sort by

174 publications mentioning hsa-mir-128-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-128-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 353
Other miRNAs from this paper: hsa-mir-128-1
The putative targets of miR-128 were first identified using TargetScan 5.0 and Pic Tar microRNAs prediction software that predicted targets with strong and highly conserved miR-128 target sites in the 3′-UTR of targeted mRNA (Table 1). [score:11]
The observations from this study, that up-regulation of miR-128 inhibited HNSCC growth through directly mediating its targets Paip2, BAG-2, H3F3B, BMI-1, and BAX in proliferation and apoptotic pathways, support that miR-128 functions as a tumor suppressor. [score:11]
Third, up-regulated miR-128 expression inhibited HNSCC cell growth and promoted HNSCC cell apoptosis partially through mediating its direct targets. [score:11]
miR-128 acted as a tumor suppressor inhibiting the HNSCC growth by directly mediating the expression of putative targets. [score:10]
All of the targeted mRNAs have a complementarity 3′-UTR region, which can pair with miR-128 to impede the translation of targeted mRNA resulting in a down-regulated protein level. [score:10]
Up-regulated miR-128 suppresses the expression levels of its putative target proteins. [score:10]
Our results showed that enforced expression of miR-128 inhibited the HNSCC cell proliferation and tumor xenograft growth by mediating the expression of BMI-1, BAG-2, BAX, H3f3b, and Paip2 mRNAs, suggesting that miR-128 might act as a tumor suppressor. [score:9]
Up-regulated miR-128 expression inhibits the growth of cultured JHU-13 [miR-128] cells and JHU-22 [miR-128] cells, and JHU-22 [miR-128] tumor xenografts. [score:8]
Moreover, a recent report has shown that miR-128 exerts pro-apoptotic effects via directly inhibiting SIRT1 expression to lead an increase in acetylated p53 and its transcriptional targets [38]. [score:8]
Intriguingly, miR-128 is shown to be down-regulated with age, affecting genetic diseases, and is shown to function as a tumor suppressor. [score:8]
We found that upregulated miR-128 expression significantly inhibited both JHU-13 [miR-128] and JHU-22 [miR-128] cell viability approximately 20 to 40%, and the JHU-22 [miR-128] tumor xenograft growth compared to the vector control groups. [score:7]
miR-128 is one of the miRNAs, which has been shown to be down-expressed in several types of cancer including prostate cancer, glioma and non-small cell lung cancer, and to inhibit cancer cell growth and invasion when it is constitutively expressed [17– 19]. [score:7]
Secondly, miR-128 was able to suppress mRNA and protein levels of H3f3b, BMI-1, PAIP2, BAG-2, and BAX expression, but the degree of inhibition varied. [score:7]
Up-regulated miRNA-128 expression regulates the levels of cell growth and apoptotic mediators. [score:7]
Up-regulated miR-128 expression inhibits the growth of cultured JHU-13 [miR-128] cells and JHU-22 [miR-128] cells, and JHU-22 [miR-128] tumor xenograftsThe effects of miR-128 on the regulation of cell viability and colonigenic potential were evaluated using MTT (Fig. 4A) and colonigenic formation assays (Fig. 4B), respectively, in cultured JHU-13 [miR-128] and JHU-22 [miR-128] cells. [score:6]
Conversely, endometrial cancers expression miR-128 is shown to be up-regulated [25]. [score:6]
Enforced miR-128 expression was monitored under fluorescence microscope on the basis of EGFP expression (Fig. 1C) and quantified by QRT-PCR (Fig. 1D). [score:5]
The expression levels of miR-128 and its targeted proteins were analyzed with qRT-PCR, Western blotting and flow cytometry. [score:5]
The EGFP-miR-128 expression vector was constructed with a lentiviral expression system [22]. [score:5]
Lastly, our comprehensive analysis elucidated a possible mechanism of miR-128 function as a tumor suppressor, and suggested great clinical value of miR-128 as a therapeutic target and indicator. [score:5]
TargetScan 5.0 has categorized and predicted targets of miR-128 in both conserved and non-conserved sites. [score:5]
0116321.g002 Fig 2Comparison of expression levels of the putative targets between JHU-22 [miR-128] and JHU-22 [vect]. [score:5]
0116321.g003 Fig 3(A) A set of tests included 3’UTR-target-luci vector alone, EGFP-miR-128 vector alone, and combination of 3’UTR-target-luci vector and EGFP-miR-128 vector. [score:5]
miRNA-128 was able to bind with the 3′-untranslated regions of BMI-1, BAG-2, BAX, H3f3b, and Paip2 mRNAs, resulting in significant reduction of the targeted protein levels. [score:5]
Our results provide a better understanding of miRNA-128 function and its potential targets, which may be valuable for developing novel diagnostic markers and targeted therapy. [score:5]
Comparison of expression levels of the putative targets between JHU-22 [miR-128] and JHU-22 [vect]. [score:5]
Our data also suggested that miR-128 is able to balance the ratio of protein expression between the anti-apoptotic regulator BAG-2 and the pro-apoptotic regulator BAX. [score:5]
Specifically, miR-128 is shown to block major singling pathways such as ERK and AKT in tumor development, resulting in the inhibition of proliferation, metastasis and angiogenesis in non-small cell lung cancer [24]. [score:4]
Additionally, we also found that the expression levels of cell proliferation-related regulators were altered, showing reduced protein levels of PCNA and cyclin D1 in JHU-22 [miR-128] cells. [score:4]
Paip2 might be another direct target of miR-128, since the protein level of Paip2 was reduced more than 60% in the JHU-22 [miR-128] cells (Fig. 2A). [score:4]
First, miR-128 had the capacity to directly bind to the 3’-UTR region of these targeted mRNAs of H3f3b, BMI-1, PAIP2, BAG-2, and BAX. [score:4]
In this study, we comprehensively analyzed the function of miRNA-128 (miR-128) in the regulation of HNSCC growth and its putative targets in vitro and in vivo systems. [score:4]
Construction of the EGFP-miR-128 expression vector. [score:3]
In the present study, we analyzed the function of miR-128 and its putative targets using HNSCC cells and tumor xenograft mo dels. [score:3]
Moreover, overexpression of miR-128 has been associated with reduced cell growth in glioma tissue and cell lines [19, 26, 27]. [score:3]
An EGFP control vector was also constructed using the same expression system without the miR-128 gene. [score:3]
Fig. 5D shows a comparison of the expression profiles of protein index between JHU-22 [miR-128] and JHU-22 [vect] tumor xenografts. [score:3]
In contrast to these studies, Myatt et al. have demonstrated that miR-128 is highly expressed in endometrial cancer. [score:3]
There were no notable changes with PARP; however, the anti-apoptotic proteins including MDM2, Bcl-2, Bcl-XL, and NFkb were dramatically down-regulated approximately 30 to 80% in cultured JHU-22 [miR-128] cells compared with JHU-22 [vect] cells (Fig. 5B). [score:3]
There are still no data available for the expression and function of miR-128 in HNSCC. [score:3]
Each putative target has a near-perfect binding site in its 3′-UTR for miR-128. [score:3]
Enforced miR-128 expression is of potential value in HNSCC therapy. [score:3]
Stable expression of the miR-128 in JHU-22 head and neck squamous cancer cell lines. [score:3]
We found that reduction of BMI-1 and H3F3B expression led to diminish JHU-22 [miR-128] cell proliferation and xenograft growth (Fig. 4), Furthermore, we observed significant reduction in cell growth of JHU-13 [miR-128] (Fig. 4A). [score:3]
The results from MTT assay showed that unregulated miR-128 expression in JHU-13 [miR-128] and JHU-22 [miR-128] cells led to approximately 22% to 43% reduction of cell viability (Fig. 4A). [score:3]
Establishment of miRNA-128 stably expressed HNSCC cell lines. [score:3]
Further studies are warranted to confirm the expression and function of miR-128 with human tumor samples of HNSCC and other pathological types. [score:3]
Again, the levels of BMI-1 (30/80), PNCA (21/30) and cyclin D1 (37/65) were significantly down-regulated in the JHU-22 [miR-128] group compared with the control JHU-22 [vect] group. [score:3]
Overall, the cell cycle and proliferation indicators including PCNA, cyclin D1 and BMI-1, were significantly down-regulated by approximately 30 to 80% in JHU-22 [miR-128] cells and JHU-22 [miR-128] xenograft tissue compared to the control groups (Fig. 5A). [score:3]
Evidence suggests that miR-128 may play a central role in cellular proliferation by regulating BMI-1, E2fa, and other regulatory element(s) such as transcriptional WEE1-a tyrosine kinase, which phosphorylates CDK1 [19]. [score:3]
Summary of sequence alignment of putative and binding capacities targets of miR-128. [score:3]
As expected, we found the levels of pro-apoptotic regulators, such as p53, and caspases 3 and 9 (Fig. 5B and C) were elevated, and the levels of anti-apoptotic regulators, such as Bcl-XL, Bcl-2, NFκb and MDM2 significantly decreased in JHU-22 [miR-128] cells (Fig. 5B). [score:3]
HNSCC cells stably expressing either EGFP-miR-128 or EGFP alone were generated and the infected cells could be easily viewed under a fluorescence microscope. [score:3]
Enforced expression of miR-128 was detected in both cultured JHU-13 [miR-128] and JHU-22 [miR-128] cell lines, approximately seventeen to twenty folds higher than in vector control cell lines. [score:3]
The molecular and cellular functions of miR-128 are expressed in numerous pathways and organs within the body [23]. [score:3]
Another possibility is that miR-128 expression induces apoptosis by disrupting the mitochondrial membrane potential which would cause the release of cytochrome C and increase caspase activity. [score:3]
The binding capacities of miR-128 with its putative targets. [score:3]
First, we modified the commercial pLVX-Tight-Puro vector (Clontech, Mountain View, CA) by replacing the P [tight] promoter with an expression cassette containing a full CMV promoter (P [CMV)], enhanced green fluorescent protein (EGFP), miRNAs linker, and pre-miR-128-a. The miRNAs linker contained a multiple cloning site. [score:3]
The stable transfection was performed using a lentiviral delivery system, which contained an expression cassette of the CMV promoter, EGFP, and miR-128 precursor (Fig. 1A and B). [score:3]
Effects of miR-128 expression on the profiles of cell growth and apoptotic indicators. [score:3]
org We utilized the luciferase report assay to determine the binding capacity of miR-128 with its putative targets. [score:2]
Consistent with these reports, our data supports that dysregulation of miR-128 is involved in the HNSCC growth and progression. [score:2]
We found significant reduction of BMI-1 expression in JHU-22 [miR-128] and JHU-13 [miR-128] compared to the control vectors. [score:2]
As expected, the protein levels of these targeted genes were significantly decreased in JHU-22 [miR-128] cells compared with JHU-22 [vect] (Fig. 2). [score:2]
The flow cytometry analysis revealed a left shift in fluorescence intensity of the targeted proteins in miR-128 transfected cells (JHU-22 [miR-128]) compared to the vector control cells (JHU-22 [vect]), indicating a decrease in labeled protein levels (BMI-1, H3f3B, BAG-2, BAX, and PAIP2). [score:2]
The binding capacity of miRNA-128 to its putative targets was determined using a luciferase report assay. [score:2]
The miR-128 expression levels were increased approximately 16 folds in JHU-13 [miR-128] cells and 19 folds in JHU-22 [miR-128] cells compared to their vector control cells (Fig. 1D). [score:2]
Interestingly, both BMI-1 and H3F3B showed a higher binding rate with miR-128 among these five potential targets analyzed with luciferase report assay (Table 1). [score:2]
The protein level of BAG-2 was extremely high in the HNSCC JHU-22 cells (Fig. 2A), however, up-expressed miR-128 in the JHU-22 [miR-128] cells was able to attenuate BAG-2 protein significantly, even though BAG-2 had a relative lower binding capacity with miR-128 compared to BMI-1, H3F3B, or BAX (Table 1). [score:2]
Binding capacity of miR-128 with individual putative targets determined by luciferase report assay. [score:2]
We utilized the luciferase report assay to determine the binding capacity of miR-128 with its putative targets. [score:2]
The binding capacity of miR-128 towards its putative targets was summarized in Table 1. We further utilized the QRT-PCR to determine the effect of miR-128 in the mRNA levels of BMI-1 and BAX in JHU-13 [miR-128] and JHU-22 [miR-128] cell lines compared to their vector controls (Fig. 3B). [score:2]
In addition, JHU-22 [miR-128] cells displayed significant decreased capability to form colonies, showing a low number of colonies in comparison to JHU-22 [vect] cells (Fig. 4B). [score:1]
Hsa-miR-128–pseudotyped lentiviral particles contained a double-stranded 21-nucleotide of ″miR-128 mimic″. [score:1]
S2 FigCell Cycle Analysis JHU-22 [vect] and JHU-22 [miR-128] Cell Lines 24hrs. [score:1]
Cell Cycle Analysis JHU-22 [vect] and JHU-22 [miR-128] Cell Lines 24hrs. [score:1]
The distributions of cells in G1, S, and G2 phases are shown for JHU22 [vect] (A) and (B) miRNA transfected JHU-22 [miR-128] cell lines. [score:1]
A growth curve of tumor xenograft was showed in Fig. 4C that JHU-22 [vect] tumor xenografts were able to visualize two weeks after inoculation and JHU-22 [miR-128] xenografts appeared four weeks after inoculation (Fig. 4C). [score:1]
Overall, our results imply that miR-128 leads HNSCC cell apoptosis (Figs. 2 and 5, and Table 1). [score:1]
The average tumor weight in JHU-22 [vect] group was significantly higher than JHU-22 [miR-128] group (0.15 g vs. [score:1]
JHU-22 [vect] and JHU-22 [miR128] cells were seeded at a density of ∼500 cells per well in BD Falcon 6-well tissue culture plates (Palo Alto, CA). [score:1]
Approximately 1 x 10 [6] cells were injected subcutaneously into the left (JHU-22 [vector]) and right (JHU-22 [miR-128]) lower flank of the mice, respectively. [score:1]
Human HNSCC JHU-13 and JHU-22 cell lines were chosen for the studies because both cell lines have relative low levels of miR-128. [score:1]
miR-128 is uniquely encoded by two distinct genes, miR-128a and miR-128b, which are processed into an identical mature sequence. [score:1]
JHU-22 [vect] and JHU-22 [miR128] cells were collected, washed, and fixed in chilled 80% ethanol. [score:1]
BAX was found to be 2:1 in the JHU-22 [vect] cells; however, the ratio was significantly changed in the JHU-22 [miR-128] cells that BAG-2 vs. [score:1]
The 3′-UTR-Lucivector was constructed using the phCMV-FSR luciferase reporter vector (Genlantis) with a fragment of mRNA 3′-UTR of BAX (NM_004324 3′-UTR 50–56), BAG-2 (NM_004282 3′-UTR 631–619), PAIP2 (NM_001033112 3′-UTR 42–48), H3f3b (NM_005324 3′-UTR 388–394), or BMI-1 (NM_005180 3′-UTR 481–487), which carry a putative complementary site for mature miR-128. [score:1]
Individual 3′-UTR Luci vector and EGFP-miR-128 vector were transfected into 293T cells either alone or together using the calcium phosphate method. [score:1]
The present data indicates that miR-128 is involved in multiple signal pathways that are associated with HNSCC progression and growth. [score:1]
The miR-128 level in JHU-22 [miR-128] tumor xenografts was maintained approximately 10-fold higher than in its control group (Fig. 4E). [score:1]
Pre-miR-128-a double strand sequence was designed based on the miRBase:Sequences 12.0 databases. [score:1]
JHU-22 [vect] cells on the left and JHU-22 [miR-128] cells on the right. [score:1]
The function and targets of miR-128 were investigated in human HNSCC cell lines (JHU-13 and JHU-22), which were stably transfected with the miR-128 gene using a lentiviral delivery system. [score:1]
The colony forming ability of JHU-22 [miR-128] was 55% less than that of JHU-22 [vect] cells. [score:1]
Simultaneously, the protein levels of BMI-1 and H3F3B were largely reduced in JHU-22 [miR-128] cells. [score:1]
Cell Cycle Analysis JHU-22 [vect] and JHU-22 [miR-128] Cell Lines 20hrs. [score:1]
Following the manufacturer′s instruction, the lentivirus particles, containing the EGFP-miR-128 vectors or EGFP control vectors, were produced with the lentiphos HT packaging system (Clontech). [score:1]
We analyzed cell cycle regulation, focusing on the changes in S-phase compared to G1 and G2 after 20 hours and 24 hours; however we did not observe significant changes between the control vector and miR-128 in JHU-22 cell lines (S1 and S2 Fig. ). [score:1]
Fig. 1 shows an example for generation of JHU-22 [miR-128] cell line. [score:1]
S1 FigCell Cycle Analysis JHU-22 [vect] and JHU-22 [miR-128] Cell Lines 20hrs. [score:1]
JHU-22 [vect] and JHU-22 [miR128] cells were seeded at an initial density of 5000 cells per well in a flat-bottom 96-well cell culture plate and allowed to grow for 48 hours in a humidified 5% CO [2], 95% air atmosphere in an incubator maintained at 37 [o]C. Twenty microliters of MTT (5 mg/ml) solution (Sigma) were added to each well followed by 4-hour incubation at 37°C. [score:1]
We confirmed miR-128 binding capacity to the 3’UTR of the mRNA of BMI-1 (Fig. 3A). [score:1]
Both pre-miRNA-128-a and pre-miRNA-b formed an identical mature sequence of miR-128. [score:1]
We generated two miR-128 stably transfected human HNSCC cell lines (JHU-13 [miR-128] and JHU-22 [miR-128]). [score:1]
In order to limit individual mouse effects, both JHU-22 [vect] and JHU-22 [miR-128] cells were subcutaneously inoculated into a Balb/c athymic nude mouse. [score:1]
Stable transfection of miRNA-128 in HNSCC cell line. [score:1]
[1 to 20 of 106 sentences]
2
[+] score: 240
The miRanda v3.0 target scanning algorithm predicts two target regions (Target-A and –C) for miR-128 and two target regions (Target-A, and -B) for miR-152 in the 2,172nt CSF-1 mRNA 3’UTR (Figure 3A). [score:11]
In this report, we study 3’UTR targets for binding miRNAs, and find that both miR-128 and miR-152 down-regulate CSF-1 expression in ovarian cancer. [score:8]
While some differential effects of miRNA alteration are seen between the different ovarian cancer cell lines, overall, the effect of miR-128 and −152 on down-regulation of CSF-1 expression are similar, and may be achieved by both translational repression and mRNA decay. [score:8]
The major CSF-1 mRNA 3’UTR contains a common miRNA target which is involved in post-transcriptional regulation of CSF-1. Our results provide the evidence for a mechanism by which miR-128 and miR-152 down-regulate CSF-1, an important regulator of ovarian cancer. [score:8]
To address this issue, we decided to study, in more detail, the roles of miR-128 (as being inversely correlated to CSF-1 expression) and miR-152 (as appearing to be most positively correlated to CSF-1 expression) in the post-transcriptional regulation of CSF-1 expression. [score:8]
This suggests that Target-A is a critical cis-acting regulatory sequence, and we have validated that it serves as a direct target for at least miR-128 and miR-152 (Figure 4). [score:7]
To determine the effects of miR-128 and miR-152 on the expression of CSF-1, either miR-128 or miR-152 were over-expressed or inhibited in S KOV3 and Bix3 ovarian cancer cells. [score:7]
Target-A appears to be a miRNA ‘hot-spot’ as our bioinformatics analysis predicted at least fourteen miRNAs, including miR-128 and miR-152, targeting a region of 2573–2577 (Target-A) in CSF-1 mRNA 3’UTR (Figure 3). [score:7]
To further confirm Target-A as an actual miRNA-responding sequence, miR-128 or miR-152 was overexpressed together with either wild type construct (Luc-CSF-1 3’UTR-Wt) or Target-A mutant construct (Luc-CSF-1 3’UTR-Mut). [score:7]
By using in silico text-mining algorithms against the CSF-1 mRNA 3’UTR, we selected miR-128 and miR-152 that would fit the profile of having regulatory abilities of CSF-1. While miR-128 and miR-152 possess target sequences in the CSF-1 mRNA 3’UTR, their expression patterns in the ovarian cancer cell lines proved to be different. [score:6]
Target-A mutation also abrogated response of reporter RNA and activity to miR-128 and miR-152 over -expression (Figure 4). [score:6]
miR-128 and miR-152 down-regulate CSF-1 mRNA and protein expression. [score:6]
By mutations in putative miRNA targets in CSF-1 mRNA 3’UTR, we identified a common target for both miR-128 and miR-152. [score:6]
After transfection with, miR-128 overexpression construct (miR-128OE), miR-152 overexpression construct (miR-152OE), or Empty vector (pCMV-miR), Hey cells were plated on A) an 8 micron pore membrane for a 6 hour directed motility assay. [score:5]
Furthermore, overexpression of miR-128 or miR-152 in Hey cells inhibited cell adhesiveness by 15-20% (p < 0.001) (Figure 6B). [score:5]
HHW and CFL carried out most of the experiments including the quantitative real-time qRT-PCR for CSF-1 mRNA, miR-128 and miR-152 as well as the overexpression and suppression of miRNAs and wrote the manuscript. [score:5]
Since endogenous miR-128 RNA level is already high in Bix3 (Figure 1), overexpression by exogenously introduced miR-128 RNA may have little effect on CSF-1 expression. [score:5]
In both cases, expressions of miR-128 and miR-152 follow their host gene expression patterns (Figure 2C, D). [score:5]
