sort by

463 publications mentioning hsa-mir-34b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-34b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 385
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
Western blot analysis (Figure 2 A ) showed that transfection of miR-34 mimics downregulated expression of target genes, Bcl-2, Notch1 and Notch2 at the protein level, but had no effect on Bcl-xL and Mcl-1 expression, indicating the target gene knock-down by miR-34 mimics affects transcripts harbouring miR-34 target sites. [score:15]
Interestingly, the Notch2 expression inhibition at the protein level by miR-34 was not accompanied by inhibition at the mRNA level, in agreement with previous reports that miRNA inhibits target gene expression post-transcriptionally, with or without mRNA degradation [11], [20]. [score:13]
Our results show that miR-34 restoration in human pancreatic cancer MiaPaCa2 and BxPC3 cells inhibited the expression of target genes, Bcl-2, Notch1 and Notch2; significantly inhibited clonogenic cell growth and invasion; induced apoptosis and G1 and G2/M arrest; and sensitized the cells to chemotherapy and radiation. [score:9]
Restoration of miR-34 down-regulates target genes' expression. [score:8]
This strategy was explored in the current study, where p53 downstream target miR-34 was restored in p53-mutant pancreatic cancer MiaPaCa2 cells with a high level of Bcl-2 and low levels of miR-34s, resulting in downregulation of Bcl-2 and Notch1-2, together with the inhibited clonogenic cell growth and invasion; increased apoptosis and G1 and G2/M arrest in cell cycle; and sensitization to chemotherapy and radiation. [score:8]
Our results are consistent with the notion that Bcl-2 is a direct target of miR-34 and miR-34 potently inhibits Bcl-2 expression. [score:8]
This multi-mode action of miR-34 provides a therapeutic advantage over the siRNA -based therapies in that miR-34 has multiple targets, can work on multiple cell signalling pathways at the same time, leading to synergistic effects which may translate into improved clinical efficacy for pancreatic cancer patients with p53 deficiency and advanced disease. [score:7]
Figure 2 B shows the qRT-PCR analysis of the potential target genes; miR-34 mimics potently inhibited BCL2 and Notch1 gene expression, consistent with the Western blot data. [score:7]
Our results demonstrate that miR-34 is involved in MiaPaCa2 cell growth; miR-34 restoration inhibits the clonogenic growth, and inhibition of endogenous miR-34 by miR-34 inhibitors promotes the growth. [score:7]
However, our study is the first report showing that miRNA miR-34 inhibits pancreatic CD44+/CD133+ CSC, potentially via inhibiting downstream target “stem cell genes” such as Notch and Bcl-2. Interestingly, miR-34a and miR-34b are among the short-list of the stem cell-specific miRNAs discovered by Dr. [score:7]
We have recently shown that expression of miR-34s is dramatically reduced in p53-mutant gastric cancer cells and that the restoration of miR-34 expression inhibited the cancer cell growth [6]. [score:7]
These data indicate that the CD44+/CD133+ cells were the target cells of miR-34, i. e., miR-34 exerts its tumor-suppressing activity via inhibiting the CD44+/CD133+ cells. [score:7]
A, miR-34 restoration down-regulates target proteins Bcl-2, Notch1 and Notch2, no effects on Mcl-1. MiaPaCa2 cells were transfected with miR-34 mimics or non-specific control miRNA mimic (NC mimic) (100 pmol per well in 6-well plates by Lipofectamine 2000) for 48 hours, then collected for Western blot analysis. [score:6]
0006816.g002 Figure 2 A, miR-34 restoration down-regulates target proteins Bcl-2, Notch1 and Notch2, no effects on Mcl-1. MiaPaCa2 cells were transfected with miR-34 mimics or non-specific control miRNA mimic (NC mimic) (100 pmol per well in 6-well plates by Lipofectamine 2000) for 48 hours, then collected for Western blot analysis. [score:6]
Restoration of miR-34 expression in the pancreatic cancer cells by either transfection of miR-34 mimics or infection with lentiviral miR-34-MIF downregulated Bcl-2 and Notch1/2. [score:6]
The report from He et al. indicated that ectopic expression of miR-34 induces cell cycle arrest in both primary and tumor-derived cell lines, which is consistent with the ability of miR-34 to downregulate a program of genes promoting cell cycle progression [11]. [score:6]
B, qRT-PCR analysis shows that the target gene Bcl-2 is downregulated in miR-34-MIF clone. [score:6]
Recently, the three members of the miR-34 family were found to be directly regulated by p53 and the functional activity of miR-34 indicated a potential role as a tumor suppressor [6], [7], [8], [9], [10], [11], [12]. [score:5]
MiaPaCa2 and BxPC3 cells have very low expression levels of both primary and mature miR-34a,b,c but high levels of the miR-34 target genes BCL2 and Notch1, and different levels of Notch2–4 (Figure 1 ). [score:5]
We have also shown that the CD44+/CD133+ tumorsphere-forming and tumor-initiating cells have high Bcl-2 and loss of miR-34 expression, indicating that miR-34 and its target Bcl-2 might be involved in cancer stem cells. [score:5]
qRT-PCR was performed to determine the expression levels of potential miR-34 target genes [6]. [score:5]
Restoration of miR-34 inhibits the clonogenic growth of MiaPaCa2 cells, whereas inhibition of miR-34 promotes cell growth. [score:5]
We also assessed in parallel the expression of presumptive miR-34-regulated target genes and proteins, using the primers and methods as we described recently [6]. [score:5]
The miR-34 -mediated reduction of the CD44+/CD133+ CSC is associated with the potent and simultaneous inhibition of its downstream target genes Notch and Bcl-2, genes involved in stem cells self-renewal and survival, so-called “stem cell genes” or “stemness genes” [6], [41], [42], [43]. [score:5]
C, qRT-PCR analysis of the expression levels of miR-34 target genes in human pancreatic cancer cell lines as well as normal human fibroblast WI-38 cells. [score:5]
More significantly, miR-34 restoration inhibits the CD44+/CD133+ tumor-initiating cells or CSC, accompanied by significant inhibition of tumorsphere growth in vitro and tumor formation in vivo. [score:5]
The transfected miR-34 mimics inhibited the luciferase reporter gene expression, which is controlled by Bcl-2 3′UTR in the promoter region (Figure 2 C ). [score:5]
Our above results have shown that miR-34 potently inhibits Bcl-2 expression and cell growth and increases cell death and response to chemo-/radiotherapy in the overall population of MiaPaCa-2 cells. [score:5]
Here again, miR-34 shows the advantage of its multi-target potential, as both stem cell genes Notch and Bcl-2 are inhibited by miR-34 at the same time, a potent synergy may be achieved in blocking both Notch signalling pathway and the anti-apoptotic function of Bcl-2 in tumor-initiating cells or cancer stem cells. [score:5]
We also examined the effect of inhibition of endogenous miR-34 on cell growth by mi RIDIAN miR-34 inhibitors. [score:5]
Next, we carried out qRT-PCR analysis of the sorted MiaPaCa2 cells to assess whether there is any difference in these populations as to the expression levels of miR-34 and its target genes. [score:5]
As shown in Figure 3 A–B, miR-34 restoration significantly inhibited the clonogenic cell growth, with miR-34a mimic inducing >80% inhibition of colony formation compared to NC mimic (18.3±3.8 colonies/well vs. [score:4]
Our data support the view that miR-34 may be involved in pancreatic cancer stem cell self-renewal, potentially via the direct modulation of downstream targets Bcl-2 and Notch, implying that miR-34 may play an important role in pancreatic cancer stem cell self-renewal and/or cell fate determination. [score:4]
Our data support the view that miR-34 may be involved in pancreatic cancer stem cell self-renewal, potentially via the direct modulation of downstream targets Bcl-2 and Notch, implying that miR-34 may play an important role in pancreatic cancer stem cell self-renewal and/or cell fate determination, at least in the p53-mutant MiaPaCa2 mo del. [score:4]
Among the target proteins regulated by miR-34 are Notch pathway proteins and Bcl-2, suggesting the possibility of a role for miR-34 in the maintenance and survival of cancer stem cells. [score:4]
Our data provide the first evidence that miR-34 is involved in pancreatic CSC self-renewal, potentially via the direct modulation of downstream targets Notch and Bcl-2. Our results provide novel insight into how miR-34 works in pancreatic cancer cells with p53 loss of function. [score:4]
The results demonstrate that the transfected miR-34s are functional and confirm that Bcl-2 is a direct target of miR-34, consistent with earlier reports [8], [10], [21]. [score:4]
In addition, because more than 50% of primary human cancers have mutations inactivating p53 function, the findings provided impetus to explore the functional restoration of miR-34 as a novel approach to inhibit cancers with p53 loss-of-function. [score:4]
CD44+/CD133+ cells are tumorsphere-forming and tumor-initiating cells with high Bcl-2 and loss of miR-34 expression. [score:3]
There is an inverse correlation in the expression levels of miR-34 and Bcl-2 in Q2 versus Q3, e. g., Q2 cells (with enriched cancer stem cells) have high Bcl-2 and low miR-34, Q3 cells (non-tumorigenic cells) have low Bcl-2 and high miR-34 levels. [score:3]
miR-34 restoration inhibits the MiaPaCa2 tumor formation in nude mice. [score:3]
In conclusion, our study demonstrates that miR-34 may restore, at least in part, the tumor suppressing function of p53 in p53 -deficient human pancreatic cancer cells. [score:3]
The miR-34 expression data were normalized to that of Actin and the relative levels are shown (set unsorted cells = 1). [score:3]
miR-34 restoration leads to a significant reduction of CD44+/CD133+ cells and inhibition of tumorsphere growth. [score:3]
Our results show that miR-34 restoration caused an 87% reduction of the CD44+/CD133+ tumorsphere-forming and tumor-initiating CSC in MiaPaCa2 cells with p53 loss of function, accompanied by a significant inhibition of tumorsphere growth in vitro and tumor formation in vivo. [score:3]
