [score:3]
In particular, PDTXs with a Ki67 immunoreactivity >50% showed significantly higher expression of circulating miR-19b and miR-21 levels (p = 0.04 and p = 0.03 by Mann–Whitney U test, respectively; Figure 6C). [score:3]
In particular, circulating miR-19b, -21, and miR-210 levels were directly correlated with PDTXs proliferation. [score:2]
As a member of the miR-17-92 cluster, miR-19b is an oncogenic key factor present in different types of cancer (27, 28). [score:1]
Lastly, to investigate whether our mo del supported the discovery of new biomarkers, we analyzed in SCC tissues or serum the expression of seven miRNAs (miR-19a, miR-19b, miR-20a, miR-21, miR-31, miR-150, and miR-210) known to be involved in lung cancer (13, 14). [score:1]
Recently, miR-19b has been shown to induce tumor growth and metastasis in vivo (29). [score:1]
Conversely, serological levels of miR-19b, miR-20a, and miR-31 significantly decreased at the latter PDTX harvesting point compared to the 1.5 and 3 months schedule (p = 0.02, p = 0.007, and p = 0.003 by ANOVA, respectively; Figure 6B), mimicking what observed for these small regulatory RNAs in PDTXs tissues (Figure 6A). [score:1]
miR-19b, miR-20a, and miR-31 were significantly higher in 1.5 months old PDTXs (respectively * p = 0.02, ** p = 0.007, and ** p = 0.003, by ANOVA), and miR-21 and -210 levels were correlated with PDTXs proliferative activity (respectively * p = 0.03, * p = 0.02 by ANOVA). [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 12
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
[1 to 20 of 1 sentences]
32
[+] score: 11
In HepG2 cells, miR-192, miR-204, miR-18, miR-19 and miR-211 could down-regulate HOTTIP expression (all P<0.05). [score:6]
All miRNA mimics (miR-138, miR-18, miR-192, miR-215, miR-19, miR-204 and miR-211), miRNA inhibitors(miR-192 and miR-204) and small interfering RNA (siRNA) duplexes (siHOTTIP-1 and siHOTTIP-2) were products of Genepharma (Shanghai, China). [score:3]
20 nmol/L mimics of miR-138, miR-18, miR-192, miR-215, miR-19, miR-204, and miR-211, two HOTTIP siRNAs (siHOTTIP-1 and siHOTTIP-2)or NC RNA were transfected into SMMC7721,HepG2 and Hep3B HCC cells. [score:1]
* MicroRNAs Seed position Conservation Primates Mammals Other Vertebrates miR-138 chr7:27245289 89% 30% 0% miR-18 chr7:27238346 89% 30% 0% miR-192/215 chr7:27241747 89% 91% 77% miR-19 chr7:27245115 100% 0% 0% miR-204/211 chr7:27245995 89% 43% 0%*Data from miRcode (http://www. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 11
All the members of the cluster were cloned from purified P6 SCs [14], in situ hybridization with LNA (Locked Nucleic Acid) on adult testes showed miR-17 and miR-20a expression in SCs [12], and ulterior analysis of the small RNA transcriptome of SCs purified from mice at postnatal day 6 revealed high levels of expression for miR-19a and miR-19b, intermediated levels for miR-17 and miR-20a and low levels for miR-18a and miR-92a [16]. [score:5]
As an example, despite the fact that the number of deregulated genes in the embryonic tail buds of mice harboring a homozygous deletion for the miR-17 seed family (~500) was lower than the observed in the same tissue of homozygous mutants for the miR-19 seed family (~700), skeletal malformations were observed in the former mice (defects in axial patterning regulation), but not in the latter ones. [score:3]
The miR-17-92 cluster, also known as Mirc1, is a polycistronic miRNA gene encoding six members (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) which are highly conserved in vertebrates and expressed in practically all tissues analyzed during embryonic and postnatal stages [5– 7]. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 10
One possible relevant difference between these two clusters is that miR-17-92, but not miR-106b-25, expresses members of the miR-19 and miR-18 families. [score:3]
Furthermore, the antiangiogenic proteins TSP11 and CTGF are both negatively regulated by miR-18 and miR-19 [58]. [score:2]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
In addition, it has been demonstrated that miR-18 and miR-19 repress the antiangiogenic factors TSP-1 and CTGF [51]. [score:1]
It is tempting to speculate that loss of miR-19a, miR-19b, and miR-18 is significantly responsible for the phenotype caused by deletion of miR-17-92. [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 10
Moreover, the expression of the closely related family members miR-17 (which only differs from miR-20a by 2 nucleotides) and miR-19a (which only differs from miR-19b by one nucleotide) was not significantly changed, and might compensate for the reduction in miR-20a and miR-19b expression, respectively. [score:5]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
