sort by

47 publications mentioning mmu-mir-219a-2

Open access articles that are associated with the species Mus musculus and mention the gene name mir-219a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 512
Our observation that miR-219 expression is upregulated, whereas TLX expression is downregulated, in DISC1-mutant NSCs provides a direct link between TLX and miR-219 expression and DISC1 function. [score:14]
Moreover, the expression of PDGFRα, similar to TLX, was relatively high in NSCs but low in neurons, whereas the expression of miR-219 was relatively low in NSCs but increased in neurons, inversely correlating to the expression of PDGFRα and TLX (Supplementary Fig. 3c–e), supporting the concept that TLX represses the expression of miR-219, while miR-219 inhibits the expression of PDGFRα. [score:13]
To determine whether inhibition of PDGFRα by TLX is mediated by upregulating miR-219, we co-transduced NSCs with lentivirus expressing TLX siRNA and lentivirus expressing TuD-miR-219, a tough decoy inhibitor 35 of miR-219. [score:12]
Co -expressing TuD-miR-219 with TLX siRNA rescued the inhibition of PDGFRα expression by TLX siRNA substantially (Supplementary Fig. 3g), suggesting that TLX regulates PDGFRα expression through miR-219. [score:10]
We show here that knockdown of PDGFRα expression induced NSC phenotypes similar to that induced by miR-219 overexpression, whereas overexpression of PDGFRα restored NSC phenotypes induced by miR-219 overexpression or TLX siRNA treatment. [score:10]
Our result of altered expression of TLX in DISC1-mutant NSCs suggests that mutant DISC1 could regulate TLX expression, which in turn induces abnormal miR-219 expression and inhibition of NSC proliferation. [score:10]
To confirm that miR-219 acts downstream of TLX in NSCs, we tested whether the effect of TLX knockdown on NSC proliferation and differentiation could be rescued by a miRNA hairpin inhibitor that is designed specifically to inhibit miR-219 action by interfering with miR-219 binding to downstream targets. [score:8]
In this study, we have provided a direct link between DISC1 mutation and altered TLX and miR-219 expression, and a causative link between dysregulated TLX and miR-219 expression and proliferative defects in DISC1-mutant SCZ NSCs. [score:8]
To uncover mechanisms underlying miR-219 -mediated regulation of NSC phenotypes, we identified potential miR-219 target genes using TargetScan, which revealed a set of candidate miR-219 tartgets, the 3′-untranslated region (3′-UTR) of which can base pair with miR-219. [score:8]
Together with our observation that miR-219 expression is abnormally upregulated in SCZ NSCs, these results suggest that the abnormally elevated miR-219 expression could be an underlying factor for reduced NSC proliferation observed in SCZ patients. [score:8]
Next we tested whether overexpressing miR-219 or knockdown of TLX regulates PDGFRα expression. [score:7]
The miRIDIAN miRNA mimic for miR-219-5p (c-310578-05-0005), negative control (CN-001000-01-05) and miR-219-5p hairpin inhibitor (IH-310578-07-0005) were used for overexpressing miR-219 or inhibiting miR-219 action in mouse NSCs. [score:7]
Among the candidate targets, PDGFRα is a confirmed miR-219 target 26 and is expressed in NSCs 34. [score:7]
These results together indicate that miR-219 expression is elevated in NSCs of DISC1-mutant SCZ patients, and that a DISC1 mutation is sufficient to induce miR-219 upregulation in NSCs. [score:7]
The upregulation of pre-miR-219 and mature miR-219 by TLX knockdown was not affected by the treatment of the transcriptional inhibitor actinomycin D (Fig. 1d). [score:7]
To determine whether elevated miR-219 expression is sufficient to reduce cell proliferation in human NSCs, we overexpressed miR-219 in WT NSCs using a miR-219 -expressing retroviral vector, and NSC proliferation was determined by BrdU and SOX1 double labelling. [score:7]
In contrast to elevated miR-219 expression, we observed reduced expression of TLX in both the DISC1-mutant SCZ NSCs (D1 and D2) and the genetically engineered C1M and C3M NSCs that contain the DISC1 mutation (Fig. 7d). [score:6]
When comparing gene expression in wild-type (WT) and TLX knockout (KO) mouse brains, we detected markedly elevated expression of miR-219 in TLX KO brains (Fig. 1a). [score:6]
These results suggest that TLX regulates the expression level of miR-219 at the post-transcriptional level, presumably through inhibiting the processing of miR-219 from the primary form to the precursor form. [score:6]
Either knockdown of TLX or blocking the interaction between TLX and the miRNA processing machinery resulted in potent induction of pre-miR-219 and mature miR-219 expression, but had minimal effect on pri-miR-219 expression. [score:6]
These results indicate that Dpi inhibits NSC proliferation in vivo, presumably through regulating miR-219 expression. [score:6]
Expressing TuD-miR-219 rescued the Dpi -mediated inhibition of NSC proliferation substantially (Fig. 6a,b), suggesting that Dpi regulates NSC proliferation by modulating miR-219. [score:6]
To determine whether PDGFRα is a critical downstream target gene of miR-219 in NSC regulation, we tested whether the effect of miR-219 on NSC proliferation and differentiation could be reversed by overexpressing PDGFRα. [score:6]
In addition to elevated miR-219 expression in DISC1-mutant SCZ NSCs, we also detected reduced expression of TLX in DISC1-mutant SCZ NSCs (Fig. 7). [score:5]
The expression of miR-219 in mammalian NSCs prompted us to ask whether miR-219 expression is altered in SCZ NSCs. [score:5]
To determine whether the proliferative defect in DISC1-mutant NSCs indeed resulted from abnormally elevated miR-219 expression, we inhibited miR-219 in DISC1-mutant NSCs using TuD-miR-219. [score:5]
Moreover, we have shown that miR-219 expression is elevated, whereas TLX expression is reduced, in DISC1-mutant SCZ patient iPSC-derived NSCs. [score:5]
For electroporation of the Dpi peptide -expressing vector, plasmids expressing Dpi and RFP or Dpi, RFP and TuD-miR-219, at 2.5 μg μl [−1] each, were electroporated into E13.5 mouse brains. [score:5]
We detected robust inhibition of cell proliferation and induction of neuronal differentiation when miR-219 was overexpressed in NSCs. [score:5]
These results indicate that elevated miR-219 expression is sufficient to inhibit cell proliferation in human NSCs. [score:5]
To determine whether inhibition of NSC proliferation by Dpi is mediated by modulating miR-219, we co-transduced NSCs with Dpi and the miR-219 decoy inhibitor, TuD-miR-219. [score:5]
In TLX siRNA -treated NSCs, where miR-219 expression level was elevated, inhibition of miR-219 was able to rescue the proliferative defect and precocious differentiation. [score:5]
E13.5 mouse brains were electroporated in utero with (1) a control RNA and the RFP reporter (siC-RFP); (2) TLX siRNA and the RFP reporter (siTLX-RFP); (3) a miR-219 inhibitor with siC-RFP; or (4) a miR-219 inhibitor with siTLX-RFP. [score:5]
Elevated miR-219 expression inhibits SCZ NSC proliferation. [score:5]
Inhibition of miR-219 or overexpression of TLX rescues reduced cell proliferation in SCZ NSCs. [score:5]
Overexpression of TLX or inhibition of miR-219 could rescue the reduced cell proliferation in DISC1-mutant SCZ NSCs. [score:5]
These results together indicate that the Dpi peptide inhibits NSC proliferation and promotes neuronal differentiation by modulating miR-219 expression. [score:5]
To prepare the Dpi peptide or control peptide -expressing vector, DNA fragment containing the Dpi (amino acid residues 341–359) or control peptide (amino acid residues 201–223) of TLX was fused in-frame to three copies of nuclear localization signals and cloned into the CMX-HA or CSC-GFP vector 3. To make miR-219 -expressing retroviral vector, DNA oligos of miR-219 were annealed and cloned into the UEG vector 66. [score:5]
Understanding the regulation of miR-219 expression in mammalian brains will not only broaden our knowledge about neurodevelopment, but also provide insights into the pathogenesis of neurological disorders. [score:5]
However, no obvious change in cell proliferation and differentiation was observed in NSCs treated with miR-219 inhibitor, presumably because the basal miR-219 expression level is low in NSCs. [score:5]
miR-219 is derived from two primary transcripts, pri-miR-219-1 and pri-miR-219-2. No expression of pri-miR-219-1 was detected in both WT and TLX KO brains, and not much change in the expression of pri-miR-219-2 was observed in WT and TLX KO brains either (Fig. 1b,c). [score:5]
Moreover, our study suggests that both TLX and miR-219 could be potential therapeutic targets for SCZ, and that TLX inducers or miR-219 inhibitors may serve as potential therapeutic tools to maintain normal NSC proliferation in SCZ patients. [score:5]
Moreover, miR-219 repressed the activity of the luciferase reporter with the WT PDGFRα 3′-UTR, but not that with the mutant 3′-UTR, in which the base pairing with miR-219 was destroyed (Supplementary Fig. 3b), suggesting that miR-219 inhibits PDGFRα expression. [score:5]
Our results showing that mutant DISC1 induces elevated expression of miR-219 in SCZ NSCs led us to hypothesize that increased expression of miR-219 induced by mutant DISC1 could result in abnormal cell proliferation in SCZ NSCs. [score:5]
Taken together, these results demonstrate that PDGFRα is a downstream target gene of the TLX-miR-219 regulatory cascade. [score:4]
These results indicate that miR-219 is an important TLX downstream target in regulating mammalian NSC proliferation and differentiation in vivo. [score:4]
To determine whether the DISC1 mutation is sufficient to induce elevated miR-219 expression in NSCs, we took advantage of the isogenic iPSC lines C1M and C3M, in which the 4-bp deletion seen in the SCZ patients was introduced into the DISC1 gene in the WT control iPSC lines C1 and C3 (ref. [score:4]
To test this hypothesis, we made cell lysates from NSCs transduced with lentivirus expressing TLX siRNA and performed to determine if knockdown of TLX would affect the binding of Drosha and DGCR8 to pri-miR-219 (Fig. 2e). [score:4]
These results indicate that miR-219 plays an important role in regulating cell proliferation in DISC1-mutant SCZ NSCs and that a miR-219 inhibitor could rescue the proliferative defect in these cells. [score:4]
The primers are listed in Supplementary Table 1. The miR-219-Glo, miR-1224-Glo or control-Glo (pmirGLO, Promega) vector was transfected together with TLX -expressing vector or TLX siRNA -expressing vector. [score:4]
The miR-219-5P target site 5′-GACAATCA-3′ in PDGFRα 3′-UTR was mutated into 5′-GATCGTCA-3′ by site-directed mutagenesis. [score:4]
The primers are listed in Supplementary Table 1. In vivo monitoring of pri-miRNA processingThe miR-219-Glo, miR-1224-Glo or control-Glo (pmirGLO, Promega) vector was transfected together with TLX -expressing vector or TLX siRNA -expressing vector. [score:4]
However, we did not detect the induction of either astrocyte marker GFAP or oligodendrocyte marker MBP expression in miR-219-electroporated brains collected at E15.5 (Supplementary Fig. 2b,c), presumably because we analysed brains at an earlier cortical developmental stage when neurogenesis is active but gliogenesis is not yet. [score:4]