By modulating CSC, the restoration of tumor suppressor miR-34 may provide a novel therapeutic approach for p53 -deficient pancreatic cancer. [score:3]
We are currently carrying out more detailed mechanism studies to delineate the involvement of Notch signaling pathway in miR-34 -induced inhibition of pancreatic CSC and its role in chemo/radiosensitization of pancreatic cancer with p53 loss of function. [score:3]
More significantly, we show that miR-34 restoration led to an 87% reduction of the CD44+/CD133+ CSC, accompanied by significant inhibition of tumorsphere growth in vitro as well as tumor formation in vivo. [score:3]
mi RIDIAN miRNA miR34a,b,c mimics and negative control miRNA mimic (NC mimic), mi RIDIAN miR-34 inhibitors and negative controls were obtained from Dharmacon (Chicago, IL) [6]. [score:3]
Our data are consistent with the reported tumor suppressor function of miR-34 [6], [8], [9], [11], [22]. [score:3]
miR-34 restoration inhibits the MiaPaCa2 tumor initiation in nude mice. [score:3]
We previously reported that the Bcl-2 protein is regulated directly by miR-34 [10]. [score:3]
Our data provide the first evidence that miR-34 is able to inhibit CD44+/CD133+ tumorsphere-forming and tumor-initiating cancer stem cells in p53-mutant pancreatic cancer, implying that miR-34 might play a role in the self-renewal of pancreatic cancer stem cells. [score:3]
miR-34 restoration inhibits MiaPaCa2 cell clonogenic growth and leads to caspase-3 activation and apoptosis. [score:3]
Twenty-four hr after miR-34 mimic transfection of MiaPaCa2 cells with miR-34 mimics (100 pmol per well in 6-well plates), the expression of potential target genes was measured by qRT-PCR with SYBR Green PCR System (TaqMan). [score:3]
Transcription of the three miRNA miR-34 family members was recently found to be directly regulated by p53. [score:3]
Our results demonstrate that miR-34 may restore, at least in part, the tumor suppressing function of the p53 in p53 -deficient human pancreatic cancer cells. [score:3]
Our study demonstrates that miR-34 may restore, at least in part, the tumor suppressing function of p53 in p53 -deficient cancer cells. [score:3]
Next, we examined whether miR-34 restoration could sensitize the pancreatic cancer cells with a high level of endogenous Bcl-2 expression to chemo- and radiotherapy. [score:3]
Figure S3Restoration of miR-34 by MIF lentiviral system inhibited MiaPaCa2 tumorspheres. [score:3]
More significantly, miR-34 restoration led to an 87% reduction of the tumor-initiating cell population, accompanied by significant inhibition of tumorsphere growth in vitro and tumor formation in vivo. [score:3]
This effect on cell cycle is similar to that of p53 restoration as we previously reported [23], [24], [27], [28], indicating that miR-34 restoration can exert effects akin to restoration of p53 tumor suppressor function, at least in part, in the cells with p53 loss of function. [score:3]
miR-34 significantly inhibited the invasion potential of MiaPaCa2 cells (Figure S2). [score:3]
Restoration of miR-34 by MIF lentiviral system decreases the CD44+/CD133+ MiaPaCa2 cells and inhibits tumorspheres from the sorted CD44+/CD133+ cells. [score:3]
At present, the linkages between p53, the downstream target miR-34 and presumptive pancreatic cancer stem cells are unknown. [score:3]
Another important finding from the current study is that our data provide a potential link between the tumor suppressor miR-34 and the tumor-initiating cells or cancer stem cells. [score:3]
0006816.g003 Figure 3MiaPaCa2 cells were transfected with miR-34 mimics or inhibitors, 24 hr later the cells were seeded in 6-well plates (200 cells/well, in triplicates). [score:3]
Taken together, the published studies suggest miR-34 family members may have tumor suppressor function downstream of p53. [score:3]
More importantly, our results demonstrate for the first time that the CD44+/CD133+ tumor-initiating cells, or pancreatic cancer stem cells, have a low level of miR-34 accompanied by a high level of Bcl-2, suggesting a potential link of miR-34 and its target Bcl-2 to pancreatic cancer stem cells. [score:3]
MiaPaCa2 cells were transfected with miR-34 mimics or inhibitors, 24 hr later the cells were seeded in 6-well plates (200 cells/well, in triplicates). [score:3]
miR-34 restoration significantly inhibited clonogenic cell growth and invasion, induced apoptosis and G1 and G2/M arrest in cell cycle, and sensitized the cells to chemotherapy and radiation. [score:3]
They are single-stranded chemically enhanced oligonucleotides that can effectively inhibit the endogenous mature miR-34. [score:3]
Figure S2 Restoration of miR-34 inhibits the invasion of MiaPaCa2 cells. [score:3]
Restoration of miR-34 may hold significant promise as a novel molecular therapy for human pancreatic cancer with loss of p53–miR34, potentially via inhibiting pancreatic cancer stem cells. [score:3]
It has been reported that miR-34 targets Notch, c-Met and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells [10], [11], [14]. [score:3]
B, Quantitative real-time PCR analysis of the potential target genes' mRNA levels after miR-34 mimic transfection in MiaPaCa2 cells. [score:3]
Since p53 tumor suppressor function is mediated in part via induction of apoptosis [23], [24], we examined the effect of miR-34 restoration on apoptosis-induction in MiaPaCa2 cells transfected with miR-34 mimics. [score:3]
miR-34 restoration could thus re-build, at least in part, the p53 tumor suppressing signalling network in pancreatic cancer cells lacking functional p53. [score:3]
Delineating the role of miR-34 in regulation of cell growth and tumor progression, and its potential link to tumor-initiating cells or cancer stem cells may provide a basis for exploring its potential as a novel treatment strategy. [score:2]
miR-34 inhibitors induced an almost 20% increase in clonogenic growth as compared with control (120.3±2.9 colonies/well vs. [score:2]
E, Colony formation assay shows the miR-34a inhibits clonogenic growth of the miR-34-MIF. [score:2]
However, mutation in the Bcl-2 3′UTR complementary to the miR-34 seed sequence abolished this effect, indicating that the observed activity is sequence-specific. [score:2]
We identified that CD44+/CD133+ MiaPaCa2 cells are enriched with tumorsphere-forming and tumor-initiating cells or cancer stem/progenitor cells with high levels of Notch/Bcl-2 and loss of miR-34. [score:1]
A, miR-34 restoration sensitizes the cells to chemotherapeutic agents. [score:1]
Sharp's group in their pioneer miRNA study [47], supporting the link of miR-34 to CSC. [score:1]
C, Restoration of miR-34 leads to caspase-3 activation. [score:1]
Restoration of miR-34 sensitizes MiaPaCa2 cells to chemotherapy and radiation. [score:1]
MiaPaCa2 CD44+/CD133+ cells are tumorsphere-forming cells that have high Bcl-2 and loss of miR-34. [score:1]
Another potential role for miR-34 in cancer initiation and progression may be a link to tumor-initiating cells or cancer stem cells (CSC). [score:1]
For cell cycle and apoptosis analysis by flow cytometry, MiaPaCa2 cells were transfected with miR-34 mimics or NC mimic in 6-well plates, trypsinized 24 hr later and washed with phosphate-buffered saline, and fixed in 70% ethanol on ice. [score:1]
We examined the roles of miR-34 in p53-mutant human pancreatic cancer cell lines MiaPaCa2 and BxPC3, and the potential link to pancreatic cancer stem cells. [score:1]
To investigate the potential role of miR-34 in pancreatic cancer stem cells, we examined whether miR-34 restoration could inhibit the CD44+/CD133+ cells and their self-renewal potential. [score:1]
Cells were also co -transfected with 100 pmol of each miR-34 mimic or NC mimic, as indicated, using Lipofectamine 2000. [score:1]
As shown in Figure 3 C, transient transfection of miR-34 mimics resulted in significantly increased activation of caspase-3, a key indication of the cells undergoing apoptosis [25]. [score:1]
miR-34a, miR-34b and miR-34c mimics all had similar activities. [score:1]
To evaluate the long-term effects of the miR-34 restoration, we also employed a lentiviral system to express miR-34a. [score:1]
miR-34 restoration by transfection of MiaPaCa2 cells with miR-34 mimics. [score:1]
These findings suggest that miR-34 mimics may hold significant promise as a novel molecular therapy for human pancreatic cancer with loss of p53–miR34, potentially via modulating pancreatic cancer stem cells. [score:1]
miR-34 restoration sensitizes MiaPaCa2 cells to chemo- and radiotherapy. [score:1]
Our data demonstrate that miR-34 restoration can overcome chemo-/radioresistance of the pancreatic cancer cells that have high levels of Bcl-2 and low basal levels of miR-34s, and are dependent on Bcl-2 for survival and resistance to therapy. [score:1]
MiaPaCa2 cells were transfected with miR-34 mimic or NC mimic for 24 hr, plated in 96-well plates (5,000 cells/well), and treated with serially diluted chemotherapeutic agents, in triplicates. [score:1]
B, miR-34 restoration increases caspase-3 activation induced by gemcitabine or X-ray radiation in MiaPaCa2 cells. [score:1]
0006816.g004 Figure 4 A, miR-34 restoration sensitizes the cells to chemotherapeutic agents. [score:1]
Loss of miR-34 has been linked to chemoresistance of cancer [13]. [score:1]
In the current study, we have examined the effects of functional restoration of miR-34 by miR-34 mimics and lentiviral miR-34a on human p53-mutant pancreatic cancer MiaPaCa2 cells, as well as the potential link to the pancreatic cancer stem cell self-renewal. [score:1]
MiaPaCa2 cells were co -transfected with the Bcl-2 3′UTR Luciferase Reporter or its mutant, b-gal vector, together with either miR-34 mimics or NC mimic. [score:1]
miR-34 mimics resulted in significant G1 and G2/M arrest and a reduction of cells in S phase (Figure 3 D ), consistent with other reports on miR-34 restoration in various cancer mo dels [6], [7], [8], [10], [11], [21], [22], [26]. [score:1]
Transfection of miR-34 mimics. [score:1]
[1 to 20 of 108 sentences]
2
[+] score: 377
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