However, the reduction of miR-19b and miR-20a in muscle tissue of miR-92a [−/−] mice was less than 50%. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 10
For example, after the miR-19b-3p antagomir treatment, 40% of the JEV-infected mice became asymptomatic, and the expression of miR-19b-3p showed a reciprocal pattern with its target gene RNF11 in the JEV-infected mouse brain tissues. [score:5]
The miR-19b-3p antagomir inhibits cytokine secretion and activation of astrocytes and microglia, and reduces neurons damage in the JEV-infected mice (Ashraf et al., 2016). [score:3]
MicroRNA-19b-3p modulates japanese encephalitis virus -mediated inflammation via targeting RNF11. [score:2]
[1 to 20 of 3 sentences]
37
[+] score: 10
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-130a, mmu-mir-186, mmu-mir-200b, mmu-mir-202, mmu-mir-30e, mmu-let-7d, mmu-mir-130b, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-mir-200a, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-19a, mmu-mir-200c, mmu-mir-29b-2, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-709, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-574, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-21b, mmu-mir-130c, mmu-mir-21c, mmu-mir-30f, mmu-mir-466c-3
miR-19 has been reported to be downregulated by CsA in vitro[18] while miR-574 has been reported to be downregulated with acute rejection in human [19]. [score:7]
Two microRNAs—miR-19 and miR-574 have been reported to be related to CsA immunosuppression effect. [score:3]
[1 to 20 of 2 sentences]
38
[+] score: 9
The top 5 miRNAs with the highest expression values were miR-19b, miR-125b, miR-17, miR-214 and miR-34b; miR-19b was most substantially expressed with a copy number of 11,333 per cell. [score:5]
We noticed that several members of the miR-17-92/106b cluster, such as miR-17, miR-19b, miR-20a and miR106b, were increased in expression with depletion of Myc in BASCs. [score:3]
Several members of the miR-17-92/106b cluster including miR-17, miR-19b, miR-20a and miR106b were increased. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 9
Inhibition of FGF signaling through SU5402 -treated primitive streak regions of chick embryos identified up-regulation of let-7b, miR-9, miR-19b, miR-107, miR-130b, miR-148a, miR-203, and miR-218 and down-regulation of miR-29a and miR-489 (Bobbs et al. 2012). [score:9]
[1 to 20 of 1 sentences]
40
[+] score: 9
These results support differential roles of miR-19a and miR-19b in regulating circulating lipids, as miR-19b targets ABCA1 and miR-19a targets HBP1. [score:6]
MicroRNAs are involved in the regulation of blood lipids [36]; among them, miR-19b is reported to regulate HDL-C and LDL-C in the plasma of ApoE -null mice [37]. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 9
However, miR-19 and -92 appear to regulate thyroid and cervical vertebrae development (without fusion of the vertebrae) and mandible and head size (microcephaly) (Figure 13b). [score:3]
miR-19 expression was decreased in PMIS-miR-19-92 embryos but not in WT or PMIS-miR-17-18 (Figure 11b). [score:3]
Both miR-17 and miR-19 expression levels were decreased in the PMIS-miR-17-18-19-92 embryos compared with WT (Figure 11b). [score:2]
36, 37 As controls, the levels of m iR-23a, miR-200b and miR-19 were not affected by PMIS-miR-17-18. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 9
The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
0044060.g004 Figure 4The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
The highest-ranking IPA networks associated with miR-124, miR-19, miR-29 and miR-20/17/106/93 predicted targets are depicted in Figure 4 and Figure S1. [score:3]
[1 to 20 of 3 sentences]
43
[+] score: 8
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 8
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
[19] Dissection of the miR-17∼92 cluster has demonstrated that miR-19 is both necessary and sufficient to abrogate apoptosis, at least in Myc -mediated lymphomagenesis most likely by repression of PTEN and BIM. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 8
In particular, miR-19 was reported to be upregulated in the Basal subtypes, miR-200c downregulated in Normal-like tumors and miR-223 downmodulated in luminal-B breast cancers [64]. [score:7]
All tumor cells resulted almost empty for miR-223 and miR-340, while showed variable levels for miR-200b and miR-203 and higher levels of miR-19 and miR-21. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 8