The inverse correlation between TLX and miR-219 expression in SCZ NSCs further supports our hypothesis that TLX negatively regulates miR-219 level in NSCs. [score:4]
To determine the effect of miR-219 on NSC regulation in vivo, miR-219 RNA duplex was electroporated together with an red fluorescent protein (RFP) -expressing vector into NSCs of E13.5 embryonic brains in uterus. [score:4]
These results indicate that PDGFRα is an important downstream target of miR-219 in regulating NSC proliferation and differentiation. [score:4]
Because TLX plays an important role in regulating mammalian NSC proliferation and differentiation 3 4, our observation that TLX regulates miR-219 processing in mouse NSCs led us to hypothesize that miR-219 could be involved in regulating mammalian NSC phenotypes. [score:4]
Expressing the Dpi peptide decreased miR-219-Glo activity compared to expressing the empty vector (−) or a control peptide (C); n=3. [score:4]
WT and DISC1-mutant NSCs were transduced with a control vector (−miR-219-TuD) or TuD-miR-219 -expressing vector (+miR-219-TuD). [score:3]
Reduced cell proliferation was observed in miR-219 -overexpressing WT NSCs compared to control vector -expressing WT NSCs, in a manner similar to the reduced cell proliferation observed in DISC1-mutant NSCs when compared to WT NSCs (Fig. 8a). [score:3]
Repression of PDGFRα expression was detected in miR-219 -transfected NSCs and TLX siRNA -transfected NSCs, respectively (Supplementary Fig. 3f), indicating that PDGFRα indeed acts downstream of miR-219 and TLX. [score:3]
We found that ectopic expression of TLX in HEK293T cells reduced miR-219 processing, as revealed by increased luciferase activity of miR-219-Glo (Fig. 1f). [score:3]
How to cite this article: Murai, K. et al. The TLX-miR-219 cascade regulates neural stem cell proliferation in neurodevelopment and schizophrenia iPSC mo del. [score:3]
In parallel, the miR-219 -overexpressing WT NSCs were induced for neuronal differentiation. [score:3]
PDGFRα is a target gene of miR-219 and TLX in NSCs. [score:3]
WT (C1, C2 and C3) and DISC1-mutant NSCs (D1, D2, C1M and C3M) were transduced with virus expressing a control vector (−miR-219) or miR-219-expresing vector (+miR-219). [score:3]
To determine the effect of miR-219 overexpression on neuronal differentiation, immunostaining with doublecortin (DCX), a neuronal marker, was performed. [score:3]
In brains co-electroporated with TLX siRNA and the miR-219 inhibitor, the percentage of transfected cells that migrated to the CP was also restored towards the control level (Fig. 4c,d). [score:3]
These results indicated that TLX inhibits Drosha and DGCR8 from binding to pri-miR-219. [score:3]
We show here that TLX inhibits miR-219 processing by interacting with the p68/Drosha/DGCR8 complex, which in turn prevents the miRNA processing machinery from binding to miR-219 primary form. [score:3]
PDGFRα has been shown to be expressed in oligodendrocyte progenitor cells 44 and play a role in oligodendrocyte differentiation downstream of miR-219 (ref. [score:3]
Quantification of the RFP+ cells that expressed Tbr1 revealed a much higher percentage of Tbr1+RFP+ cells in miR-219-electroporated brains than that in control RNA-electroporated brains (Fig. 3j). [score:3]
A miR-219 inhibitor reversed NSC phenotypes induced by TLX siRNA in vivo. [score:3]
We also identified PDGFRα as a downstream target of the TLX-miR-219 cascade in NSCs. [score:3]
Reverse transcription was performed using Tetro cDNA synthesis kit (Bioline), and the expression levels of pri-miRNA and pre-miRNA of miR-219, and TLX and PDGFRα mRNAs were determined using DyNAmo Flash SYBR Green qPCR mix (Thermo Scientific) and StepOnePlus Real-Time PCR system (Applied Biosystems). [score:3]
However, when TLX siRNA and the miR-219 inhibitor RNA were co-electroporated, the percentage of RFP+Ki67+ cells was recovered substantially (Fig. 4a,b). [score:3]
The relative luciferase activity in NSCs transfected with a vector expressing siC or siTLX, together with the control-Glo, miR-219-Glo reporter or miR-1224-Glo reporter control; n=4. [score:3]
miR-219 inhibits NSC proliferation and promotes neuronal differentiation. [score:3]
However, we did not detect the induction of oligodendrocyte marker expression in miR-219-electroporated mouse brains collected at E15.5, presumably because we collected brains at an earlier stage that is active for neurogenesis but not for gliogenesis yet. [score:3]
The DISC1-mutant NSCs exhibit increased miR-219 expression and reduced proliferation. [score:3]
In contrast to overexpression of TLX, knockdown of TLX in NSCs promoted miR-219 processing, as shown by reduced luciferase activity of miR-219-Glo, compared to control RNA -treated cells (Fig. 1g), but had no effect on luciferase activity of miR-1224-Glo (Fig. 1g). [score:3]
Human iPSC-derived NSCs were seeded on Matrigel-coated 24-well plates in proliferation media and cultured for 24 h. Lentivirus expressing miR-219 or TuD-miR-219 and a GFP reporter was added to human NSCs in 24-well plates for 16 h. The virus-transduced cells were labelled with GFP. [score:3]
Our study has identified a novel role for miR-219 in SCZ NSCs; elevated miR-219 expression reduces SCZ NSC proliferation. [score:3]
miR-219 inhibits mammalian NSC proliferation. [score:3]
E13.5 mouse brains were electroporated in utero with vectors expressing: (1) a control peptide and RFP reporter (C); (2) Dpi peptide and RFP reporter (Dpi); (3) TuD-miR-219 plus control peptide and RFP reporter (TuD-miR-219+C); or (4) TuD-miR-219 plus Dpi and RFP reporter (TuD-miR-219+Dpi). [score:3]
Immunostaining with Ki67, a proliferation marker, revealed that overexpression of miR-219 decreased cell proliferation in the ventricular zone and subventricular zone (VZ/SVZ) of mouse brains, where NSCs reside (Fig. 3e,f). [score:3]
The interaction of TLX with Drosha and DGCR8 led us to hypothesize that TLX could inhibit miR-219 processing by preventing the miRNA processing machinery from binding to pri-miR-219. [score:3]
Elevated expression of TLX in DISC1-mutant NSCs increased cell proliferation (Fig. 8d), consistent with the observation in DISC1-mutant NSCs treated with TuD-miR-219 (Fig. 8b). [score:3]
Weak binding of Drosha and DGCR8 to pri-miR-219 was detected in NSCs transduced with lentivirus expressing a control RNA, and no binding of TLX to pri-miR-219 was detected (Fig. 2f). [score:3]
TLX inhibits miR-219 processing in NSCs. [score:3]
We next determined the expression levels of the precursor form of miR-219 (pre-miR-219) in TLX KO brains. [score:3]
These results further demonstrate that expressing the Dpi peptide promotes miR-219 processing but has no effect on the transcription of pri-miR-219. [score:3]
It is also possible that the action of other miRNAs, such as miR-9, miR-124, miR-137, miR-338 or let-7, could compensate for miR-219 inhibition in NSCs. [score:3]
Mouse embryonic NSCs were transduced with virus expressing the Dpi peptide or a control peptide (C), in the absence or presence of TuD-miR-219. [score:3]
It is possible that miR-219 could play distinct roles at different developmental stages. [score:2]
In this study, we show that TLX represses miR-219 biogenesis in NSCs during mouse brain development. [score:2]
In this study, we have demonstrated that TLX regulates miRNA processing independent of its well-characterized role in transcriptional regulation, and that miR-219 acts downstream of TLX to regulate NSC proliferation and differentiation in mammalian brains. [score:2]
Overexpression of miR-219 in WT NSCs also increased neuronal differentiation rate, compared to that in control vector -treated WT NSCs (Supplementary Fig. 7a). [score:2]
We then examined the levels of all three forms of miR-219 in TLX knockdown NSCs. [score:2]
Supplementary Figures 1-10 and Supplementary Table 1 Supplementary Figures 1-10 and Supplementary Table 1 (a) Elevated expression of mature miR-219 in TLX KO mouse brains, compared to WT mouse brains, revealed by northern blot analysis. [score:2]
These results indicate that TLX negatively regulates miR-219 processing from the primary form to the precursor form. [score:2]
These results together indicate that the TLX-miR-219 cascade is important in regulating cell proliferation in DISC1-mutant SCZ NSCs. [score:2]
Together with the observation that Dpi promotes miR-219 processing (Fig. 5f–i), these results suggest that modulation of miR-219 processing by TLX regulates NSC proliferation and differentiation. [score:2]
Knockdown of TLX increased the binding of both Drosha and DGCR8 to pri-miR-219 substantially. [score:2]
To determine whether the interaction between TLX and the miRNA processing machinery is critical for regulation of miR-219 processing by TLX, we used Dpi to block the interaction of TLX with the miRNA processing machinery and miR-219-Glo, a luciferase reporter containing the pri-miR-219 sequence in its 3′-UTR to monitor miR-219 processing. [score:2]
Co-transfection of TLX with Dpi reduced the luciferase activity substantially, compared to transfection with TLX alone (Fig. 5f), suggesting that expression of Dpi promoted miR-219 processing from pri-miR-219. [score:2]
To determine whether abnormal expression of miR-219 in DISC1-mutant NSCs tips the balance between human NSC proliferation and differentiation, we compared neuronal differentiation in WT and DISC1-mutant NSCs under a spontaneous differentiation condition. [score:2]
miR-219 acts downstream of TLX to regulate NSC phenotypes. [score:2]
Treatment with Dpi also increased the percentage of Tuj1 -positive neurons significantly, compared to treatment with the control peptide, and co -expressing TuD-miR-219 reversed this effect largely (Fig. 6c). [score:2]
The pri-miR-219 sequences were placed between the coding region of the luciferase gene and its polyadenylation signal. [score:1]
miR-219 processing was monitored using the miR-219-Glo reporter. [score:1]
Because TLX is a transcription factor, we next examined the level of primary transcripts of miR-219. [score:1]
The sequences for the probes are listed in Supplementary Table 1. RT–PCR was performed to detect the levels of primary, precursor and mature miR-219, or TLX and PDGFRα mRNAs. [score:1]
Consistent with our observation in TLX KO brains, considerable increase in the levels of pre-miR-219 and mature miR-219 was seen in TLX knockdown NSCs, compared to control NSCs, whereas minimal change was detected in the level of pri-miR-219 (Fig. 1d). [score:1]
This phenotype is similar to the effect induced by electroporation of miR-219 into the VZ/SVZ of mouse brains (Fig. 3g,h). [score:1]
E14.5 mouse NSCs were treated with the miR-219 RNA duplex and cultured in differentiation medium. [score:1]
RNAs were extracted from the immunoprecipitates, and subjected to RT–PCR for pri-miR-219. [score:1]
A TLX peptide promotes miR-219 processing. [score:1]
These results indicate that miR-219 promotes mammalian NSC differentiation into neurons. [score:1]
Because we only detected pri-miR-219-2 in the brain, pri-miR-219-2 is referred to as pri-miR-219 hereafter. [score:1]
miR-219 has been shown to induce oligodendrocyte differentiation in in utero electroporated mouse brains collected at E17.5 (ref. [score:1]
Co-electroporating Dpi with TuD-miR-219 rescued the reduced cell proliferation induced by Dpi (Fig. 6d,e). [score:1]