Consistent with these C. elegans results, of a published GEO dataset for hippocampus of wild-type adult male C57BL/6 mice 44 revealed upregulation of genes related to extracellular matrix, cell adhesion, basement membrane and anti-apoptosis when mir-34 was knocked down by adeno -associated viral (AAV)- delivered mir-34 sponges (180 upregulated and 36 downregulated genes, FDR < 0.01) (Table S3). [score:11]
We observed reduced stress resistance in both mir-34 mutants and overexpressors, supporting the role of this feedback inhibition loop in regulation of mir-34 and DAF-16 levels to reduce the fluctuations in daf-16 and myc network target expression levels under stress conditions. [score:10]
We conclude that mir-34 upregulation is necessary for inducing developmental arrest with correct morphogenesis and enhanced survival of dauers, and that this role of mir-34 relies on a functional insulin signaling receptor, DAF-2. mir-34 is regulated by DAF-16, PQM-1 and DAF-12The insulin signaling pathway regulates dauer-related phenotypes and responses to stress conditions by regulating nuclear localization of its downstream target transcription factor, DAF-16/FOXO 32 33. [score:10]
According to this regulatory loop, if miR-34 becomes upregulated above threshold levels, mir-34 expression is lowered via the feedback inhibition of DAF-16, which results in reduced stress resistance. [score:9]
Supplementary Table 1. Supplementary Table 2. Supplementary Table 3. P mir-34 [2.2kb] ::gfp is expressed in various tissues during development of C. elegans and its expression is upregulated in dauers. [score:9]
We conclude that mir-34 upregulation is necessary for inducing developmental arrest with correct morphogenesis and enhanced survival of dauers, and that this role of mir-34 relies on a functional insulin signaling receptor, DAF-2. The insulin signaling pathway regulates dauer-related phenotypes and responses to stress conditions by regulating nuclear localization of its downstream target transcription factor, DAF-16/FOXO 32 33. [score:9]
A mir-34 rescue strain, which has a single copy insertion of mir-34 and restores expression of miR-34 to 70% of the wild type level (Fig. 2A), as well as a mir-34 overexpression strain (mir-34OE), which has 4 copies of mir-34 and expresses miR-34 3-fold higher than wild type (Fig. 2A), rescue these morphological defects (Fig. S1). [score:7]
Genes that were expressed higher in the absence of mir-34 were significantly enriched for DAF-16 binding elements (DBE) and AGO-CLIP supported miR-34 targets, whereas genes which were expressed higher in the wild-type dauers were significantly depleted for DAF-16 binding but enriched for PQM-1 binding the DAE (Fig. 4B). [score:7]
These data suggest that differential expression of genes between wild-type and mutant dauers is the result of both direct regulation by miR-34 and indirect regulation via DAF-16/PQM-1 binding. [score:7]
We observed a large overlap between class 1 genes, dauer related genes, and genes that were up-regulated in mir-34(gk437) dauers, and between class 2 genes, non-dauer genes, and genes that were down-regulated in mir-34(gk437) dauers (Fig. S4). [score:7]
The same expression patterns were observed in dauers of the transgenic P mir-34 [5kb] ::gfp reporter 26, suggesting that all crucial regulatory elements for dauer related upregulation of mir-34 were located within the 2.2 kb upstream region. [score:7]
If miR-34 expression helps in establishing the stress response program, then gene expression changes when mir-34 is overexpressed under normal conditions should overlap with stress response genes that are observed in WT animals grown under heat stress. [score:7]
Although the observed changes in daf-16 expression upon miR-34 overexpression are not large, combined with the experimental AGO-CLIP data 39 and DAF-16::GFP reporter analysis results, they suggest direct regulation of daf-16 by miR-34. [score:7]
In mir-34OE and mir-34 mutant dauers a large number of genes were differentially expressed compared to WT dauers (1157 and 4652, respectively; Fig. 4B), consistent with the observed phenotypes and upregulated mir-34 expression pattern in dauers. [score:7]
GO term analysis of genes that were upregulated in the mir-34(gk437) dauer background and had ALG-1 binding sites and/or MIRZA scores higher than 100 revealed upregulation of genes encoding glycoproteins, cytoskeletal genes, intermediate filaments, extracellular matrix proteins, transmembrane and transport proteins (Table S2). [score:7]
In mutants that enhance temperature -induced dauer formation, the P mir-34 [2.2kb] ::gfp transgene expression patterns were similar to those seen in the wild-type (WT) background, implying that high mir-34 expression derived from differential gene expression at the dauer stage, and not from starvation conditions (Fig. 1C). [score:7]
mir-34 expression is regulated by the dauer larva gene expression program. [score:6]
Stress -induced upregulation of mir-34 expression was observed in starved worms, dauers and older adults 26 31, which was recapitulated by our P mir-34 [2.2kb] ::gfp transgenic line (Fig. 1A–D). [score:6]
Further evidence for a DAF-16- mir-34 feedback inhibition loopFinally, we sought additional evidence for daf-16 regulation by miR-34 in a daf-16::gfp reporter strain and in gene expression data. [score:6]
In this study, we demonstrated that miR-34 levels are upregulated to sustain a gene expression program that is associated with morphological and metabolic adaptation of stress. [score:6]
mir-34 expression is regulated by the dauer larva gene expression programTo study the relationship between mir-34, cell cycle arrest and stress, we focused on the dauer stage of C. elegans, which is the stress-resistant diapause stage that forms under harsh environmental conditions such as crowding, high temperatures and starvation 28 29. [score:6]
The highest expression levels were observed with insulin signaling pathway mutant dauers (Fig. 1C ii and iii), suggesting the possibility for the involvement of DAF-16/FOXO in the regulation of mir-34 expression. [score:6]
Furthermore, in N2 animals shift from 20 °C to 25 °C does not significantly change daf-16 levels (6% change, P = 0.523) but overexpression of miR-34 at 25 °C leads to a 25% downregulation of daf-16 compared to WT at 20 °C (P = 0.012). [score:5]
However, several other autophagy-related genes (lgg-1, atg-13, atg-16.2, unc-51, bec-1) were downregulated in mir-34OE dauers compared to mir-34 mutants (Table S1), which may suggest autophagy inhibition by mir-34 as was proposed in the aforementioned study 57. [score:5]
Detailed MIRZA alignment of the miR-34 target in daf-16 mRNA shown in panel C. (E) Expression of DAF-16::GFP is elevated with temperature in amphid neurons (indicated by arrows) in mir-34(gk437) mutants but not in wild-type animals. [score:5]
Small internal promoter deletions in the region bound by these TFs revealed that DAF-12 binding elements, insulin response element (IRE) and GA-repeats were required for mir-34 expression in hypodermis and seam cells (Fig. S2), and DAF-16 was necessary for activation of P mir-34 [2.2kb] ::gfp expression in dauers (Fig. 1C and Fig. S3A) and in amphid neurons, especially AWC neurons of adults (Fig. S3D). [score:5]
According to the mo del, MK5 activates mir-34b/c expression via phosphorylation of FOXO3a, thereby promoting nuclear localization of FOXO3a and enabling it to induce mir-34b/c expression and arrest proliferation. [score:5]
A good target would have a MIRZA score above 50, and Table S1 also lists how many miR-34 targets were found in a gene, and their cumulative MIRZA score. [score:5]
Effects of mir-34 deletion or overexpression on gene expression under various conditions. [score:5]
miR-34 targets daf-16To understand the molecular programs underlying phenotypic changes observed in the mir-34 mutant and overexpression strains, we identified experimentally supported targets of miR-34 using Argonaute crosslinking and immunoprecipitation (AGO-CLIP) data generated by Grosswendt et al. 39, in combination with calculated by MIRZA software 40. [score:5]
These results suggest that mir-34 upregulation is dependent upon DAF-16 in the dauer stage. [score:4]
We also observed that upregulation of P mir-34 [2.2kb] ::gfp in dauers is abolished by mutating this region, and in the daf-16(mu86) background. [score:4]
While in wild-type animals temperature shift from 20 °C to 25 °C resulted in 1891 and 2425 down- and up- regulated genes respectively (Fig. 4D), the number of differentially expressed genes was smaller in mir-34(gk437) (1192/1709 genes) and mir-34OE (1008/1442) backgrounds (Fig. 4D). [score:4]
Thus, our results suggest that mir-34 is involved in a feedback inhibition loop that includes the daf-16 and myc networks to regulate a stress response program in C. elegans (Fig. S6). [score:4]
Furthermore, analysis of P mir-34 [2.2kb] ::gfp in excretory gland cells in various mutant background showed a direct correlation between DAF-16 levels and reporter expression (Fig. S3B,C). [score:4]
Finally, we sought additional evidence for daf-16 regulation by miR-34 in a daf-16::gfp reporter strain and in gene expression data. [score:4]
Additionally, mdl-1 and mxl-3, from the Myc-like interaction network in C. elegans, showed mir-34 dependent downregulation under high temperature growth, suggesting that the myc network is a part of the stress response pathway that is modulated by daf-16 and mir-34. [score:4]
We showed that mir-34 mutation results in morphogenesis defects of dauers, which correlates with our transcriptome analysis results that shows deregulation of cell adhesion, cytoskeleton, ECM and basement membrane related gene categories both in of mir-34 mutant dauers and mir-34 knockdown mouse hippocampus. [score:4]
Therefore, we think that upregulation of mir-34 is necessary for correct morphogenesis of tissues to ensure long survival of dauers. [score:4]
Additionally, ATG9A did not show a significant change in expression levels in mir-34 knockdown in male mouse hippocampus (Table S3). [score:4]
We identified the minimal promoter region responsible for mir-34 upregulation by generating several P mir-34 [2.2kb] ::gfp strains with shorter upstream regions relative to the initial 2.2 kb promoter (Fig. 3A). [score:4]