Overexpression of miR-128 in these cells already overexpressing high levels of endogenous miR-128 (Figure 1C), does not change luciferase activity (p = NS). [score:5]
Figure 4 Target-A is an active target for miR-128 and miR-152. [score:5]
It was also recently revealed that both miR-128 and miR-152 have the ability to inhibit neuroblastoma cell motility and invasiveness when overexpressed [39]. [score:5]
Figure 5 miR-128 and miR-152 inhibit CSF-1 expression in S KOV3 and Bix3 cells. [score:5]
In the presence of the Target-A mutant construct, miR-128 overexpression also had no significant effect (p = NS) on luciferase activity. [score:5]
Either S KOV3 or Bix3 cells were transfected with the A, D) miR-128 or miR-152 overexpression plasmids (miR-128OE, miR-152OE); or B, E) inhibitor plasmids (miR-128Inh, miR-152Inh); or vector controls. [score:5]
Our findings demonstrate that both miR-128 and miR-152 can negatively impact cell motility and adhesiveness of human ovarian cancer cells, important aspects of their metastatic potential, correlated with suppression of CSF-1 expression. [score:5]
Expression of miR-128 is significantly inversely correlated with CSF-1 protein expression (correlation coefficient = −0.998, p = 0.002), with miR-128 RNA level low in Hey and S KOV3 and high in Bix3 ovarian cancer cells, as well as in NOSE. [score:5]
Either miR-128 or miR-152 was overexpressed together with either A, B) wild type construct (Luc-CSF-1 3’UTR-Wt) or C, D) Target-A mutant construct (Luc-CSF-1 3’UTR-Mut) in Bix3 cells. [score:5]
In this report, we add the findings that over -expression of miR-128 or miR-152 in ovarian cancer cells results in a significant reduction in both motility and adhesiveness (Figure 6), therefore inhibiting important aspects of invasiveness and metastasis. [score:5]
The current study identifies miR-128 and miR-152 as important regulators for CSF-1 mRNA and protein expression, and of ovarian cancer cell behavior. [score:4]
In contrast, overexpression of either miR-128 or miR-152 in Bix3 cells transfected with the Target-A mutant construct did not decrease luciferase RNA significantly (p = NS) compared to the wild type construct (Figure 4C). [score:4]
CSF-1 mRNA 3’UTR is a direct target for miR-128 and miR-152 in ovarian cancer cells. [score:4]
To further confirm the expression pattern of miR-128 and miR-152 in ovarian cancer cells, we applied the Splinted Ligation technique to directly detect these miRNAs [34]. [score:4]
Overexpression of miR-128 does not alter CSF-1 mRNA (p = NS) or protein levels (Figure 5D, F). [score:3]
Expression of miR-128, miR-152, miR-27a, miR-214, and miR-454 in ovarian cancer cells. [score:3]
miR-128 is highly expressed in human brain tissue and its function is linked to neuronal differentiation [35]. [score:3]
The motility of Hey cells was significantly curtailed by over 50% by the overexpression of either miR-128 or miR-152 (p < 0.001) (Figure 6A). [score:3]
In S KOV3, overexpression of miR-128 decreased CSF-1 mRNA level by 92% (p < 0.001) (Figure 5A) and CSF-1 protein levels (~60 kDa) by 87% (Figure 5C). [score:3]
In CSF-1 mRNA 3’UTR, we identified three potential miRNA target sequences for miR-128 and/or miR-152 (Figure 3). [score:3]
In this context, exogenously introduced miR-128 may not have a strong influence on luciferase translation. [score:3]
Recently, both miR-128 and miR-152 have been shown to inhibit neuroblastoma invasiveness [39]. [score:3]
In contrast, in S KOV3, inhibition of miR-128 increased CSF-1 mRNA level by 3.73-fold (p < 0.001) (Figure 5B) and CSF-1 protein level by 13.61-fold (Figure 5C). [score:3]
In contrast, inhibition of miR-128 increased CSF-1 mRNA level by 3.01-fold (p < 0.001) (Figure 5E) and CSF-1 protein level (~60 kDa) by 2.45-fold (Figure 5F). [score:3]
miR-128 and miR-152 inhibit cellular motility and adhesion of ovarian cancer cells. [score:3]
At the same time, overexpression of miR-128 had no significant effect on viability (p = NS) (Figure 6C). [score:3]
Figure 6 Ovarian cancer cell adhesiveness and motility is inhibited by miR-128 and miR-152. [score:3]
Overexpression of either miR-128 or miR-152 in Bix3 cells co -transfected with the wild type construct decreased luciferase RNA by 39% and 93%, respectively (p < 0.001). [score:3]
To find the actual target sequence for miR-128 and miR-152, we used a luciferase reporter system. [score:3]
miR-128-1 is in R3HDM1 gene on chromosome 2q21.3 and miR-128-2 is in ARPP21 gene on chromosome 3p22. [score:1]
miR-128 gene is imbedded in two paralogous genes, both present in the intronic region of their respective “host” genes. [score:1]
miR-128 RNA is detected in both NOSE. [score:1]
In our study, both miR-128 and miR-152 reside in introns of R3HDM1 gene and COPZ2 gene, respectively. [score:1]
Both gene products are processed into the same mature miR-128 [36]. [score:1]
miR-128 RNA level is lower in the invasive, metastatic Hey and S KOV3 ovarian cancer cells in comparison to the less invasive and tumorigenic Bix3 ovarian cancer cells (Figure 1C). [score:1]
These data suggest important biologic roles of miR-128 and miR-152 in cancer. [score:1]
In S KOV3, effects of either miR-128 or miR-152 are more prominent on CSF-1 protein level than on the CSF-1 mRNA level (Figure 5A-C). [score:1]
Figure 2 A) of miR-128 in ovarian cancer cells. [score:1]
[1 to 20 of 56 sentences]
3
[+] score: 236
Other miRNAs from this paper: hsa-mir-128-1, hsa-mir-143
The 2′ O-methyl -modified mRNA oligonucleotides miR-128-CYP2C9-target, miR-128-PAIP2-target1, miR-128-PAIP2-target2, miR-128-PFKFB4-target, and miR-143-CYP2C9-target were labeled with IRDye®800 (LI-COR Biosciences, Lincoln, NE) dye on their 5′ ends. [score:11]
Most importantly, this study revealed an up-regulation of hsa-miR-128-3p expression and a significant inverse correlation between CYP2C9 expression and hsa-miR-128-3p expression in HCC tissues, indicating that hsa-miR-128-3p combined with CYP2C9 are potential biomarkers for HCC diagnosis. [score:10]
In summary, our study identified and experimentally confirmed that hsa-miR-128-3p is a suppressor for CYP2C9 expression in HCC, and revealed a direct interaction between a miRNA and its target mRNA sequence in vitro, which demonstrated a molecular mechanism of miRNA mediated CYP2C9 suppression. [score:10]
Because of the low expression of DMEs and transporters by HepaG2 and other hepatocellular carcinoma cell lines 30 42, we used HepaRG cells, which express DMEs and transporters at levels similar to primary hepatocytes, to investigate the suppression effects of hsa-miR-128-3p on endogenous CYP2C9 expression and translation. [score:9]
Altogether, our results indicated that hsa-miR-128-3p is able to suppress CYP2C9 expression/production in human hepatic cells by specifically targeting the 3′-UTR of CYP2C9 mRNA molecules. [score:7]
The predicted free energies of binding were −20.5 kcal/mol, −18.0 kcal/mol, and −15.8 kcal/mol for miR-128-PAIP2-target2, miR-128-PAIP2-target1 and miR-128-PFKFB4-target, respectively. [score:7]
In this study, we demonstrated that hsa-miR-128-3p plays an important role in the suppression of CYP2C9 expression and translation in human liver cells by a series of in silico analyses and in vitro and in vivo experiments. [score:7]
As shown in Fig. 1c, transfection with the hsa-miR-128-3p mimic did not suppress luciferase activity from CYP2C9-MUT1-CU or CYP2C9-MUT2-CU construct, indicating that hsa-miR-128-3p modulates CYP2C9 expression in a sequence specific manner by targeting its non-mutated 3′UTR. [score:7]
Suppression of endogenous CYP2C9 expression/translation by exogenous hsa-miR-128-3p. [score:7]
The treatment -induced hsa-miR-128-3p expression changes were accompanied by inverse alterations in the expression of CYP2C9 gene expression (Fig. 4b) and protein production (Fig. 4c and 4d). [score:7]
Interestingly, no statistically significant correlation between PTEN mRNA (as a known miR-128 target) levels and hsa-miR-128-3p levels was observed in those tissues (Supplementary Fig. S5), probably due to the complexity and high heterogeneity of gene expression in tumor tissue. [score:5]
Two chemicals, with strong negative or positive effect on hsa-miR-128 expression, were used to produce CYP2C9 alterations through the modulation of hsa-miR-128 expression. [score:5]
We first transfected the hsa-miR-128-3p or hsa-miR-143-3p mimics into liver HepG2 and kidney 293T cells, together with a reporter gene (luciferase) plasmid containing the core region of CYP2C9 3′-UTR, and found that hsa-miR-128-3p suppressed luciferase activity in both liver cells and kidney cells, while hsa-miR-143-3p exhibited a relatively smaller suppression effect only in kidney cells. [score:5]
Inverse correlation between hsa-miR-128-3p and CYP2C9 expression in HCCThe expression levels of hsa-miR-128-3p and CYP2C9 mRNA in human HCC tumor tissue samples and adjacent normal liver samples were extracted from The Cancer Genome Atlas (TCGA) database. [score:5]
Chemical compounds NSC-156306 and NSC-606170 affected endogenous CYP2C9 expression by altering the expression of hsa-miR-128-3p in HepaRG cells. [score:5]
The hsa-miR-128-3p and hsa-miR-143-3p suppressed reporter gene expression. [score:5]
Notably, transfection of hsa-miR-128-3p was more efficient at suppressing CYP2C9 protein expression than transfection of the CYP2C9-specific siRNA positive control (Fig. 3b, 3c and 3d). [score:5]
The hsa-miR-128-3p suppressed endogenous CYP2C9 expression in HepaRG cells. [score:5]
Modulation of CYP2C9 expression/translation through chemically -induced alteration of hsa-miR-128-3p levels. [score:5]
PTEN was proved to be negatively associated with hsa-miR-128-3p level in pituitary cells, probably due to hsa-miR-128-3p targeting BMI1, one transcriptional suppressor of PTEN 28. [score:5]
gov/cellminer), chemical compounds NSC-156306 and NSC-606170 appear to inhibit or induce, respectively, the expression of hsa-miR-128 in human liver tissue. [score:5]
Our results showed that enforced up-regulattion of hsa-miR-128-3p reduced CYP2C9 production at both the protein and mRNA levels, indicating that hsa-miR-128-3p is at least involved in CYP2C9 mRNA degradation. [score:4]
The results confirmed that the dramatic changes in hsa-miR-128-3p expression caused by these two compounds (Fig. 4a) indeed altered the CYP2C9 expression/production inversely (Fig. 4b, 4c and 4d), which is consistent with the transfection assays. [score:4]
In this study, we demonstrated that hsa-miR128-3p plays a pivotal role in the regulation of CYP2C9 expression in human liver using series of in silico, in vitro, and in vivo analyses. [score:4]
To test the potential effects of hsa-miR-128-3p and hsa-miR-143-3p on CYP2C9 expression, a reporter construct retaining the core region of the CYP2C9 3′-UTR that harbors the putative binding sites for hsa-miR-128-3p and hsa-miR-143-3p was constructed and then co -transfected into HepG2 and 293T cells together with the hsa-miR-128-3p mimic, hsa-miR-143-3p mimic, or miRNA negative control. [score:3]
The solid vertical line indicates base pairing and the numbering used for the hsa-miR-128-3p and hsa-miR-143-3p target sequences (88–108 or 161–181, respectively) is consistent with that given for the CYP2C9 3′-UTR in NM_000771. [score:3]
gov/cellminer), which integrates the molecular and pharmacological data sets for the NCI-60 cell lines, was used to select the chemical compounds that have demonstrated positive or negative correlations with hsa-miR-128-3p expression. [score:3]
Spearman Rank Order Correlation analysis was used to test the correlation between CYP2C9 levels and hsa-miR-128-3p expression. [score:3]
Relationship between CYP2C9 mRNA expression and hsa-miR-128-3p level in HCC and paired non-tumor tissues. [score:3]
RNA expression levels of CYP2C9 and hsa-miR-128-3p were obtained from The Cancer Genome Atlas database (TCGA, http://cancergenome. [score:3]
For example, hsa-miR-128 is aberrantly expressed in many types of tumors, including acute lymphoblastic leukemia, glioblastoma, and breast cancer. [score:3]
The expression levels of hsa-miR-128-3p and CYP2C9 mRNA in human HCC tumor tissue samples and adjacent normal liver samples were extracted from The Cancer Genome Atlas (TCGA) database. [score:3]
By targeting EGFR, Bim-1, ABCC5 and other genes, hsa-miR-128 is involved in tumor differentiation, proliferation, invasion, apoptosis and resistance to drugs 39. [score:3]
The RNA expression levels of CYP2C9 or hsa-miR-128-3p were calculated relative to expression of GAPDH or U6, respectively. [score:3]
hsa-miR-128-3p and hsa-miR-143-3p suppress CYP2C9 3′-UTR luciferase reporter. [score:3]
There were 28 and 27 tumor and non-tumor samples respectively that had expression data for hsa-miR-128-3p and CYP2C9. [score:3]
The hsa-miR-128-3p mimic was able to bind the probe with the free energy of −20.5 kcal/mol (Fig. 2b, lane 8), but not the ones with free energy of −18.0 kcal/mol, or −15.8 kcal/mol (Fig. 2b, lane 7 or 9), showing a correlation between the predicted free energy of binding directly and the observed interaction between miRNAs and their counterparts, which we propose should also correlate with the efficiencies of gene regulation by these miRNAs. [score:3]
Inverse correlation between hsa-miR-128-3p and CYP2C9 expression in HCC. [score:3]
We did observed that the inherent CYP2C9 mRNA level in HepaRG cells was ~10-fold and ~20-fold greater than those in 293T cells and HepG2 cells, respectively, while the hsa-miR-128-3p was expressed in a similar level among these cell lines (Supplementary Fig. 3a). [score:3]
Fig. 4 shows that treatment of the HepaRG cells with 100 nmol/L NSC-156306 resulted in a significant decrease in the expression of hsa-miR-128-3p and that its level was markedly increased after treating cells with NSC-606170 (Fig. 4a). [score:3]
Further, we used RNA EMSA to test the binding efficiencies between hsa-miR-128-3p and three other target sequences with different free energies of binding predicted by the RNAhybrid software. [score:3]
Fig. 2a shows that hsa-miR-128-3p was able to bind the corresponding target sequence of CYP2C9 3′-UTR (lane 3) and competition assays showed the binding is sequence-specific (lanes 7, 8). [score:2]
Compared to the related hsa-miR-143-3p complex, the enhanced thermodynamic stability predicted for the hsa-miR-128-3p complex with its CYP2C9 3′-UTR target sequence correlated with results from RNA EMSA experiments, confirming the in vitro stability of the latter complex only. [score:2]
Besides, CYP2C9-MUT1-CU or CYP2C9-MUT2-CU construct, which with mutated hsa-miR-128-3p target sequences in the CYP2C9 3′UTR, was created by site-directed mutagenesis using CYP2C9-MUT1-F and CYP2C9-MUT1-R primers, or CYP2C9-MUT2-F and CYP2C9-MUT2-R primers, respectively. [score:2]
Free energy directly affected the interaction between hsa-miR-128-3p and its counterparts. [score:2]
To investigate the specificity of hsa-miR-128-3p suppressing CYP2C9 3′UTR, CYP2C9-MUT1-CU and CYP2C9-MUT2-CU constructs (with mutated hsa-miR-128-3p targeting sequences in the CYP2C9 3′UTR), were created and applied in the reporter gene assays. [score:2]
In tumor tissues, there is a negative correlation between hsa-miR-128-3p and CYP2C9 (r = −0.424, P = 0.025, Fig. 5b), but in non-tumor tissues there is no significant correlation (r = −0.204, P = 0.304, Fig. 5b). [score:1]
Lanes 1 and 4 show mobility of the labeled hsa-miR-128-3p oligonucleotide with corresponding CYP2C9, and PAIP2 mRNA probes with the free energy of −23.9 kcal/mol and −20.5 kcal/mol, respectively. [score:1]
Data were shown as relative hsa-miR-128-3p levels versus U6. [score:1]
Finally, the correlation between the expression of CYP2C9 and hsa-miR-128-3p in HCC tissues was evaluated using the GSE22058 and TCGA datasets. [score:1]
In silico analysis predicted that hsa-miR128-3p and hsa-miR143-3p might form complexes with target sequences present in the 3′-UTR of CYP2C9 to yield unique structures with different calculated free energies of binding: −23.9 kcal/mol for hsa-miR128-3p (Supplementary Fig. S2a) and −16.1 kcal/mol for hsa-143-3p (Supplementary Fig. S2b). [score:1]
In addition, we found that the miRNA-mRNA complex, formed by hsa-miR-128-3p with CYP2C9 3′UTR, or with PAIP2 3′UTR, could be eliminated by adding 50× unlabeled hsa-miR-128-3p probe(Fig. 2c, lane 3 or 6), but not by adding a nonspecific probe (Cold-NC) (Fig. 2c, lane 2 or 5), suggesting the binding between hsa-miR-128-3p and its cognate 3′UTR of CYP2C9 or PAIP2 is in a sequence-specific manner. [score:1]
In addition, we also observed that the PTEN mRNA level was decreased significantly after NSC-606170 treatment in HepaRG cells (67.6% at 10 nmol/L and 75.3% at 100 nmol/L; all P < 0.05) (Supplementary Fig. S4b), suggesting that the modulation of hsa-miR-128-3p by NSC-606170 was obtained. [score:1]
The relationship between hsa-miR-128-3p and CYP2C9 expression was evaluated by the Spearman Rank Order Correlation analysis in patient matched tumor and non-tumor tissues. [score:1]
When the cells reached 70%–80% confluence, they were transfected with the CYP2C9-CU plasmid (100 ng/well) that contains the 3′-UTR of CYP2C9 together with 50 nmol/L (final concentration) hsa-miR-128-3p mimic, hsa-miR-143-3p mimic, or miRNA negative control (Thermo Scientific, Tewksbury, MA) using the Lipofectamine reagent 2000 (Life Technologies, Carlsbad, CA). [score:1]
To determine whether or not hsa-miR-128-3p or hsa-miR-143-3p is able to bind its cognate CYP2C9 3′-UTR mRNA sequence in vitro, RNA EMSA was performed. [score:1]
The rank sum test was used to evaluate the difference in the expression of CYP2C9 or hsa-miR-128-3p in HCCs, with P < 0.05 as the significant criterion. [score:1]
Fig. 3a shows that the level of hsa-miR-128-3p was dramatically increased by more than 200-fold after transfection with hsa-miR-128-3p mimics at concentrations of 25 nmol/L or 50 nmol/L. [score:1]
Arrow indicates an oligonucleotide complex (yellow) in Lane 3. * or † indicates the CYP2C9 mRNA oligonucleotides retaining the hsa-miR-128-3p or hsa-miR-143-3p recognition sites, repectively. [score:1]
Lanes 1, 2, 3, 4, and 5 show mobility of the labeled oligonucleotides; Lanes 6, 7, 8 and 9 show mobility of the labeled hsa-miR-128-3p oligonucleotide with corresponding CYP2C9, PAIP2, or PFKFB4 mRNA probes with different free energy. [score:1]
Arrows indicate the oligonucleotide complex (yellow) in Lane 1, 2, 3, 4 and 5. Differentiated HepaRG cells were transiently transfected with 25 nmol/L or 50 nmol/L hsa-miR-128-3p mimic, CYP2C9-specific siRNA, or miRNA negative control, respectively, and harvested 48 hours after transfection. [score:1]
Interaction between CYP2C9 3′-UTR and hsa-miR-128-3p or hsa-miR-143-3p. [score:1]
It was observed that only the probes with free energy of less than −20 kcal/mol could bind hsa-miR-128-3p under our experimental conditions. [score:1]
In addition, the CYP2C9 protein level decreased significantly (76.7%) when the cells were transfected with 50 nmol/L hsa-miR-128-3p mimics in comparison with the transfection of the miRNA negative control (Fig. 3c and 3d). [score:1]
293T and HepG2 cells were transiently transfected with the CYP2C9- CU, CYP2C9-MUT1-CU (containing a mutated sequence in the 3′UTR of CYP2C9), or CYP2C9-MUT2-CU (containing another mutated sequence in the 3′-UTR of CYP2C9) plasmid, together with 50 nmol/L hsa-miR-128-3p mimic, hsa-miR-143-3p mimic, or miRNA negative control, respectively, and harvested 48 hours after transfection. [score:1]
Transfection of HepaRG cells with hsa-miR-128-3p and treatments with chemical compounds. [score:1]
Briefly, 25 nmol/L or 50 nmol/L (final concentration) hsa-miR-128-3p mimic, miRNA negative control, or CYP2C9-specific siRNA (positive control), was transfected into the differentiated HepaRG cells using Lipofectamine transfection reagent (Life Technology), and cells were harvested 48 hours after transfection. [score:1]
The miRNA oligonucleotides hsa-miR-128-3p and hsa-miR-143-3p were labeled with cy5.5™ dye on their 5′ ends. [score:1]
Lanes 2, 3, 5 or 6 show mobility of the labeled hsa-miR-128-3p oligonucleotide with corresponding CYP2C9 and PAIP2 mRNA probes, in the presence of unlabeled excess nonspecific competitor (Cold-NC) and excess specific competitor (Cold hsa-miR-128-3p), respectively. [score:1]
Data are shown as relative hsa-miR-128-3p levels versus U6. [score:1]
Several miRNAs, including hsa-miR-128-3p and hsa-miR-143-3p, were identified in all three databases. [score:1]
To explore the applicability of this predictive strategy further, we calculated the free energy of binding between hsa-miR-128-3p and 3 other putative target sequences (2 probes from the PAIP2 3′-UTR and 1 probe from the PFKFB4 3′-UTR). [score:1]
[1 to 20 of 72 sentences]
4
[+] score: 232
*Only one out of 38 deregulated and predicted target genes was upregulated BCL2 has no predicted target sites for miR-128 and, as previously mentioned, resulted to be upregulated upon miR-128 overexpression (FC = 1.69, third most upregulated gene) in our microarray experiment. [score:17]