Treating the DISC1-mutant NSCs (D1, D2, C1M and C3M) with TuD-miR-219 increased the proliferative rate in these cells substantially, largely rescuing the proliferative defects of the DISC1-mutant NSCs (Fig. 8b). [score:1]
HEK293T cells were transfected with a luciferase reporter construct containing pri-miR-219 sequences that include the Drosha/DGCR8 -binding sites. [score:1]
Co-electroporating Dpi- with TuD-miR-219 reversed the precocious migration largely (Fig. 6f,g). [score:1]
The levels of both pre-miR-219 and mature miR-219 forms increased considerably, whereas no significant change was detected in the level of pri-miR-219 (Fig. 5g–i). [score:1]
However, whether miR-219 plays a role in SCZ pathogenesis remained unknown. [score:1]
Treatment with miR-219 reduced cell proliferation substantially (Fig. 3a,c), but had minimal cytotoxicity (Supplementary Fig. 2a). [score:1]
These results indicate that Dpi promotes neuronal differentiation in vivo through modulating miR-219 action. [score:1]
We next tested the effect of miR-219 on NSC differentiation. [score:1]
The DNA fragment containing the U6 promoter and TuD-miR-219 was then subcloned into pHIV-GFP vector or CMVLV lentiviral vector containing a puromycin-resistant gene 65. [score:1]
miR-219 has been shown to induce oligodendrocyte differentiation in electroporated mouse brains that were collected at E17.5 (ref. [score:1]
To prepare the construct of TuD-miR-219, DNA oligos of TuD-miR-219, 5′- TCGAAGAATTGCGTTCTGATGGACAATCA -3′ and 5′- CTAGTGATTGTCCATCAGAACGCAATTCT -3′ were annealed and cloned into the U6-TuD vector. [score:1]
TLX represses miR-219 processing. [score:1]
pri-miR-219 RNA associated with Drosha (indicated by solid arrows) or DGCR8 (indicated by open arrows) was determined by RT–PCR. [score:1]
To test whether miR-219 affects mammalian NSC proliferation, NSCs were isolated from E14.5 mouse brains and treated with the miR-219 RNA duplex. [score:1]
In contrast, a control peptide that contains TLX residues outside the Dpi domain failed to boost miR-219 processing (Fig. 5f). [score:1]
[1 to 20 of 137 sentences]
2
[+] score: 142
To further validate the influence of miR-219-5p on CDH1, we overexpressed miR-219-5p in HepG2 cells and knocked down miR-219-5p in MHCC-97H cells, finding that miR-219-5p upregulation led to a significant decrease of CDH1 expression at both mRNA and protein levels (P < 0.01). [score:9]
In the present study, we found that miR-219-5p was upregulated in HCC tissues, was related to overall survival (OS) time of HCC patients, and promoted the proliferation and metastasis of HCC cells via downregulating CDH1. [score:7]
Upregulation of miR-219-5p in HepG2, which had a low endogenous expression level, by miR-219-5p mimic induced significant increases in the abilities of proliferation (Figure 2(a); Supplementary Figure 2(A)). [score:6]
Furthermore, miR-219-5p mimic transfection significantly suppressed the apoptosis of HepG2 cells compared with ctrl, while miR-219-5p downregulation induced by miR-219-5p antagomir markedly promoted the apoptosis of MHCC-97H cells (Figure 2(c)). [score:5]
These suggested that miR-219-5p is closely associated with negative regulation of CDH1 and CDH1 is a direct target of miR-219-5p. [score:5]
Results showed that miR-219-5p upregulation significantly enhanced the migration and invasion abilities of HepG2, and miR-219-5p knockdown induced by miR-219-5p antagomir led to reduced number of migrated and invaded cells (Figure 2(d); Supplementary Figure 2(C)). [score:5]
In the present study, we found that miR-219-5p expression levels were remarkably upregulated in HCC tissues compared with the nontumor liver tissues, and high miR-219-5p levels were significantly associated with metastasis and dismal prognosis of HCC. [score:5]
These indicated that miR-219-5p is closely associated with negative regulation of CDH1 and CDH1 is a direct target of miR-219-5p. [score:5]
Therefore, these results suggested that miR-219-5p upregulation can be a predictor of metastasis and dismal prognosis of HCC patients. [score:4]
CDH1 Is a Direct Target of microRNA-219-5p. [score:4]
These results indicated that miR-219-5p upregulation is correlated with HCC metastasis. [score:4]
On the other hand, knockdown of miR-219-5p in MHCC-97H (with a high endogenous miR-219-5p level) by miR-219-5p antagomir (Supplementary Figure 2(A)) significantly inhibited the proliferation of cells (Figure 2(a)). [score:4]
3.1. miR-219-5p Upregulation Is Associated with Metastasis and Dismal Prognosis of HCC. [score:4]
In conclusion, these data suggest that miR-219-5p upregulation is an independent prognostic indicator for HCC patients. [score:4]
Collectively, miR-219-5p promotes HCC growth and metastasis by downregulating CDH1 (Figure 4(f)). [score:4]
We identified CDH1 as a direct target of miR-219-5p and the potential binding sequence in CDH1 3′UTR (Figure 4(a)). [score:4]
And, miR-219-5p knockdown resulted in enhanced CDH1 expression (P < 0.01) (Figures 4(c) and 4(d)). [score:4]
The wild-type sequence containing the predicted target sites of miR-219-5p in the 3′UTR of CDH1 mRNA was synthesized by JIELI corporation (Shanghai, China). [score:3]
For example, miR-219-5p was reported to function as a tumor suppressor in colorectal and gastric cancers [17, 18]. [score:3]
In this study, we found the following: (1) Bioinformatic analysis indicated that CDH1 can be a potential downstream target of miR-219-5p. [score:3]
We carried out a dual-luciferase reporter assay to prove that CDH1 is a direct target of miR-219-5p. [score:3]
Kaplan–Meier analysis showed that miR-219-5p overexpression was associated with poorer overall survival and higher recurrence rates of patients after curative HCC resection (Figure 1(c)). [score:3]
Next, we searched for putative target genes of miR-219-5p in microRNA. [score:3]
Moreover, elevated miR-219-5p expression was found to be correlated with vascular invasion (P = 0.003) and worse differentiation (P = 0.011) of liver tumor, as well as severe liver cirrhosis (P < 0.001) (Table 1). [score:3]
Supplementary Figure 2: the relative expression levels of miR-219-5p in HepG2 and MHCC-97H cells were examined after the cells were treated with miR-219-5p mimic, antagomir, or negative control (A) for 48 h using RT-qPCR. [score:3]
The expression levels of miR-219-5p were remarkably higher in HCC patients with metastasis in comparison to those without metastasis (P < 0.001) (Figure 1(b)). [score:3]
Another significant finding of the present study is that CDH1 is identified as a downstream target of miR-219-5p. [score:3]
Supplementary Figure 1: (A) miR-219-5p expressions in six liver cancer cell lines. [score:3]
We analyzed the expression levels of miR-219-5p in 191 paired HCC tissues and corresponding noncancerous liver tissues by using qRT-PCR and found that miR-219-5p was significantly increased in HCC tissues compared with the nontumor liver tissues (P < 0.001) (Figure 1(a)). [score:2]
The analysis of distribution of cells with miR-219-5p mimic/antagomir was shown by histogram (B). [score:1]
These provided more evidence to support that miR-219-5p is an important promoter for HCC growth and metastasis. [score:1]
The reporter vector containing wild-type (CDH1-WT) or mutated-type binding sequence (CDH1-MT) was transfected into HEK293T cells along with miR-219-5p mimic or ctrl. [score:1]
The average volume of orthotopic tumors in the miR-219-5p antagomir group was significantly smaller than that in the antagomir NC group (P < 0.05) (Figure 3(c)). [score:1]
However, little is known of the possible mechanism of miR-219-5p involved in HCC metastasis. [score:1]
These results suggested that miR-219-5p plays a crucial role in promoting in vivo tumor growth and lung metastasis of HCC. [score:1]
Subcutaneous HCC mo del was established by injecting 5 × 10 [6] MHCC-97H cells (transfected with antagomir NC or antagomir miR-219-5p) into BALB/c nude mice (Shanghai SLAC Laboratory Animal Co. [score:1]
To further validate the role of miR-219-5p in HCC metastasis, we analyzed miR-219-5p in various HCC cell lines with different metastatic potentials and found that miR-219-5p levels in the HCC cells with high metastatic potentials were higher than those nonmetastatic cell lines (Supplementary Figure 1(A)). [score:1]
To further validate promoting roles of miR-219-5p in HCC progression, we established HCC xenografts mo dels by subcutaneous implantation of MHCC-97H cells (transfected with miR-219-5p antagomir or antagomir NC). [score:1]
miR-219-5p mimic, antagomir, and their corresponding negative controls were purchased from Ribobio (Shanghai, China). [score:1]
In our previous work, miR-219-5p is identified as one of the significant metastasis-related miRNAs in HCC [10]. [score:1]
To investigate the biological significance of miR-219-5p, we treated human HCC cell lines with miR-219-5p mimic or antagomir that would lead to different expression levels of miR-219-5p. [score:1]
Univariate analysis showed that miR-219-5p, tumor size, tumor encapsulation, and vascular invasion were related to overall survival (OS) (Table 2); miR-219-5p, HBsAg, tumor size, vascular invasion, and tumor number were associated with HCC recurrence (Table 3). [score:1]
Cell cycle arrest at the G1 to S transition was found in MHCC-97H cells after treated with miR-219-5p antagomir (Figure 2(b); Supplementary Figure 2(B)). [score:1]
Taken together, these data suggested that miR-219-5p can promote the proliferation, cell cycle transition of G1 into S phase, antiapoptotic potentials, and metastatic phenotype of HCC cells. [score:1]
The average tumor volume of the miR-219-5p antagomir -treated group was obviously smaller than that of antagomir NC group (P < 0.05) (Figures 3(a) and 3(b)). [score:1]
The Effects of miR-219-5p on In Vitro Proliferation and Invasion of HCC Cells. [score:1]
These results provide a clear understanding of the underlying mechanism by which miR-219-5p promotes HCC metastasis. [score:1]
Multivariate analysis showed that miR-219-5p, vascular invasion, and tumor size were independent prognostic indicators for overall survival and tumor recurrence. [score:1]
Moreover, the linear regression analysis showed a negative relevance between miR-219-5p and CDH1 in HCC tissues (R [2] = 0.4225; P < 0.001) (Figure 4(e)). [score:1]
In our previous study, miR-219-5p was found to be a promoter for HCC metastasis [10]. [score:1]
Effects of miR-219-5p on In Vivo Tumor Growth and Lung Metastasis of HCC Xenografts. [score:1]
HepG2 and MHCC-97H cells were transfected with miR-219-5p mimic (50 nM) and miR-219-5p antagomir (400 pmol/ml) according to the manufacturer instructions. [score:1]
Using gain- and loss-functional analyses, we found that miR-219-5p could promote in vitro proliferation, migration, and invasion of HCC cells. [score:1]
[1 to 20 of 53 sentences]
3
[+] score: 137
As expected, Olig1, Zic5, Erbb2, and Olig2 were upregulated two-fold to five-fold when the ESCs were induced by RA treatment or miR-219 mimics, whereas they were dramatically inhibited when Foxj3 or Zbtb18 was overexpressed (Figure 6d). [score:8]
As shown in Figures 2e–g, the miR-219 inhibitors blocked the RA -induced upregulation of Nestin, Map2, and Tuj1. [score:6]