HEK 293T cells were seeded onto 24-well plates for 12 h. Afterwards, 0.2 μg of firefly luciferase reporter plasmid; 0.2 μg of β-galactosidase expression vector (Ambion); 0.2 μg of expression vector pcDNA3.1 -overexpressing miR-17-92 cluster; empty vector pcDNA3.1; or 10-, 20-, 50-nM miR-17, miR-20a, miR-19a, and miR-19b mimics were transfected into the cells. [score:7]
b Sequence alignment of mature miR-19a, miR-19b, miR-17, and miR-20a revealed their seed sequences that were reverse complementary to the seed-matched sequence within the 3′ UTR of mouse CNTFR or GP130, respectively. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 7
Of these miRNAs, the relatively prominent upregulated miRNAs were hsa-miR-3656, hsa-miR-139-5p, hsa-miR-4796-5p, hsa-miR-330-5p, hsa-miR-4698, hsa-miR-3124-5p, hsv2-miR-H10, hsa-miR-133b, hsa-miR-515-3p, hsa-miR-516a-5p, hsa-miR-4762-5p, hsa-miR-4508, hsa-miR-27a-5p, hsa-miR-3120-5p, hsa-miR-133a, and hsa-miR-205-5p (>15-fold), and the relatively prominent downregulated miRNAs were hsa-miR-411-3p, hsa-miR-19b-3p, hsa-miR-152, and hsa-miR-142-5p (>15-fold). [score:7]
[1 to 20 of 1 sentences]
48
[+] score: 7
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, mmu-mir-19b-2, mmu-mir-17
Hence, although we were unable to detect down-regulation of TGFβRII in miR-17-92-transduced T-cells (data not shown), we must consider whether miR-17 and miR-19b alone are sufficient to mediate the observed enhancement of anti-GBM efficacy in our CAR therapy. [score:4]
However, it has been recently shown that miR-17 and miR-19b are critical for Th1 responses, with miR-17 and miR-19b targeting TGFβRII and Pten (phosphatase and tensin homolog), respectively [30, 31]. [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 7
Among validated miRNAs, the most highly upregulated were miR-6240 and miR-6970 (22-fold and 21-fold at P17, respectively), whereas miR-20b-5p and miR-19b-3p were the only miRNAs that were downregulated (−1.76-fold and −1.73-fold at P17, respectively). [score:7]
[1 to 20 of 1 sentences]
50
[+] score: 7
In addition to miR-135a, several CEBPD -downregulated miRNAs including miR-9, miR-19b, miR-29a/b-1, miR-16, and miR-107 were found to be repressed in neurodegenerative diseases [50, 51]. [score:6]
In addition, with respect to PD, miR-19b, miR-29a, and miR-16 were decreased in sporadic and familial late-onset PD [55]. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 7
Of the four miRNAs identified, miR-19a and miR-19b did not regulate ANO1, while miR-144 regulated ANO1 only indirectly as indicated by preliminary experiments (Supplementary Figs.   1– 6). [score:4]
Four miRNAs were predicted to target ANO1: miR-9, miR-19a, miR-19b, and miR-144. [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 7
The type II TGF-β receptor, Tgfbr2, a predicted target of miR-17 and miR-19 group miRNAs [19], was upregulated at both the protein and mRNA levels (Fig.   3a, d). [score:6]
Olive V miR-19 is a key oncogenic component of mir-17-92Genes Dev. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 7
miR-19b was found to inhibit TGF-β signaling, and its expression decreased in patients with advanced fibrosis, suggesting the potential of miR-19b as a therapeutic target for hepatic fibrosis [17]. [score:7]
[1 to 20 of 1 sentences]
54
[+] score: 7
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-19a
[68] Micro -RNA (miR-19) directly downregulates TG2 expression and enhances the invasion of colorectal cancer cells. [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 6
miR-19, a component of the oncogenic miR-17~92 cluster, targets the DNA-end resection factor CtIP. [score:3]
Indicated amounts of synthetic miR-17, miR-18a, miR-19b and miR-92 were added to naïve and activated T KO B cells before RNA extraction. [score:1]
Our calculation showed that each naïve B cell expresses 900–1,800 molecules of miR-17, miR-19, and miR-92 subfamily miRNAs, and 80 molecules of miR-18 subfamily miRNAs (Fig 3B and 3C and S7 Table). [score:1]
They fall into four miRNA subfamilies (miR-17, miR-18, miR-19, and miR-92 subfamilies), with members in each subfamily sharing the same seed sequence. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 6
Along these lines, an exciting recent study by Rogers et al. [43] is the first study in clinical material from BPD patients to demonstrate that the expression levels of all members of the miR-17-92 (Mirc1) cluster were downregulated in autopsied lung material from BPD patients and that the abundance of miR-17 and miR-19b was reduced in the plasma of infants that developed BPD. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