Considering a fold-change (FC) cutoff of 1.2 and a q-value <5, we could identify a total of 183 deregulated genes after miR-128 overexpression in SH-SY5Y cells - 116 downregulated and 67 upregulated - with a maximum FC of ~1.8 for upregulated genes and -2 for downregulated genes. [score:16]
Finally, microarray results were compared to target predictions, in order to check whether any of the deregulated genes could potentially be direct targets of miR-128; such genes would undergo miRNA -mediated regulation through mRNA cleavage rather than translational repression. [score:9]
Enzymes implicated in these pathways show a marked predominance of downregulation over upregulation, indicating that metabolic processes may in general be inhibited or impaired in miR-128 -transfected cells. [score:9]
In addition, we demonstrate that, among the miRNAs that inhibit the truncated isoform, the overexpression of miR-128 - a brain-enriched miRNA - in SH-SY5Y neuroblastoma cells alters the expression profile of genes involved in cytoskeletal organization and of genes related with apoptosis and cell cycle regulation, including the anti-apoptotic factor BCL2. [score:8]
Table 5 shows the intersection of the 183 genes deregulated by miR-128 overexpression (FC cutoff of 1.2 and a q-value <5) and the putative target genes predicted by TargetScan. [score:8]
Of 669 total predicted miR-128 targets, 38 were deregulated (5.7%), a number that is higher than expected by chance (chi square test, p < 10 [-6]) and indicates a significant enrichment for deregulated genes among predicted targets. [score:7]
Another consequence of the overexpression of miR-128 in SH-SY5Y cells is an increase in cell number, which is accompanied by the deregulation of genes involved in apoptosis, cell death/survival and proliferation, with a remarkable upregulation of BCL2. [score:7]
Overexpression of miR-128 upregulates BCL2. [score:6]
The upregulation of BCL2 in miR-128 -transfected cells could explain the observed increase in cell number, which is consistent with enhanced apoptosis inhibition. [score:6]
In addition, overexpression of the brain-enriched miRNA miR-128 - one of the miRNAs that regulates the truncated isoform of NTRK3 - causes morphological changes in neuroblastoma cells and alters the expression profile of genes involved in cytoskeletal organization, apoptosis and cell proliferation, including the anti-apoptotic factor BCL2. [score:6]
Intriguingly, miR-128 is expressed in brain, whereas miR-509 is not present in brain but shows a strong expression in kidney and testis. [score:5]
Interestingly, miR-151-3p and miR-185 have partially overlapping target sequences in the full-length isoform and, in a similar way, miR-128, miR-509 and miR-768-5p target the same segment of the 3'UTR of the truncated isoform (Figure 1B). [score:5]
In order to gain insight into the role of miR-128, the effects of its overexpression were further analyzed using whole genome expression microarrays (Illumina's HumanRef-8 v3.0 beadchips). [score:5]
As for TR-NTRK3 (Figure 3C), a significant downregulation, ranging between 20% and 30%, was observed with miR-128, miR-485-3p, miR-765 and miR-768-5p; the strongest repression was caused by miR-128 (32% reduction) and miR-485-3p (30%). [score:4]
Cells were therefore transfected with an siRNA directed against TR-NTRK3, which targets an isoform-specific sequence located within the 3'UTR region and reduces TR-NTRK3 levels by approximately 25% - a degree of repression comparable to that observed with miR-128. [score:4]
Enhanced G0 could possibly explain the increase in cell number associated with miR-128 and is compatible with the general downregulation of metabolic pathways indicated by the microarray analysis. [score:4]
In particular, we show that the overexpression of miR-128 - a brain enriched miRNA - causes morphological changes in SH-SY5Y neuroblastoma cells similar to those observed using an siRNA specifically directed against truncated NTRK3, as well as a significant increase in cell number. [score:4]
These results suggest an involvement of miR-128 in the organization of the cytoskeleton through the regulation of NTRK3, possibly in cooperation with other miR-128 targets. [score:4]
Given that miR-128 downregulates TR-NTRK3, it was reasonable to speculate that the repression of this variant could be responsible for at least part of the observed effects. [score:4]
The possible effect of the upregulation of BCL2 on the activation of apoptotic markers, such as caspase-3 and caspase-9, in cells transfected with miR-128 was also analyzed by western blotting. [score:4]
Here, we show that the overexpression of miR-128 causes morphological changes in SH-SY5Y cells, which resemble those observed using an siRNA specifically directed against TR-NTRK3. [score:4]
In fact, we identify one miRNAs regulating the full-length isoform of NTRK3 (miR-151-3p) and 4 miRNAs regulating the truncated isoform (miR-128, miR-485-3p, miR-765 and miR-768-5p). [score:3]
miR-128 overexpression affects the morphology and number of SH-SY5Y cells. [score:3]
Representative WB experiment of SH-SY5Y cells transfected with an anti-miR-128 LNA inhibitor and a control. [score:3]
Click here for file Representative WB experiment of SH-SY5Y cells transfected with an anti-miR-128 LNA inhibitor and a control. [score:3]
Furthermore, accumulation of miR-128 has been detected in the hippocampus of Alzheimer's disease brains [31]. [score:3]
miR-128 is a brain-enriched miRNA, whose expression has been shown to positively correlate with neuronal differentiation [27, 28]. [score:3]
In accordance with the morphological changes, as revealed by microarray analysis, miR-128 alters the expression of genes involved in cytoskeletal organization, a process with which the truncated isoform has been related. [score:3]
Figure 8 Molecular network showing the highest percentage of genes altered by the overexpression of miR-128. [score:3]
In SH-SY5Y cells, in agreement with the miRNA microarray experiment described before, miR-128 showed low levels of expression, with average crossing point (Ct) values ranging from ~33 to ~35. [score:3]
The analysis confirmed that miR-128 is strongly expressed in the brain, and high levels were also detected in skeletal muscle, followed by thymus and kidney (Figure 7A). [score:3]
Nevertheless, we could indeed observe an increase in miR-128 expression upon RA treatment (Figure 7B). [score:3]
The expression of miR-128 was analyzed by real-time quantitative RT-PCR in a set of human tissues (adult brain, colon, heart, kidney, liver, lung, ovary, skeletal muscle, spleen, testis, thymus and placenta) as well as in SH-SY5Y cells at different stages of RA treatment. [score:3]
The most conspicuous inhibition was detected with miR-625 (62% reduction), miR-509 (47%) and miR-128 (32%), while the other five miRNAs gave a reduction ranging between 13% and 30%. [score:3]
A. Two-parameter forward/side scatter (FSC/SSC) flow cytometry analysis of SH-SY5Y cells transfected with a non -targeting control and miR-128. [score:3]
Total RNA samples obtained from four independent experiments (SH-SY5Y cells transfected with miR-128 and the related negative controls) were analyzed on HumanRef-8 BeadChips from Illumina, which target 24,500 well-annotated RefSeq transcripts. [score:3]
miR-128 is a brain-enriched miRNA, whose expression has been shown to correlate and increase with neuronal differentiation [27, 28]. [score:3]
Accordingly, transcriptome analysis of cells transfected with miR-128 revealed an alteration of the expression of genes implicated in cytoskeletal organization as well as genes involved in apoptosis, cell survival and proliferation, including the anti-apoptotic factor BCL2. [score:3]
A. Cells were transfected with a non -targeting control (A,B,C) and with miR-128 (D,E,F); morphological changes (rounded bodies, shorter neurites and smaller cell size) were observed in cells transfected with miR-128. [score:3]
In the case of miR-128, the miRNA that caused the strongest reduction in TR-NTRK3 levels, we performed antisense experiments using LNA miRNA inhibitors. [score:3]
Three natural mutations occurring in the 3'UTR of TR-NTRK3 had been previously identified, which fall within the predicted binding sites of these four miRNAs [19]: ss102661458 at the binding sites for miR-768-5p (A-> C at the +3 seed region position) and miR-128 (+13 position), rs28521337 at the binding site for miR-485-3p (G-> C at the +3 seed region), and ss102661460 at the binding site for miR-768-5p (C-> G at the +3 seed region). [score:2]
Figure 7Real-time RT-PCR analysis of miR-128 expression using TaqMan [® ]miRNA assays. [score:2]
The expression levels of miR-128 in different human tissues and in SH-SY5Y cells were analyzed using the TaqMan [® ]MicroRNA Assays, following the manufacturer's instructions. [score:2]
Blocking endogenous miR-128, we could observe a slight increase (over 10%) in the levels of TR-NTRK3 compared with the control (Additional file 3); however, the difference did not reach statistical significance, probably due to the low basal expression of miR-128 in this cell system. [score:2]
Thirteen combinations of two miRNAs were tested, but we could not detect a significant decrease in luciferase expression compared with the corresponding miRNAs taken individually; a combination of the three most effective miRNAs - miR-128, 509 and 625 - was also analyzed and no synergistic effect was observed (Additional file 2). [score:2]
In the case of pGL4.13-TR, the luciferase activity was significantly reduced by 8 miRNAs (Figure 1A), all of which were predicted by at least one program: miR-128, miR-324-5p, miR-330, miR-485-3p, miR-509, miR-625, miR-765 and miR-768-5p. [score:1]
Transcriptome analysis of SH-SY5Y cells transfected with miR-128. [score:1]
B. Counting of undifferentiated SH-SY5Y cells transfected with miR-128, the a TR-NTRK3-specific siRNA and the corresponding negative controls. [score:1]
While in most cases there were no appreciable differences, considerable changes were observed after transfection with miR-128 (Figure 5A): cells acquired rounded bodies with shorter neurites, the overall cell size looked smaller than control cells and the culture confluence appeared to be higher, suggesting an increase in the total number of cells. [score:1]
It is worth of notice that while both miR-128 and miR-509 cause a strong reduction in luciferase activity (30-50%), only miR-128 seems to repress the corresponding protein isoform in SH-SY5Y cells. [score:1]
Finally, transfected cells were counted with a Coulter cell counter, showing that the total number of cells in plates transfected with miR-128 was 27% higher than in control plates (Figure 6B). [score:1]
Figure 9 Western blot analysis of BCL2 levels and caspase activation in undifferentiated cells transfected with miR-128. [score:1]
Cells cultured on 6-well plates and transfected with miR-128, the TR-NTRK3-specific siRNA (sense 5'-gagucuaugccuuuggcaatt-3', antisense 5'-uugccaaaggcauagacuctt-3', Gene Link) and the related negative controls were trypsinized and resuspended in 1 mL DMEM; 100 μL of each sample were then diluted in 10 mL of Coulter Isoton II diluent (Beclman Coulter) and counted using a Z2™ Series Coulter Particle Count and Size Analyzer (Beckman Coulter). [score:1]
The second part of this study focused on miR-128, one of the miRNAs repressing the truncated isoform. [score:1]
Luciferase-validated miRNAs were therefore transfected into either undifferentiated (miR-128, miR-324-5p, miR-330, miR-485-3p, miR-509, miR-625, miR-765 and miR-768-5p) or differentiated SH-SY5Y cells (miR-151-3p and miR-185), and protein levels were assessed by western blotting 72 h after transfection. [score:1]
Although an increase in the levels of TR-NTRK3 was observed with the anti-miR-128, the difference did not reach statistical significance (three independent experiments were performed). [score:1]
This change in miR-128 levels, also observed by microarray analysis, is consistent with the hypothesis that it contributes to the repression of TR-NTRK3 during RA -mediated differentiation of SH-SY5Y cells. [score:1]
Interestingly, the morphology of cells was similar to that described for miR-128 (Figure 5B), supporting the hypothesis that TR-NTRK3 plays a part in the morphological phenotype. [score:1]
In addition, these findings open new perspectives for the study of the physiological role of miR-128 and its possible involvement in cell death/survival processes. [score:1]
It would be therefore interesting to analyze the effects of miR-128 in the presence of apoptosis-promoting agents. [score:1]
We identify one microRNA (miR-151-3p) that represses the full-length isoform of NTRK3 and four microRNAs (miR-128, miR-485-3p, miR-765 and miR-768-5p) that repress the truncated isoform. [score:1]
These findings open new perspectives for the study of the physiological role of miR-128 and its possible involvement in cell death/survival processes. [score:1]
The morphology of cells transfected with the siRNA resembles that of cells transfected with miR-128. [score:1]
SH-SY5Y cells transfected with miR-128 and the related negative controls were trypsinized and resuspended in PBS 72 h after transfection cells. [score:1]
[1 to 20 of 65 sentences]
5
[+] score: 210
Other miRNAs from this paper: hsa-mir-128-1
Here, we demonstrate that overexpression of miR-128-3p down-regulates SPTAN1 expression via translational repression and results in the failure to recruit FANCA and XPF to facilitate chromosomal instability after MMC -induced DNA ICL damage in lung cancer cells. [score:10]
This conclusion is supported by several lines evidence: increased expression of miR-128-3p and decreased expression of SPTAN1 in lung cancer cells treated with MMC; a putative SPTAN1 binding site in the 3′-UTR that is subject to miR-128-3p regulation; overexpression of miR-128-3p augmented MMC -mediated chromosomal instability and cell cycle arrest of G2/M phase in lung cancer cells; these biological dysfunctions were caused by disruption of the αII Sp/FANCA/XPF complex induced by miR-128-3p. [score:8]
We transfected A549 cells with equal doses of scrambled ncRNA, miR-128-3p mimic or miR-128-3p inhibitor and analyzed SPTAN1 mRNA expression by RT-PCR at 24 h post-transfection. [score:5]
Multiple target prediction programs were applied for determining the potential targets of miR-128-3p. [score:5]
MiR-128-3p directly targets SPTAN1 via translational repression. [score:5]
The percentage of inhibitor scramble -treated cells in G2/M phase was 31.88%, and that of miR-128-3p inhibitor -transfected cells was 27.6% (Figure 2A). [score:5]
Synthetic miR-128-3p mimic, miR-128-3p inhibitor and scrambled negative control RNAs (mimic scramble and inhibitor scramble) were purchased from GenePharma (Shanghai, China). [score:5]
In another report, in situ hybridization revealed that miR-128 expression is decreased in chemoresistant tumor tissues but increased in chemosensitive tissues, and the level of miR-128 expression in breast cancer tissues was correlated with patient response to novel adjuvant chemotherapy and survival [13]. [score:5]
MMC treatment not only cross-links DNA but also inhibits expression of SPTAN1 through miR-128-3p to disrupt recruitment of DNA repair -associated proteins (FANCA and XPF), with dual destructive effects in lung cancer cells. [score:5]
MiR-128 targets ZEB1 in prostate cancer, and the miR-128- ZEB1 axis could be a promising prognostic and therapeutic target for future prostate cancer therapy. [score:5]
MiR-128-3p targets SPTAN1 via translational repressionMiRNAs are crucial regulators in lung cancer. [score:5]
For luciferase reporter assays, A549 cells were cultured in 24-well plates, and each well was transfected with 1 μg of firefly luciferase reporter plasmid, 1 μg of β-galactosidase expression vector (Ambion), and equal amounts of scrambled ncRNA, miR-128-3p mimic, or miR-128-3p inhibitor using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:4]
It has been found that aberrant expression of miR-128 occurs in malignant tumors, and this miRNA has been identified as a key regulator of oncogenic properties. [score:4]
However, we repeated the above experiments and determined whether overexpression or knockdown of miR-128-3p had an impact on the level of αII Sp protein by western blotting at 24 h post-transfection. [score:4]
Up-regulation of miR-128-3p causes G2/M arrest and chromosomal instability. [score:4]
Collectively, these findings strongly indicate that miR-128-3p can directly recognize the binding site in the 3′-UTR of SPTAN1 and mediate posttranscriptional inhibition of the gene. [score:4]
SPTAN1 mRNA expression in all miR-128-3p mimic/inhibitor -transfected cells remained unchanged compared to that in all corresponding ncRNA -transfected cells (Figure 1H). [score:4]
Overexpression or knockdown of miR-128-3p. [score:4]
MiR-128-3p targets SPTAN1 via translational repression. [score:4]
Conversely, co-localization of FANCA or XPF with αII Sp in miR-128-3p inhibitor -transfected cells was greatly enhanced compared to that in inhibitor scramble -transfected cells. [score:4]
In contrast, knockdown of miR-128-3p in A549 cells by a miR-128-3p inhibitor led to a reduction in cells in G2/M phase (Figure 2C). [score:4]
In the present study, we found that SPTAN1 is predicted to be a direct target of miR-128-3p. [score:4]
These findings demonstrate that miR-128-3p is capable of regulating SPTAN1 through translational repression. [score:4]
Therefore, other miRNAs or other miR-128-3p target genes might be involved in this process. [score:3]
For each well, equal doses of miR-128-3p mimic, miR-128-3p inhibitor or scrambled ncRNA were added. [score:3]
Figure 1F illustrates the predicted interaction of miR-128-3p and the target site in the SPTAN1 3′-UTR (MFE = −27.9 kcal/mol). [score:3]
Thus, we next sought to confirm which mechanism miR-128-3p uses to modulate SPTAN1 expression. [score:3]
The miR-128-3p- SPTAN1 axis provides a novel avenue for understanding the mechanism of chemosensitivity, and miR-128-3p could be a candidate molecular target for improving the efficacy of lung cancer chemotherapy. [score:3]
The S-phase fractions of the control and miR-128-3p inhibitor groups were 27.8% and 38.69%, respectively. [score:3]
An inverse correlation between miR-128-3p expression and αII Sp protein level in lung cancer treated with MMC was confirmed experimentally. [score:3]
Accumulating evidence has shown aberrant miR-128 expression in tissues and blood from patients with many types of malignant tumors [7– 12]. [score:3]
Volinia et al. examined 540 different types of malignant tumor samples by miRnome analysis and found significant increases in expression of miR-128 in colon, lung and pancreatic cancer [7]. [score:3]
Abnormal expression of miR-128 contributes to the malignant phenotypes of cancer cells, such as proliferation [33], cell motility, invasion [34, 35], apoptosis [36] and self-renewal [37]. [score:3]
In addition to the above-mentioned findings, we here present the first evidence that miR-128-3p enhances MMC -induced chromosomal aberrations and cell cycle arrest at G2/M phase by targeting SPTAN1. [score:3]
Here, we note that overexpression of miR-128 remarkably hindered DNA repair to contribute to the anti-cancer function of MMC and sensitized MMC -mediated chemotherapy in lung cancer. [score:3]
A549 cells were transfected with scrambled ncRNA, miR-128-3p mimic, miR-128-3p inhibitor or SPTAN1 siRNA, and subsequently treated (24 h post transfection) with MMC. [score:3]
MMC -induced chromosomal aberrations and miR-128-3p expression in lung cancer cells. [score:3]
Transfection with siRNA against αII Sp yielded an effect similar to that obtained via overexpression of miR-128-3p (Figure 2D). [score:3]
MiR-128 is also down-regulated in glioma tissue and serum and could be used as potential biomarker in glioma identification, early diagnosis, classification and prognosis prediction [31]. [score:3]
To determine whether miR-128-3p influences interaction of the αII Sp/FANCA/XPF complex by inhibiting SPTAN1, immunofluorescent co-localization and co-immunoprecipitation (co-IP) experiments were performed. [score:3]
Apparently, miR-128-3p inhibitor boosted the abundances of αII Sp, FANCA or XPF (20%, 28% or 30%). [score:3]
Cells transfected with scrambled ncRNA, miR-128-3p mimic, miR-128-3p inhibitor or SPTAN1 siRNA were incubated for 24 h, and subsequently treated with MMC and incubated for an additional 24 h. Colcemid (0.1 μg/ml) (Sigma-Aldrich, USA) was added 22 h after MMC treatment and incubation continued for 2 h. The cells were harvested, swollen in hypotonic solution, fixed and slides stained with 4′-6′ diamidino-2-phenylindole (DAPI). [score:3]
Completely different from the traditional function of DNA ICLs caused by MMC, the miR-128-3p- SPTAN1 axis is a novel molecular mechanism for inhibiting the repair of DNA ICLs and could serve as an excellent potential auxiliary to treat lung cancer. [score:3]
A luciferase assay was performed to examine whether SPTAN1 is a direct target of miR-128-3p. [score:3]
As hypothesized, compared to treatment with scrambled ncRNA, the miR-128-3p mimic decreased the luciferase activity to 35% of that of the reporter containing the miR-128-3p binding site, whereas a miR-128-3p inhibitor increased activity by 19%. [score:2]