Santa-Maria et al. [48] found that miR-219 downregulation promotes neurodegeneration by targeting Tau. [score:6]
The results showed that miR-219 was dramatically and highly expressed during the initial 48 h, and its expression decreased gradually over time (Figure 1c). [score:5]
Olig1/2 overexpression and knockdown were performed to demonstrate the involvement of Olig1 and Olig2 in the downstream of the RA-miR-219-Foxj3/Zbtb18 pathway. [score:4]
As expected, the Foxj3 or Zbtb18 disrupted the upregulation of Nestin after the miR-219 mimics treatment. [score:4]
Thus, miR-219 regulates the expression levels of Foxj3 and Zbtb18 at the post-transcriptional level. [score:4]
In addition to epigenetic modifications, other transcription factors can possibly mediate the effects of RA on miR-219 upregulation. [score:4]
Moreover, the mechanism of how RA upregulates miR-219 is not well understood. [score:4]
Interestingly, the miR-219 inhibitors prevented ESCs from differentiating in a neural directional manner (Figures 2e–g; Supplementary Figures S1B–E). [score:4]
The extremely high rate of mutants in the miR-219- and Foxj3/Zbtb18 -injected embryos implied that the normal expression of Foxj3/Zbtb18 is crucial in early embryonic development in mice. [score:4]
Approximately 27.8% (15/54) of the miR-219 -injected embryos were resorbed or had no significant progress in their development, and 38.9% (21/54) of the embryos showed varying degrees of overdevelopment in the anterior region. [score:3]
[31] Kocerha et al. [47] reported that miR-219 is important in the expression of behavioral aberrations associated with NMDA receptor hypofunction. [score:3]
These results indicated that Foxj3 and Zbtb18 are the targets of miR-219. [score:3]
We speculate that histone demethylases accelerate DNA demethylation at the promoter region of miR-219, thereby increasing the expression level of miR-219 and facilitating neural differentiation. [score:3]
Among the candidate targets, the 3′-UTR of mouse Foxj3 and Zbtb18 contains putative regions that match the miR-219 seed sequence, which is conserved in humans and rats (Figure 3a). [score:3]
Foxj3 and Zbtb18 are the targets of miR-219. [score:3]
As shown in Figure 3b, the miR-219 mimics dramatically suppressed the activities of wild-type (WT) 3′-UTRs of Foxj3 and Zbtb18. [score:3]
We then tested the expression levels of mesoderm-specific (Brachyury, Flk1) and endoderm-specific (Sox17, Foxa2) markers in ESCs treated with RA or miR-219 antagomirs. [score:3]
The validity of miR-219 mimics and inhibitors were verified in Figure 2a. [score:3]
At E6.5, Nestin expression in the miR-219 -injected embryos occurred earlier than the control group (Figures 5A). [score:3]
The results showed that the increase in the expression levels of the mesoderm- and endoderm-specific markers in ESCs transfected with miR-219 antagomirs were larger than that in the RA -treated cells (Supplementary Figure S3). [score:3]
qRT-PCR and western blot were performed to examine the mRNA and protein levels of Foxj3 and Zbtb18 in ESCs transfected with miR-219 mimics or inhibitors. [score:3]
These data indicated that RA -induced ESCs tend to differentiate into mesodermal and endodermal cells upon miR-219 inhibition. [score:3]
We demonstrated that Foxj3 and Zbtb18, two target genes of miR-219, are the main controls in neural differentiation of ESCs (Figure 8). [score:3]
To investigate the underlying mechanism, we examined the potential targets of miR-219 by searching the PicTar, miRanda, and targetScan databases. [score:3]
In this study, we found that miR-219 is sufficient in promoting neural differentiation by targeting Foxj3 and Zbtb18. [score:3]
Double-stranded mmu-miR-219-5p (miRBase accession number MIMAT0000664, 5'-UGAUUGUCCAAACGCAAUUCU-3') mimics, single-stranded mmu-miR-219-5p inhibitors and their corresponding negative controls were purchased from GenePharma (GenePharma, Shanghai, China). [score:3]
Furthermore, the ESCs transfected with miR-219 inhibitors resisted the RA -induced neural differentiation. [score:3]
Notably, Nestin (neural stem cell marker) appeared in the Olig1/ 2-knockdown ESCs treated with RA or miR-219 mimics. [score:2]
These results indicated that Olig1 and Olig2 are the main factors regulated by miR-219 in RA -induced neural differentiation. [score:2]
To elucidate the role of miR-219-Foxj3/Zbtb18 in the regulation of neural induction in vivo, we examined the effects of miR-219 and Foxj3/Zbtb18 on developing embryos between egg-cylinder and primitive streak stages. [score:2]
MiR-219 promotes the neural differentiation ESCs (Figures 2e–g), targeting Foxj3 and Zbtb18 (Figures 3b–d). [score:2]
Recent studies have suggested that miR-219 regulates NPC proliferation and differentiation. [score:2]
These results indicated that miR-219 induces neural development in the mouse embryos. [score:2]
As expected, the mESCs differentiated into neural-type cells 48 h after transfection of miR-219 mimics. [score:1]
Three of them, namely, miR-10a-5p, miR-219-5p, and miR-219-2-3p, showed highly significant fold changes. [score:1]
This finding may be attributed to other factors or mechanisms involved in the miR-219 -mediated neural differentiation apart from Olig1/ 2. However, this hypothesis requires validation through further experiments. [score:1]
These findings suggested that miR-219 mediates ESCs to differentiate into neural cells. [score:1]
Olig1 and Olig2 are important in miR-219 -mediated neural differentiation. [score:1]
We hypothesized that Olig1 and Olig2 are the most dominant downstream factors of miR-219 -mediated neural differentiation. [score:1]
Next, miR-219 mimics and inhibitors were used to investigate whether or not miR-219 is involved in RA -induced differentiation. [score:1]
The results showed that the miR-219 mimics considerably decreased the protein levels of Foxj3 and Zbtb18 rather than the mRNA levels of these genes (Figures 3c–e). [score:1]
This result was verified in D3 and B6 ESCs (Supplementary Figure S1A), suggesting that miR-219 plays an important role in RA -induced ESC differentiation. [score:1]
The ESCs were differentiated after RA treatment regardless of the presence of miR-219 inhibitors, as characterized by the decreased Oct4 and loss of tight colony morphology (Figure 2g). [score:1]
However, Oct4 disappeared and Nestin was detected in the entire ectoderm of the miR-219 -injected embryos (Figures 5B, c and d). [score:1]
MiR-219 agomirs or Foxj3/Zbtb18 mRNAs were injected into the zygote cytoplasm. [score:1]
Approximately 10 pl of miR-219 agomirs or Foxj3/Zbtb18 mRNAs were injected into the cytoplasm of the zygotes under a Zeiss Axio Observer Z1 fluorescence microscope (Carl Zeiss, Jena, Germany) equipped with an Eppendorf Transfer-Man NK2 micromanipulator (Eppendorf, Hamburg, Germany). [score:1]
MiR-219 is necessary in promoting oligodendrocyte differentiation, and partially rescues oligodendrocyte differentiation defects caused by total miRNA loss. [score:1]
At E7.5, the differences between the control and miR-219 -injected embryos became more apparent. [score:1]
MiR-219 agomir, antagomir, and their corresponding negative controls were chemically synthesized (Ribobio) and diluted with a dilution buffer (Ribobio) to a final concentration of 5 nM. [score:1]
We then performed qRT-PCR to validate the relationships of these genes with miR-219, Foxj3, and Zbtb18. [score:1]
49, 50 However, the specific role of miR-219 in RA -associated ESC differentiation is not elucidated. [score:1]
[1 to 20 of 53 sentences]
4
[+] score: 120
Other miRNAs from this paper: mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
Recently, Chen et al. suggested that transplanted OPCs not only survived and formed a myelin sheath but also stimulated BDNF and Bcl-2 expression and the proliferation of NSCs while inhibiting hypoxic-ischemic -induced neuronal apoptosis 52. miR219-OPCs promote remyelination via direct differentiation and the formation of new oligodendrocytes. [score:6]
The vehicle group spent less time swimming in the target quadrant (where the platform was located) than did the control group (p =  0.0063), whereas the scramble and miR-219 groups spent more time swimming in the target quadrant than did the vehicle group (scramble vs. [score:5]
At 20 days, both scramble and miR-219 groups expressed strong A2B5 and NG2 fluorescence, no O4 -positive cells were found in the scramble group, and a few O4 -positive cells were detected in the miR-219 group (data not shown). [score:3]
To explore this question, we induced miR219-mESCs using the protocol shown in Fig. 2A to test the expression of NPC or OPC marker A2B5, the pre-oligodendrocyte marker NG2 and the immature oligodendrocyte marker O4. [score:3]
These results support the potential therapeutic role of miR-219 in demyelinating diseases such as MS 62. [score:3]
Thus, we verified that miR-219 overexpression did not affect the properties of mESCs, which maintained pluripotency and were able to give rise to the three main CNS cell types upon differentiation. [score:3]
In the miR-219 group, GFP -positive cells expressed weak A2B5 (K–M) and strong NG2 (N–P) and O4 (Q–S) fluorescence intensity. [score:3]
Our results demonstrated that miR-219 overexpression did not affect the properties of mESCs, which maintained pluripotency and could be induced to form EBs and NPCs. [score:3]
To use qRT-PCR to analyze miR-219 expression, RNA samples were obtained from mESCs cultured for 3 days. [score:3]
As expected, undifferentiated miR219-mESC colonies expressed strong GFP fluorescence and were positive for the mESC markers Nanog (Fig. 1C–E) and Oct4 (Fig. 1F–H). [score:3]
RT-qPCR showed that miR-219 was successfully overexpressed in mESCs and that the relative miR-219 level in miR219-mESCs was 22.4 times higher than in the scramble group at 3 days (Fig. 1B, p =  0.0001). [score:3]
Moreover, the expression of A2B5, NG2 and O4 was not detected (data not shown) when these cells were maintained in mESC medium, which suggests that miR-219 might be a non-sufficient factor, not a switch, for mESC differentiation at an early stage. [score:3]
Otherwise, miR219-OPCs may benefit the environment by secreting neurotrophic factors or inhibiting inflammation. [score:3]
Preparation of miR-219 lentivirus expression vector and transfection. [score:3]
We also detected the activation of astrocytes and microglia (data not shown); a slight increase was detected for GFAP and Iba-1 expression in OPC transplanted mice compared with control mice, but an obvious decrease in GFAP and Iba-1 expression was observed in miR219-OPC transplanted mice compared with scramble mice. [score:3]
For the first time, we found that the overexpression of miR-219 accelerated the differentiation of mESCs into OPCs. [score:3]
In differential medium containing FBS and T3, miR219-OPCs developed into mature oligodendrocytes by expressing CNPase and MBP, which is critical in the initial steps leading up to myelination. [score:3]
Here, we show for the first time that miR-219 rapidly transforms mESCs into oligodendrocyte lineage cells in vitro and that miR219-OPC transplantation not only promotes remyelination and improves cognitive function but also enhances host endogenous NPC proliferation in a chronic demyelination mouse mo del, thus suggesting a possible therapy for demyelinating diseases. [score:3]