VSELs also express several miRNAs that attenuate Igf-1/Igf-2 signaling in these cells (mir681, mir470, mir669b) as well as up regulate expression of p57 (mir25.1, mir19b, mir92). [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
org tool (Betel et al., 2008), we identified miR-377, miR-32, miR-410, miR-19b, and let-7f, as potential candidates to bind to the 3′-UTR sequence of the N-Wasp mRNA, ultimately suggesting that a group of different miRNAs might be directly controlling the expression of a single target in a concerted manner. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
Seventeen miRNAs were found which had 2-folds or greater differences in levels in VemR A375 melanoma cells as compared with parental A375 cells by microarray (Figure 1B and Supplementary Table S1), with 7 down-regulated miRNAs including miR-7 (40.3-fold), miR-18a-5p (5.2-fold), miR-19a-3p (3.6-fold), miR-20b-5p (3.4-fold), miR-17-5p (3.2-fold), miR-20a-5p (3.1-fold), and miR-19b-3p (2.8-fold) and 10 up-regulated miRNAs including miR-514a-3p (116-fold), miR-129-1-3p (87-fold), miR-509-3p (83-fold), miR-629-3p (22-fold), miR-937-5p (4.6-fold), miR-3960 (4.3-fold), miR-1915-3p (3.2-fold), miR-6090 (3.1-fold), miR-4281 (2.6-fold) and miR-4634 (2-fold). [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
PAK2 is a target of miR-93 and miR-106a; PAK6 is a target of miR-19a and miR-19b [69]. [score:5]
As shown in Table 4, eight miRNAs were observed to belong to the miR-17 family; three miRNAs were identified to belong to the miR-19 family and three miRNAs to the miR-25 family; the miR-363-5p was found to belong to the miR-363 family, but its sequence was similar in part to that of miR-25 family members (Table 3). [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 6
Other miRNAs from this paper: mmu-mir-106a, mmu-mir-19b-2, mmu-mir-17, mmu-mir-363, mmu-mir-20b
In humans, the mir-106a cistron contains several paralogs to members of the mir-17 cistron including mir-17, mir-19b-1, and mir-92-1 [16], which are implicated in cancer development: overexpression of the mir-17 cluster accelerates lymphoma formation from cells of mice overexpressing c-Myc [7]. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
miR-17, miR-19b, miR-20a, and miR-106a are down-regulated in human aging. [score:4]
miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis. [score:2]
[1 to 20 of 2 sentences]
63
[+] score: 6
Increased expression of miR-17-92 cluster is usually associated with oncogenesis, cell growth and proliferation, while decreased expression of miR-19 and other members of the miR-17-92 cluster are generally associated with cellular senescence [48]– [50]. [score:5]
The miR-17–92 cluster is comprised of 6 miRNA genes: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92–1, all of which are located on chromosome 14 in the mouse. [score:1]
[1 to 20 of 2 sentences]
64
[+] score: 6
2013.125 24212931 42. van Almen GC Verhesen W van Leeuwen RE van de Vrie M Eurlings C Schellings MW MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failureAging Cell. [score:4]
The same study validates the presence of miR-19b in the miR-19a/-19b pair which ranked second and both miRNAs were defined as age -dependent. [score:1]
Moreover, the work of van Almen et al. [42] linked miR-19a and miR-19b with age-related heart failure. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 6
The mir-17 family is the one most enriched (p = 3.24 E-4; Table S6) and comprises mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1 and mir-92-1. This family is expressed as polycistronic units, revealing a common regulatory mechanism [62], that is confirmed by the similarity of their expression profiles (Figure 4 D). [score:6]
[1 to 20 of 1 sentences]
66
[+] score: 5
Relevant to polyQ-ATXN1 cytotoxicity, Lee et al. found that ATXN1 levels might be post-transcriptionally regulated by miRNA, specifically miR-19, miR-101, and miR-130. [score:2]
miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis. [score:2]
When miR-19, miR101, and miR130 were transfected into HEK293T, HeLa and MCF7 cells, a marked decrease in ATXN1 levels was observed. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 5
It was recently reported that miR-19b suppresses the activation of stellate cells via the inhibition of TGF-β signaling by interacting with the type II TGF-β receptor [21]. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
miR-19 was found to be the principal oncogenic component of this cluster, targeting the tumour suppressor PTEN [13]. [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