Co-IP were undertaken to ascertain whether miR-128-3p regulate the interaction between αII Sp and FANCA or XPF. [score:2]
Mutations in complementary seed sites almost fully rescued the repression of reporter activity caused by the miR-128-3p mimic (Figure 1G). [score:2]
MiR-128-3p was found to disrupt the cell cycle in lung cancer by targeting SPTAN1. [score:2]
To further identify the influence of miR-128-3p on chromosomal stability, overexpression or knockdown of miR-128-3p in A549 cells was evaluated for effects on chromosomal morphological changes using metaphase spread analysis. [score:2]
In this study, we describe a novel function for miR-128-3p, whereby regulation of chromosomal stability and cell cycle progression occur through SPTAN1 in lung cancer cells treated with MMC. [score:2]
We generated mutations in the corresponding complementary seed sites in the 3′-UTR of SPTAN1 to eliminate the predicted miR-128-3p binding. [score:2]
Cells transfected with the miR-128-3p mimic showed a level of αII Sp protein that was reduced to almost half of that of cells transfected with scrambled ncRNA; in contrast, the protein level of αII Sp increased by 30% in miR-128-3p inhibitor -transfected cells compared to scrambled ncRNA -transfected cells (Figure 1I and 1J). [score:2]
To investigate whether miR-128-3p and SPTAN1 can affect the cell cycle after MMC -mediated DNA ICL damage, miR-128-3p was overexpressed or knocked down in A549 cells, and the cells were examined by flow cytometry (Figure 2A). [score:2]
Taken together, we extend the current knowledge by highlighting the role of miR-128-3p in the sensitivity of lung cancer to chemotherapy. [score:1]
SPTAN1 siRNA showed a similar effect as the miR-128-3p mimic. [score:1]
Thus, these results indicate miR-128-3p breaks the formation of αII Sp/FANCA/XPF complex by eliminating αII Sp. [score:1]
These results indicate that miR-128-3p and αII Sp are reversely correlated. [score:1]
These results suggest that miR-128-3p promoted chromosome instability by silencing SPTAN1 (Figure 2E and 2F). [score:1]
We also transfected A549 cells with SPTAN1 siRNA and siRNA scramble, which showed a 51% decrease and the same effect as observed in the miR-128-3p mimic -transfected cells (Figure 1I and 1J). [score:1]
MiR-128-3p regulates the cell cycle and chromosomal aberrations. [score:1]
These results indicate that miR-128-3p blocked cell cycle progression by arresting cells in G2/M phase. [score:1]
Sequence alignment of putative miR-128-3p binding sites across species are marked by a gray background. [score:1]
Both miR-128-3p and αII Sp are essential for the function of MMC in causing chromosomal aberrations and cell cycle arrest. [score:1]
SPTAN1 siRNA and miR-128-3p mimic have similar effects to their interaction of the complex. [score:1]
MiR-128 promotes proliferation in osteosarcoma cells by down -regulating PTEN [32]. [score:1]
Figure 2A shows a representative experiment in which 32.87% of miR-128-3p scramble -treated cells were in G2/M phase but 38.98% of miR-128-3p mimic -treated cells were in G2/M phase. [score:1]
As Figure 3C and 3D showed, cells transfected with miR-128-3p mimic made 58%, 27% or 46% reduction in protein levels of αII Sp, FANCA or XPF respectively relative to the cells transfected with ncRNAs. [score:1]
Reduced miR-128 was first found in glioblastoma [29], and miR-128 is involved in multiple signal pathways associated with head and neck squamous cell carcinoma progression and growth [30]. [score:1]
Gain of function of miR-128-3p following mimic transfection resulted in an increase in the population of cells in G2/M phase, with a concomitant decrease in the fraction of cells in S phase (Figure 2B). [score:1]
The resulting plasmid was transfected into A549 cells along with a transfection control plasmid and a miR-128-3p mimic or scrambled ncRNA. [score:1]
To investigate the molecular mechanism by which MMC alters chromosomal stability to kill cancer cells, the levels of miR-128-3p and SPTAN1 expression were detected, as abundant data indicate their important functions in chromosomal instability, DNA ICLs and cancer [12, 16, 27, 28]. [score:1]
[1 to 20 of 71 sentences]
6
[+] score: 197
Other miRNAs from this paper: hsa-mir-21, hsa-mir-128-1
Those expression levels were significantly downregulated by the combined treatment of BRM270 with miR-128 inhibitor compared with the cells treated with miR-128 inhibitor or the cells treated with miR-128 inhibitor NC as observed by western blot (Supplementary Figure  2). [score:11]
Notably, miR-128 was downregulated whereas VEGF-C was upregulated in breast cancer tissue and cells and directly targeted VEGF-C in human bladder cancer cells [22]. [score:10]
Bigger tumors were observed in the mice treated with miR-128 inhibitor and smaller tumors were observed in the mice treated with BRM270+miR-128 inhibitor compared with the mice treated with miR-128 inhibitor NC, as determined by the IRDye [®] 800CW 2-DG (radiolabeled 2-deoxy- d-glucose (2-DG) based optical imaging of xenograft mo dels with A549/GR tumors (Supplementary Figure  3a, b and c), indicating the inhibition of tumor growth by BRM270 via activation of miR-128. [score:8]
miR-128 is frequently downregulated in lung cancer [9]; however, it has also been shown to act as a tumor suppressor in several malignancies by inhibiting cell proliferation, migration, and invasion [20]. [score:8]
Additionally, the levels of VEGF-C, VEGFR2, phosphorylated ERK, p38, and AKT were similarly expressed in the cells treated with miR-128 inhibitor NC and the cells treated with miR-128 inhibitor. [score:7]
Zhou XU miR-128 downregulation promotes growth and metastasis of bladder cancer cells and involves VEGF-C upregulationOncol. [score:7]
BRM270 -induced miR-128 overexpression in A549 cell lines suppresses the expression of stemness genes and cell growth. [score:7]
miR-128 inhibits cell proliferation by targeting Bmi-1 to suppress neuroblastoma cell motility [21]. [score:7]
miR-128 -overexpressing or inhibition and control miRNA -expressing A549, A549/GR, and A549/PTX cell lines were established by transfection of pCMV-miRNA-128, control pCMV-miRNA (http://www. [score:7]
Additionally, the effect of miR-128 inhibitor NC, the effect of miR-128 inhibitor, and the combined effect of BRM270+miR-128 inhibitor were observed on A549/GR tumors. [score:7]
miR-128 is a typical tumor suppressor that is downregulated in many malignancies including lung cancer 9, 10. [score:6]
BRM270 induces miR-128 and inhibits miR-21 expression in A549 cell lines. [score:5]
Godlewski J Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewalCancer Res. [score:5]
Moreover, miR-128 overexpression reversed GR by inhibiting the phosphoinositide 3-kinase (PI3K)/AKT pathway [9]. [score:5]
It was previously reported that miR-128 was downregulated in lung tumor tissue, suggesting that miR-128 may play an important role in NSCLC progression and development [9]. [score:5]
We found that BRM270 increased miR-128 and inhibited miR-21 expression in A549 cell lines. [score:5]
BRM270 directly targets miR-128 and VEGF. [score:4]
MiR-128 modulates chemotherapeutic sensitivity in CSCs by targeting Bmi-1 and Musashi-1, and its reduced expression in cancer tissues is correlated with chemotherapeutic resistance and poor patient outcome 15, 16. [score:4]
CAN-14-0404 24903149 9. Hu J microRNA-128 plays a critical role in human non-small cell lung cancer tumourigenesis, angiogenesis and lymphangiogenesis by directly targeting vascular endothelial growth factor-CEur. [score:4]
Based on these observations, we investigated the effect of BRM270 in GR and PTX human NSCLC A549 cells and found that it suppressed tumorigenesis by directly targeting miR-128. [score:4]
The reported effects of miR-128 on glioma cells include Bmi-1 downregulation resulting in decreased glioma stem cell self-renewal. [score:4]
We observed that miR-128 expression was attenuated in the A549 cell line and its chemoresistant derivatives. [score:3]
The results of the present study indicate that miR-128 induced by BRM270 suppresses VEGFR -induced activation of ERK/p38/AKT signaling, as evidenced by the decreases in ERK, p38, and AKT phosphorylation. [score:3]
We found that BRM270+miR-128 more potently reduced the expression of all factors than either treatment alone, as determined by Western blotting (Fig.   4a) and immunocytochemistry (Fig.   4b). [score:3]
However, BRM270 treatment increased miR-128 expression by 2–3 folds in A549, A549/GR, and A549/PTX cells (Fig.   3a, b). [score:3]
com/), miRNA-128 -inhibitor, and miRNA-control (www. [score:3]
We confirmed that BRM270 -induced miR-128 overexpression decreased the protein levels of Bmi-1 and Musashi-1 in A549 cell lines. [score:3]
High levels of miR-128 inhibited tumor angiogenesis and progression blocked ERK, AKT, and p38 signaling pathways [9]. [score:3]
a Expression levels of CSC markers in A549 cells treated with miR-128, BRM270, or both. [score:3]
BRM270/miR-128 treatment decreased VEGF-C, VEGF-A, VEGF receptor (VEGFR)2 and VEGFR3 expression in all three cell lines (Fig.   5). [score:3]
MiR-128 has been shown to inhibit angiogenesis and tumor growth and block p38/extracellular signal-regulated kinase (ERK)/AKT signaling in cancer cells [9]. [score:3]
Fig. 4 a Expression levels of CSC markers in A549 cells treated with miR-128, BRM270, or both. [score:3]
We therefore examined whether BRM270 -induced miR-128 expression affects the levels of VEGF/PI3K/AKT signaling pathway components in A549 cells. [score:3]
BRM270 blocks cancer progression by inducing miR-128 expression. [score:3]
In conclusion, BRM270 suppressed proliferation and induced apoptosis in chemoresistant A549 lung adenocarcinoma cells by modulating VEGF/PI3K/AKT signaling via miR-128. [score:3]
Taken as a whole, these observations suggest that BRM270 suppresses VEGFR -induced activation of ERK/p38/AKT signaling via miR-128 activation. [score:3]
b miR-128 and c miR-21 expression levels in A549 cells treated with miRNA128 and BRM270. [score:3]
BRM270 also suppressed the formation of A549/GR and A549/PTX cell spheres in part by increasing miR-128 level (Fig.   4c). [score:3]
miR-128 has been shown to abolish chemoresistance by inhibiting PI3K/AKT signaling [19]. [score:3]
BRM270 prevents the maintenance of the CSC phenotype via regulation of miR-128. [score:2]
The reduced level of miR-128 in NSCLC patients has been linked to tumor differentiation, pathological stage, and lymph node metastasis [9]. [score:1]
The combined treatment had a more potent effect than either miR-128 or BRM270 alone. [score:1]
b Representative images of A549 cells treated with miR-128, BRM270, or both and probed with an antibody against Bmi-1. c Number of A549 cell spheres following treatment with miR-128, BRM270, or both. [score:1]
Zhu Y Reduced miR-128 in breast tumor-initiating cells induces chemotherapeutic resistance via Bmi-1 and ABCC5Clin. [score:1]
A549 cell tumors were established in nude mice, which were then divided into the following four groups: negative control, miR-128, BRM270 (1 mg/kg, oral administration via a catheter), or BRM270+miR-128. [score:1]
Fig. 3 a miR-128 level was increased in A549 cells treated with BRM270. [score:1]
As expected, cells treated with BRM270 and miR-128 mimic showed reduced migration relative to control miRNA -transfected cells, as evidenced by the slower rate of wound closure (Fig.   4d). [score:1]
Mice treated with both miR-128 and BRM270 had smaller tumors than those in other groups (Fig.   6a). [score:1]
Fig. 6 a Xenografts of A549 cells treated with miR-128, BRM270, or both showed reduced growth relative to those cells treated with either agent alone or left untreated (control). [score:1]
We found here that BRM270/miR-128 treatment decreased ERK p38-mitogen-activated protein kinase and AKT phosphorylation in A549/GR and A549/PTX cells to a greater extent than miR-128 or BRM270 alone. [score:1]
These data indicate that BRM270 reduces the malignant behavior of A549 cells by inducing miR-128. [score:1]
[1 to 20 of 51 sentences]
7
[+] score: 168
Importantly, cell lines with higher miR-27b, miR-101, or miR-128 expression tended to have lower VEGF-C expression, while cell lines with lower expression of miR-27b, miR-101 or miR-128 had higher VEGF-C expression. [score:9]
Collectively, these findings highlight the role of miRNAs in suppressing carcinogenesis, tumor development, and progression and suggest that aberrant overexpression of VEGF-C may be due to the decreased miR-27b, miR-101, or miR-128 expression in gastric cancers. [score:8]
Collectively, these results suggest ectopic expression of miR-27b, miR-101 or miR-128 significantly inhibits migration and invasion activity of gastric cancer cells in vitro, and provide further evidence that metastasis due to VEGF-C is likely due to downregulation of key miRNAs. [score:8]
Additionally, miR-27b and miR-128 expression inversely correlated to VEGF-C expression in gastric cancers (Figure 3G2 and 3G4 p = 0.0492, r = −0.2414 or p = 0.0031, r = −0.3900), although there was no statistically significant inverse correlation between miR-101 level and VEGF-C expression (Figure 3G P = 0.3224, r = −0.068). [score:7]
MiR-27b, miR-101, or miR-128 directly down-regulates VEGF-C expression. [score:7]
As the results showed, miR-101 merely restrained its expression by about 30% via a fine-tuning manner; however, miR-27b or miR-128 has inhibited VEGF-C expression by ∼45% or more respectively. [score:7]
MiR-27b, miR-101, or miR-128 directly down-regulates VEGF-C expression through posttranscriptional repression in gastric cancer cells. [score:7]
The luciferase assays showed that miR-27b, miR-101, or miR-128 rather than miR-144 or miR-186 (Figure 3A and 3B) displayed more effectively inhibited luciferase activity with an inhibitory rate of more than 30% in pmiR-VEGF-C and miRNAs co -transfected cells, indicating that miR-27b, miR-101, and miR-128 were candidate miRNAs for VEGF-C. Specifically, miR-27b, miR-101, or miR-128 transfection decreased luciferase expression by 41.65 ± 4.60%, 30.36 ± 15.99%, and 51.20 ± 7.3%, respectively in MKN-45 cells (Figure 3C, p = 0.0020, p = 0.0179, or p = 0.0037). [score:6]
Importantly, we found that miR-27b and miR-128 are significantly down-regulated and inversely correlated with VEGF-C expression in gastric cancer cell lines and tissues. [score:6]
Similarly, the expression of VEGF-C was down-regulated by miR-128 in non-small cell lung cancer [23]. [score:6]
We identified three miRNAs that target and suppress VEGF-C: miR-27b, miR-101, or miR-128. [score:5]
Our data showed that miR-27b and miR-101, miR-27b and miR-128, or miR-101 and miR-128 co-transfection led to significant decreases in luciferase activity (miR-27b and miR-101: 42.58% ± 4.83%, p = 0.002; miR27b and miR-128: 45.59% ± 5.99%, p = 0.0027; miR101 and miR-128: 53.39% ± 2.27%, p = 0.0003), decreases of VEGF-C mRNA expression by 70% ± 4.50%, 66.55% ± 5.67%, or 47.18% ± 5.4% (p = 0.0012, p = 0.0017, or p = 0.0058, respectively) and decreases of VEGF-C protein expression by 52.92% ± 33.83%, 34.04% ± 7.59%, or 31.94% ± 6.99% (p = 0.0205, p < 0.0001, or p < 0.0001, respectively) in MKN-45 cells (Figure 3C- 3E). [score:5]
A. and B. However, there was no significant difference in the overall survival and disease-free survival between the miR-27b C. and D., miR-101 E. and F. or miR-128 G. and H. lower and higher expression groups. [score:5]
Spearman's correlation was applied for analyzing the association between miR-27b, miR-101, or miR-128 and VEGF-C expression, MVD or LVD, as well as the association between VEGF-C expression and MVD or LVD. [score:5]
Compared to human non-tumorous gastric mucosa (n = 5), higher expression of VEGF-C mRNA and protein and decreased expression of miR-27b, miR-101 or miR-128 were detected in 3 gastric cancer cell lines by and RT-qPCR, respectively F.. [score:4]
Dual-luciferase reporter gene assay showed that miR-27b, miR-101, or miR-128(decreased 38.68% ± 10.86%, 30.36% ± 10.29%, 47.76% ± 13.61%, p = 0.0115, p = 0.0156, or p = 0.0111) respectively, but not miR-144 or miR-186 displayed strong inhibitory effect on the luciferases expression in MKN-45 cells. [score:4]
Collectively, these data suggest miR-27, miR-101, and miR-128 suppress the migration and proliferation of HUVECs at least in part by down -regulating VEGF-C secretion. [score:4]
In addition to reduced VEGF-C expression in gastric cells transfected with miR-27b, miR-101, or miR-128, migration and invasion abilities were also attenuated, indicating that autocrine regulation of gastric cancer cells is critical for tumorigenesis [8]. [score:4]
Collectively, our data suggest VEGF-C is down-regulated by miR-27b, miR-101, or miR-128. [score:4]
Inhibition of miR-27b, miR-101, or miR-128 affected VEGF-C secretion was confirmed by ELISA. [score:3]
MiR-27b, miR-101, miR-128 or miR-27b/miR-101, miR-27b/miR-128, miR-101/miR-128 co-transfection could significantly reduce the VEGF-C mRNA expression in MKN-45 cells D.. [score:3]
MiR-27b, miR-101, miR-128, miR-27b/miR-101, miR-27b/miR-128 or miR-101/miR-128 co-transfection could significantly suppress the luciferase activity in pmiR-VEGF-C transfected MKN-45 cells C.. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the tube formation of HUVECs. [score:3]
Overexpression of miR-27b, miR-101, or miR-128 abolished the migration, invasion activity of gastric cancer cells and the migration activity of HUVECs in vitro. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration and proliferation activity in HUVECs. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration or invasion activity of gastric cancer cells in vitro. [score:3]
Importantly, VEGF-C expression positively correlated with MVD and LVD (Figure 5A3 and A4 p = 0.0003 or p = 0.0027), and miRNA-27b, miR-101, or miR-128 levels inversely correlated with MVD (Supplementary Figure S7A-C p = 0.0471, p = 0.0442, or p = 0.0018); no correlation between the level of the three miRNAs and LVD was found (Supplementary Figure S7D-F p > 0.05). [score:3]
Here we demonstrated that miR-27b, miR-101, and miR-128 inhibited HUVEC migration, proliferation and tube formation by reducing secretion of VEGF-C by gastric cancer cells. [score:3]
An inverse correlation was found between miR-27b (G2) and miR-128 (G4) expression and VEGF-C levels in human gastric cancers samples. [score:3]
Overexpression of miR-27b, miR-101, or miR-128 attenuated proliferation and tube formation of HUVECs. [score:3]
MiR-27b, miR-101, miR-128 or miR-27b/miR-101, miR-27b/miR-128, miR-101/miR-128 co-transfection could significantly decrease the VEGF-C protein expression in MKN-45 cells E.. [score:3]
Expression of VEGF-C and miR-27b, miR-101 or miR-128 and their correlation with patients’ survival in gastric cancers. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration or invasion activity of gastric cancer cells in vitroPrevious studies suggest the VEGF-C/VEGFR-3 axis is critical in enhancing cancer cell migration and invasion and promotes metastasis [13]. [score:3]
To determine whether miR-27b, miR-101, or miR-128 inhibits VEGF-C -induced endothelial cell migration, transwell monolayer permeability assays were used to detect the changes in migration activity of HUVECs, which were treated with the culture supernatants of gastric cancer cells transiently transfected with the three miRNAs or a negative control. [score:2]
Figure 3 through posttranscriptional repression in gastric cancer cellsScheme representation of the potential binding site of miR-27b, miR-101, or miR-128 in the VEGF-C 3′UTR A.. [score:1]
Based on these studies, we investigated whether miR-27b, miR-101, and miR-128 could inhibit migration and invasion. [score:1]
Five tumor-suppressing miRNAs including miR-27b, miR-101, miR-128, miR-144, and miR-186, which have potential binding sites in the 3′-UTR of VEGF-C (Figure 3A and Supplementary Figure S1A), were selected for further investigation. [score:1]
VEGF-C levels were significantly reduced by 82.23% ± 2.07%, 81.54% ± 1.76%, or 52.33% ± 1.94% respectively in MKN-45 cells transfected with miR-27b, miR-101, or miR-128 (Figure 5A1 and Supplementary Figure S4B) (all p < 0.05). [score:1]
As shown in Figure 4A, miR-27b, miR-101, or miR-128 -transfected cells showed a considerable decrease in migration activity by 64.9% ± 4.27%, 45.16% ± 3.71%, or 46.38% ± 0.56% (p = 0.0001, p < 0.0001, or p = 0.0003, respectively) and a decrease in invasion capacity by 45.83% ± 4.83%, 39.13% ± 9.46% or 63.64% ± 3.49% (Figure 4B p = 0.0004, p = 0.0133, or p = 0.0002, respectively) than that of the negative control group in MKN-45 cells. [score:1]
Other mechanisms underlying the synergistic effect of miR-27b, miR-101 and miR-128 on VEGF-C expression need further investigation in the future. [score:1]
The efficacy of miR-27b, miR-101, and miR-128 was significant as indicated by reduced VEGF-C protein levels (36.38 ± 27.62%, 40.56 ± 20.50%, or 43.22 ± 22.27% reduction) (Figure 3E, p = 0.0108, p = 0.0026, or p = 0.0036, respectively). [score:1]
Gastric cancer cells were co -transfected with miR-27b and miR-101, miR-27b and miR-128, or miR-101 and miR-128. [score:1]