mir-34 is regulated by DAF-16 and targets daf-16. [score:4]
Upregulation of mir-34 in hypodermis and seam cells and the morphological defects of mir-34(gk437) mutants correlate with these GO terms. [score:4]
miR-34 targets daf-16. [score:3]
Construction of mir-34 rescue and overexpression strains. [score:3]
The predicted miR-34 target region is located in the last coding exon of daf-16, not far from the stop codon (Fig. 3C). [score:3]
The mdl-1 gene promoter is bound by DAF-16 and PQM-1, according to modENCODE data 35, and the mdl-1 mRNA is targeted by miR-34 according to AGO-CLIP data 39 and MIRZA prediction, although the MIRZA score is modest (Table S1). [score:3]
qPCR validation of miR-34 expression. [score:3]
Furthermore, according to our combined analysis of MIRZA scores and AGO-CLIP data, one of the top predicted miR-34 targets is daf-16/FOXO. [score:3]
We observed higher DAF-16::GFP levels in mir-34(gk437) mutants grown at high temperatures (P = 0.0175, t test), accompanied by higher levels of nuclear localization of the translational fusion protein in amphid neurons, however, there were no significant differences under normal growth conditions (Fig. 3E,F). [score:3]
P mir-34 [2.2kb] ::gfp levels were similar to WT levels in daf-2(e1370);daf-16(mu86) background (Fig. S3D), suggesting that other factors were also involved in mir-34 induction upon inhibition of insulin signaling pathway. [score:3]
miR-34 expression is necessary for inducing stress response programs. [score:3]
The number of differentially expressed genes was highly diminished in mir-34(gk437) mutants when the comparison was done in the daf-2(e1370) background, where nuclear DAF-16 levels are saturated (Fig. 4C). [score:3]
Construction of mir-34 rescue and overexpression strainsP mir-34 [2.2kb]:: mir-34 was cloned into MosSCI plasmid and isolated plasmid was microinjected into N2 worms together with marker plasmids. [score:3]
The levels of daf-16 mRNA decreased by 12% and 8%, respectively, in adults and dauers overexpressing miR-34 at 20 °C, although the statistical significance of these changes is low (adjusted P value 0.41 and 0.58 respectively). [score:3]
We demonstrated DAF-16 dependent changes in the transcriptomes of animals that lack and overexpress mir-34. [score:3]
To understand the molecular programs underlying phenotypic changes observed in the mir-34 mutant and overexpression strains, we identified experimentally supported targets of miR-34 using Argonaute crosslinking and immunoprecipitation (AGO-CLIP) data generated by Grosswendt et al. 39, in combination with calculated by MIRZA software 40. [score:3]
At 25 °C, overexpression of miR-34 in adults results in a 17% decrease of daf-16 levels (adjusted P = 0.161). [score:3]
However, we found that in C. elegans atg-9 mRNA expression was lower in mir-34 and daf-2;mir-34 backgrounds, and did not observe a significant change in atg-9 transcript levels in adult stages (Table S1). [score:3]
mir-34 regulates dauer morphogenesis and survival dependent upon the insulin signaling pathwayWe investigated the role of mir-34 upregulation in dauers by studying dauer morphogenesis and survival in mir-34 mutants. [score:3]
Native levels of mir-34 expression are required for correct morphogenesis of dauers and dauer survival. [score:3]
In predauers, P mir-34 [2.2kb] ::gfp expression was increased in amphid neurons, especially in AWC neurons. [score:3]
In line with these findings, our results suggest that mir-34 has an evolutionarily conserved function in orchestrating responses to stresses, by modulating expression levels of DAF-16/FOXO and the Myc network. [score:3]
Additionally, glucose supplementation reduced P mir-34 [2.2kb] ::gfp levels (Fig. S3C), and prolonged stress conditions resulted in reduction of P mir-34 [2.2kb] ::gfp expression in many tissues of the worms. [score:3]
Further evidence for a DAF-16- mir-34 feedback inhibition loop. [score:3]
There were only 28 such genes for which expression increased with temperature in WT animals but decreased in mir-34(gk437) animals (Fig. 4H), including mdl-1 and mxl-3. mdl-1 is a basic helix-loop-helix (bHLH) transcription factor that acts as a part of the Myc-like interaction network in C. elegans. [score:3]
The analysis of these strains indicated that sequences between 0.5 kb and 1.2 kb upstream of mir-34 gene are essential for its regulation (Fig. 3B). [score:2]
These results suggest that indeed mir-34 plays a direct role in establishing the stress response program. [score:2]
The combination of AGO-CLIP evidence and highly-scoring MIRZA prediction suggests that daf-16 is very likely regulated by miR-34 and suggests existence of a negative feedback-loop between daf-16 and mir-34. [score:2]
mir-34 is regulated by DAF-16, PQM-1 and DAF-12. [score:2]
Other transcription factors, which showed same pattern as mdl-1 in terms of sensitivity to mir-34 levels included nhr-23, egl-13 and zip-7. NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting. [score:2]
The survival defect of mir-34 mutants required a functional insulin signaling pathway, where DAF-16 nuclear localization levels are not saturated, and probably DAF-16 activity is more prone to regulation by mir-34. [score:2]
Additionally, compared to WT dauers, mir-34(gk437) mutants had a shorter body size, and worms that overexpress mir-34 had a slightly longer body size (Fig. 2B). [score:2]
Such a regulatory loop that involves miR-34b/c, FOXO3a and Myc was previously described in mammalian cells 61. [score:2]
Additionally, the mir-34(gk437) mutation enhanced dauer formation in daf-7(e1372) mutant background but it did not have an effect on dauer formation in daf-2(e1370) mutants (Fig. 2D). [score:2]
mir-34 regulates dauer morphogenesis and survival dependent upon the insulin signaling pathway. [score:2]
We investigated the role of mir-34 upregulation in dauers by studying dauer morphogenesis and survival in mir-34 mutants. [score:2]
Since daf-16(mu86) null mutants cannot form dauers, this mutation was introduced into the daf-7(e1372);P mir-34 [2.2kb] ::gfp strain, which is dauer constitutive at 25 °C, in order to investigate whether the high expression of mir-34 in daf-7(e1372) mutant dauers was dependent upon DAF-16. [score:2]
For example, mir-34 deletion mutants do not show any abnormal morphological, developmental or biological phenotypes under standard laboratory culture conditions. [score:2]
According to a previous study the autophagy-related mRNA ATG9A was regulated by mir-34 in mammalian cells 57. [score:2]
Which genes might be particularly sensitive to miR-34 levels in this stress response program? [score:1]
To study the relationship between mir-34, cell cycle arrest and stress, we focused on the dauer stage of C. elegans, which is the stress-resistant diapause stage that forms under harsh environmental conditions such as crowding, high temperatures and starvation 28 29. [score:1]
Thus, a strong daf-2/dauer transcriptional signature is present in mir-34(gk437) mutant dauers, as it is also evident from our transcriptome analysis (Fig. S5A (i, ii)). [score:1]
In line with these results, both mir-34(gk437) and mir-34OE adults were more sensitive to hypoxia, heat stress, and starvation. [score:1]
Although mir-34 mutant dauers exhibit more a dauer-related transcriptional signature, changes in gene category representation are accompanied by the body defects and short survival rates of mir-34 mutants. [score:1]
This suggests that precise levels of miR-34 are required to elicit proper response to heat stress, and that deviations from these levels impair the stress response program. [score:1]
qPCR was performed on N2, mir-34(gk437) and N2 and mir-34(gk437) worms carrying P mir-34 [2.2kb]:: mir-34 transgene by using TaqMan kit. [score:1]
This finding was in line with the lower amount of phenotypic changes observed between daf-2(e1370) and daf-2(e1370);mir-34(gk437) mutant worms. [score:1]
These transcription factors may also be responsible for miR-34 dependent transcriptome and phenotypic changes under stress conditions. [score:1]
At the same time, there was no significant difference between daf-2(e1370) and daf-2(e1370);mir-34(gk437) worms in terms of body size and survival (data not shown). [score:1]
Around 80% (250 dauers tested) of mir-34(gk437) dauers that were selected from starved plates had locomotion defects, and were rolling along their body axis. [score:1]
How to cite this article: Isik, M. et al. MicroRNA mir-34 provides robustness to environmental stress response via the DAF-16 network in C. elegans. [score:1]
Transcriptome analysis reveals the crosstalk between DAF-16 and mir-34To investigate the possible crosstalk between mir-34 and DAF-16, we performed microarray gene expression analysis for several genetic backgrounds and stress conditions (Table S1, Fig. 4). [score:1]
It has a MIRZA score of 625, and exhibits perfect complementarity to nucleotides 1–8 of the mature miR-34 sequence (Fig. 3D). [score:1]
Transcriptome analysis reveals the crosstalk between DAF-16 and mir-34. [score:1]
This suggests that the C. elegans myc network may play an important role in modulating a stress response program downstream of mir-34. [score:1]
By engineering promoter truncations we showed that an IRE sequence, which binds DAF-16, is present in mir-34 promoter. [score:1]
P mir-34 [2.2kb]:: mir-34 was cloned into MosSCI plasmid and isolated plasmid was microinjected into N2 worms together with marker plasmids. [score:1]
To investigate the possible crosstalk between mir-34 and DAF-16, we performed microarray gene expression analysis for several genetic backgrounds and stress conditions (Table S1, Fig. 4). [score:1]
MIRZA, miR-34 target predictions calculated by MIRZA. [score:1]
ALG – presence of AGO-CLIP regions from Grosswendt et al. 39, overlapping miR-34 MIRZA predictions. [score:1]
Furthermore, mir-34(gk437) mutant dauers exhibited a lower survival rate (at both 20 °C and 25 °C) than WT dauers (Fig. 2C). [score:1]
However, miR-34 is critical in the DNA damage response in both mammals and C. elegans. [score:1]
To address this question, we looked for genes that responded oppositely to heat stress in WT and mir-34(gk437) animals. [score:1]