In the miR-219 group, the expression of A2B5 was decreased (Fig. 2K–M), whereas that of NG2 (Fig. 2N–P) and O4 (Fig. 2Q–S) was further increased with strong fluorescence. [score:3]
How to cite this article: Fan, H. -B. et al. Transplanted miR-219 -overexpressing oligodendrocyte precursor cells promoted remyelination and improved functional recovery in a chronic demyelinated mo del. [score:3]
The number of A2B5 -positive cells was 4.78 times lower in the miR-219 group (Fig. 2X; 18.15 ± 3.82 versus scramble 86.05 ± 7.14), whereas the numbers of NG2- and O4 -positive cells significantly increased in the miR-219 group compared to the scramble group (Fig. 2X; NG2 86.60 ± 6.93 versus scramble 41.42 ± 5.43; O4 42.51 ± 5.88 versus scramble 22.03 ± 3.57), suggesting that overexpression of miR-219 accelerated the differentiation of mESCs into OPCs. [score:2]
MiR-219 -overexpressed mESCs are pluripotent. [score:2]
Moreover, the myelin score was higher in the miR-219 group than in the scramble group (p < 0.05). [score:1]
They then received a single injection of 2 μl scramble-OPCs (scramble group, n = 17) or miR219-OPCs [miR-219 group, n = 17, (1 × 10 [5] cells/μl Hank’s Balanced Salt Solution, HBSS)] injected for 0.2 μl/min at the coordinates: anterior-posterior +0.5, medial-lateral ±1.2, and dorsal-ventral −2.5 (Paxinos and Franklin, 2001). [score:1]
These ultrastructural examinations revealed that miR219-OPC transplantation promoted remyelination more efficiently than scramble-OPC transplantation. [score:1]
Our findings demonstrate for the first time that miR-219 rapidly transforms mESCs into oligodendrocyte lineage cells in vitro. [score:1]
A difference was also observed in the number of crossings of the scramble group and the miR-219 group (p =  0.044, Fig. 7D). [score:1]
The behavior of miR219-OPCs in vitro was observed by OPCs and spinal cord explants co-culture. [score:1]
High-magnification images of the box in A are shown in B. (C,D) Phase contrast micrographs show miR219-OPCs-derived cells exhibiting multipolar morphology and interacting with the neurites from spinal cord explants. [score:1]
However, miR219-OPCs grafts exhibited consistently elevated numbers of BrdU- and nestin -positive cells (Fig. 6M, BrdU p =  0.0075; nestin p =  0.0021). [score:1]
However, we also found an increase in the total numbers of various cell types in the SVZa following miR219-OPC transplantation. [score:1]
In contrast, a minority of GFP -positive cells became negative for NG2 in the miR-219 group (Fig. 4B,E; 246.90 ± 25.30 versus scramble 53.63 ± 8.43/mm [2]), although the majority were MAG positive (data not shown). [score:1]
Therefore, we explored the potential of miR-219 to promote ESC differentiation into an oligodendroglial lineage in vitro and the utility of miR219-OPCs as a cell replacement neuroprotective therapy. [score:1]
Interestingly, the number of myelinated axons in the miR219-OPC transplanted mice was greater than in the scramble-OPC transplanted mice (Fig. 5F; p =  0.0331), suggesting that miR-219 might be beneficial for remyelination. [score:1]
vehicle p =  0.0330, miR-219 vs. [score:1]
OPCs derived from miR219-mESCs were cultured for 8–10 days prior to co-culture following above protocols. [score:1]
The miR-219 locus on chromosome 2 and its approximately 200 bp flanking sequences were PCR amplified from mouse genomic DNA and inserted into the GV254 vector (the functional element is Ubi-EGFP-MCS-IRES-Puromycin) to form miR219-GV254 recombinant plasmids. [score:1]
A comparison between the vehicle group and the miR219 group showed that the transplantation of miR219-OPCs decreased the escape latency of mice fed the cuprizone diet (p =  0.0331), whereas the scramble group and the vehicle group had no significant differences in their spatial learning or memory abilities. [score:1]
Semi-thin sections stained with toluidine blue (we converted the colour pictures into grey) show the cells in the SVZa in control (A), vehicle (B), scramble (C) and miR-219 groups of mice (D). [score:1]
Representative electron microscopic images of cross-sections of the corpus callosum of control mice (G), vehicle treated mice (H), scramble-OPCs transplanted mice (I) and miR219-OPC transplanted mice (J). [score:1]
Less disturbed myelin sheaths and more compact and thicker myelin sheaths were found in the miR-219 group (Fig. 5I–J). [score:1]
Survival and differentiation of miR219-OPCs after transplantation. [score:1]
Moreover, MAG/GFP double positive cells in the miR-219 group acquired a more mature oligodendrocyte shape (Fig. 4C), indicating that these cells had differentiated into oligodendrocytes, and miR-219 promoted the earlier maturation of oligodendrocytes, in accordance with observations from in vitro experiments. [score:1]
We initially tested the effect of miR-219 on mESC differentiation without differentiating cocktails in vitro. [score:1]
miR219-OPC transplantation induced an increase in the number of proliferating NPCs, as confirmed by morphological analysis, BrdU labeling and nestin immunostaining. [score:1]
vehicle p =  0.0193, miR219 vs. [score:1]
mESCs were infected with LV-miR-219 at a multiplicity of infection (MOI) = 100 when mESCs grew until 80–90% confluent in serum-free Opti-MEM (GBICO). [score:1]
To assess whether miR-219 promotes a more effective transplant engraftment, OPCs derived from mESCs were injected by stereotaxic surgery into the corpus callosum of cuprizone -induced demyelinated mice. [score:1]
MBP/GFP double positive cells seemed to wrap around neurites, and the bundles of MBP/GFP double positive nerve fibers were denser in the miR-219 group than in the scramble group (Fig. 4D). [score:1]
Spinal cord explants were plated onto miR219-OPCs and allowed to grow for 2 weeks before fixation and immunolabeling. [score:1]
vehicle group p =  0.021; miR-219 vs. [score:1]
The latency time was markedly increased in mice engrafted with scramble-OPCs or miR219-OPCs (scramble vs. [score:1]
However, it is unknown whether miR-219 controls the oligodendrocyte lineage commitment of ESCs. [score:1]
The data suggested that fewer NG2 -positive OPCs had differentiated into immature or mature oligodendrocytes in the scramble group; however, miR-219 likely promoted the differentiation of OPC grafts in vivo. [score:1]
Enhanced remyelination in miR219-OPC-transplanted mice. [score:1]
vehicle p =  0.0310, miR-219 vs. [score:1]
Although, it is not clear whether miR-219 influences the differentiation of mESCs into the oligodendrocyte lineage. [score:1]
For oligodendrocyte maturation, miR219-OPCs were cultured in DMEM/F12 with 10% FBS for 7 days. [score:1]
To observe the role of miR-219 in mESC differentiation, we followed the differentiation protocol shown in Fig. 1A. [score:1]
Moreover, miR219-OPC transplantation not only promotes remyelination and improves cognitive function but also enhances host endogenous NPC proliferation following chronic demyelination. [score:1]
Mature oligodendrocyte markers MBP and CNPase probed using immunocytochemistry showed that miR219-mESC derived OPCs (miR219-OPCs) were able to differentiate into mature oligodendrocytes in vitro, almost all oligodendrocytes that differentiated from miR219-OPCs were MBP positive (Fig. 2T–U) and CNPase positive (Fig. 2V–W). [score:1]
miR219-mESCs maintained pluripotency. [score:1]
Toluidine blue staining of semi-thin resin sections of the corpus callosum in control mice (A,B), mice fed a cuprizone diet for 12 weeks followed by a normal diet for 8 weeks, treated with vehicle (C), engrafted with scramble-OPCs (D) and engrafted with miR219-OPCs (E). [score:1]
At 24 h, mESCs infected by miR-219 lentivirus were selected under 4 ng/ml puromycin. [score:1]
Two weeks after co-culture, the oligodendrocytes that differentiated from miR219-OPCs exhibited multipolar morphology, and the processes of some GFP -positive oligodendrocytes touched and elongated along the neurites, thus suggesting the association of OPCs with spinal axons. [score:1]
Here, we took advantage of the fact that chronic cuprizone exposure in C57BL/6 mice results in a less than 30% rate of spontaneous remyelination to study the role of miR219-OPCs after transplantation. [score:1]
Our results demonstrated that OPCs, which were generated in vitro from miR219-mESCs, can survive transplantation and effectively promote oligodendrocyte differentiation in vivo. [score:1]
In this study, we used a spinal cord explant-oligodendrocyte co-culture mo del to observe the association of miR219-OPCs with spinal axons because without the interference of non-GFP somas, the interaction between GFP-oligodendrocytes and neurites could be observed clearly and dynamically without immunostaining. [score:1]
The miR-219 group showed greater improvement on step-through test performance than the scramble group, suggesting that miR-219 facilitated cognitive functional improvement by promoting oligodendrocyte differentiation and remyelination. [score:1]
Two weeks after co-culture, phase contrast micrographs showed that the oligodendrocytes that differentiated from miR219-OPCs exhibited multipolar morphology and attached to the neurites growing out from the spinal cord explants (Fig. 3C,D). [score:1]
Mouse ESCs were infected by miR-219 lentivirus at day 0. Twenty-four hours later, infected cells were selected under puromycin and grown in mESC medium without bFGF for 5 days, then switched to DIM medium supplemented with Pur and RA for 8 days to generate EBs. [score:1]
After the puromycin-resistant mESCs were passaged more than 10 times, both the miR-219 vector lentivirus-infected and the scramble vector lentivirus-infected mESCs presented as GFP -positive. [score:1]
Excitingly, miR219-OPCs grafts effectively survived and promoted mature oligodendrocyte differentiation in vivo. [score:1]
[1 to 20 of 73 sentences]
5
[+] score: 74
The role of miR-219 in the brain is limited to being downregulated upon disruption of NMDAR signaling in the PFC, and downregulation of miR-219 inhibits the NMDAR antagonist dizocilpine -induced effect on locomotion and stereotypy (Kocerha et al., 2009). [score:9]
For the other miRNAs, miR-28a-5p, miR-219a-5p, miR-340-5p, and miR-491-5p, which were significantly correlated with the impulsivity trait (Table 3), the expression of three (miR-28a-5p, miR-340-5p, and miR-491-5p) was correlated in the same direction (positive correlation) with the impulsivity trait, whereas the expression of miR-219a-5p was correlated in the opposite direction. [score:7]
Gene products targeted by miR-28a-5p, miR-340-5p, and miR-491-5p are shown in red, a miR-219a-5p target in green, and the miR-340-5p/miR-219a-5p targets in yellow. [score:7]
Moreover, the expression of miR-219-5p, which was positively correlated with impulsivity, is downregulated in gliomas. [score:6]
miR-219-5p inhibits receptor tyrosine kinase pathway by targeting EGFR in glioblastoma. [score:5]
miR-219 regulates neural precursor differentiation by direct inhibition of apical par polarity proteins. [score:5]
miR-219 inhibits the proliferation, migration and invasion of medulloblastoma cells by targeting CD164. [score:5]
For the GeneNetwork IDs of individual traits see Table 1. Finally, we established that expression of miR-28a-5p, miR-219a-5p, miR-340-5p, and miR-491-5p, although not directly related to the impulsivity locus or Nrg3, is significantly correlated with the impulsivity trait (Table 3). [score:4]