These results suggest that miR-27b, miR-101, or miR-128 attenuates tube formation of HUVECs induced by secreted VEGF-C from gastric cancer cells in vitro. [score:1]
We evaluated 48 samples of gastric cancer tumors for expression of miR-27b, miR-101, and miR-128. [score:1]
Scheme representation of the potential binding site of miR-27b, miR-101, or miR-128 in the VEGF-C 3′UTR A.. [score:1]
Figure 4Overexpression of miR-27b, miR-101, or miR-128 abolished the migration, invasion activity of gastric cancer cells and the migration activity of HUVECs in vitroIn migration assay, the migration activity of the miRNAs -transfected MKN-45 cells was significantly decreased when compared to the negative control A.. [score:1]
HUVECs cultured with the media supernatant from cancer cells transfected with miR-27b, miR-101, miR-128 mimics, or negative control, were incubated with 50 μM EdU for 4 h. Samples were fixed, permeabilized, and stained for EdU. [score:1]
[1 to 20 of 47 sentences]
8
[+] score: 158
Consistent with other glioma miRNA profiling studies [9], [14], [15], [31], we also observed down-regulation of miR-124, miR-128, miR-132, and miR-7, and up-regulation of miR-10b, amongst others, demonstrating that high-throughput sequencing can be an effective method for profiling miRNA expression. [score:9]
pcDNA3-miR-128 inhibits luciferase expression from pFLuc-128.2X, indicative of miRNA expression. [score:7]
Furthermore, reduced expression of miR-128 is not specific to just glioblastomas as this miRNA is also down-regulated in other brain cancers [33]. [score:6]
Using an in vitro mo del to recapitulate expression of brain-enriched miRNAs, we demonstrated that differentiated neuronal SH-SY5Y cells transduced with a miR-128-regulated HSV-TK lentiviral vector are indeed resistant to killing by GCV due to the expression of endogenous miR-128. [score:6]
We engineered artificial target sites for miR-128, which is highly down-regulated in glioblastoma, into the 3′UTR of HSV-TK. [score:6]
Instead, we focused on miRNAs that are consistently down-regulated in glioblastomas [9], [14], [15] (Fig. 1A, Table S6), and chose miR-128 as the best candidate to restrict cell suicide gene expression. [score:6]
While miRNA effects on target mRNAs are usually modest, using a miRNA such as miR-128, which is brain-enriched and highly expressed in non-glioma cells, potentially maximizes the efficacy of miRNA regulation. [score:6]
Additionally, overexpression of miR-128 did not affect HSV-TK -mediated killing in the absence of miR-128 target sites (Fig. 4B & C). [score:5]
Next, U373 cells, which do not express detectable levels of miR-128 (Fig. 2, 5), were co -transfected with pcDNA3-HSV-TK-128.2X and the miR-128 expression vector. [score:5]
Additionally, miR-128 is highly enriched in the brain as it is expressed by neurons and is induced during neuronal differentiation of embryonal carcinoma (EC) cells [20], [21], thus making it an ideal candidate to limit cell suicide gene expression. [score:5]
We engineered two miR-128 target sites into the HSV-TK 3′UTR (HSV-TK-128.2X) and then transiently expressed the cell suicide gene in glioblastoma cell lines. [score:5]
A. 293T cells were co -transfected with 1 µg pcDNA3 (vector) or pcDNA3-miR-128 (miR-128), 50 ng firefly luciferase expression vector, pFLuc-128.2x containing two miR-128 binding sites or pFLuc-2X control, and 10 ng renilla luciferase expression vector, pRLuc, as internal control using Lipofectamine 2000 (Invitrogen). [score:5]
Finally, miR-128, which is also abundantly expressed in neurons, has been shown to target the Bmi-1 stem cell renewal factor [14]. [score:5]
miR-128 is one of the most significantly and consistently down-regulated miRNAs in glioblastomas and glioblastoma cell lines according to data presented here (Fig. 1) as well as previous studies [9], [14], [15], [31]. [score:4]
Both the ectopic expression of miR-128 in glioblastoma cells and the natural, endogenous level of miR-128 expression seen in neuronal cells indeed limited cell death when compared to control glioblastoma cells. [score:4]
Ectopic expression of miR-128 in glioblastoma cells inhibited HSV-TK-128.2X -mediated cell death when cells were cultured in the presence of GCV as shown by trypan blue exclusion (Fig. S4), crystal violet staining, and MTT viability assays (Fig. 3). [score:4]
MiRNAs down-regulated in gliomas include miR-7, miR-124, miR-128, miR-137, and miR-181a/b [9], [14], [15], [18], [19]. [score:4]
293T, U373, and A172 cells were transduced with pLCE (GFP), pLC-HSV-TK, or pLC-HSV-TK-128.2X and then transfected with a miR-128 expression plasmid or empty vector as indicated (Fig. 4). [score:3]
HSV-TK -mediated killing was unaffected by the presence of the miR-128 target sites in the absence of miR-128 (Fig. 4A, S5B). [score:3]
Similar to Fig. 3, introduction of a miR-128 expression plasmid rescued both U373 and A172 cells from cell death when the miR-128 binding sites were present in the HSV-TK 3′UTR (Fig. 4B–D). [score:3]
Figure S4 Ectopic expression of miR-128. [score:3]
Thus, the expression of endogenous, brain-enriched miR-128 can restrict the effects of a cell suicide gene containing cognate miRNA binding sites. [score:3]
Primer extension analysis confirmed enhanced expression of miR-21 (Fig. 2A) and decreased expression of miR-128, miR-124, and miR-132 (Fig. 2B) in glioblastomas compared to non-tumor brain tissue samples. [score:3]
B. miR-128 rescues HSV-TK-128.2X expressing U373 cells from GCV -induced cell death. [score:3]
Congruent with previous studies [42], [43], ATRA treatment of SH-SY5Y cells induced expression of the brain-enriched miRNAs miR-128 and miR-124 (Fig. 5A) as well as miR-132 and miR-7 (not shown). [score:3]
Additionally, we could not detect expression of miR-128, miR-124, or miR-132 in three glioblastoma cell lines (A172, U373, and U87). [score:3]
miR-7, miR-124, miR-128, miR-132, and miR-212 are amongst the most highly down-regulated miRNAs found in glioblastomas compared to non-transformed cells (Fig. 1, Table S4, S6). [score:3]
To validate results from our deep sequencing experiments, we selected four differentially expressed miRNAs for further analysis: miR-21, miR-128, miR-124, and miR-132. [score:3]
Furthermore, miR-7, miR-124, and miR-128 have been reported to impair cell growth and proliferation when over-expressed in glioma-derived stem cells [14], [15], [19], [41]. [score:3]
B. miR-128, miR-124, and miR-132 expression levels detected by primer extension. [score:2]
At least 20 cellular miRNAs were differentially expressed in the six glioblastomas assayed here compared to non-tumor brain tissue, many of which (miR-128, miR-124, miR-7, miR-132, miR-139) are consistently dysregulated in not only gliomas but also other brain cancers including medulloblastomas and neuroblastomas [33]. [score:2]
Based on the read counts for individual miRNAs in Tables S2, S3, and S4, previous profiling studies (listed in Table S6), and data shown here regarding miRNAs such as miR-21 and miR-128 (Fig. 2, Fig. 5) that do not meet the standard FDR-adjusted p<0.05 criteria (Table S5), clearly additional miRNAs identified here are dysregulated in glioblastoma (Fig. 1, Tables S4 and S6). [score:2]
miR-128, miR-124, and miR-137 are all enriched in the brain and have been shown to regulate neuronal differentiation, maturation, and/or survival [15], [20]– [23]. [score:2]
miR-128 expression was confirmed from this vector using luciferase indicator assays (Fig. S4). [score:2]
B and C. U373 cells were co -transfected with 1 μg pcDNA3 (vector), pcDNA3-HSV-TK (HSV-TK), or pcDNA3-HSV-TK-128.2X (HSV-TK-128.2X) and 1 μg either pcDNA3 (vector) or pcDNA3-miR-128 (miR-128). [score:1]
Interestingly, the growth and viability of both A172 and U373 cells was not significantly affected by the overexpression of miR-128 (Fig. 3B, S5), contrary to previous studies using other glioma cell types that may retain more stem-cell like characteristics [14], [41]. [score:1]
A172 cells were transduced with indicated vectors, then transfected with pcDNA3 (grey lines, circles) or pcDNA3-miR-128 (black lines, squares). [score:1]
0024248.g004 Figure 4 A. miR-128 binding sites have no effect on HSV-TK -mediated killing in cells lacking miR-128. [score:1]
Cells were co -transfected with either pcDNA3 (+vector) or pcDNA3-miR-128 (+miR-128) and subjected to 10 µg/mL ganciclovir selection (+GCV) for 10 days prior to staining. [score:1]
U373 cells were co -transfected with pcDNA3 (vector), pcDNA3-HSV-TK, or pcDNA3-HSV-TK-128.2X and either pcDNA3 as control or pcDNA3-miR-128 (+miR-128). [score:1]
pcDNA3-HSV-TK-128.2X contains two perfect binding sites for miR-128 in the 3′UTR of HSV-TK. [score:1]
C and D. Endogenous miR-128 restricts the activity of HSV-TK-128.2X. [score:1]
B. miR-128 rescues glioblastoma cells from killing by HSV-TK-128.2X. [score:1]
Our sequencing data reveal that miR-128 has an invariant sequence and does not exhibit post-transcriptional editing or significant 5′ end variation. [score:1]
HSV-TK -mediated killing of undifferentiated SH-SY5Y cells was again unaffected by the presence of the miR-128 binding sites. [score:1]
The miR-128 indicator vector (pcDNA3-GL3-128.2X) contains a firefly luciferase cassette and two fully complementary binding sites for miR-128 inserted into the 3′UTR using XhoI to XbaI (Fig. S4). [score:1]
A. Brain-enriched miRNAs, miR-128 and miR-124, are induced during neuronal differentiation of SH-SY5Y cells. [score:1]
U373 cells were co -transfected with pcDNA3 (vector), pcDNA-HSV-TK, or pcDNA-HSV-TK-128.2X and either pcDNA3 or pcDNA3-miR-128. [score:1]
Endogenous miR-128 protects neuronal cells from HSV-TK induced cell death. [score:1]
A. miR-128 binding sites have no effect on HSV-TK -mediated killing in cells lacking miR-128. [score:1]
Two miR-128 binding sites were then inserted into the 3′UTR XhoI to XbaI. [score:1]
In contrast, miR-128 did not rescue the viability of U373 cells transfected with an analogous HSV-TK vector lacking the miR-128 binding sites (Fig. 3). [score:1]
Brain-enriched miRNAs, miR-128 and miR-124, are induced during neuronal differentiation of SH-SY5Y cells. [score:1]
24 hrs post-transduction, cells were transfected with pcDNA3 or pcDNA3-miR-128 using Lipofectamine 2000. [score:1]
[1 to 20 of 54 sentences]
9
[+] score: 152
Other miRNAs from this paper: hsa-mir-214, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-9-2
In general, our data revealed that upregulated SNAI1 accelerates glioma progression and suppresses the expression of miR-128, which can oppose SNAI1's effect and modulate SP1 expression. [score:10]
SNAI1 suppressed miR-128b expression by binding to the miR-128b specific promoter motif, and miR-128 targeted SP1 via binding to the 3′-untranslated region of SP1. [score:9]
0098651.g007 Figure 7 SNAI1 suppresses miR-128 expression and miR-128 restrains SP1 expression. [score:7]
SNAI1 suppresses miR-128 expression and miR-128 restrains SP1 expression. [score:7]
Downregulation of SNAI1 increased miR-128 expression level through the reduction of transcriptional repression and a consequent decrease in SP1 protein level. [score:6]
Downregulation of SNAI1 inhibited SP1 protein level to a greater degree than the application of SNAI1 shRNA and miR-128 anti-sense oligonucleotide (ASO). [score:6]
The SNAI1/miR-128/SP1 axis promotes cell invasion, cell migration, cell proliferation and cell cycle via increasing MMP-2, MMP-9, PLAU and CCNE1 expression and reducing CDKN1A expression. [score:5]
MiR-128 targets SP1 by binding to its 3′-untranslated region (3′-UTR). [score:4]
Subsequently, we found that SP1 expression is restrained by miR-128 via 3′-UTR and that SNAI1 regulates SP1 partly via miR-128. [score:4]
We investigated the direct targets of miR-128 using the TargetScan, PicTar and MiRDB algorithms. [score:4]
Previously, we demonstrated that miR-128 is decreased in gliomas and inhibits cell proliferation, tumor growth and angiogenesis [19]. [score:3]
MiR-128 directly targets SP1. [score:3]
Pearson correlation of SNAI1 and miR-128 expression levels was negative (R = −0.6949, P<0.001). [score:3]
SNAI1 increases SP1 expression through miR-128. [score:3]
was used to measure microRNA-128 (miR-128) expression level and western blot was performed to detect protein expression in U87 and U251 cells and human brain tissues. [score:3]
We then tested for possible correlations among SNAI1, miR-128 and SP1 expression levels. [score:3]
Moreover, introduction of miR-128 anti-sense oligonucleotide alleviated the cell cycle retardation, proliferation and invasion inhibition induced by SNAI1 shRNA. [score:3]
Expression of the SNAI1/miR-128/SP1 axis in glioma tissues. [score:3]
Immunohistochemistry and in situ hybridisation analysis of SNAI1, SP1 and miR-128 unraveled their expression levels and correlations in glioma samples. [score:3]
showed that ectopic expression of miR-128 reduced SP1 protein level (Figure 4B). [score:3]
Immunohistochemistry and in situ hybridisation staining were used for quantifying SNAI1, SP1 and miR-128 expression levels in human glioma samples. [score:3]
SNAI1, SP1 and miR-128 expression in human glioma tissues. [score:3]
In addition to SP1, tumor supporters such as E2F3a, BAX, BMI-1, DCX and Reelin are also targeted by miR-128 [15], [27], [40], [41]. [score:3]
We propose that the SNAI1/miR-128/SP1 axis, which plays a vital role in glioma progression, may come to be a clinically relevant therapeutic target. [score:3]
Among the miRNAs identified, miR-128 was previously studied and proven to be a tumor suppressor in gliomas [19]. [score:3]
0098651.g004 Figure 4 (A) Putative binding site of miR-128 within SP1 3′-UTR in human, chimpanzee and mouse, as predicted by TargetScan, PicTar, and MiRDB algorithms. [score:3]
We initially increased miR-128 ectopic expression in glioma cell lines (Figure S3). [score:3]
The quantitative real-time PCR (qRT-PCR) results uncovered that miR-128 expression in the SNAI1 shRNA group increased when compared with that of the scramble group (Figure 3B). [score:2]
The mechanism of miR-128 targeting SP1 was also tested by luciferase reporter assay. [score:2]
Our findings first establish a role for the SNAI1/miR-128/SP1 axis in the regulation of glioma evolution (Figure 7). [score:2]
In the SNAI1/miR-128/SP1 axis, miR-128 acts as a negative regulator, which resist the SNAI1-promoted progression of gliomas. [score:2]
SNAI1/miR-128/SP1 axis regulates glioma progression. [score:2]
MiR-128 was initially shown to be enriched in brain and frequently decreased in glioma cells [39], and subsequently in neuroblastoma, prostate, breast cancer, and demonstrated to be a tumor suppressor gene [23], [27], [28]. [score:2]
This result shows that SNAI1 can negatively regulate miR-128. [score:2]
Cell cycle retardation, proliferation and invasion suppression by SNAI1 shRNA were all alleviated by miR-128 ASO transfection, compared with the SNAI1 shRNA group. [score:2]
MiR-128 functions as extinguisher in the SNAI1/miR-128/SP1 axis. [score:1]
In the current study, we demonstrated that and showed that miR-128 can override the effect of SNAI1 on glioma cell cycle, proliferation and invasiveness. [score:1]
Next, the RNA level of miR-128 and SP1 protein level were analysed using qRT-PCR and western blot analysis within groups A, B and C. The results are shown in figure 6D. [score:1]
SNAI1/miR-128/SP1 axis in glioma tissues. [score:1]
Figure S4 Pearson correlation (R = −0.3543, P<0.0001) between miR-128 and SP1 in 158 glioma tissues of the CGGA data. [score:1]
Primarily, miR-128 ASO antagonised SNAI1 shRNA function in glioma cell lines. [score:1]
revealed that miR-128 ASO reduced the impact of sh-SNAI1 on cell cycle, specifically the G0/G1 phase (Figure 6A). [score:1]
Effect of miR-128 on the SNAI1/miR-128/SP1 axis. [score:1]
Figure S3 Transfection efficiency of miR-128 anti-sense oligonucleotide in U87 and U251 by qRT-PCR. [score:1]
We identified the binding sites of miR-128 within the 3′-UTR of SP1 mRNA and found that the binding motifs were conserved among species, such as human, chimpanzee and mouse (Figure 4A). [score:1]
The CGGA data showed that the Pearson correlation index between SNAI1 and miR-128 was negatively correlated. [score:1]
0098651.g003 Figure 3 (A) The heat map of 158 glioma sample microarray data reveals a negative correlation between SNAI1 and 15 miRNAs, including miR-128. [score:1]
The miR-128 probe was purchased from Applied Biosystems. [score:1]
U87 and U251 were transfected with scramble oligonucleotides (group A), SNAI1 shRNA (group B) and SNAI1 shRNA plus miR-128 ASO (group C). [score:1]
Decrease in SNAI1 shRNA -induced SP1 protein level was mitigated by the introduction of miR-128 ASO. [score:1]
Therefore, the present study focused on miR-128. [score:1]
U87 and U251 cells were differentially treated with SNAI1 shRNA and miR-128 ASO. [score:1]
The SP1 3′-UTR has two miR-128 binding sites: 1662 to 1669(AGAGA------CACUGUGA) and 4516 to 4522(CACUGUG). [score:1]
The same result was found for miR-128 and SP1 (R = −0.5668, P<0.001). [score:1]
Many studies reported that miR-128 is reduced in several kinds of cancer [19], [23], [27], [28]. [score:1]
The oligonucleotides (GenePharma, Shanghai, China) were as follows: miR-128 mimics 5′-UCACAGUGAACCGGUCUCUUU-3′ (sense), 5′-AGAGACCGGUUCACGGUGAUU-3′ (anti-sense); scrambled miRNA (NC) 5′-UUCUCCGAACGUGUCACGUTT-3′ (sense), 5′-ACGUGACACGUUCGGAGAATT-3′ (anti-sense); miR-128 ASO 5′-AAAGAGACCGGUUCACUGUGA-3′ and miR-128 ASO (NC) 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:1]
The CGGA data showed that Pearson correlation between miR-128 and SP1 was negative (R = −0.3543, P<0.0001) (Figure S4). [score:1]
0098651.g006 Figure 6 U87 and U251 cells were differentially treated with SNAI1 shRNA and miR-128 ASO. [score:1]
[1 to 20 of 58 sentences]
10
[+] score: 104
Figure 5 The loss of the retinoblastoma tumor suppressor (RB ) expression plays a role in Smurf2 downregulation in triple -negative breast cancer (TNBC) cells, via upregulation of miR-15, miR-16 and miR-128. [score:11]
We also have revealed that microRNAs such as miR-15a, miR-15b, miR-16 and miR-128, whose expression is increased by inactivating mutations of the retinoblastoma (RB) gene, downregulate translation of Smurf2 protein in TNBC cells. [score:9]
Studies using quantitative PCR and specific microRNA inhibitors indicated that increased expression of miR-15a, miR-15b, miR-16 and miR-128 was involved in Smurf2 downregulation in those triple -negative cancer cell lines, which have mutations in the retinoblastoma (RB) gene. [score:9]
Therefore, RB inactivation accounts at least partly for Smurf2 downregulation in the TNBC cells, via deregulated expression of the miR-15 family and miR-128. [score:7]
miRNAs such as miR-15/16 and miR-128, whose upregulation is linked to the inactivation of RB, play important roles in the downregulation of Smurf2. [score:7]
Therefore, we hypothesized that RB inactivation could result in elevated expression of the miR-15 family and possibly miR-128, which contributed to the downregulation of Smurf2. [score:6]
Low expression of Smurf2 protein was also observed in several TNBC cell lines, which had RB mutations and high expression of miR-15a, miR-15b, miR-16 and miR-128. [score:6]
To further delineate the role of the miRNAs in Smurf2 downregulation observed in BT549, MDA-MB-436 and DU4475 cells, cells were transfected with miRNA inhibitors (antagomirs) against miR-15a, miR-15b, miR-16 or miR-128 (Figure  4). [score:6]
miR-128 is known to target Bmi1, the polycomb transcription factor required for stemness [15, 22], and miR-128 expression may be increased during the transition from the cancer-initiating cell state to the expansive state of breast cancer. [score:5]
DU4475 cells showed increased expression of miR-15b, miR-16 and miR-128, relative to their expression in MCF-10A cells. [score:5]
miR-15/16 and miR-128 mediate Smurf2 downregulation. [score:4]
Figure 4 MicroRNAs such as miR-15, miR-16 and miR-128 are involved in downregulation of Smurf2 protein in triple -negative breast cancer. [score:4]
Interestingly, oncogenic p53(R175H) mutant induces the transcription of miR-128, which then promotes chemoresistance of non-small cell lung cancer [23], presenting another example of high miR-128 expression associated with malignant phenotypes. [score:3]
Cells were transfected with Ambion® Anti-miR™ miRNA Inhibitors specifically against miR-15a, miR-15b, miR-16 and miR-128 (Ambion/Invitrogen, Carlsbad, CA), using the Lipofectamine® RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. [score:3]
Also in MCF-7 cells, the levels of miR-15a, miR-15b and miR16 were low, whereas the expression of miR-128 was modestly higher. [score:3]
High expression of miR-128 has been associated with poor prognosis of ER + breast cancer [21]. [score:3]
Human triple -negative breast cancer cell lines, BT549, MDA-MB-436 and DU4475 cells, were transfected with microRNA inhibitors against miR-15a, miR-15b, miR-16 and miR-128, or nonspecific ssRNA as negative control (NC), and cellular levels of Smurf2 protein were determined at 24 h (A, B) or 48 h (C) post-transfection by immunoblotting. [score:3]