Nine miRNAs with the highest expression levels (average Ct value range 19.6–22.5) were common amongst the four groups of mice despite the differences in age and disease state, and they were miR-133a, miR-126-3p, miR-24, miR-30c, miR-30b, miR-1, miR-16, miR-19b and miR-145 (Table S1). [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
However, although TLR2 is targeted by several human miRNAs including miR-105, miR-19, miR-1225-5p, miR-143 and miR-154 in a variety of cell types [38– 42], no viral miRNA has been shown to target TLR2—until now. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
All of these miRNAs are up-regulated in iPS cells, indicating the importance of miR-17 and miR-19 in the activation and maintenance of iPS pluripotency (Table 1). [score:4]
Among 82 pre-miRNAs for these 73 mature miRNAs, which are commonly involved for activation and maintenance, we found all 7/8 members of the miR-17 family, all 3/3 members of the miR-19 family, 6/6 miRNAs in the cluster of miR-17-92 and 3/3 miRNAs in the cluster of miR-106-93. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 4
Other miRNAs from this paper: mmu-mir-106a, mmu-mir-106b, mmu-mir-19b-2, mmu-mir-17, mmu-mir-19a
Analysis of the microRNAs expressed by the two clusters revealed that miR-19a and miR-19b-1 that share the same seed sequence are encoded only by the miR-17∼92 but not the miR-106b∼25 cluster (Fig.  10). [score:3]
miR-19 is a key oncogenic component of mir-17-92. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 4
miR-17, miR-19b, miR-20a and miR 92a belong to the cluster miR-17-92 known to be upregulated in several solid tumors (16, 17). [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Genome-wide RNA -mediated interference screen identifies miR-19 targets in Notch -induced T-cell acute lymphoblastic leukaemia. [score:3]
miR-19 is a key oncogenic component of mir-17-92. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Our results are also mostly in agreement with those of Esau et al. [25] who identified a similar expression pattern regarding miR-130b, miR-30c, miR-30a*, miR-191, miR-30d, miR-196, miR-30b, miR-19b, miR-92, miR-138 and miR-100 during differentiation of cultured human adipocytes. [score:3]
One example of miRNAs that can be actively involved in cell proliferation is the miR-17-92 cluster, which comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b, and miR-92-1). [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, among the 66 uniformly expressed miRNAs for which IPA assigned functions, we identified 12 candidates that have been implicated in androgen regulation, including: let-7a-5p, miR-15a-5p, miR-17-5p, miR-19b-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-30a-5p, miR-34a-5p, miR-140-5p, miR-193a-3p, miR-205-5p (S1 Fig). [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
For example, Tgfbr2, the TGF-ß cell surface receptor, is a predicted target of both miR-19b and miR-106a, but was not significantly changed in tumors with Xpcl1 integration. [score:3]
This indicates that there are only 5 microRNAs (miR-363, miR-92-2, miR-20b, miR-19b, and miR-106a) influenced by viral integration at Xpcl1 (Figure 1D). [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 4
In the order of the significance score by SAM, 15 up-regulated miRNAs are mmu-miR-127, mmu-miR-410, mmu-miR-433, mmu-miR-138, mmu-miR-181c, mmu-miR-382, mmu-miR-19b, mmu-miR-381, mmu-miR-666-3p, mmu-miR-376a, mmu-miR-873, mmu-miR-181a, mmu-miR-383, mmu-miR-181b, and mmu-miR-99b. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
The miR-17-92 (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a) cluster was previously described to be regulated by cell cycle via E2F3 binding and by a negative feedback loop through miR-17 that targets E2F2 (ref. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
For example, three of the Treg-enriched miRNAs, miR-17-3p, miR-19a-5p and miR-19b-5p are all predicted to target numerous signalling molecules, including multiple MAP kinases, serine/threonine kinases and phosphatases, as well as various transcription factors and cell cycle regulators. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
For example, miR-29b [20] and miR-133a [21] directly represses the expression of several collagen genes, whereas miR-19b [22], miR-101 [23] and miR-146a [24] impairs TGF-β signaling. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
However, inspection of the human IRF8 3′UTR revealed potential target sites for multiple miRNAs, including miR-130a, miR-19a and miR-19b, which are differentially regulated in mouse pDCs and cDCs (results herein). [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