[1 to 20 of 104 sentences]
3
[+] score: 374
In this study, we identified one such estrogen downregulated miRNA, miR-34b, as an oncosuppressor that targets cyclin D1 and Jagged-1 (JAG1) in an ER+/wild-type p53 breast cancer cell line (MCF-7), as well as in ovarian and endometrial cells, but not in ER -negative or mutant p53 breast cancer cell lines (T47D, MBA-MB-361 and MDA-MB-435). [score:8]
In this study, we observed that the expression of miR-34b was downregulated by ER signaling, thus we provide evidence of the negative correlation between ER and miR-34b expression levels in patients with ER+ tumors (Figure 1B). [score:8]
Since we observed that miR-34b was downregulated in ER+ breast cancer cells (MCF-7 cells), we speculated that overexpression of miR-34b might inhibit cell proliferation. [score:8]
The xenoestrogens diethylstilbestrol and zeranol also showed similar estrogenic effects by inhibiting miR-34b expression and by restoring the protein levels of the miR-34b targets cyclin D1 and JAG1 in MCF-7 cells. [score:7]
Furthermore, these data suggest that miR-34b may suppress tumor growth through the suppression of cyclin D1 and JAG1 expression. [score:7]
One of the estrogen-regulated miRNAs, miR-34b, has been identified and has been functionally validated as a tumor suppressor miRNA downregulated by estrogen. [score:7]
Overexpression of miR34b decreases the expression of a number of cell-cycle regulatory proteins, including cyclin D1, c-MET and CDK4 [15, 17, 23], and thus hampers cell-cycle progression [15, 16]. [score:6]
In this study, we confirmed that p53 participates in miR-34b regulation and leads to cell growth inhibition by targeting cyclin D1. [score:6]
Moreover, overexpression of precursor miR-34b leads to downregulation of JAG1 and cyclin D1 (Figure 3C). [score:6]
Our results show that the xenoestrogens DES and ZEA downregulate miR-34b expression in MCF-7 cells (Figure 6A). [score:6]
As shown in Figure 6F, E2 downregulated miR-34b/c expression in both OVCAR4 and endometrial cells. [score:6]
Further validation indicated that estrogen's inhibition of miR-34b expression was mediated by interactions between ERα and p53, not by DNA methylation regulation. [score:6]
According to miRNA target gene prediction software, including PicTar, miRanda and miRNAMap, miR-34 could target key regulators of cell proliferation, including cyclin D1 and JAG1 (Figure 3B). [score:6]
Mutations of the 3'UTR -binding sites completely abolished the ability of miR-34b to regulate luciferase expression (Figures 3D and 3E). [score:5]
Our results show that treatment with 5-aza-dC (a DNA methyltransferase inhibitor) did increase the expression of miR-34b/c, but that the methylation status of miR-34b/c promoter was not affected by E2 treatment. [score:5]
Moreover, overexpression of miR-34b leads to inhibition of cell growth in breast cancer cells with different ER and p53 status. [score:5]
These data suggest that miR-34b expression is closely linked to ERα expression levels in ER+ human breast tumors involved in the complexity of in vivo systems. [score:5]
Also, the overexpression of miR-34b inhibited ER+ breast tumor growth in an orthotopic mammary fat pad xenograft mouse mo del. [score:5]
In addition, our computational analysis of miR-34b/c targets using PicTar and miRanda pointed to the Notch ligand JAG1 as another possible target. [score:5]
In agreement with these data, we found that miR-34b inhibited breast cancer cell proliferation by targeting cyclin D1 and JAG1. [score:5]
In our study, miR-34b has been showed to inhibit cell growth by targeting cyclin D1 and JAG1, both of which are crucial genes covering various types of breast cancer [27, 47, 48]. [score:5]
Thus it seems unlikely that E2 regulates miR-34b/c expression through epigenetic regulation. [score:5]
The inhibitory effect of estrogen on miR-34b expression was apparent within 2 hours and was sustained for at least 24 hours in MCF-7 cells (Figure 2B). [score:5]
To determine whether miR-34b could reduce orthotopic tumor growth, the mice were randomized into two groups (n = 10 for each group): (1) miR-34b Tet-On overexpression stable clone without doxycycline (Sigma-Aldrich) or (2) miR-34b Tet-On overexpression clone with doxycycline. [score:5]
miR-34b suppressed cell proliferation by direct regulation of Jagged-1 and cyclin D1. [score:5]
However, in the presence of E2 or xenoestrogens, the activated ER disrupts the binding of the p53-ER complex to the miR-34b promoter region, which subsequently inhibits the tumor-suppressing network and promotes cell proliferation and tumor progression. [score:5]
Treatment of MCF-7 cells with a DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (5-aza-dC), increased the expression level of miR-34b (Figure 5D) and reduced the methylation status in the CpG islands of the miR-34b promoter region as demonstrated by MSP and BSP (Figure 5E). [score:5]
Recent studies showed that p53 could bind to miR-34b/c and regulate its expression [16]. [score:4]
To investigate whether xenoestrogen could promote cancer progression by regulating miR-34b (similarly to E2), we examined miR-34b and its downstream target's expression level after xenoestrogen treatment. [score:4]
Since the regulation of miR-34b/c is dependent on both active ERα and p53, it provide more hints that ER+ breast cancer patients with wild-type p53 expression might be more responsive than patients with mutant p53 to TAM therapy. [score:4]
Xenoestrogens and tamoxifen regulate miR-34b expression in breast cancer cells. [score:4]
Previous studies showed that miR-34b has important functions in cell proliferation and apoptosis and also serves as a direct transcriptional target of p53 [15- 17]. [score:4]
Previous studies indicated that miR-34b/c expression is regulated by p53, which mediates cell-cycle arrest and promotes apoptosis [17, 38]. [score:4]
These data suggest that miR-34b may serve as a tumor suppressor that regulates tumor progression, as has been reported in a variety of cancers [15- 17, 23- 25]. [score:4]
p53 -dependent regulation of miR-34b expression by estradiol. [score:4]
These data suggest that E2 did not regulate miR-34b/c expression through DNA methylation in MCF-7 cells. [score:4]
Previously presented evidence indicated that miR-34b/c expression may be regulated by DNA methylation [18]. [score:4]
Furthermore, the interaction between p53 and ER at the promoter site plays a pivotal role in the regulation of miR-34b expression [29- 31]. [score:4]
TAM, a SERM that exhibits antiestrogenic effects in breast tissue, did not affect miR-34b expression levels in MCF-7 cells (Figure 6A). [score:3]
We provide evidence that miR-34b plays a pivotal role in the human breast cancer -expressing ER+ phenotype (Figure 8). [score:3]
Our in vivo Tet-On system orthotopic mo del revealed the tumor-suppressive ability of miR-34b. [score:3]
Although many reports have described the regulation of the miR-34 family as being mediated mostly through the p53 signaling pathway [15- 17, 39], miR-34b/c could also be regulated by DNA methylation of CpG islands [18, 40, 41]. [score:3]
To verify that miR-34b expression is linked to tumor growth, MCF-7 cells were treated with different concentrations of E2 (0.1, 1.0, 10 and 100 nM), and cell proliferation rates were determined. [score:3]
Furthermore, miR-34b might be used as a therapeutic target for treating breast cancer. [score:3]
We have further demonstrated that the activation of ER by E2 impairs the binding of p53 to the two p53RE regions of the miR-34b promoter leads to repression of miR-34b expression. [score:3]
miR-34b expression levels were analyzed by quantitative PCR (qPCR) (ER+, n = 26; ER-, n = 21). [score:3]
Among these estrogen-regulated miRNAs, miR-34b has been shown to regulate tumor progression in a variety of cancers [15- 17, 23- 25]. [score:3]
Estradiol increased anchorage -dependent colony formation and repressed miR-34b expression in MCF-7 cells. [score:3]
A precursor form of miR-34b was inserted into the p Silencer 4.1-CMV puro vector, then subcloned into the pTRE-Tight vector for overexpression. [score:3]
By establishing Tet-On-inducible miR-34b expression in MCF-7 cells, we have demonstrated that the induction of miR-34b significantly decreases cell proliferation rate in vitro and greatly lowers tumor growth in an orthotopic breast cancer mo del in vivo. [score:3]
We next examined the expression levels of miR-34b in 47 human breast cancer patients (Table 2). [score:3]
On the other hand, ER+ breast cancer cells are not as malignant, and, in addition, the patterns of their malignancy are usually simpler than those of ER- cells, which may be the reason why the miR-34b expression pattern in ER+ cancer patients is more consistent and more important than that in ER- cancer patients. [score:3]
We first demonstrated that miR-34b promoter activity was significantly inhibited by 10 nM E2 treatment of 293T cells cotransfected with ER (Figure 5A). [score:3]
E2 increased anchorage -dependent growth in a concentration -dependent manner (Figure 2A), but the expression levels of miR-34b decreased concentration -dependently. [score:3]
Tet-On induction of miR-34b can cause inhibition of tumor growth and cell proliferation. [score:3]
Only cells expressing both wild-type p53 and ERα responded to estrogen repression of miR-34b (Figure 5B). [score:3]
These findings reveal that miR-34b is an oncosuppressor miRNA requiring both ER+ and wild-type p53 phenotypes in breast cancer cells. [score:3]
Because E2 markedly decreased miR-34b expression levels (72-fold), miR-34b was chosen for further study. [score:3]
These results demonstrate that JAG1 and cyclin D1 are potential targets of miR-34b. [score:3]
To further confirm the interaction between miR-34b and its putative target genes, we cloned the JAG1 and cyclin D1 3'UTR sequence and inserted it downstream of the firefly luciferase coding region of the pMIR-REPORT vector (Figures 3D and 3E). [score:3]
To test this hypothesis, we established a miR-34b Tet-On overexpression system. [score:3]
Doxycycline was applied to induce miR-34b expression after tumor size reached 5 mm [3]. [score:3]
There is a negative association between ERα and miR-34b expression levels in ER+ breast cancer patients. [score:3]