Figure 3 Expression levels of miR-15a, miR-15b, miR-16 and miR-128 in breast cancer cell lines. [score:3]
MDA-MB-436 cells had increased expression of miR-15b, miR-16, and miR-128. [score:3]
The miR-15 family and miR-128 have been implicated for the regulatory network in breast cancer initiating cells [14, 15]. [score:2]
Our finding that miR-15/16 and miR-128 are involved in provides a new pathway to the miRNA -mediated biological processes in breast cancer. [score:1]
The analysis led us to candidates such as miR-128 (binding to Smurf2 3′UTR, 5′-CACUGUGA-3′) and the miR-15 family miRNAs including miR-15a, miR-15b and miR-16 (binding to Smurf2 3′UTR, 5′-GCUGCUA-3′). [score:1]
[1 to 20 of 22 sentences]
11
[+] score: 95
Among the three microRNAs (Shi et al., 2012; Xu et al., 2012, 2015) (miR-497-5p, miR-145-5p, miR-128-3p) previously reported to target p70s6k1 mRNA and inhibit its translation, only miR-128-3p was downregulated by TXL during I/R. [score:10]
By western blotting analysis, the miR-128-3p mimics downregulated expression and inhibited phosphorylation of p70s6k1 (Figure 7B). [score:8]
Further research will be needed to elucidate whether TXL decreases miR-128-3p levels by directly inhibiting the transcription of its gene or, instead, acts in an indirect manner, such as by facilitating expression of endogenous RNAs (e. g., lnc-LAMC2-1:1 Gong et al., 2016) that compete with miR-128-3p. [score:7]
Furthermore, p70s6k1 upregulation by TXL was attributable to downregulation of miR-128-3p in cardiomyocytes during I/R. [score:7]
Because of the decrease in p-p70s6k1/p70s6k1 levels in HCMs during H/R, TXL pretreatment no longer inhibited cell death in HCMs (Figure 7A), suggesting that upregulation of miR-128-3p abrogated the protective effects of TXL on HCMs. [score:6]
TXL downregulated miR-128-3p, a microrna targeting p70s6k1. [score:6]
However, in our study we found that, with inhibition of miR-128-3p, TXL enhanced p70s6k1 phosphorylation and, thus, activated the RISK pathway by facilitating p70s6k1 expression, rather than by activating Akt or Erk. [score:5]
Because TXL was reported to decrease expression of microRNAs and increase levels of their corresponding proteins under certain conditions (Wang J. Y. et al., 2014; Zhang et al., 2014, 2017), we used quantitative PCR to examine levels of several microRNAs (Shi et al., 2012; Xu et al., 2012, 2015) (miR-497-5p, miR-145-5p, and miR-128-3p) known to target the mRNA of p70s6k1 in HCMs (Figure 6B). [score:5]
In conclusion, we reveal for the first time that TXL can directly inhibit cardiomyocyte apoptosis and thus alleviate myocardial reperfusion injury through the miR-128-3p/p70s6k1 pathway. [score:4]
MicroRNA-128 inhibition attenuates myocardial ischemia/reperfusion injury -induced cardiomyocyte apoptosis by the targeted activation of peroxisome proliferator-activated receptor gamma. [score:4]
Figure 6TXL downregulated the level of miR-128-3p in cardiomycytes during H/R or I/R. [score:4]
To explore whether miR-128-3p was involved in the beneficial effects of TXL against H/R -induced apoptosis, mimics were utilized to upregulate levels of miR-128-3p in HCMs. [score:4]
MiR-128 inhibits tumor growth and angiogenesis by targeting p70S6K1. [score:4]
Moreover, miR-128-3p inhibition in cells enhanced their resistance to detrimental stimuli like chemotherapeutic agents and H/R (Zhu et al., 2011; Chen et al., 2016; Zeng et al., 2016). [score:3]
The inhibition of microRNA-128 on IGF-1-activating mTOR signaling involves in temozolomide -induced glioma cell apoptotic death. [score:3]
miR-128 and its target genes in tumorigenesis and metastasis. [score:3]
Another limitation is that we did not investigate how TXL downregulated miR-128-3p. [score:2]
H/R+TXL+miR-128 mimic; NC, negative control. [score:1]
MicroRNAs (miR-497-5p, miR-145-5p, and miR-128-3p) were reverse transcribed using miScript II RT Kit (Qiagen, Valencia, CA, USA) and then quantified by quantitative real-time RT-PCR using the miScript SYBR green PCR kit (Qiagen). [score:1]
When HCMs reached 70–80% confluence, small interfering RNA (siRNA) oligonucleotides against p70s6k1 (Santa Cruz Biotechnology), nonspecific control siRNA oligonucleotide (Santa Cruz Biotechnology), mimics of miR-128-3p (Thermo Fisher Scientific, Inc. [score:1]
Reduced miR-128 in breast tumor-initiating cells induces chemotherapeutic resistance via Bmi-1 and ABCC5. [score:1]
Brain microRNAs and insights into biological functions and therapeutic potential of brain enriched miRNA-128. [score:1]
The miR-497-5p, miR-145-5p, and miR-128-3p levels were determined with the 2 [(−ΔΔCT)] relative quantification method, using U6 as an internal control. [score:1]
Figure 7Transfection of miR-128-3p mimic abrogated the anti-apoptotic effects of TXL on HCMs during H/R. [score:1]
The protective effects of TXL on HCMs during H/R were largely abolished by transfection with miR-128-3p, indicating that miR-128-3p mediated the beneficial effects of TXL on HCMs during H/R. [score:1]
HCMs were transfected with miR-128-3p mimics, preconditioned with 400 μg/mL TXL and then subjected to H/R. [score:1]
A major limitation of our study was that we did not identify which ingredients in TXL, alone or in combination, were responsible for activation of the miR-128-3p/p70s6k1 pathway in cardiomyocytes during I/R. [score:1]
[1 to 20 of 27 sentences]
12
[+] score: 68
Therefore, the decreased expression of miR-128 and increased expression of its target, the HLX serve as potential therapeutic targets for equine as well as human asthma. [score:9]
All three up-regulated DEGs (RAB20, member RAS oncogene family (RAB20), bromodomain adjacent to zinc finger domain 2B (BAZ2B), H2.0 like homeobox (HLX)) in mock stimulated control and asthmatic PBMCs derived from the same blood sample collection as the serum samples used in this study are potential targets of miR-128 and were previously implicated in human asthma-like diseases [108, 109]. [score:8]
This is backed by the fact that downregulated miR-128 was shown to negatively regulate T cell maturation towards Th1 but to also positively regulate the maturation towards Th2 cells. [score:6]
Downregulated miR-128 has been shown to positively regulate CD4 [+] T cell differentiation to T helper 2 (Th2) cells and to negatively regulate Th1 cell maturation. [score:6]
We retrieved 212 potential (predicted and experimentally known) target genes of the miRNA with the lowest adjusted p-value, eca-miR-128 from the TargetScan database. [score:5]
MiR-128 has recently been shown to be downregulated in asthmatic bronchial epithelial cells and to be part of a regulatory miRNA network that was confirmed to significantly increase the production of interleukin 6 (IL6) and interleukin 8 (IL8) [78]. [score:5]
We next retrieved potential target genes of the DEmiR, showing the lowest adjusted p-value, eca-miR-128, with TargetScan (v. 6.2) [54]. [score:5]
Hu J. Cheng Y. Li Y. Jin Z. Pan Y. Liu G. Fu S. Zhang Y. Feng K. Feng Y. microRNA-128 plays a critical role in human non-small cell lung cancer tumourigenesis, angiogenesis and lymphangiogenesis by directly targeting vascular endothelial growth factor-CEur. [score:4]
The top differentially expressed miRNA (miR-128) has already been implicated in carcinomas [70, 71] and serum miR-128 was suggested as potential biomarker for e. g., glioma [72]. [score:3]
It is likely that an increased expression of HLX in asthmatic horses is maintained due to the decreased activity of the TF enforced by silencing of the HLX transcript by miR-128. [score:3]
Adlakha Y. K. Khanna S. Singh R. Singh V. P. Agrawal A. Saini N. Pro-apoptotic miRNA-128-2 modulates ABCA1, ABCG1 and RXR[alpha] expression and cholesterol homeostasisCell Death Dis. [score:3]
Potential target genes of miR-128 are involved in signal transduction, an indisputable part of immune response. [score:3]
Adlakha Y. K. Saini N. miR-128 exerts pro-apoptotic effect in a p53 transcription -dependent and -independent manner via PUMA-Bak axisCell Death Dis. [score:1]
Additionally, a modulated cytokine profile towards the IL6 and TGFβ side caused by decreased levels of miR-128 and miR-197, as well as increased levels of miR-744 positively affect the maturation of T cells towards the Th17 side. [score:1]
A potential role of miR-128 in horse asthma may result from its pro-apoptotic properties [73, 74]. [score:1]
The analysis with the tool edgeR showed following differenced in contrast to the analysis with DESeq2: four miRNAs were not significantly affected by the level of hemolysis (eca-miR-744, eca-miR-128, eca-miR-28-3p and eca-miR-125a-5p) and additionally five significantly affected miRNAs were reported: eca-miR-423-5p, eca-let-7g, eca-miR-19b, eca-miR-425, eca-miR-7177b (Table S6). [score:1]
Sun J. Liao K. Wu X. Huang J. Zhang S. Lu X. Serum microRNA-128 as a biomarker for diagnosis of gliomaInt. [score:1]
Therefore, we propose that the decreased levels of serum miR-128 might yield insights into the molecular mechanisms underlying asthma and might also provide room for novel therapeutic strategies. [score:1]
Using DESeq2, we identified 11 miRNAs as statistically significant DEmiRs after accounting for the level of hemolysis: eca-miR-128, eca-miR-744, eca-miR-197, eca-miR-103 and the closely related eca-miR-107a, eca-miR-30d, eca-miR-140-3p, eca-miR-7, eca-miR-361-3p, eca-miR-148b-3p and eca-miR-215. [score:1]
For further in-silico downstream analysis we focused on the most significant DEmiR eca-miR-128. [score:1]
[1 to 20 of 20 sentences]
13
[+] score: 55
Recently, Palumbo et al. identified miR-26b to be upregulated and miR-128 to be downregulated in GH-secreting pituitary tumors [18]. [score:7]
Inhibition of miR-26b and overexpression of miR-128 suppressed colony formation and invasiveness of pituitary tumor cells. [score:7]
Specifically, five miRNAs (miR-26b, miR-26a, miR-212, miR-107, and miR-103) were upregulated and twelve miRNAs (miR-125b, miR-141, miR-144, miR-164, miR-145, miR-143, miR-15b, miR-16, miR-186, let-7b, let-7a3, and miR-128) were downregulated. [score:7]
Interestingly, the inhibition of miR-26b and overexpression of miR-128 had a synergistic effect on suppressing the tumorigenicity and invasiveness of pituitary tumors. [score:7]
Deregulation of BMI1 has been revealed to affect apoptosis; thus, miR-128, which was downregulated in GH-secreting pituitary tumors, could also affect apoptosis by directly regulating BMI1 [18]. [score:7]
Since deregulation of PTEN and BMI1 correlates with the invasive and metastatic phenotype of several human cancer types [97, 98], it is possible that miR-26b and miR-128 regulate invasiveness of pituitary tumor cells by directly targeting PTEN and BMI1, respectively. [score:6]
miR-26b and miR-128 controlled pituitary cell properties through regulation of their direct targets, PTEN, and BMI1, respectively [18]. [score:5]
Moreover, miR-128 regulated PTEN expression and Akt activity in the pituitary tumor cells by interfering with the binding of BMI1 to PTEN promoter [18]. [score:4]
miR-26b and miR-128 were found to directly regulate PTEN and BMI1, respectively. [score:3]
Since PTEN-Akt pathway plays important roles in cell cycle control, miR-26b and miR-128 might regulate cell cycle through PTEN-Akt pathway [71]. [score:2]
[1 to 20 of 10 sentences]
14
[+] score: 53
Ciafrè et al. [54] demonstrated aberrant expression profiles of numerous miRNAs such as miR-221 which were strongly upregulated in GBM and miRNAs such as miR-128, miR-181a, miR-181b, and miR-181c which were shown to be downregulated in GBM. [score:9]
Overexpression of miR-128 was shown to downregulate the activity of p70S6K1 and expression of its downstream signaling molecules such as HIF-1 and VEGF and reduced cell proliferation, tumour growth, and angiogenesis [61]. [score:8]
p70S6K1, a key downstream target of mammalian rapamycin (mTOR), is a direct target of miR-128 which plays a role in glioma tumour angiogenesis [61]. [score:6]
As mentioned in BTICs of MB and GBM, miR-128 is also downregulated in pituitary adenomas [168]. [score:4]
In addition, Bmi1, a stem cell marker and an oncogene, is directly targeted by miR-128 [59]. [score:4]
This dual nature of miR-128 family with its different members playing both oncogenic and tumour suppressor activities can be explained based on the microRNAs processing from pri-miR to pre-miR to the export in cytoplasm [171]. [score:3]
Important cell cycle regulatory proteins such as PTEN and Bmi1 are regulated by miR-26b and miR-128, respectively [168]. [score:3]
Be it any mechanism, the aberrant expression of miR-128 family members needs further study to clarify its role in tumorigenesis and cancer progression [174, 175]. [score:3]
Overexpression of miR-128 is accompanied by a decrease in histone methylation H3K27me(3) and Akt phosphorylation [59]. [score:3]
Transcription factor E2F3 was also reported as a target of miR-128 in glioma cells [62]. [score:3]
Oncogenic receptor tyrosine kinases epithelial growth factor receptor (EGFR) and platelet-derived growth factor receptor-a (PDGFR) are targeted by miR-128 [59, 60]. [score:3]
They are point mutation/single nucleotide polymorphism [172], loss of heterozygosity (LOH) or amplification in miR-128 host gene ARPP21 [173], and epigenetic alteration of miR-128 gene by CpG-island methylation in promoter regions [44]. [score:2]
Three major mechanisms suggest the differential action of miR-128 in different cell types. [score:1]
Recent studies showed that miR-128 also modulates other mitogenic kinases such as oncogenic receptor tyrosine kinases (RTKs) in gliomas [60]. [score:1]
[1 to 20 of 14 sentences]
15
[+] score: 48
T1 expression is up-regulated whereas miR-128 expression is down-regulated in the spinal cord of ALS G93A mice and in human SALS. [score:11]
T1 up-regulation associated with down-regulation of miR-128 and disease progression in human sporadic ALS and in an ALS animal mo del, we suggest that TrkC. [score:9]
T1 up-regulation in spinal cord astrocytes in a mouse ALS mo del and human sporadic ALS is due to miR128 downregulation. [score:7]
Data are expressed as the mean + SEM (n = 8 spinal cord samples each group (B) The levels of miR-128 (regulator of TrkC. [score:4]
T1 is up-regulated in mouse and human ALS, due to decreased miR-128, a miR that destabilizes TrkC. [score:4]
1 [TrkC-T1] vectors, or by re -expressing miR-128 to promote degradation of TrkC. [score:3]
In healthy wild type spinal cord miR128 is expressed. [score:3]
T1 mRNA and reduced miR128 are detected in the mutant SOD1 mouse mo del, and also in humans with ALS unrelated to SOD1 mutations (which represent the majority of clinical cases). [score:2]
T1 mRNA and protein, whereas reduced miR128 levels would lead to increased TrkC. [score:1]
Pre-symptomatic ALS spinal cords (~100 days of age) have lower miR128, and symptomatic ALS spinal cords (~140 days of age) have even lower miR128 levels (p<0.003). [score:1]
T1 mRNA is destabilized by micro -RNA miR128 [24]. [score:1]
A miR128-promoted degradation would explain why healthy spinal cords have low or undetectable TrkC. [score:1]
T1 mRNA in human SALS is associated with significantly reduced levels of miR128 (a known disruptor of TrkC. [score:1]
[1 to 20 of 13 sentences]
16
[+] score: 36
miR-21 Most common oncomiR in a wide range of cancers, acting as an anti-apoptotic factor targeting a network of p53, transforming growth factor beta (TGF-β), and mitochondrial apoptosis tumor suppressor genes miR-10b Commonly upregulated miRNA in glioblastoma, located in HOX cluster miR-128 miRNA associated with glioma stem cell properties and neuronal differentiation via Bmi-1 and epidermal growth factor receptor (EGFR)/platelet-derived growth factor (PDGF)/AKT signaling pathways miR-34b One of the most elucidated tumor suppressor miRNAs, considered a key regulator of tumor suppressor pathways; one of the promising targets for miRNA replacement therapy miR-196 Extremely highly expressed miRNA in glioblastoma showing significant association with overall survival Based on molecular pathological perspectives, GBM is a heterogeneous tumor. [score:16]
Godlewski et al. (2008) identified down-regulation of miR-128 in GBM compared with adjacent brain, leading to reduced self-renewal of glioma stem cells via Bmi-1 down-regulation. [score:6]
Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. [score:5]
In fact, recent research has facilitated the replacement of miRNAs for tumor suppressor miR-7, miR-128, and miR-34a over the inhibitory approach (Godlewski et al., 2008; Kefas et al., 2008; Bader, 2012). [score:5]
Recurrent aberrations of expression were thus detected in only four miRNAs (miR-21, miR-10b, miR-128-1, and miR128-2). [score:3]
In addition to miR-128, miR-124, miR-137 (Silber et al., 2008), miR-34a (Li et al., 2009; Guessous et al., 2010), and miR-326 (Kefas et al., 2009) reportedly play roles in the maintenance of CSC properties. [score:1]
[1 to 20 of 6 sentences]
17
[+] score: 35
Transcriptome-supported target genes of miR-128 and miR-30 were downregulated when human rhabdomyosarcoma cells were transfected with lentiviral constructs overexpressing miR-128 (E) and miR-30 (F). [score:8]
Ectopic overexpression of miR-128 led to the downregulation of three of its four target genes, randomly selected among the genes supported by our transcriptome data. [score:8]
One transcriptome-supported miR-128 target gene, RBM15B, could not be validated using qRT-PCR, as we did not observed significant changes in its expression level following miRNA precursor tranfection (data not shown). [score:5]
Here we confirm the target genes of miR-128 might be involved in these biological functions. [score:3]
In addition, transcriptome analysis of cell transfected with miR-128 revealed an alteration of the expression of genes implicated in cytoskeleton organization, kinase activity and protein phosphorylation [81]. [score:3]
In addition, our predictions suggest that miR-128 might target genes in DNA damage response, transport, protein modification and ubiquitination and cell motility (Figure  5, Additional file 9). [score:3]
These novel qRT-PCR validated miR-128 target genes include EDARADD (EDAR -associated death domain), CAV1 (Caveolin 1) and DTYMK (deoxythymidylate kinase) (Figures  4C). [score:3]
Human rhabdomyosarcoma cells (RD) were transfected with plasmids coding for miR-128 and miR-30 precursors or scrambled sequence (scr) (B). [score:1]
phrGFP-1 vector was from Stratagen, pcDNA3.2/V5 hsa-mir-128 (#26308) [115] and pCMV-miR30 (#20875) [116] vectors were provided by Addgene. [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 32
Each data point stands for one gene Of the four miRNAs that were significant, three miRNAs, miR-124, miR-9, and miR-128, show highly specific expression in the brain, based on a dataset of miRNA expression profiles across 40 human tissue samples [21] (Fig.   3b), which is consistent with the observed brain-specific destabilization of their targets. [score:7]
Each data point stands for one gene Of the four miRNAs that were significant, three miRNAs, miR-124, miR-9, and miR-128, show highly specific expression in the brain, based on a dataset of miRNA expression profiles across 40 human tissue samples [21] (Fig.   3b), which is consistent with the observed brain-specific destabilization of their targets. [score:7]
For validation of miRNA targets, we obtained experimentally validated targets of hsa-miR-124-3p, hsa-miR-128-3p, hsa-miR-29(a/b/c)-3p, and hsa-miR-9-5p from miRTarBase [35] release 6.1, which is a database of miRNA-target interactions collected from literature. [score:7]
Papagiannakopoulos T Pro-neural miR-128 is a glioma tumor suppressor that targets mitogenic kinasesOncogene. [score:5]
Of these miRNAs, miR-124 and miR-9 are involved in development and function of the nervous system 22, 23, and de-regulation of miR-128 is associated with tumors of the nervous system 24, 25. [score:3]
We show that a substantial portion of the brain mRNA stability profile can be explained by the functions of two RNA -binding protein families (the RBFOX and ZFP36 families) and four miRNAs (miR-124, miR-29, miR-9, and miR-128). [score:1]
Specifically, presence of 3′ UTR binding sites for miR-124, miR-29, miR-9 and miR-128 was significantly associated with reduced mRNA stability, whereas binding sites of RBFOX and ZFP36 families of RBPs were significantly associated with increased stability. [score:1]
Furthermore, our high-confidence network is significantly enriched for experimentally validated interactions that are collected from the literature for each of the four miRNAs miR-124, miR-128, miR-29, and miR-9 [35] (Fig.   4e). [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 30
Indeed the downregulation of Phf6 that occurs in these cortical layers during development was inversely correlated with an increase in the expression levels of miR-128. [score:7]
In this regard, the recent findings of a network whereby neurogenesis depends upon the timely expression of PHF6 to positively regulate NGC/CSPG5 (via PAF1) to ensure proper cortical neuron migration, and miR-128 to negatively regulate PHF6, which allows for subsequent neuronal maturation, represent the first clear mo del of a developmental role for PHF6 [20, 87]. [score:6]