For the GeneNetwork IDs of individual traits see Table 1. Finally, we established that expression of miR-28a-5p, miR-219a-5p, miR-340-5p, and miR-491-5p, although not directly related to the impulsivity locus or Nrg3, is significantly correlated with the impulsivity trait (Table 3). [score:4]
Based on our results, we propose here that miR219-5p along with miR-340-5p, miR-28a-5p and possibly miR-491-5p could have a key role in the development of psychiatric diseases, possibly by affecting the balance between neuronal outgrowth and differentiation in the context of synapse plasticity, maturation and maintenance. [score:4]
However, expression of miR-219a-5p was not correlated with any other trait (Table 4, Figure 3). [score:3]
Axonal guidance also appeared to be one of the pathways targeted by miR-219a-5p (Table 7, lower part). [score:3]
Three of these miRNAs (miR-28a-5p, miR-340-5p, and miR-491-5p) were negatively correlated with impulsivity, whereas expression of miR-219a-5p showed a positive correlation. [score:3]
Since miR-219a-5p is correlated with impulsivity in an opposite direction as the three other miRNAs, it could attenuate some of the effect of these miRNAs. [score:2]
We next determined in a similar fashion pathways regulated by miR-219a-5p, a brain-specific miRNA. [score:2]
Similarly to the axonal guidance, both of these pathways seem to be more affected by the positively correlated miRNAs (miR-28a-5p, miR-340-5p, and miR-491-5p) rather then the negatively correlated one (miR-219a-5p), of which the effect on these pathways is barely significant (Table 7). [score:1]
KEGG biological pathway P-value miR-28a, miR-340, and miR-491 Axon guidance 2.18E-09 Wnt signaling pathway 1.46E-07 Endocytosis 2.38E-07 MAPK signaling pathway 1.28E-05 Focal adhesion 1.40E-05 miR-219a Endocytosis 1.45E-02 Circadian rhythm 2.81E-02 Axon guidance 3.34E-02 Wnt signaling pathway 4.73E-02 Enriched pathways related to neuronal functions are shown. [score:1]
The effect of miR-219a-5p seems to be small and mainly limited to slits-related guidance cues and (partially) semaphorins cues, whereas the netrins and ephrins cues were affected exclusively by the positively correlated miRNAs (miR-28a-5p, miR-340-5p, and miR-491-5p). [score:1]
We have analyzed miR-219a separately because it was the only miRs correlated negatively with impulsivity. [score:1]
To understand the contribution of these miRNAs to biological processes, we uploaded all three positively correlated microRNAs as a one group and the negatively correlated microRNA (miR-219a-5p) as a second group into v2.0 (Vlachos et al., 2012). [score:1]
[1 to 20 of 20 sentences]
6
[+] score: 62
Downregulation of miR-219 in MS may thus contribute to impaired OPC differentiation and consecutive lack of remyelination in MS. [score:4]
c Percentage of CSF samples with undetected miR-219 in cohort 2. d Scatter plot of relative expression levels of miR-219 in CSF of individuals with detectable miR-219 levels of cohort 2. Mean miR-219 levels in CSF of individuals with detectable miR-219 were similar in all groups. [score:3]
This suggests that the differentiation failure of OPCs into mature oligodendrocytes in MS might be (partially) due to the lack of miR-219 expression. [score:3]
There was no correlation between CSF miR-219 levels and age, disease duration, CSF erythrocyte count, or CSF leukocyte count. [score:3]
Pre-amplification has a higher chance of resulting in false positive signals, especially in miRNAs with very low expression levels such as miR-219. [score:3]
In particular, decreased miR-219 expression was identified in both white matter and gray matter lesions. [score:3]
No differences in mean expression levels were observed between groups (data not shown), but again, individuals with undetectable miR-219 were more frequent in the MS patients’ groups (Fig. 1e). [score:3]
Fig. 1Expression of miR-219 in CSF of MS patients and controls. [score:3]
Multiple sclerosis Cerebrospinal fluid Biomarkers miRNA miR-219 miR-150 Multiple sclerosis (MS) is the most common chronic inflammatory demyelinating central nervous system (CNS) disease of young adults worldwide [1]. [score:3]
The differences in the amount of undetectable samples from the different cohorts in our study can be explained by the different analytic methods used, which included a pre-amplification step in cohorts 1 and 2, not performed in cohort 3. This step was omitted in cohort 3 as pre-amplification has a higher chance of resulting in false positive signals, especially in miRNAs with very low expression levels such as miR-219. [score:3]
Absence of CSF miR-219 expression correlates with MS diagnosis in three independent cohorts. [score:3]
This study therefore particularly looked into the specificity of miR-219 decrease in MS compared to a wide range of other neurological diseases for which a molecular biomarker does not necessarily have clinical relevance in differentially diagnosing MS. [score:2]
However, mean relative expression of miR-219 in individuals with detectable miR-219 did not significantly differ in MS patients compared to controls in this cohort (Fig. 1d). [score:2]
Differentiation of neural precursor cells, including OPCs, is—amongst others—regulated by miR-219 [14– 18]. [score:2]
Mean relative expression of miR-219 in individuals with detectable miR-219 was significantly lower in CSF of SPMS and PPMS patients compared to NHI (Fig. 1b). [score:2]
a Percentage of CSF samples with undetected miR-219 in cohort 1. b Scatter plot of miR-219 relative expression levels in CSF of individuals with detectable miR-219 levels of cohort 1. miR-219 levels were significantly decreased in SPMS and PPMS compared to controls. [score:2]
Previously, we identified decreased miR-219 expression in tissue of MS patients compared to controls. [score:2]
All three cohorts of MS patients and controls revealed that absence of miR-219 detection in CSF is consistently associated with MS. [score:1]
OR above 1 denotes a positive association between the non-measurability of miR-219 expression and MS. [score:1]
Therefore, once the issues described above are evaluated further and more experience is gained, miRNAs, and more specifically, miR-219, may emerge as promising biomarkers for use in accurate diagnosis, prognosis, and treatment options in MS disease. [score:1]
e Percentage of CSF samples with undetected miR-219 in cohort 3. f Scatter plot of miR-150 relative expression levels in CSF of individuals with detectable miR-150 levels of cohort 3. miR-150 levels were significantly increased in RRMS compared to PPMS, and in relapse-onset (RRMS, SPMS) compared to progressive-onset (PPMS). [score:1]
Again, miR-24 and miR-16 were detected in all samples, while the proportion of individuals with undetectable miR-219 was higher in the MS patients’ groups (Fig. 1c). [score:1]
In this cohort, the OR for a diagnosis of MS (RRMS, SPMS, and PPMS) versus controls (IND and NIND) was 39.7 (p = 0.0002) times higher if CSF miR-219 was undetectable (Table 2). [score:1]
In contrast, miR-219 could not be detected in all samples (Fig.   1a). [score:1]
In addition, there is a strong positive association between undetectable miR-219 and the diagnosis of MS (OR 2.9 and 39.7 in cohorts 2 and 3, respectively). [score:1]
In mouse and rat, miR-219 is required for this differentiation. [score:1]
Future studies will therefore be necessary to further evaluate the performance of miR-219 in more clinically pertinent situations in which MS cannot be differentiated from other neurological diseases that mimic the MS phenotype. [score:1]
The odds ratio (OR) for a diagnosis of progressive MS (SPMS and PPMS) versus NHI was 20.8 (p = 0.0294) times higher if CSF miR-219 was undetectable (Table  2). [score:1]
The omission did result in less measurable total miRNA providing 38 MS and 8 controls with sufficient total miRNA to be included in the analysis of miR-219 expression. [score:1]
In mouse and rat, miR-219 is required for both oligodendrocyte differentiation and myelination [14– 18]. [score:1]
The OR for a diagnosis of MS (RRMS, SPMS, PPMS, CIS) versus controls was 2.6 (p = 0.0262) times higher if CSF miR-219 was undetectable, and the OR for a diagnosis of progressive MS versus non-MS was 3.6 (p = 0.0165) times higher if CSF miR-219 was undetectable (Table 2). [score:1]
miR-219 absence of detection was not correlated with gender or EDSS. [score:1]
In this study, we therefore assessed the biomarker performance of CSF miR-219 for MS diagnosis. [score:1]
[1 to 20 of 33 sentences]
7
[+] score: 42
Based on available literature [71- 74], the observed down-regulation of miR-219 and up-regulation of CAMKIIγ is consistent with the hypothesis that a single brief re-exposure to the context may inhibit NMDAR activity while maintaining or even increasing CAMKII signaling and thus promote memory reconsolidation while inhibiting extinction. [score:11]
Statistical significance is highlighted as p-value <0.01 (**) B. Protein levels of miR-219 target, CAMKIIγ, increase after retrieval, as expected from the downregulation in expression of miR-219. [score:8]
Downregulation of miR-219 was only found to be significant after retrieval (Figure 5A), supporting our previous observation that retrieval downregulates genes involved in RNA processing. [score:7]
On the other hand, splicing factor Rbfox1 and NMDA receptor -dependent microRNA miR-219 are only downregulated after retrieval, accompanied by an increase in protein levels of miR-219 target CAMKIIγ. [score:6]
Finally, we examine genome-wide non-coding RNA regulation following memory acquisition and retrieval, pointing to a likely important role of microRNAs miR-132, miR-212, miR-410 and snoRNAs Snord14d and Snord14e in posttranscriptional regulation during both processes as well as a specific role for and miR-219 and its target CAMKIIγ after retrieval. [score:5]
MiR-219 expression is dependent on the activity of NMDA receptors [61], which play an essential role in the acquisition of spatial memories in the hippocampus [62, 63]. [score:2]
MiR-219 is down regulated only at RT30' (box). [score:1]
MicroRNA genes miR-212, miR-132 and miR-219 were selected for further validation. [score:1]
MiR-219 is known to regulate protein levels of CAMKIIγ [61]. [score:1]
[1 to 20 of 9 sentences]
8
[+] score: 29
In Fig.   3a, NOR (10, 30 μM) significantly downregulated mRNA expression of miR-31, but not miR-219 and miR-490 in CD4 [+] T cells under hypoxic atmosphere. [score:6]
MiRs are small noncoding RNA molecules and intrinsic miR-31 expression in CD11b [+] DCs is increased under hypoxic microenvironment [4]; DIM and I3C decrease miR-31, miR-219, and miR-490 expressions in draining lymph nodes of mice with delayed-type hypersensitivity [7]. [score:5]
Furthermore, 3, 3'-diindolylmethane (DIM) and indole-3-carbinol (I3C), the classical AhR agonists, promote Treg differentiation by targeting miR-31, miR-219, and miR-490 4, 5, 7. Thus, quantitative-PCR (Q-PCR) assay was performed to assess effect of NOR on mRNA expressions of miR-31, miR-219, and miR-490 in CD4 [+] T cells. [score:4]