Moreover, the correlation between miR-34b and ER expression levels were inversely correlated (Pearson coefficient = -0.4185, P = 0.0019) for ER+ patients (Figure 1B). [score:3]
E2 (10 nM) treatment reduced miR-34b expression by 88% in MCF-7 cells (Figure 2B). [score:3]
miR-34b/c suppresses cell growth in breast cancer cell lines. [score:3]
IgG = immunoglobulin G. (D) Quantitative PCR of miR-34b expression in MCF-7 cells following 10 nM E2 treatment (24 hours) and 2 μM 5-aza-2'-deoxycytidine (5-AZA) (72 hours) (n = 3). [score:3]
To test whether miR-34b suppresses tumor growth in vivo, 1 × 10 [6 ]MCF-7/miR-34b Tet-On stable clones were injected into the mammary fat pads of female NOD SCID mice. [score:3]
To evaluate this possibility by using miR-34b/c as potential therapeutic targets, we obtained four breast cancer cell lines with different ER and p53 status and overexpressed miR-34b/c. [score:3]
These results indicate that miR-34b could be a potential therapeutic target in the treatment of various types of breast cancer. [score:3]
The evidence we present suggests that miR-34b is a crucial factor in ER+ breast cancer tumorigenesis and may serve as a target for miRNA -based breast cancer therapy or as a miRNA -based prognostic marker, and we provide new insights into breast cancer treatments. [score:3]
To investigate the possible link between miR-34b and these possible downstream targets, the protein expression levels of cyclin D1 and JAG1 were examined. [score:3]
DNA damage or aberrant cell-cycle progression leads to rapid increase of p53, which in turn may lead to p53 -dependent miR34b expression [16]. [score:3]
Negative correlation of miR-34b expression level and ER status in ER+ human breast cancers. [score:3]
Our results show that the luciferase activity of the wild-type JAG1 and cyclin D1 3'UTR construct was significantly inhibited after the introduction of miR-34b into 293T cells, but not by the negative control. [score:3]
As shown in Figure 7, despite the different status of ER and p53, all four cell lines showed a significant decrease in growth after 48 hours with the expression of miR-34b/c. [score:3]
Addition of doxycycline significantly decreased cell proliferation (Figure 2E) and cyclin D1 expression (Figure 2F) in MCF-7/miR-34b Tet-On stable clones. [score:3]
Figure 4 miRNA (miR)-34b inhibited tumor growth in mouse mammary fat pads xenografted with MCF-7 pTRE-miR-34b/Tet-On stable clones. [score:3]
This result demonstrates that the induction of miR-34b/c could suppress cell growth and that the effect was not influenced by ER or p53 status. [score:3]
miR-34b inhibited tumor growth in mouse mammary fat pads xenografted with MCF-7 pTRE-miR-34b/Tet-On stable clones. [score:3]
Among these estrogen-regulated miRNAs, miR-34b was selected for further investigation because it has been reported to be a tumor suppressor in colorectal cancer [18], prostate cancer [25] and gastric cancer [24]. [score:2]
In this study, we have demonstrated for the first time that miR-34b significantly regulates the growth of ER+ breast cancer cells in vitro. [score:2]
The role of estrogen in the miR-34b -regulating pathway is shown. [score:2]
The miR-34b expression level in Tet-On group was increased 2.76-fold compared to the noninduced miR-34b group (Figure 4D). [score:2]
This result showed that E2 regulation of miR-34b does not occur through classical ER signaling. [score:2]
These data suggest that the E2 regulation of miR-34b/c maybe a universal event and might also contribute to the proliferation potential in these tissues. [score:2]
We have examined the regulation of miR-34b in both OVCAR4 and endometrial cells. [score:2]
We demonstrate herein that estrogen regulates the promoter activity of miR-34b gene through the interaction between ER and p53. [score:2]
To investigate whether the regulation of miR-34b expression is tissue-specific, we studied human OVCAR4 ovarian cancer cells and primary culture of mouse endometrial cells. [score:2]
We found that the ER+ tissues had lower miR-34b expression levels compared to ER- tissues (ER+: n = 26 vs ER-: n = 21; P < 0.05) (Figure 1A). [score:2]
Cell proliferation assay of breast cancer cell lines after overexpression miR-34b/c (n = 6). [score:2]
Transfection of precursor miR-34b or antagomir-34b also showed significant decreases or increases in cell proliferation (Figure 3A). [score:1]
s and chromatin immunoprecipitation assay demonstrated miR-34b were regulated by p53-ER interaction. [score:1]
Lipofectamine 2000 transfection reagent (Invitrogen/Life Technologies) and pTRE-miR-34b and Tet-On plasmids were mixed according to the manufacturer's instructions and added to the cells. [score:1]
The clinical data derived from our experiments show no significant correlation of miR-34b in ER- tumors (Figure 1C). [score:1]
After verification of the sequences, miR-34b/c fragments were excised using HindIII and ligated into a pGL3-Basic vector (Promega). [score:1]
In this system, miR-34b is conditionally turned on by doxycycline treatment (Figure 2D). [score:1]
Herein, on the basis of clinical and in vivo animal mo dels, we show that miR-34b may play a role in controlling the growth of ER+ breast cancer. [score:1]
However, the correlation of miR-34b and ER showed no significance for ER- patients (Pearson coefficient = 0.009, P = 0.9679) (Figure 1C). [score:1]
In summary, E2 may enhance breast cancer growth by modulating cell-cycle-related genes through the repression of miR-34b. [score:1]
Given that E2 significantly repressed the binding of both p53 and ER to the p53 binding sites in the miR-34b/c promoter, E2's binding to ER may change the conformational structure of ER, which in turn alters p53's binding to the miR34-b/c promoter because of ER-p53 protein-protein interactions. [score:1]
Importantly, combined estrogen and TAM treatment reversed the effect of estrogen on miR-34b (Figures 6D and 6E). [score:1]
These data suggest that both ER and p53 activity are required for E2 to repress miR-34b. [score:1]
In addition, oligonucleotide fragments corresponding to p53-responsive elements were synthesized and inserted upstream of the miR-34b/c promoter in the pGL3-Basic vector. [score:1]
We next examined whether both proteins bind to the two p53 binding sites in the miR-34b promoter. [score:1]
Under 17β-estradiol (E2)-free conditions, p53 and estrogen receptor (ER) bind to the miR-34b promoter and activate its transcription. [score:1]
Bottom bar graphs: 293T cells were cotransfected with negative control (Mock) (200 pM) or miR-34b (200 pM), Luc-JAG1-3'UTR (0.5 μg) or Luc-CyclinD1-3'UTR (0.5 μg), along with a pRL-SV40 reporter plasmid (0.05 μg). [score:1]
Binding of p53 to the two p53RE binding sites of the miR-34b promoter region were disrupted by treatment of cells with E2 (Figure 5C). [score:1]
H & E staining of the fat pads confirmed that miR-34b induction led to a decrease in tumor size (Figure 4C). [score:1]
These data support the notion that E2's binding to ER may affect p53's binding to miR-34b promoter through p53-ER interaction. [score:1]
We believe that miR-34b is not likely the only factor involved in tumor progression in ER- breast cancer patients. [score:1]
For each well, 200 pM miR-34b precursor molecule (Ambion/Life Technologies) or a negative control (mock) precursor miRNA (Ambion/Life Technologies) was cotransfected with the reporter constructs. [score:1]
However, we could not find any possible binding sites of ER in the miR-34b promoter. [score:1]
We found that E2 exerts similar miR-34b repression effects in human ovarian cancer cell OVCAR4 cells and mouse primary cultured endometrial cells, suggesting that a general repression mechanism by miR-34b may exist in different tissue types. [score:1]
As shown in Figure 4B, the tumor volumes in the induced miR-34b group were significantly lower than in the control group (P < 0.01). [score:1]
To generate the Luc-JAG1-3'UTR-Mut and Luc-CyclinD1-3'UTR-Mut construct, seed regions were mutated by removing complementary nucleotides of miR-34b. [score:1]
[1 to 20 of 116 sentences]
4
[+] score: 269
We detected modest upregulation of cMyc, E2f3, Met and Sirt1 in miR-34 -deficient MEFs, while Bcl2 was expressed at similar levels in wild-type and mutant cells (Figure 3K). [score:6]
Expression of members of the miR-34 family was similarly upregulated in response to p53 stabilization (Figure 3G). [score:6]
In addition, miR-449 expression is not substantially increased in miR-34 -null mice, and activation of the p53 pathway does not lead to significant upregulation of miR-449 (Figure S8). [score:6]
We also examined the consequences of miR-34 loss in MEFs on the expression of a subset of its previously reported direct targets [17], [20], [23], [25]. [score:6]
Thus, although a longer follow-up of miR-34 [T KO/T KO] mice may be needed to uncover very subtle defects in tumor suppression, we conclude that loss of miR-34 expression does not lead to a substantial increase in spontaneous tumorigenesis. [score:5]
Because previous work has relied on the use of miRNA antagonists to inhibit miR-34 function, it is possible that some of the previous observations reflected miR-34-independent off-target effects. [score:5]
With respect to the potential tumor suppressive role of miR-34, our experiments indicate that loss of miR-34 expression does not lead to an obvious increase in tumor incidence in mice and does not cooperate with Myc in the context of B cell lymphomagenesis. [score:5]
Importantly, in these three tissues, miR-34 expression is almost entirely p53-independent (Figure 1B–1D and [58]), a finding that suggests that additional transcription factors control the expression of this family of miRNAs in the absence of genotoxic or oncogenic stresses. [score:5]
Consistent with a possible tumor-suppressor role, loss of expression of members of the miR-34 family has been reported in human cancers. [score:5]
Here, we probe the tumor suppressive functions of the miR-34 family in vivo by generating mice carrying targeted deletion of the entire miR-34 family. [score:5]
The upregulation of Myc and E2f3 might contribute to the increased proliferation rate we have observed in miR-34 deficient MEFs. [score:4]