These findings are strikingly similar to those of Franzoni et al. who also ectopically expressed Phf6 to rescue neuronal migration defects that accompanied premature expression of miR-128 in the developing neocortices of mice [20]. [score:5]
Interestingly, miR-128 is also oncogenically expressed in tumours arising from non-neuronal tissue, including T-ALL, where PHF6 was confirmed as a target [25]. [score:5]
Post-transcriptionally, PHF6 mRNA is targeted by as many as 25 microRNAs, including miR-20a, miR-26a, miR-128, and miR-574 [20, 24, 25]. [score:3]
Mets E. Van Peer G. Van der Meulen J. Boice M. Taghon T. Goossens S. Mestdagh P. Benoit Y. De Moerloose B. Van Roy N. Microrna-128–3p is a novel oncomir targeting phf6 in t-cell acute lymphoblastic leukemia Haematologica 2014 26. [score:3]
Franzoni et al. recently described that miR-128, which has three binding sites in the Phf6 3’ UTR, is essential for mediating the switch between neuronal migration and neurite outgrowth by silencing Phf6 in upper level cortical neurons [20]. [score:1]
[1 to 20 of 7 sentences]
20
[+] score: 30
In addition, miR-128 specifically inhibits the self-renewal capacity of GSCs by directly targeting BMI-1, a polycomb family transcriptional repressor required for postnatal maintenance of neural stem cells in the peripheral and central nervous system (Molofsky et al., 2003). [score:6]
Patients with high-grade glioma show significant downregulation of miR-128 expression. [score:6]
Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. [score:5]
MiR-124 and miR-128 are the most highly expressed miRNAs in the adult brain and are preferentially expressed in neurons (Smirnova et al., 2005). [score:5]
Functional analyses showed that miR-128 expression inhibits glioma cell proliferation in vitro and glioma xenograft growth in vivo (Godlewski et al., 2008). [score:5]
Since BMI-1 maintains neural stem cells in an undifferentiated self-renewing state, the regulation of BMI-1 by miR-128 may contribute to normal stem cell regulation. [score:3]
[1 to 20 of 6 sentences]
21
[+] score: 27
miR-124 precursor expression was not different between SCZ and control individuals and the differentially expressed miR-137 target genes may only slightly be co-regulated by miR-124 and miR-128. [score:8]
miR-137 acts cooperatively and synergistically with miR-124 and miR-128 [7, 33, 34]; therefore, changes in the expression of these two microRNAs may interfere with the expression of miR-137 target genes. [score:7]
We analyzed miR-124 and miR-128, which act cooperatively with miR-137, and obtained no evidence that these two microRNAs influence the differential expression of miR-137 targets. [score:5]
Several targets listed in Table  1 had putative binding sites for miR-124 (5 out of 16) and miR-128 (1 out of 16) (Additional file  1: Table S7). [score:3]
Analysis of the 3′UTR of the differentially expressed miR-137 genes in the DLPFC between SCZ and control individuals for additional putative miR-124 and miR-128 binding sites. [score:3]
No data was available for MIR-128 (ENSG00000207654, ENSG00000207625) or for mature microRNAs. [score:1]
[1 to 20 of 6 sentences]
22
[+] score: 27
Similarly, miR-128 inhibits P70s6 kinase 1 (P70s6k1) translation and suppresses the expression of its downstream effectors, hypoxia-inducible factor 1 (HIF-1) and VEGF, which are both key mediators of tumor angiogenesis, reducing vascularization. [score:9]
Godlewski J. Nowicki M. O. Bronisz A. Williams S. Otsuki A. Nuovo G. Raychaudhury A. Newton H. B. Chiocca E. A. Lawler S. Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal Cancer Res. [score:5]
Wu N. Wu G. C. Hu R. Li M. Feng H. Ginsenoside Rh2 inhibits glioma cell proliferation by targeting microRNA-128 Acta Pharmacol. [score:5]
A group of miRNAs, including miR-218, miR-21, miR-132, miR-134, miR-155, and miR-409-5p, were reported to be overexpressed by three times as much in GBM compared with oligodendrogliomas, while miR-128 expression in oligodendrogliomas is four times higher than that in GBM. [score:4]
Zhang Y. Chao T. Li R. Liu W. Chen Y. Yan X. Gong Y. Yin B. Liu W. Qiang B. MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a J. Mol. [score:4]
[1 to 20 of 5 sentences]
23
[+] score: 26
Previously, it was reported that miR-128 was down-regulated and E2F3a was highly expressed in glioma cells or tissues, and upregulation of miR-128 significantly reduced the luciferase activity of a luciferase-reporter containing the 3′-UTR of E2F3a mRNA [19]. [score:9]
In glioma cells, overexpression of miR-128 inhibited cell proliferation in T98G cells by targeting E2F3a and augment of E2F3a can partly rescue the proliferation inhibition caused by miR-128 [19]. [score:9]
Likewise, down-regulation of miR-128 was reported to promote proliferation of undifferentiated GBM cells, in part, by coordinately up -regulating E2F3a [20]. [score:5]
Conformably, miR-128 was also observed to be significantly reduced in glioblastoma multiforme (GBM) tissues and cell lines and E2F3a was its bioinformatics-verified target [20]. [score:3]
[1 to 20 of 4 sentences]
24
[+] score: 24
Figure 5 Since miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494 were found downregulated and have been shown to induce chemoresistance (Figure 5), we evaluated the expression of some of them, including miR-15b (Hs04231486_s1), miR-23a (Hs03659093_s1) and miR-29a (Hs03849009_s1), through TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
Finally, given that PTEN has been shown to be a hypothetical gene target for miR106b and miR-494, BAX for miR-128, and BIM (or BCL2L11) for miR-192, their gene expression was analyzed by means of quantitative Real-time PCR analysis (Supplementary Figure 5). [score:5]
Figure 5Since miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494 were found downregulated and have been shown to induce chemoresistance (Figure 5), we evaluated the expression of some of them, including miR-15b (Hs04231486_s1), miR-23a (Hs03659093_s1) and miR-29a (Hs03849009_s1), through TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
We found that some miRNAs, including miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494, were downregulated in MDA-MB-231 cells under STS conditions. [score:4]
MiR-15b and miR-23a have been shown to increase Cisplatin-resistance in lung cancer cell line A549 [28] and in tongue squamous cell carcinoma [29], whereas miR-29a induced Adriamycin and Docetaxel resistance in breast cancer (BC) [30], miR-128 enhanced antiblastic resistance in BC cells targeting BAX [31], miR-192 promoted Cisplatin-resistance in lung cancer cells A549/DDP [32], and, finally, miR-106b and miR-494 conferred radioresistance and Sorafenib-resistance in colorectal cancer and hepatocellular carcinoma silencing PTEN and p21 [33– 35]. [score:3]
Among miRNAs involved in chemotherapy response, miR-26a, miR-106b, miR-128 and miR-192 were not found significantly deregulated. [score:2]
[1 to 20 of 6 sentences]
25
[+] score: 20
Overexpression of miR-128 in HNSCC cell lines inhibited cell growth and downregulated anti-apoptotic proteins, including MDM2, Bcl2, and NFkB (57). [score:8]
Further, Sirt1, a target of differentially expressed miR-128-3p and miR-32-5p, also deacetylates p53, thereby inhibiting its transcriptional activity (47). [score:7]
Mir-128 has been shown to be downregulated in many types of cancer and acts as a tumor suppressor in HNSCC specifically. [score:5]
[1 to 20 of 3 sentences]
26
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
Cell cycle and Neurotrophin signaling pathway were regulated by ssc-miR-20b, ssc-miR-128, ssc-miR-497, ssc-miR-195 and ssc-miR-371-5p through corresponding putative target genes. [score:4]
[1 to 20 of 3 sentences]
27
[+] score: 18
Godlewski et al. identified downregulation of miR-128 in glioblastoma compared with adjacent brain, leading to a reduction in self-renewal of glioma stem cells via Bmi-1 downregulation [15]. [score:6]
In addition, TCGA revealed that miR-128 expression is lower in high-grade gliomas than in low-grade gliomas. [score:3]
These findings support that miR-128 has a potential to achieve its therapeutic effect by suppressing proliferation and enhancing differentiation of glioma initiating cells. [score:3]
A recent study revealed that reduced miR-128 levels are associated with dedifferentiation and aggressiveness of malignant gliomas via EGFR/PDGF/AKT signaling [37]. [score:1]
In addition to miR-128 described above, miR-124, -137 [42], -34a [43, 44], and -326 [45] have been reported to play roles in the maintenance of CSC properties. [score:1]
Verhaak et al. have revealed that miR-128 was repressed in glioblastoma classified the aggressive/dedifferentiated tumor subtype [2]. [score:1]
Consequently novel miRNAs, of which more than three studies confirmed aberrations, were only four miRNAs (miR-21, miR-10b, miR-128-1, and miR-128-2). [score:1]
Interestingly, miR-128 is enriched in brain, and associated with terminally differentiated neuron [38, 39]. [score:1]
6. miR-128. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 18
Meanwhile, a systemic screen for miRNA aberrations by microarray of 245 miRNAs in GBM samples first identified a set of dysregulated miRNAs, including the upregulation of miR-10b-5p, miR-21-5p and miR-25-3p, and downregulation of miR-128-3p and miR-181a-5p/181b-5p/181c-5p [23]. [score:8]
Apart from direct repression of EGFR expression, miR-128-3p was shown to simultaneously target PDGFRA [34]. [score:6]
miR-7-5p [33], miR-128-3p [34], miR-491-5p [35] and miR-218-5p [36] coordinately regulate the expression of EGFR in human GBM. [score:4]
[1 to 20 of 3 sentences]
29
[+] score: 17
Other miRNAs from this paper: hsa-mir-128-1
Colorectal cancer patients with high miR-128 expression had significantly lower NEK2A expression and lower recurrence rates than those with low miR-128 expression. [score:7]
MicroRNA-128, a tumor suppressor, is thought to target NEK2A in colorectal cancer cell [68]. [score:4]
Consistent with other tumor suppressor microRNAs, microRNA-128 is silenced by DNA methylation in colorectal cancer cells. [score:3]
A two- to threefold recovery of miR-128 expression was found after 5-aza-2-deoxycytidine (5aza-dC) treatment, a DNA-demethylating agent. [score:3]
[1 to 20 of 4 sentences]
30
[+] score: 16
miR-128 has been reported to inhibit lymphangiogenesis in human non-small cell lung cancer by directly suppressing VEGF-C expression [20]. [score:8]
Accumulating evidences further indicate that numerous miRNAs can impede cancer progression via direct suppression of VEGF-C. miR-27b, miR-101, miR-128, miR-206 and miR-1826 have been reported to inhibit tumor growth, lymphangiogenesis and metastasis by targeting VEGF-C in a variety of human cancer cells [20– 22, 38– 40]. [score:8]
[1 to 20 of 2 sentences]
31
[+] score: 14
NANOG, a downstream target of activated SMAD2/3, has been predicted to be a miR-128 target, but not a miR-27 target gene, by TargetScan. [score:9]
An interesting observation, when screening for miR-27 target sites, was that miR-27 sites are often predicted to be binding sites for miR-128 and vice versa. [score:3]
However, the seed sequence of miR-128 (CACAGUG, nucleotides 2–7) can also be found within the miR-27 sequence (U CACAGUG, nucleotides 3–8). [score:1]
Interestingly, the seed sequences of miR-128 (CACAGUG) and miR-27 (UCACAGU) overlap but are not identical. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 14
It is a direct target of miR-10b [63] and miR-128 [49], and is indirectly suppressed by miR-27 [46] and miR-378 [64]. [score:7]
Treatment with miR-27a/b [46], miR-128 [49], miR-145 [50], miR-302 [51], and miR-758 [48] directly suppressed ABCA1 by binding to its 3' UTR and attenuated cholesterol efflux to ApoA1. [score:4]
Adlakha Y. K. Khanna S. Singh R. Singh V. P. Agrawal A. Saini N. Pro-apoptotic miRNA-128-2 modulates ABCA1, ABCG1 and RXRα expression and cholesterol homeostasis Cell Death Dis. [score:3]
[1 to 20 of 3 sentences]
33
[+] score: 13
Another miR-128 putative target engaged in muscle development, Nr5a2, was identified in chickens [44]. [score:4]
For non-myomiRs, a statistically significant upregulation of miR-128 and -139 was confirmed. [score:4]
Further, we assume that, at least partially, the coordinated action of miR-128 and miR-139 could influence the HER/LIM cell differentiation in a similar manner, possibly via the inhibition of Foxo1 and Nr5a2. [score:3]
A few high-throughput studies have confirmed some of the identified miRNAs (miR-1, miR-128, miR-133a, miR-133b, miR-206, miR-222, and miR-503) as common for skeletal muscle development in mouse, human, pig, common carp [11], and cattle [25]. [score:2]
[1 to 20 of 4 sentences]
34
[+] score: 13
However, miR-128-3p showed the lowest uncorrected P-value (0.001) and this miRNA was detected in 7 non-smoker cases and 9 smoker cases and was slightly up-regulated in smokers (Figure  5). [score:4]
Figure 5 Serum miR-128-3p expression in current smokers and never smokers. [score:3]
We have found that although miR-128-3p was not significantly deregulated in the serum of smokers, this miRNA was detected in more current smoker samples than non-smoker samples and had the lowest P-value prior to correction. [score:2]
Taking the results of both studies into account, the role of smoke exposure should be considered when determining the possible utility of miR-128-3p as a biomarker of disease. [score:2]
A recent study using 6-month cigarette smoking in mice found that the levels of miR-128-3p were significantly changed in the lung tissue and plasma of exposed mice suggesting a role for this miRNA in the cellular response to cigarette smoke exposure [43]. [score:1]
Levels of miR-128-3p in the serum of non-smokers and current smokers. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 12
The expression of mir-296-5p (p = 0.002), mir-122 (p<0.001), mir-448 (p<0.001) and mir-128 (p<0.001) was significantly down-regulated in patients with chronic hepatitis C compared to normal non-infected patients (Fig. 2C). [score:5]
Moreover, IFNα/β up-regulates several cellular miRNAs (mir-196, mir-296, mir-351, mir-431, mir-1, mir-30 and mir-128 and mir-448) with putative recognition sites within HCV genome [17]. [score:4]
2C- The expression of mir-122, mir-196b, mir-296-5p, mir-448, mir-431 and mir-128 was analyzed by RT q-PCR in the total group of patients (n = 111). [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 12
miRNA Target Genes Pathways miR-128 ABCB9, BTG1, DSCR1, RASD1 ABC transporters General miR-136 GRN, PPP1R9B miR-147 HOXA1, PTGFRN miR-148 EGR3, SCN3A miR-181b IGF1R, NKX6-1 Adherens junction, Maturity onset diabetes of the, Focal adhesion, **Long term depression miR-196a ABCB9, CPB2, IRS1, MAPK10 ABC transporters General, Complement and coagulation cas, Adipocytokine signaling pathwa, Insulin signaling pathway, Type II diabetes mellitus, Fc epsilon RI signaling pathwa, Focal adhesion, **GnRH signaling pathway, **MAPK signaling pathway, Toll like receptor signaling p, Wnt signaling pathway miR-203 SARA1 miR-20 BTG1, SARA1, YWHAB Cell cycle miR-21 TPM1 mir-216 GNAZ **Long term depression miR-217 RHOA Adherens junction, Axon guidance, Focal adhesion, Leukocyte transendothelial mig, Regulation of actin cytoskelet, TGF beta signaling pathway, T cell receptor signaling path, Tight junction, Wnt signaling pathway miR-31 ATP2B2, DNM1L, EGR3, PPP1R9B, YWHAB **Calcium signaling pathway, Cell cycle miR-7 SLC23A2 miR-7b HRH3, NCDN, SLC23A2 **Neuroactive ligand receptor in b: miRNAs and their targets (from TargetScan and miRanda). [score:8]
We predict that several of the differentially regulated genes are miRNA targets and miR-21, miR-31, miR-128, miR-147 and miR-217 may be the important players in such interaction. [score:4]
[1 to 20 of 2 sentences]
37
[+] score: 12
Moreover, it has been shown that the absence of miR-128 expression in miR-128-2−/− mice causes seizure -induced death, which is prevented by its overexpression [76]. [score:5]
Similar to our observation, prominent down-regulation of miR-128 has been recorded in the acute and chronic phase of Litio-PILO induced epileptogenesis [75]. [score:4]
In fact, the bioinformatics analysis of the validated targets of hsa-miR-128 showed a significantly over-representation of pathways such as P53, Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade (Table 1), which are enhanced after SE insult. [score:3]
[1 to 20 of 3 sentences]
38
[+] score: 11
Other miRNAs from this paper: hsa-mir-128-1
Overexpression of miR-128 resulted in downregulation of PCM1, leading to repressing proliferation of neural progenitor cells yet simultaneously promoting their differentiation into neurons. [score:6]
Conversely, the reduction of miR-128 elicited the opposite effects; promotion of proliferation and suppression of differentiation of neural progenitor cells [140]. [score:3]
One recent report [140] shows that a microRNA, called miR-128, negatively regulates the cellular levels of PCM1. [score:2]
[1 to 20 of 3 sentences]
39
[+] score: 11
Other miRNAs from this paper: hsa-mir-128-1, hsa-mir-206, hsa-mir-410, hsa-mir-300
miR-128 has been documented to suppress lymphangiogenesis in human non-small cell lung cancer by directly inhibiting VEGF-C expression [30]. [score:8]
Whether other miRNAs (miR128, miR410 or 186) are involved in WISP-1 -induced VEGF-C expression needs further examination. [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 11
Furthermore, overexpression of miR-7, a miRNA involved in the repression of the pro-oncogenic Akt pathway, reduced the proliferation and invasion in different GBM cell lines and in one GBM stem cell line [128], while expression of miR-128 inhibited the proliferation of glioma cells by decreasing the levels of E2F3a [129]. [score:7]
Zhang Y. Chao T. Li R. Liu W. Chen Y. Yan X. Gong Y. Yin B. Qiang B. Zhao J. Microrna-128 inhibits glioma cells proliferation by targeting transcription factor e2f3a J. Mol. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
Notably, in addition to porcine myomiRs (miR-1, -206, -133 a-3p/a-5p/b), three other miRNAs (miR-128, -208b and -378) reported to be related to muscle development in other mammals were also included in up-regulation Cluster 2, suggesting their roles in the regulation of porcine embryonic myogenesis at 35 to 77 dpc. [score:6]
miR-128 was reported to participate in the regulation of adipogenesis, osteogenesis and myogenesis [36] and herein, together with ssc-miR-411, up regulated at 35 to 77 dpc and fluctuated at 77 dpc to 180 dpn (Figure 5C), might behave in a similar manner as ssc-miR-133b during porcine muscle development. [score:4]
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 11
For instance, several brain-enriched miRNAs, miR-128, miR-181a, miR-181b, and miR-181c, are mainly down-regulated in glioblastomas [7], whereas miR-221 and miR-21 are strongly up-regulated in GBM and grade II–IV astrocytic tumors [8]. [score:7]
Generally, microRNAs are mainly down-regulated in cancers, as is the case with miR-128, miR-181a, miR-181b, and miR-181c in glioblastomas [7]. [score:4]
[1 to 20 of 2 sentences]
43
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
Indeed, miR-128 expression causes p21Waf1 upregulation through the inhibition of the transcriptional repressor E2F5 and its accumulation in the cytoplasm, a feature associated with the anti-apoptotic effect of p21waf1 [147]. [score:8]
Donzelli et al. demonstrated that in NSCLC, mutant p53R175H induces the expression of miR-128 through the transactivation of its host gene ARPP21, resulting in the increased chemoresistance of cancer cells. [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 10
In addition, it has been demonstrated that miR-128, a tumour suppressor miRNA which is upregulated during RA -mediated differentiation of NB SH-SY5Y cells, will inhibit the expression levels of Reelin, a glycoprotein that acts as a guide during migration, and DCX—doublecortin located on chromosome X—a microtubule -associated protein essential for neuroblastic migration - limiting cell motility and invasiveness [254]. [score:10]
[1 to 20 of 1 sentences]
45
[+] score: 10
It has also been reported that high expression of miR-196 and miR10b in GBM patients correlates with a poor prognosis [10], and that down-regulation of miR-128 leads to reduction in the self-renewal ability of glioma stem cells by inhibiting Bmi1 gene expression. [score:10]
[1 to 20 of 1 sentences]
46
[+] score: 10
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
For brain polyribosome -associated mRNAs from miR-128 knockout (KO) and wild-type (WT) mice, the presence of miR-128 chimeras in transcript 3′-UTRs correlated with enhanced polysome association in miR-128 KO brain (Fig. 2a) 2. Sites with canonical seed matches and non-canonical sites predicted significant de-repression (Fig. 2b). [score:2]
Non-miR-128 3′-UTR chimeras were plotted as controls. [score:1]
Normalized microarray values for CAD neuroblastoma cells transfected with miR-124 or control mimics were obtained from GEO and processed as for miR-128 profiles 38. [score:1]