Furthermore, 3, 3'-diindolylmethane (DIM) and indole-3-carbinol (I3C), the classical AhR agonists, promote Treg differentiation by targeting miR-31, miR-219, and miR-490 4, 5, 7. Thus, quantitative-PCR (Q-PCR) assay was performed to assess effect of NOR on mRNA expressions of miR-31, miR-219, and miR-490 in CD4 [+] T cells. [score:4]
In addition, miR-31, miR-219, and miR-490 can bind with 3′-untranslated region of Foxp3 gene to regulate Treg differentiation [7]. [score:4]
Normal group a CD4 [+] T cells were cultured with anti-CD3/CD28 (2 µg/ml), NOR (1, 3, 10, 30 μM), and TCDD (5 nM) in hypoxia for 24 h. The mRNA expressions of miR-31, miR-219, and miR-490 were analyzed by Q-PCR. [score:3]
Fig. 3 a CD4 [+] T cells were cultured with anti-CD3/CD28 (2 µg/ml), NOR (1, 3, 10, 30 μM), and TCDD (5 nM) in hypoxia for 24 h. The mRNA expressions of miR-31, miR-219, and miR-490 were analyzed by Q-PCR. [score:3]
[1 to 20 of 7 sentences]
9
[+] score: 28
Other miRNAs from this paper: mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
Two recent studies demonstrated the therapeutic potential of miR-219 for remyelination in animal mo dels of demyelinating diseases [26, 27]. [score:3]
miR-219 is one the most abundant miRNAs in mature OLs and is an essential factor in promoting OL differentiation, in part by suppressing cell cycle factors that promote continued OPC proliferation [24, 25]. [score:3]
Notable among the list of targeted miRNAs was Mir219a-2 because it is abundant in the developing CNS, its induction coincides with OL differentiation, and it plays a critical role in facilitating the differentiation of proliferating OPCs into myelinating OLs [24– 27]. [score:3]
For example, it was recently reported that the locus of Mir219a-2 is embedded within the intron of lncOL4, a non-protein-coding transcript that itself appears to regulate myelin-related gene expression [66]. [score:3]
We identified Mir219a-2 as a direct target of Olig2 in vivo. [score:3]
It is possible that, in addition to Mir219a-2, any number of the miRs identified in our ChIP-Seq might have important functional roles in OL development and myelin formation and repair, however, they will need to be addressed in future studies. [score:2]
Knockdown of lncOL4 lead to a decrease of Mir219a-2 abundance, leading the authors to speculate that the regulatory sequence controlling Mir219a-2 is also embedded within the lncOL4 locus and that some or all of the functional significance of lncOL4 in OL differentiation might be mediated through Mir219a-2 [66]. [score:2]
Based on the results of our ChIP-Seq, we found that Olig2 occupies a region upstream of Mir219a-2 (or Mir219-2) locus and might therefore regulate Mir219a-2 in OLs in the adult spinal cord, revealing a potentially important mechanism whereby Olig2 regulates OL differentiation and myelination in the adult in vivo (Fig 1C). [score:2]
It is unclear which paralog was being described in [25], however, there is evidence that strongly implicates Mir219a-2 in OL development and myelination in the CNS. [score:1]
For example, miR-219 is abundant in OLs and was shown to be both necessary and sufficient for OL differentiation [24– 27]. [score:1]
In [27], it was demonstrated that small molecule mimics of miR-219 promoted remyelination in an EAE mo del of MS. [score:1]
There are two paralogs of miR-219, miR-219-1 and -2, renamed Mir219a-1 and Mir219a-2 located on chromosomes 17 and 2 in the mouse genome, respectively. [score:1]
Our data suggests that Olig2 likely plays a regulatory role upstream of Malat1, Mir219a-2, and likely other non-protein-coding functional RNAs as a mechanism to control OL differentiation in the adult in vivo. [score:1]
Furthermore, transplantation of these miR-219 -induced OPCs enhanced remyelination and cognition following cuprizone -induced demyelination [26]. [score:1]
In [26], it was shown that miR-219 accelerated the differentiation of mouse embryonic stem cells into OPCs that were in turn able to myelinate spinal neurons in vitro. [score:1]
[1 to 20 of 15 sentences]
10
[+] score: 28
The down-regulation of mir-219 just mentioned is also intriguing because this miRNA is highly enriched in brain relative to other tissues, and mir-219-5p is the most highly enriched miRNA in synaptic fractions (5-fold), while at the same time it is the most strongly down-regulated miRNA in schizophrenia synaptosomes (70% decrease). [score:7]
For example, mir-219-3p and mir-219-5p were up-regulated in whole tissue (48% and 70% increase, respectively) (Table 2) but both were strongly down-regulated in synaptosomes (by 44% (p = 0.013) and 64% (p = 0.0098), respectively). [score:7]
Furthermore, mir-219 targets CaMKIIγ, a member of the NMDA receptor signaling pathway, and mice treated with LNA-anti-miR-219 displayed markedly worsened dizocilpine -induced hyperlocomotion and stereotypy, suggesting that mir-219 down-regulation observed in postmortem PFC is functionally relevant to schizophrenia-like phenotypes [36]. [score:6]
It has been reported that dizocilpine, a highly selective phencyclidine-like NMDA-R antagonist that can rapidly produce schizophrenia-like behavioral deficits in mice, causes a severe down-regulation of mir-219 in frontal cortex of mice, an effect reversed by antipsychotic agents [36]. [score:4]
Note that mir-219 is expressed in both neurons and oligodendrocytes [35] while mir-219-5p (but not mir-219-3p) is highly enriched in synaptosomes. [score:3]
The range of synaptic enrichment ratios varied from ∼5-fold enriched in synaptosomes relative to whole tissue (mir-219-5p) to ∼5-fold depleted (mir-145). [score:1]
[1 to 20 of 6 sentences]
11
[+] score: 24
In SVZ and hippocampus miR-124a was up-regulated, miR-219 was down-regulated, and numbers of neural stem progenitor cells (NSPCs) were significantly increased. [score:7]
In the present study we have found that in whole brain and brain regions concerned with neurogenesis (SVZ and hippocampus) and affected by motor neuron degeneration (primary motor cortex and brainstem motor nuclei), altered expression of neural fate miR-124a and miR-9 (but not miR-134), cell cycle-related miR-19a and -19b, astrocyte-related miR-125b and oligodendrocyte -related miR-219 occur in late stage disease (18 weeks). [score:5]
Our finding of significantly decreased miR-219 expression in SVZ suggests an imbalance between oligodendrocyte and neuronal precursors during NSPC differentiation in that brain region, as further supported by the increased numbers of Dlx2 -positive neuroblasts found there. [score:3]
miR-125b and miR-219 tended to be expressed at higher levels (not significant) in cervical, thoracic and lumbar spinal cord of ALS than control mice (Additional file 2: Figure S2). [score:3]
We next analyzed the expression of miR-9, miR-124a, miR-19a and -19b, miR-125 and miR-219 in manually dissected SVZ, hippocampus, primary motor cortex and brainstem motor nuclei in 18-week-old ALS mice compared to same age controls. [score:2]
RT-PCR analysis of miR-125b and miR-219, implicated in astrocyte and oligodendrocyte functional regulation, in cervical, thoracic and lumbar spinal cord regions. [score:2]
Here we investigated neural miR-9, miR-124a, miR-125b, miR-219, miR-134, and cell cycle-related miR-19a and -19b, in G93A-SOD1 mouse brain in pre-symptomatic and late stage disease. [score:1]
Finally, miR-219 was significantly lower in ALS SVZ than control SVZ (p < 0.01) (Figure  2C). [score:1]
[1 to 20 of 8 sentences]
12
[+] score: 23
MiR219 downregulation aggravated Tau induced toxicity, whereas its overexpression alleviated the toxic effects. [score:5]
Therefore, miR219 expression may modulate Tau toxicity by post-transcriptionally repressing Tau expression. [score:5]
The upregulation of miR142-5p, miR181b, miR219-3p and miR219-5p became significant at 1 m (Fig.   3A). [score:4]
Santa-Maria et al. showed that Tau is one of the direct targets of miR219 [22]. [score:4]
Thus, we prioritized miR142-3p, miR142-5p, miR181a, miR181b, miR219-3p and miR219-5p to examine their temporal expression profiles in control and Tau hippocampi. [score:3]
Santa-Maria et al. showed that miR219 represses Tau synthesis at the post transcriptional level [22]. [score:1]
For 2 m, miR142-3p, miR181b, miR181a (also known as miR213) and miR219-5p were validated; and for 6 m, validation was performed for miR142-3p, miR142-5p, miR339 and miR1249 (Fig.   1C). [score:1]
[1 to 20 of 7 sentences]
13
[+] score: 19
Within the PFC of antibiotic -treated rats, we again found a significant decrease in the expression of miR-219a-5p (Fig. 4k), another miRNA found to be differentially expressed in our GF mice; however, the direction of the change was opposite. [score:6]
We found that alterations in miR-219a-2-3p expression in both the amygdala and PFC was a common feature of both GF status and animals rendered microbiota -deficient post-weaning by antibiotic exposure. [score:3]
Out of the miRNAs that were commonly dysregulated in both regions, miR-219a-2-3p, together with miR-190a-5p, was oppositely regulated between both regions (decreased in amygdala/increased in PFC) (Fig. 1g). [score:3]
We demonstrated the presence of miRNAs that had a large fold increase (miR-3535, miR-673-5p) or decrease (miR-182-5p, miR-1964, miR-206-3p), that were normalized by colonization (miR-219a-2-3p (PFC), miR-182-5p, miR-183-5p (amygdala)) and that are known to be implicated in influencing anxiety levels and expression of neurotrophins such as brain-derived neurotrophic factor (BDNF) (miR-183-5p, miR-206-3p) [33, 34]. [score:3]
When we overlapped miRNAs that were normalized in both brain regions, we found that miR-219a-2-3p was differentially regulated in the amygdala and PFC of GF mice (Fig. 1f). [score:2]
Sequencing -based studies have found miR-219a-2-3p/miR-219-3p to be altered in the basolateral amygdala following social defeat [46]. [score:1]
Specifically, in line with the data from GF mice, we found a significant decrease in miR-206-3p and miR-219a-2-3p and an increase in miR-369-3p in the amygdala of rats exposed to antibiotics (Fig. 4b–d). [score:1]
[1 to 20 of 7 sentences]
14
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
[1 to 20 of 2 sentences]
15
[+] score: 13
In SU-DHL-1cells, NPM/ALK induces the expression of ICOS, a T-cell growth-promoting costimulatory receptor that amplifies the signal generated by the antigen-specific TCR, and NPM/ALK -mediated activation of STAT3 suppresses the expression of the ICOS inhibitor miR-219 [40]. [score:9]
miR-21, miR-26a and miR-219 are also known to be repressed by an NPM/ALK/STAT3 -dependent mechanism, and their targeting could represent another way to improve therapeutic approaches. [score:3]
MiR-21, miR-26a and miR-219. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 11
Other miRNAs from this paper: mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
An integrated analysis of mRNA and miRNA expression revealed that the expression of hsa-miR-219-5p was negatively correlated with the expression of metallothionein 1 F (MT1F) and tribbles homolog 3 (TRIB3), and epigenetic mechanism was suggested to be involved in the toxicity of AgNPs in Jurkat T cells [21]. [score:7]
More recently, AgNP -induced MT1F (metallothionein 1 F) and TRIB3 (tribbles homolog 3) expressions have been reported to be regulated by miR-219-5p in Jurkat T cells [21], which suggest the involvement of an epigenetic mechanism. [score:4]