Importantly, homozygous deletion of miR-34a did not lead to compensatory up-regulation of miR-34b∼c, and vice versa (Figure 2D and data not shown). [score:4]
Consistent with previous reports indicating that miR-34a expression is under the direct control of p53 [13], [17], [18], we detected reduced levels of this miRNA in a subset of p53 -deficient tissues (heart, small and large intestine, liver and kidney), but the levels of both miR-34a and miR-34b∼c remained high in the brains, testes and lungs (Figure 1B–1D) of p53 [−/−] mice, a finding that suggests that p53-independent mechanisms determine basal miR-34 transcription in these tissues. [score:4]
Many of the predicted miR-34 target genes encode for proteins that are involved in cell cycle regulation, apoptosis, and growth factor signaling. [score:4]
Our results show that complete loss of miR-34 expression is compatible with normal development and that the p53 pathway is apparently intact in miR-34 -deficient mice. [score:4]
Canonical p53 -binding sites are located in the promoter regions of both miR-34a and miR-34b∼c, and these miRNAs are bona fide direct transcriptional targets of p53 [13], [17], [18]. [score:4]
miR-34 and tumor suppression in vivo To extend our analysis to an in vivo setting, we next examined whether miR-34 inactivation is sufficient to accelerate spontaneous and oncogene -induced transformation in mice. [score:3]
Although our observation that single KO and miR-34 [T KO/T KO] mice produce viable offspring argues against an essential role for miR-34 in these processes, members of the related miR-449 family, that are particularly highly expressed in the testis (Figure S8), could partially compensate for miR-34 loss in this context. [score:3]
Despite the growing body of evidence supporting this hypothesis, previous studies on miR-34 have been done in vitro or using non-physiologic expression levels of miR-34. [score:3]
p53 -dependent and p53-independent miR-34 expression in vivo. [score:3]
High contribution chimeras were crossed to Actin-flpe transgenic mice for germline transmission of the targeted allele and to delete the Neo cassette resulting in the miR-34b∼c [Δ] allele. [score:3]
Consistent with these results, doxorubicin treatment caused similar activation of p53 and of its downstream targets in wild-type and miR-34 [T KO/T KO] MEFs (Figure 3E and 3F). [score:3]
To test whether miR-34 plays a role in this context, we ectopically expressed oncogenic K-Ras in wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs. [score:3]
Next, we sought to determine whether loss of miR-34 expression affects the p53 response in vitro. [score:3]
Members of the miR-34 family (miR-34a, miR-34b, and miR-34c) have been wi dely speculated to be important tumor suppressors and mediators of p53 function. [score:3]
Complete loss of miR-34 expression in miR-34 [T KO/T KO] animals was confirmed by Northern blot and qPCR (Figure 2D). [score:3]
Figure S1 Relative miR-34 expression in mouse tissues upon irradiation. [score:3]
Although these observations point towards an important role for miR-34 members as critical downstream effectors of p53 and potential tumor suppressors, these hypotheses have not been formally tested using miR-34 -deficient animals and cells. [score:3]
Our results show that the miR-34 family is not required for tumor suppression in vivo, and they suggest p53-independent functions for this family of miRNAs. [score:3]
We have reported the generation of mice carrying targeted deletion of miR-34a, miR-34b and miR-34c, and we have investigated the consequences of loss of miR-34 expression on p53 -dependent responses in vitro and in vivo. [score:3]
In humans, for example, loss of miR-34 expression has been reported in a large fraction of primary melanomas, prostatic adenocarcinomas and small cell lung cancers [27], [28], among others. [score:3]
However, the tumor suppressive function of miR-34 might be restricted to specific tissues and loss of miR-34 might cooperate with specific oncogenic lesions. [score:3]
Ectopic expression of members of the miR-34 family is sufficient to induce cell cycle arrest or apoptosis, depending on the cellular context [14], [17]– [21]. [score:3]
To determine whether loss of miR-34 expression leads to increased spontaneous tumorigenesis, we aged a cohort of 14 miR-34 [T KO/T KO] and 12 wild-type mice. [score:3]
Targeted deletion of miR-34a and miR-34b∼c. [score:3]
miR-34 and tumor suppression in vitro. [score:3]
We show that under basal conditions the expression of both miR-34 loci is particularly elevated in the testes and, to a lesser extent, in the brains and lungs of mice. [score:3]
miR-34 and tumor suppression in vitro The p53 pathway provides a crucial barrier against the neoplastic transformation of primary cells [40]. [score:3]
In addition, inactivation of miR-34 expression has been recently shown to lead to accelerated neurodegeneration and ageing in Drosophila melanogaster [64]. [score:3]
miR-34 and tumor suppression in vivo. [score:3]
Introducing the miR-34 -null alleles we have generated into mouse mo dels of these types of human cancers will be important to fully explore the tumor suppressive potential of this family of miRNAs. [score:3]
MiR-34b∼c expression seems largely restricted to these three tissues, while miR-34a is detectable, albeit at lower levels, also in a variety of other organs (Figure 1B–1D). [score:3]
These results show that while miR-34 alone is not required for p53 -mediated tumor suppression in MEFs, its loss might cooperate with inactivation of the Rb pathway in promoting cellular transformation. [score:3]
P53 -dependent cell cycle arrest in miR-34 [T KO/T KO] MEFsNext, we sought to determine whether loss of miR-34 expression affects the p53 response in vitro. [score:3]
Under basal conditions, miR-34a and miR-34b∼c expression is particularly intense in the testis, brain, and lung of adult mice (Figure 1B–1D). [score:3]
p53 -dependent and p53-independent miR-34 expression in vivo To investigate the biological functions of miR-34, we first examined the expression of this family of miRNAs under basal conditions and in response to p53 activation in vivo. [score:3]
However, even in this context complete loss of miR-34 expression was not sufficient to accelerate tumor formation. [score:3]
Consistent with this mo del is our observation that while loss of miR-34 expression alone does not allow the transformation of primary cells by oncogenic K-Ras, it slightly increases the efficiency of transformation when combined with inactivation of the Rb pathway by E1A (Figure 5A, 5B). [score:3]
Recent reports have also implicated miR-34 in neuronal development and behavior [60], [61] and a role for miR-34c in learning and memory [62], as well as in stress -induced anxiety [63], has been reported. [score:2]
It is also possible that other miRNAs sharing sequence similarities with miR-34 may compensate for miR-34 loss in the knock-out animals. [score:2]
However, when MEFs were co-transduced with oncogenic K-Ras and E1A, which binds to and inhibits the retinoblastoma protein (pRb) [42], we observed a slight increase in the number of foci formed in miR-34 [T KO/T KO] MEFs compared to wild-type cells (Figure 5A, 5B). [score:2]
MiR-34 expression in wild-type and p53 [−/−] mouse tissues. [score:2]
Although we detected a remarkable induction of miR-34a and miR-34c expression in late-passage wild-type MEFs compared to early-passage MEFs (Figure 3A), miR-34 -deficient MEFs became senescent with a kinetic identical to wild-type MEFs (Figure 3B). [score:2]
To exclude the possibility that tissue culture conditions may have masked a physiologic role of miR-34 in modulating the p53 response, we next examined the consequences of p53 activation in miR-34 -deficient tissues directly in vivo. [score:2]
Generation of miR-34 constitutive and conditional knockout mice. [score:2]
In particular, three highly related miRNAs—miR-34a, miR-34b, and miR-34c (Figure 1A)—are directly induced upon p53 activation in multiple cell types and have been proposed to modulate p53 function [13]– [20]. [score:2]
Age range of the cohorts is 359–521 days (mean: 464 days) for wild-type and 359–521 days (mean: 445 days) for miR-34 [T KO/T KO]. [score:1]
Although it will be important to follow a larger cohort of animals over a more prolonged period, these results suggest that miR-34 does not provide a potent barrier to tumorigenesis in response to genotoxic stress in vivo. [score:1]
Although as predicted, p53 -null cells failed to arrest in G1 in response to doxorubicin treatment, the response of miR-34 [T KO/T KO] MEFs was indistinguishable from that of wild-type cells (Figure 3H–3I). [score:1]
Thymocytes were isolated from sex-matched, age-matched wild-type, miR-34 [T KO/T KO], and p53 [−/−] mice and seeded at a density of 1×10 [6] cells/ml in MEF medium. [score:1]
For example, p53 has been proposed to modulate autophagy [55] and stem cell quiescence [56], [57] and we cannot exclude that miR-34 plays an important role in these contexts. [score:1]
1002797.g005 Figure 5Oncogene -induced transformation in miR-34 [T KO/T KO] fibroblasts and mice. [score:1]
Age- and sex-matched wild-type, miR-34 [T KO/T KO] and p53 [−/−] mice were exposed to 10 Gy of ionizing radiation and euthanized 6 hours later. [score:1]
The precursors of these miRNAs are transcribed from two distinct loci: the miR-34a locus on chromosome 1p36 and the miR-34b∼c locus on chromosome 11q23. [score:1]
P53 -dependent cell cycle arrest in miR-34 [T KO/T KO] MEFs. [score:1]
Both wild-type and miR-34 -deficient mice appeared healthy throughout the follow-up period (Figure S7), in striking contrast with the ∼15 weeks reported median tumor-free survival of irradiated p53 [−/−] mice [52]. [score:1]
The miR-34b∼c [+/−] mice were intercrossed to obtain miR-34b∼c [−/−] animals. [score:1]
To extend our analysis to an in vivo setting, we next examined whether miR-34 inactivation is sufficient to accelerate spontaneous and oncogene -induced transformation in mice. [score:1]
Furthermore, loss-of-function studies using miR-34 antagonists have provided some evidence that this miRNA family is required for p53 function [13], [18], [22]– [24]. [score:1]