For cumulative distribution function (CDF) analysis (Fig. 2a,b), log [2]FC ratios (KO/WT) in transcript polysome association were plotted for miR-128 3′-UTR chimera sites. [score:1]
Normalized microarray values for polyribosome profiles in miR-128 KO and WT mouse brains were obtained from GEO 2. Genes with contradictory probe information (different signs) were filtered and probe log [2] fold-change (log [2]FC) values for remaining genes were averaged. [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 10
Increasing evidence suggests that several miRNAs can reduce tumor progression via direct repression of VEGF-C. miR-27b, miR-101, miR-128 and miR-206 have been shown to inhibit lymphangiogenesis and metastasis in a variety of human cancer cells, via the targeting of VEGF-C. 27, 37, 38 This current study demonstrates that BDNF markedly inhibited the expression of miR-624-3p in human chondrosarcoma cells and specimens. [score:10]
[1 to 20 of 1 sentences]
48
[+] score: 10
For example, miR-128, miR-130b and miR-210 were up-regulated and miR-424, miR-223, miR-23a, miR-27a were down-regulated in the patient group, indicating that there is a concordance between the findings despite using completely different miRNA expression analysis platforms, which suggests that these novel techniques are robust. [score:9]
Of these, miR-9*, miR-9, miR-181a and miR-128 exhibited a significantly high abundance, whilst miR-582-5p, miR-223, miR-143, miR-126 etc. [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Consequently, the expression trends of 8 differentially expressed miRNAs (miR-128, miR-1271, miR-181a, let-7i, let-7c and let-7a) in SE animal group were found to show opposite expression pattern relative to their potential target genes (Table  3). [score:9]
[1 to 20 of 1 sentences]
50
[+] score: 9
Out of 81 miRNAs examined and followed by two criteria (statistical significance and 2 -FC), the expression of three H [2]O [2] -downregulated miRNAs (let-7i, miR-106b, and miR-128) was significantly downregulated by curcumin pretreatment. [score:9]
[1 to 20 of 1 sentences]
51
[+] score: 9
Studies in glioma have shown that miRNA128 regulates BMI-1 mRNA and protein expression by directly targeting the 3′-UTR of BMI-1 mRNA [40]. [score:7]
Whether miRNA128 contributes to BMI-1 regulation in ESFT remains to be elucidated. [score:2]
[1 to 20 of 2 sentences]
52
[+] score: 9
Also, miR-125a-5p/-351, miR-200c/-429, miR-106b/-17, miR-363/-92b, miR-181b/-181d, miR-19a/-19b, let-7d/-7f, miR-18a/-18b, miR-128/-27b and miR-106a/-291a-3p pairs exhibited significant synergy and their association to aging and/or cardiovascular diseases is supported in many cases by a disease database and previous studies. [score:5]
Further, we comment on miR-27b (miR-128/-27b pair appeared on the 8 [th] rank) which was shown to be up-regulated to different degrees in the old versus young adult heart and was induced during early hypertrophic growth in response to pressure-overload [6]. [score:4]
[1 to 20 of 2 sentences]
53
[+] score: 9
Godlewski J. Nowicki M. O. Bronisz A. Williams S. Otsuki A. Nuovo G. Raychaudhury A. Newton H. B. Chiocca E. A. Lawler S. Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal Cancer Res. [score:5]
The expression of Bmi1 is regulated by miRNAs, such as miR-128, miR-200b/c, miR-141, miR-15, miR-16, miR-203, miR-183, miR-194, and miR-218 [24, 67, 121, 122, 123, 124, 125]. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 9
TFEB expression has already been shown to be downregulated by a miRNA (miR-128) (10), emphasizing the importance of these molecules for the regulation of CLEAR genes expression and, consequently, lysosomal function. [score:9]
[1 to 20 of 1 sentences]
55
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
The involvement of miRNA-128-3p expression by directly targeting ATG 1 in cerebral ischemia rat mo del has been established recently (Shi et al., 2016). [score:6]
MiR-128-3p activates autophagy in rat brain cells after focal cerebral ischemia reperfusion through targeting Atg1. [score:2]
[1 to 20 of 2 sentences]
56
[+] score: 8
This approach enabled the identification of miRNAs whose expression is significantly altered in tumors compared with peripheral brain areas from the same patient, including miR-221, strongly up-regulated in GBM, and a set of brain-enriched miRNAs, miR-128, miR-181a, miR-181b, and miR-181c, which were down-regulated in glioblastoma [36]. [score:8]
[1 to 20 of 1 sentences]
57
[+] score: 8
Other miRNAs from this paper: hsa-mir-128-1, hsa-mir-206, hsa-mir-381
Investigations have documented that miR-128 suppresses human non-small cell lung cancer lymphangiogenesis by directly inhibiting VEGF-C expression [29], while overexpression of miR-206 attenuates VEGF-C levels and lymphangiogenesis in pancreatic adenocarcinoma [30]. [score:8]
[1 to 20 of 1 sentences]
58
[+] score: 8
Several of these IFN -induced miRNAs (miR-1, miR-30, miR-128, miR-196, miR-296) are expressed in peripheral blood mononuclear cells (PBMCs) from healthy individuals and from chronic HCV-infected patients, and their expression is upregulated by IFN treatment to varying degrees [22]. [score:8]
[1 to 20 of 1 sentences]
59
[+] score: 8
Other miRNAs from this paper: hsa-mir-128-1
During the process of neurogenesis, a regulatory circuit is activated in differentiating neurons whereby expression of miR-128 targets mRNAs of several NMD factors for translational repression [90]. [score:8]
[1 to 20 of 1 sentences]
60
[+] score: 8
Overexpression of miR-128 specifically inhibits the truncated isoform of NTRK3 and upregulates BCL2 in SH-SY5Y neuroblastoma cells. [score:8]
[1 to 20 of 1 sentences]
61
[+] score: 8
This resulted in a significant suppression of FAS mRNA, which is a target of miRNA-2320 and miRNA-181a, and decreases of SERPINE mRNA, a target of miRNA-769-3p and miRNA-128, respectively [77]. [score:7]
Chen et al. [77] recently demonstrated that the addition of porcine milk exosomes to IPEC-J2 intestinal cells raised intracellular levels of milk-specific miRNA-7134, miRNA-1343, miRNA-2320, miRNA-181a, miRNA-769-3p, and miRNA-128. [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 8
From integrated genomic analysis, 8 key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were predicted to regulate 89% of the miR targets in the network [26]. [score:4]
Eight key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were identified and predicted to regulate 89% of the targets in this network. [score:4]
[1 to 20 of 2 sentences]
63
[+] score: 8
miR-17-5p and miR-128-3p showed no significant differences in expression between the three sample groups, whereas miR-146a-5p was significantly higher expressed in the tested ccRCC-M0 and ccRCC-M1 tissues in comparison to the normal kidney (Table 1). [score:5]
0148746.g001 Fig 1 To confirm the results of the IPA [®]'s MicroRNA Target Filter analysis, the three miRNAs miR-146a-5p, miR-128-3p, and miR-17-5p were revalidated by RT-qPCR in a second set of samples, including normal kidney and primary ccRCC samples from ccRCC-M0 and ccRCC-M1 patients. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 7
Micro -RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation. [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 7
The 50 miRNAs that showed highest total reads (most abundant) in the exosomes of the 36 patient samples were then subjected to unsupervised hierarchal clustering with the expression heat maps of the individual patient samples shown in Figure 1. The twenty most variable miRNAs among all samples were then further validated by qPCR analysis to examine their differential expression within the four patient cohorts described in Table 1. These miRNAs included let-7b, let-7g, miR-17, miR-19a, miR-19b, miR-20b, miR-21, miR-23a, miR-29a, miR-92a, miR-125b, miR-126, miR-128, miR-137, miR-148a, miR-149, miR-199a, miR-221, miR-222 and miR-423 (Table 2). [score:5]
hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT hsa-let-7g-5p TGAGGTAGTAGTTTGTACAGTT hsa-miR-125b TCCCTGAGACCCTAACTTGTGA hsa-miR-126 TCGTACCGTGAGTAATAATGCG hsa-miR-128 TCACAGTGAACCGGTCTCTTT hsa-miR-137 TTATTGCTTAAGAATACGCGTAG hsa-miR-148a AAAGTTCTGAGACACTCCGACT hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-199a-5p CCCAGTGTTCAGACTACCTGTTC hsa-miR-19a TGTGCAAATCTATGCAAAACTGA hsa-miR-19b TGTGCAAATCCATGCAAAACTGA hsa-miR-20b TAAAGTGCTTATAGTGCAGGTAG hsa-miR-21 TAGCTTATCAGACTGATGTTGA hsa-miR-221 AGCTACATTGTCTGCTGGGTTTC hsa-miR-222 AGCTACATCTGGCTACTGGGT hsa-miR-23a ATCACATTGCCAGGGATTTCC hsa-miR-29a TAGCACCATCTGAAATCGGTTA hsa-miR-423-5p TGAGGGGCAGAGAGCGAGACTTT hsa-miR-92a TATTGCACTTGTCCCGGCCTGT Since there are no known control or house-keeping microRNAs in exosomes, we adopted the strategy of using spiked-in C. elegans miRNAs directly into Qiazol prior to RNA extraction as normalizing controls [20]. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 7
Downregulation of miR-7 was previously reported in glioblastoma [24] along with underexpression of miR-128 in lung cancer [23], but in HNSCC cell lines the expression of these miRNAs was variable as compared to controls (Fig. S1A). [score:7]
[1 to 20 of 1 sentences]
67
[+] score: 7
miR-221 was strongly upregulated, whereas miR-128, miR-181a, miR-181b and miR-181c were downregulated in glioblastoma [29]. [score:7]
[1 to 20 of 1 sentences]
68
[+] score: 7
For instance, miRNAs have been implicated in neural cell developments, and miR-128 was shown to reduce the expression of the neural stem cell renewal factor Bmi-1 [41]. [score:4]
For example, some miRNAs (miR-497, miR-128, miR-15, and miR-16) can induce apoptosis by targeting BCL2 in neuronal cells [9, 53, 54]. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 7
miR-128 in the brain regulates Phf6, which is a mutated gene in the disorder Borjeson–Forssman–Lehmann syndrome, and ectopic expression of miR-228 in the developing brain leads to neuron migration defects, neurite outgrowth, and electrophysiological changes (130). [score:4]
Interestingly, in Xenopus, miR-128 has been shown to repress NMD by targeting the RNA helicase, UPF1, and the exon-junction cofactor, MLN51 (86). [score:3]
[1 to 20 of 2 sentences]
70
[+] score: 7
Moreover, a recent report indicates that the expression profile of a set of seven miRNAs (miR-21, miR-128, miR-132, miR-134, miR-155, miR-210, and miR-409-5p) allows to discriminate between oligodendroglioma and glioblastoma [42]. [score:3]
MiR-128 is able to decrease the expression of E2F transcription factor 3 (E2F3a) and of the BMI1 polycomb ring finger oncogene (Bmi-1) [56], and this may explain the ability of this miRNA to decrease cell proliferation both in vitro and in vivo. [score:3]
Another example is miR-128, that belongs to the class of brain-specific microRNAs [55]. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 7
Interestingly, miR-125b inhibitor boosts the chemosensitivity of glioblastoma stem cells to TMZ by targeting Bak1 [9], whereas the miR-128, miR-149 and miR-181 families enhance the chemosensitivity of glioblastoma cells to TMZ by targeting Rap1B [10, 11]. [score:7]
[1 to 20 of 1 sentences]
72
[+] score: 7
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In a number of single studies, miRNAs such as let-7d [26], let-7i [26] and miR-210 [23] were also found to be up-regulated in prostate cancer, in contrast to let-7g [23], miR-27b [28], miR-99a [23], miR-126 [54], miR-128 [26], miR-152 [28], miR-200a [58] and miR-449a [59] which were down-regulated in prostate cancer samples. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
Alternately, important down-regulated miRNAs have also been identified in glioblastoma, such as miR-128 and miR-7 (12, 13). [score:4]
It has been demonstrated that miR-128 targets Bmi-1 and reduces cellular proliferation and self-renewal of glioma stem cells (13). [score:3]
[1 to 20 of 2 sentences]
74
[+] score: 7
In an initial expression profiling of the 13 most abundant brain miRNAs mentioned above [124], Lukiw [98] reported the up-regulation of miR-9, miR-125b and miR-128 in AD affected hippocampus (Table 1B). [score:6]
AD -associated miRNAs activated by stress-inducing agents, such as aluminum and iron sulfates, include miR-9, miR-125b and miR-128 [98, 107]. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 7
Micro -RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation. [score:7]
[1 to 20 of 1 sentences]
76
[+] score: 7
Exposure to particulate matter has been associated with altered expression of miR-128 (Bollati et al. 2015). [score:3]
We additionally detected a significant association between miR-128 expression and both Σphenols and Σparabens (0.11; 95% CI: 0.02, 0.20 and 0.09; 95% CI: 0.01, 0.17, respectively). [score:3]
Two miRNAs showed poor correlation between the two study stages, miR-128 and miR-155-5p. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 6
Other miRNAs from this paper: hsa-mir-128-1
Previously, it has been shown that mir128/128b regulates translation of a variety of transcripts in concert to control neuronal excitability (Lin et al., 2011; Tan et al., 2013). [score:4]
Therefore, we tested whether mir128 or other miRNAs were predicted to disproportionately bind regulated transcripts. [score:2]
[1 to 20 of 2 sentences]
78
[+] score: 6
For example, E2F3 (a target of miRNA-34a and miRNA-128) is involved in cell cycle regulation and the p53-signaling pathway. [score:4]
Another highlighted gene in the network, BMI1 is regulated by miR-128, miR-200b and miR-708. [score:2]
[1 to 20 of 2 sentences]
79
[+] score: 6
Indeed, there is evidence that antiepileptic drugs can interfere with miRNA expression: it has been reported that valproate can modulate miR-24, miR-34a, and miR-128 [22] and that phenobarbital can down-regulate miR-122 [23]. [score:6]
[1 to 20 of 1 sentences]
80
[+] score: 6
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-128-1, hsa-mir-200c, hsa-mir-200a
Erismodegib (a Shh signaling pathway inhibitor) could inhibit EMT and human prostate cancer stem cell growth in NOD/SCID IL2Rγ null mice by regulating Bmi-1 and microRNA-128[37]. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
Several brain enriched miRNAs (miR-128 and miR-132) and other miRNAs (e. g. miR-196, miR-222, and miR-9*, miR-7, miR-130b and miR-126-5p) that were previously shown to be associated with neurodegenerative diseases were downregulated in JEV-infected microglial cells at 48 h pi (Table S3). [score:6]
[1 to 20 of 1 sentences]
82
[+] score: 6
Take MAPK signaling pathway for instance, as shown in Fig. S1A, on PID 4, there are 38 DE miRNAs involved in MAPK signaling pathway and most DE miRNAs such as miR-450b-5p, miR-146b, miR-1343, miR-128, and miR-30a-5p were down-regulated while their targets such as MEF2C, NFKB1, TGFBR1, EGFR, JUN, and MAPK1 are key factors in MAPK signaling pathway (see map 04010 in KEGG database). [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
Other miRNAs from this paper: hsa-mir-128-1, dre-mir-128-1, dre-mir-128-2, dre-mir-128-3
It was recently elucidated that a brain-specific microRNA, miR-128, targets UPF1 and the exon-junction complex core component MLN51 in neural cells, negatively regulating their expression and reducing the NMD response. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
In another study, 5 serum miRNAs (let-7i-3pm, miRNA-5706, miRNA-4463, miRNA-3665, and miRNA-638) were up-regulated and 4 miRNAs (miRNA-124-3p, miRNA-128, miRNA-29a-3p, and lep-7c) were down-regulated in Chinese women with PCOS compared with control subjects [32]. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Several studies examine the expression of miRNAs during neurodevelopment as well as in the adult CNS and reveal that certain miRNAs are found preferentially expressed in neurons, e. g., miR-124 and miR-128 [10], whereas others, e. g., miR-23, miR-26 and miR-29, seem restricted to astrocytes [11]. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
Conversely, miR-128 downregulates E2F transcription factor 3a (E2F3a) in inhibiting glioblastoma proliferation [3]. [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
Other miRNAs from this paper: hsa-mir-128-1
Indeed, miR-128 represses L1 retrotransposition by binding directly to L1 RNA, suggesting a new function of microRNAs in mediating genomic stability by suppressing the mobility of endogenous retrotransposons. [score:4]
miR-128 represses L1 retrotransposition by binding directly to L1 RNA. [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 6
Among these, only miR-128 had previously been shown to be dysregulated in other neurodegenerative diseases, suggesting a pattern specific for these closely related diseases (94, 95). [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
The ROS induction resulted in up-regulation of a specific set of miRNAs, including miR-9, miR-125b, and miR-128 (Lukiw and Pogue, 2007). [score:4]
Aluminum exposure may induce genotoxicity via miRNA-related regulatory elements, for example, miR-146a, miR-9, miR-125b, and miR-128 (Lukiw and Pogue, 2007; Pogue et al., 2009). [score:2]
[1 to 20 of 2 sentences]
90
[+] score: 6
Other miRNAs from this paper: hsa-mir-128-1
Wu et al. [20] have confirmed that miRNA-128 induces differentiation of BMSCs into neuron-like cells when Wnt3a gene expression is downregulated. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 5
miR-124 and miR-128 are primarily expressed in neurons, whereas miR-23, miR-26, and miR-29 are expressed in high amounts in astrocytes [37]. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
HIV Tat protein has been reported to induce the expression level of miR-128 in primary cortical neurons, which targets the 3′ UTR of the presynaptic protein SNAP25. [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Interestingly, according to the miRNA target finding algorithm TargetScan the 3’UTR of leptin harbors putative miRNA binding sites for miR-9, miR-490, miR-29 family, miR-27 family and miR-128 [44]. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
Interestingly, several of the miRNAs that showed elevated expression in the blood samples of glioblastoma patients (vs healthy control) also exhibited increased expression in glioblastoma stem cells (vs normal neural stem cells) in our study (Table S1), including miR-424, miR-148a, miR-362-3p, miR-30d, miR-128. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
For example, the profiling of miRNA expression showed that the majority of miRNAs are downregulated in tumors compared to normal tissues, such as miR-128 in glioma tissues (22) and miR-145 in human breast cancer (23). [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
For example, miR-625, miR-103/miR-107, miR-21 and miR-301 have been found to promote CRC to invade and metastasize by stimulating multiple metastasis-promoting genes [27– 30], whereas miR-99, miR-137, miR-132 and miR-128 function as tumor suppressors to inhibit the metastasis of CRC [31– 34]. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
An increased expression of miR-21 in T cells promotes in vitro differentiation of Th2 cells, while icreased expression of miR-27 and miR-128 reduces production of IL-4 and IL-5 in activated CD4+ T cells. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
miRNA expression profiling has also demonstrated reduced expression of several miRNAs in GB including miR-7, miR-128, miR124, miR137, and miR-218 which have been linked to alterations in proliferation, differentiation, invasion, and stem cell self-renewal [18], [22], [23]. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
Primer Sequence (5'-3') ssc-miR-128-forward TCACAGTGAACCGGTCTCTTT ssc-miR-15b-forward TAGCAGCACATCATGGTTTACA ssc-miR-185-forward TGGAGAGAAAGGCAGTTCCTGA ssc-miR-221-3p-forward AGCTACATTGTCTGCTGGGTTT ssc-miR-378-forward ACTGGACTTGGAGTCAGAAGGC ssc-miR-novel-43-forward TTCAAGTAACCCAGGATAGGCT ssc-miR-novel-269-forward TACCCATTGCATATCGGAGTTG miR-reverse GTCGGTGTCGTGGAGTCG U6-forward TCGCTTTGGCAGCACCTAT U6-reverse AATATGGAACGCTTCGCAAA Poly(T) adapter GTCGGTGTCGTGGAGTCGTTTGCAATTGCACTGGATTTTTTTTTTTTTTTTTTV V = A, G, C. Figure 4 Validation of miRNA expression by RT-qPCR. [score:2]
Primer Sequence (5'-3') ssc-miR-128-forward TCACAGTGAACCGGTCTCTTT ssc-miR-15b-forward TAGCAGCACATCATGGTTTACA ssc-miR-185-forward TGGAGAGAAAGGCAGTTCCTGA ssc-miR-221-3p-forward AGCTACATTGTCTGCTGGGTTT ssc-miR-378-forward ACTGGACTTGGAGTCAGAAGGC ssc-miR-novel-43-forward TTCAAGTAACCCAGGATAGGCT ssc-miR-novel-269-forward TACCCATTGCATATCGGAGTTG miR-reverse GTCGGTGTCGTGGAGTCG U6-forward TCGCTTTGGCAGCACCTAT U6-reverse AATATGGAACGCTTCGCAAA Poly(T) adapter GTCGGTGTCGTGGAGTCGTTTGCAATTGCACTGGATTTTTTTTTTTTTTTTTTV V = A, G, C. Figure 4 Validation of miRNA expression by RT-qPCR. [score:2]
Seven candidate miRNAs were randomly selected: two novel miRNAs (ssc-miR-novel-43 and ssc-miR-novel-269) and five known miRNAs (ssc-miR-128, ssc-miR-15b, ssc-miR-185, ssc-miR-221-3p and ssc-mir-378). [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 5
Other miRNAs from this paper: hsa-mir-128-1
Godlewski J. Nowicki M. O. Bronisz A. Williams S. Otsuki A. Nuovo G. Raychaudhury A. Newton H. B. Chiocca E. A. Lawler S. Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewalCancer Res. [score:5]
[1 to 20 of 1 sentences]