[1 to 20 of 2 sentences]
17
[+] score: 8
Mir-29a, miR-219, miR-338 and miR-132 were the miRNAs undergoing the strongest upregulation during development, a result confirmed by reverse transcription PCR (Supplementary Fig. 1) and in agreement with previous data 8, whereas miR-298, miR-149 and miR-331 were the top downregulated miRNAs. [score:8]
[1 to 20 of 1 sentences]
18
[+] score: 6
miRNA 7-bp motif MBS index Match position Mature miRNA sequence* miR-489 TGGTGTC 1 4-10aat GACACCAcatatatggcagcmiR-666 [†] GCTGTGC 2 6-12agcgg GCACAGCtgtgagagccmiR-292-3p [†] ACCTGGC 8 8-14aagtgcc GCCAGGTtttgagtgtmiR-196b [†] ACAACAG 10 12-18taggtagtttc CTGTTGTtggmiR-685 [†] GTGCCTC 14 15-21tcaatggctgaggt GAGGCAC miR-195 CTGTGCT 16 5-11tagc AGCACAGaaatattggcmiR-330 [†] CTGTGCT 16 5-11gcaa AGCACAGggcctgcagaga miR-424 GAATTGC 27 6-12cagca GCAATTCatgttttgga miR-219 GAATTGC 27 14-20tgattgtccaaac GCAATTCtmiR-488* [†] ACAGCCT 30 6-12ttgaa AGGCTGTttcttggtc Table 5 MiRNAs that match with two predicted 7-bp motifs (one G-U pair allowed) miRNA 7-bp motif MBS index Match position Mature miRNA sequence* miR-195 GTGTTGC 6 3-9ta GCAGCACagaaatattggc CTGTGCT 16 5-11tagc AGCACAGaaatattggc miR-196b ACAACAG 10 12-18taggtagtttc CTGTTGTtgg AGGGAAC 21 7-13taggta GTTTCCTgttgttggmiR-330 [†] CTGTGCT 16 5-11gcaa AGCACAGggcctgcagaga GGTCCTG 18 9-15gcaaagca CAGGGCCtgcagagamiR-666 [†] GCTGTGC 2 6-12agcgg GCACAGCtgtgagagcc CTGTGCT 16 5-11agcg GGCACAGctgtgagagccmiR-710 [†] CAGGACT 19 4-10cca AGTCTTGgggagagttgag CTCTTCC 29 11-17ccaagtcttg GGGAGAGttgag In this study, we extended the application of MotifMo deler to simultaneously identify putative cis-acting elements that represent both transcription factor and miRNA binding sites from array-derived gene expression data. [score:3]
miRNA 7-bp motif MBS index Match position Mature miRNA sequence* miR-489 TGGTGTC 1 4-10aat GACACCAcatatatggcagcmiR-666 [†] GCTGTGC 2 6-12agcgg GCACAGCtgtgagagccmiR-292-3p [†] ACCTGGC 8 8-14aagtgcc GCCAGGTtttgagtgtmiR-196b [†] ACAACAG 10 12-18taggtagtttc CTGTTGTtggmiR-685 [†] GTGCCTC 14 15-21tcaatggctgaggt GAGGCAC miR-195 CTGTGCT 16 5-11tagc AGCACAGaaatattggcmiR-330 [†] CTGTGCT 16 5-11gcaa AGCACAGggcctgcagaga miR-424 GAATTGC 27 6-12cagca GCAATTCatgttttgga miR-219 GAATTGC 27 14-20tgattgtccaaac GCAATTCtmiR-488* [†] ACAGCCT 30 6-12ttgaa AGGCTGTttcttggtc Table 5 MiRNAs that match with two predicted 7-bp motifs (one G-U pair allowed) miRNA 7-bp motif MBS index Match position Mature miRNA sequence* miR-195 GTGTTGC 6 3-9ta GCAGCACagaaatattggc CTGTGCT 16 5-11tagc AGCACAGaaatattggc miR-196b ACAACAG 10 12-18taggtagtttc CTGTTGTtgg AGGGAAC 21 7-13taggta GTTTCCTgttgttggmiR-330 [†] CTGTGCT 16 5-11gcaa AGCACAGggcctgcagaga GGTCCTG 18 9-15gcaaagca CAGGGCCtgcagagamiR-666 [†] GCTGTGC 2 6-12agcgg GCACAGCtgtgagagcc CTGTGCT 16 5-11agcg GGCACAGctgtgagagccmiR-710 [†] CAGGACT 19 4-10cca AGTCTTGgggagagttgag CTCTTCC 29 11-17ccaagtcttg GGGAGAGttgag Potential TFBS and MBS were selected based on the number of occurrences of 6-bp elements in 5'-proximal flanking region of transcription starting sites and 7-bp elements in 3'-untranslated regions of mRNA, respectively, as detailed in the methods. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 6
Zhao et al. showed that miR-219 and miR-338 functioned in part by directly repressing negative regulators of oligodendrocyte differentiation, and that these miRNAs were important regulators of oligodendrocyte differentiation, possibly providing new targets for myelin repair [40]. [score:6]
[1 to 20 of 1 sentences]
20
[+] score: 6
Other miRNAs from this paper: mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
Pan Z Epigenetic modification of spinal miR-219 expression regulates chronic inflammation pain by targeting CaMKIIγJ. [score:6]
[1 to 20 of 1 sentences]
21
[+] score: 6
Resolvin D1 upregulates several micro RNAs (miRNAs; e. g., miR-146, miR-219, miR-208) that are involved in NFκB and IL-10 expression in resolution. [score:6]
[1 to 20 of 1 sentences]
22
[+] score: 5
As shown in Figure 1A and 1B, miR-219-5p, -577, -138, and -95 are down-regulated in all four subtypes compared to normal brain tissues, with the PN subtype exhibiting higher expression of each of these miRNAs. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 4
MiRNA function in SCN -mediated regulation of circadian rhythms is supported by observations indicating that miR-219 and miR-132 are rhythmically expressed in the SCN and that antagonism of these miRNAs within the SCN region respectively increases the circadian period of behavioral rhythmicity and attenuates circadian photoentrainment [15]. [score:4]
[1 to 20 of 1 sentences]
24
[+] score: 4
miR-219 +miR-219 displayed dysregulated expression in human tongue carcinomas [50]. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 4
Interestingly, miR-219, despite being independently identified by two different groups as a key regulator of oligodendrocyte differentiation and CNS myelination [11], [12], was not identified as being differentially expressed in Dicer [fl/fl] Dhh-Cre [+] peripheral nerves in our miRNA screen. [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 4
Recently, miR-219 has been shown to target calcium/calmodulin -dependent protein kinase II gamma subunit [21], which is involved in N-methyl-d-aspartate glutamate receptor -mediated signalling and implicated in schizophrenia. [score:3]
miR-132 has also been related to neuronal morphogenesis [13], [14], and both miR-132 and miR-219 have been shown to modulate the circadian clock [15]. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 3
Dysregulation of microRNA-219 promotes neurodegeneration through post-transcriptional regulation of tau. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
The TLX-miR-219 cascade regulates neural stem cell proliferation in neurodevelopment and schizophrenia iPSC mo del. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
The potential role of miRNAs in SCN clock control of circadian rhythms was first observed in experiments indicating that miR-219 and miR-132 expression in the SCN oscillates in a circadian manner and antagonism of these miRNAs respectively alters the circadian period and light -induced phase shifts of the activity rhythm in mice [22]. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
MiR-219 regulates PRKCI and accordingly inhibits the proliferation of human tongue squamous cell carcinoma [18]. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
Other miRNAs from this paper: mmu-mir-338, mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
The microRNA-219 (miR-219) is shown to inhibit oligodendrocyte formation through repression of Sox6 [9]. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
One study identified miR-132 and miR-219 as being clock regulated in the suprachiasmatic nucleus (SCN), the 'master clock' in mammals [52]. [score:2]
In addition, they also showed that miR-132 plays a role in circadian photic entrainment, whereas miR-219 modulates period length. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 3
Dysregulation of microRNA-219 promotes neurodegeneration through post-transcriptional regulation of tau. [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 2
Other miRNAs such as miR-132 and miR-219 are functionally involved in the clock and regulate circadian period or light dependent resetting of the clock in the SCN [9]. [score:2]
[1 to 20 of 1 sentences]
35
[+] score: 2
Clock-controlled mir-219 acts in the fine tuning of the length of the circadian period, and light -induced mir-132 was shown to be a negative regulator of the light -dependent resetting of the clock [13]. [score:2]
[1 to 20 of 1 sentences]
36
[+] score: 2
Among the miRNAs that undergo the greatest dynamic regulation at early time points were miR-219 and miR-140 (Figure S1A) and at the later time point were miR-322 and miR-128a (Figure S2B, 3 and 24 h). [score:2]
[1 to 20 of 1 sentences]
37
[+] score: 1
Other miRNAs from this paper: mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
Dicer1 and miR-219 are required for normal oligodendrocyte differentiation and myelination. [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
Editing levels increased by at least 50% in 11% of all editing events (eight positions in seven miRNAs): miR-376b (position 6), let-7e (positions 17 and 19), miR-381 (position 4), miR-467d* (position 9), miR-3061-3p (position 3), miR-151-3p (position 3), miR-219-3p (position 15). [score:1]
[1 to 20 of 1 sentences]
39
[+] score: 1
Other miRNAs from this paper: mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
Dicer1 and miR-219 Are required for normal oligodendrocyte differentiation and myelination. [score:1]
[1 to 20 of 1 sentences]
40
[+] score: 1
Only a small number of miRNAs have so far been associated with neurodegenerative processes: miR-133b, miR-9, miR-125b, miR-132, miR-124a, miR-219 and miR-128 [19], [20], [47]. [score:1]
[1 to 20 of 1 sentences]
41
[+] score: 1
2 mmu-miR-204* mmu-let-7b mmu-miR-30c mmu-miR-500* mmu-miR-219-3p mmu-miR-362-3p mmu-miR-455* mmu-miR-3098-5p mmu-miR-193 DEmiRNAs in bold were confirmed using. [score:1]
[1 to 20 of 1 sentences]
42
[+] score: 1
Other miRNAs from this paper: mmu-mir-155, mmu-mir-219a-1, mmu-mir-219b, mmu-mir-219c
This evidence is based off the finding that exosomes isolated from interferon-γ stimulated rat bone marrow derived dendritic cells containing miRNA-219, which is capable of increasing baseline myelination, reducing oxidative stress, and improving remyelination in rats following a lysolecithin demyelinating injury (Pusic et al., 2014). [score:1]
[1 to 20 of 1 sentences]
43
[+] score: 1
S7 7. Nrf2 -dependent effect of 5 mg / kg PQ Nrf2(+/+) PQ5—Nrf2(–/–) PQ5 miR-135a, miR-376c, miR-31, miR-let-7i*, miR-669b*, miR-344, miR-15b, miR-700*, miR-3099, miR-377, miR-338-5p, miR-382, miR-219-3p and miR-310a S8 8. Nrf2 -dependent effect of 10 mg / kg PQ Nrf2(+/+) PQ10—Nrf2(–/–) PQ10 miR-495*, miR-154*, miR-let-7b, miR-1983, miR-103 and miR-26a S9 The miR-380-3p / Sp3 mRNA pathway is worth to mention here. [score:1]
[1 to 20 of 1 sentences]
44
[+] score: 1
Accumulating evidence has shown a strong connection between miRNA (e. g., miRNA-103 [38], let-7b [39], miRNA-7a [40], miRNA-203 [41], miRNA-219 [24], miRNA-365-3p [27], and miRNA-183 cluster [42]) modulation and pain pathways from primary afferent nociceptors, the DRG, the spinal cord, and brain areas in different pain mo dels. [score:1]
[1 to 20 of 1 sentences]
45
[+] score: 1
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, recent rodent studies demonstrated the roles of miR-219 [56], [57] and miR-338 [57] in controlling oligodendrocyte differentiation. [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
Following up these studies, emerging literature points to roles for specific microRNAs in myelination, the best studied examples in mice being miR-219 and miR-338 in oligodendrocyte differentiation and let-7 in SC differentiation 15, 16, 37, 38. [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
In two recent studies, miR-219 recombinant retrovirus injection into the corpus callosum attenuated demyelination in the CPZ mo del (45), and injection of miR-146a mimics into the demyelinated corpus callosum promoted remyelination (26). [score:1]
[1 to 20 of 1 sentences]