Furthermore, results from Murphy and colleagues [28], showed the therapeutic potential of 8-mer LNA-anti-miRs in inhibiting miR-17, 20a, 106b, and 93 (anti-miR-17) and miR-19a and 19b-1 (anti-miR-19) in two murine SHH -driven MB mo dels. [score:3]
One of the miRNAs of interest is miR19a-5p, belonging to one of the best-known miRNA clusters, the miR-17∼92, which encodes six miRNAs (i. e., miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1) [24]. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 4
Note relatively higher expression of 3′ members of the cluster, miR-20a, miR-19b, and miR-92. [score:3]
D. Age -dependent decline in miR-19b and -92. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 3
Other highly-expressed miRNAs include those of the miR-17∼92 cluster (miR-17, miR-20a, miR-19b, miR-92a) (Table 1 ). [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
A recent study revealed that lower levels of miR-200b, miR-15a-5p, miR-19b-1-5p, miR146a-5p, and miR-200c, and higher levels of miR-16-5p, miR-106b-5p, and miR-145-5p are related to modulation of vascular endothelial growth factor A (VEGFA), epidermal growth factor receptor 2 (EGFR2), phosphatase and tensin homolog (PTEN), and C-X-C chemokine receptor type 4 (CXCR4) expression, which are important in the pathogenesis of endometriosis [37]. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
MiR-19, which is a component of the miR-17/Oncomir-1 miR polycistron, interferes with the expression of the antiapoptotic Ras homolog B (rhoB). [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Meanwhile, the expression of miR-21, miR-10a, miR-126, miR-10b, miR-19a, miR-19b was significantly increased after adding into HUVECs culture, suggesting that HUVECs might release these miRs (Table 1). [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
miR-126-3p, miR-24, miR-16, miR-19b, and miR-17 were the top five miRNAs with the highest absolute expression values. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
The qRT–PCR analysis of differentially expressed microRNA candidates mmu-miR-7a, mmu-miR-19b, mmu-miR-30c, mmu-miR-103, mmu-miR-107 and mmu-miR-467 that are presented in Tables 2 and 3. The expression of each miRNA was measured and normalized to that of miR295 as a control. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
In contrast, miR-18a, miR-19a, miR-19b and miR-20a expression levels were significantly lower in PMBL than in DLBCL. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Sufficiently high levels of expression was found only in 10 miRNAs: miR-133a, miR-206, miR-1, miR-145, miR-24, miR-19b, miR-17, miR-106b, miR-20a and miR-21. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Many miRNAs that we identified as being differentially expressed in granulopoiesis were not previously implicated in this process including miR-19a, miR-19b miR-24, miR-26a, miR-26b, miR-93, miR-106b, miR-191, miR-139-5p, miR-140 and miR-195 (Figures 2A and 3, Additional file 1). [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Overexpression of miR-17~92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) induces lymphoma [29]. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
When comparing young versus aged TEC (a mix of cTEC and mTEC) a decrease in miR-148b, miR-19b, miR-24, and miR-322 expression was seen in aging (45). [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
The miRNAs that contributed most prominently to PC1 (human - mouse split) were miR-93 and miR-19a, with a lesser contribution from miR-19b, miR-20a and miR-130b, while the miRNAs that contributed most significantly to PC2 (MYCN high versus low expression) were miR-17, miR-25, miR-20b and miR-15b. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 2
A previous study found that miR-19a and miR-19b participated in glioma genesis via negative regulation of PTEN 17. [score:2]
[1 to 20 of 1 sentences]
99
[+] score: 2
Other miRNAs from this paper: mmu-mir-132, mmu-mir-19b-2, mmu-mir-22, mmu-mir-19a
37, 38, 39 In addition, we performed an analysis of miRNA binding sites in the 3′ UTR of MECP2, using a number of bioinformatic tools, 40, 41, 42 and incorporated a compact sequence containing the binding sites of three highly conserved miRNAs known to be involved in regulation of MeCP2 in the brain; miR-22, [32] miR-19, [33] and miR-132. [score:2]
[1 to 20 of 1 sentences]
100
[+] score: 2
MicroRNA-19b-3p Modulates Japanese Encephalitis Virus-Mediated Inflammation via Targeting RNF11. [score:2]
[1 to 20 of 1 sentences]