The miR-34a< floxed> mice and the miR-34b∼c−/− mice are available to the research community through The Jackson Laboratory (JAX Stock Numbers 018545 and 018546). [score:1]
The incidence and latency of B cell lymphomas was virtually identical in Eμ-Myc;miR-34 [T KO/T KO] and Eμ-Myc;miR-34 [+/+] mice (Figure 5C) and the resulting tumors displayed similar histopathological features and extent of spontaneous apoptosis (Figure 5D–5E). [score:1]
As expected, p53 [−/−] thymocytes were almost entirely resistant to irradiation -induced apoptosis; however, wild-type and miR-34 -deficient cells were equally sensitive to DNA damage -induced apoptosis, as judged by dose-response and time-course experiments (Figure 4A, 4B). [score:1]
Representative pictures of miR-34a [−/−] (E), miR-34b∼c [−/−] (F), and miR-34 [T KO/T KO] (G) males at 4 weeks of age. [score:1]
Samples obtained from sex- and age-matched adult (age range 3–16 months) wild-type and miR-34 [T KO/T KO] mice were subjected to a standard panel of serum chemistry tests to determine liver and kidney function (n≥5 per genotype). [score:1]
More difficult, however, is to reconcile our findings with previous reports of impaired p53-function in cells treated with miR-34 antagonists. [score:1]
Figure S5Serum chemistry of age- and sex-matched wild-type and miR-34 -deficient mice. [score:1]
Wild-type, miR-34 [T KO/T KO], p53 [−/−] MEFs were seeded at 70% confluence and infected with virus. [score:1]
For the irradiation experiments, 150,000 wild-type, miR-34 [T KO/T KO] and p53 [−/−] MEFs were seeded into each well of a 6-well culture plate and starved for 72 hours. [score:1]
For the miR-34 [T KO] allele (G), double heterozygous mice were inter-crossed. [score:1]
We next sought to determine whether loss of miR-34 might accelerate tumor formation in response to genotoxic stress. [score:1]
Based on these results we conclude that miR-34 function is not required for p53 -induced cell-cycle arrest and apoptosis in response to genotoxic stresses. [score:1]
Age range of the cohorts is 298–425 days (mean: 333 days) for wild-type and 387–425 days (mean: 401 days) for miR-34 [T KO/T KO]. [score:1]
An additional issue raised by the results presented in this manuscript relates to possible p53-independent functions of miR-34. [score:1]
Future studies using the miR-34 -deficient animals we have generated will be needed to test these possibilities. [score:1]
These findings highlight likely redundancies among p53's downstream effectors, show that the miR-34 family is largely dispensable for p53 function in vivo, and suggest possible p53-independent functions. [score:1]
MiR-34a [−/−] and miR-34b∼c [−/−] single KO mice were viable and fertile and were obtained at the expected Men delian frequency (Figure 2E, 2F). [score:1]
The animals were monitored for at least 12 months (wild-type = 359 days; miR-34 [T KO/T KO] = 359 days) and up to 17.3 months (wild-type = 521 days; miR-34 [T KO/T KO] = 521 days). [score:1]
Wild-type and miR-34 [T KO/T KO] MEFs were seeded into a 6-well plate (40,000 cells/well) and counted every day for the growth curves. [score:1]
Here we report the generation of mice carrying targeted deletion of all three members of the miR-34 family and systematically investigate the impact of miR-34 loss on the p53 pathway. [score:1]
To examine the consequences of complete loss of miR-34 function, we crossed miR-34a [−/−] and miR-34b∼c [−/−] mice to generate compound mutant animals carrying homozygous deletion of all three family members (miR-34 [T KO/T KO]). [score:1]
One notable exception is a recent elegant paper by Choi and colleagues demonstrating that miR-34 -deficient MEFs are more susceptible to reprogramming [30]. [score:1]
To investigate the physiologic functions of the miR-34 family and to determine the extent to which its induction is required for p53 function, we generated mice carrying targeted deletion of both miR-34a and miR-34b∼c loci (Figure 2A–2C). [score:1]
The results presented in this paper do not necessarily conflict with previous experiments showing that ectopic expression of miR-34 can induce many of the most characteristic consequences of p53 activation; here we have tested whether miR-34 is necessary for p53 function and not whether it is sufficient. [score:1]
Epigenetic silencing of miR-34 members has also been reported in human cancers. [score:1]
We next examined the role of miR-34 in the response to the DNA damaging agent doxorubicin. [score:1]
Peripheral blood samples obtained from sex- and age-matched adult (age range 3–16 months) wild-type (WT) and miR-34 -null (T KO) mice were subjected to complete blood cell count (n≥5 per genotype). [score:1]
For BrdU cell cycle analysis, wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs were plated in complete medium at 70% confluence, treated with varying doses of doxorubicin for 16 hours or treated at different time points, and pulsed with 10 µM BrdU for one hour. [score:1]
Finally, we sought to determine whether genetic ablation of miR-34 could contribute to tumor formation in cooperation with a defined oncogenic lesion. [score:1]
Response to p53 activation in miR-34 [T KO/T KO] mouse embryonic fibroblasts (MEFs). [score:1]
In particular, members of the miR-449 family (miR-449a, b and c) have the same “seed” sequence as miR-34, and miR-34 antagonists could in principle impair their function as well. [score:1]
The experiments described above were performed on asynchronously growing early-passage MEFs and as such may not be sensitive enough to detect a modest effect of miR-34 loss on the S-phase checkpoint. [score:1]
Oncogene -induced transformation in miR-34 [T KO/T KO] fibroblasts and mice. [score:1]
This interpretation is also consistent with the faster proliferation rate displayed by miR-34 -deficient MEFs (Figure 3B, 3C) and with the observation by Lal and colleagues that miR-34a is involved in modulating the cellular response to growth factors [38]. [score:1]
RNAs from miR-34 [T KO/T KO] tissues were included to control for cross-hybridization. [score:1]
Five Eμ-Myc;miR-34 [+/+] tumors and and four Eμ-Myc;miR-34 [T KO/T KO] tumors were analyzed. [score:1]
The most logical interpretation of these results is that miR-34 -deficient MEFs, rather than being more resistant to irradiation -induced cell cycle arrest, possess a slightly faster basal proliferation or more rapid re-entry into the cell cycle following serum starvation. [score:1]
P53 -dependent apoptosis in miR-34 [T KO/T KO] cells and mice Having established that miR-34 is not required for cell cycle arrest in response to genotoxic stress in MEFs, we next sought to determine whether this miRNA family might contribute to p53 -induced apoptosis. [score:1]
Ionizing radiation induced similar activation of the p53 pathway and of its downstream effectors in wild-type and miR-34 [T KO/T KO] mice (Figure 4C). [score:1]
The standard 3T3 protocol was followed to determine the cumulative population doublings of wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs. [score:1]
To investigate the biological functions of miR-34, we first examined the expression of this family of miRNAs under basal conditions and in response to p53 activation in vivo. [score:1]
1002797.g003 Figure 3Response to p53 activation in miR-34 [T KO/T KO] mouse embryonic fibroblasts (MEFs). [score:1]
The sequence similarity between the three miR-34 family members (Figure 1A), which share the same “seed”, suggests that they may be functionally redundant. [score:1]
MiR-34 wild-type and miR-34 [T KO/T KO] MEF lines were also verified by qPCR. [score:1]
However, the consequences of miR-34 loss on p53 function were not examined in detail. [score:1]
Our observation that inactivation of miR-34 does not impair p53 -mediated responses in vitro and in vivo is particularly relevant because a key role for miR-34 in the p53 pathway had been previously proposed by a number of independent groups. [score:1]
Having established that miR-34 is not required for cell cycle arrest in response to genotoxic stress in MEFs, we next sought to determine whether this miRNA family might contribute to p53 -induced apoptosis. [score:1]
To generate mice carrying deletion of the miR-34b∼c bicistronic cluster, we used recombineering to replace a 1.3 kbp DNA region in BAC RP-23-281F13 containing pre-miR-34b and pre-miR-34c with a frt-Neo-frt cassette. [score:1]
Figure S4 Complete blood cell count of age- and sex-matched wild-type and miR-34 -deficient mice. [score:1]
The results are representatitve of two independent experiments performed on a total of four wild-type and four miR-34 [T KO/T KO] MEF lines. [score:1]
Experiments were performed on three independent wild-type and three independent miR-34 [T KO/T KO] MEF lines. [score:1]
Figure S7Overall survival of wild-type and miR-34 [T KO/T KO] cohorts. [score:1]
An analysis of the major myeloid and lymphoid populations of the bone marrow, spleen and thymus also did not reveal any statistically significant difference between wild-type and miR-34 [T KO/T KO] mice (Figure S6). [score:1]
Representative images of hematoxylin and eosin staining of heart, kidney, liver, lung, small intestine, ovary, testis, and spleen (black scale bar, 200 µm), brain (green scale bar, 2000 µm), and colon (red scale bar, 100 µm) from wild-type and miR-34 [T KO/T KO] mice. [score:1]
Analogous to what we observed in thymocytes in vitro, the apoptotic response was equally dramatic in wild-type and in miR-34 -deficient mice, while it was virtually absent in p53 [−/−] animals (Figure 4D–4G). [score:1]
Similarly, loss of 11q23, containing the miR-34b∼c locus, has been reported in prostate cancers [26]. [score:1]
P53 -dependent apoptosis in miR-34 [T KO/T KO] cells and mice. [score:1]
We therefore exposed a cohort of 14 miR-34 [T KO/T KO] and 11 wild-type mice to 1 Gy of ionizing radiation soon after birth and monitored them for 42–60 weeks. [score:1]
Notice the loss of signal for miR-449b in the miR-34 [T KO/T KO] lung and testis samples, which likely reflects cross-hybridization of the miR-449b probe to miR-34. [score:1]
Generation of miR-34 -deficient mice. [score:1]
miR-34 [T KO/T KO] embryos were obtained by intercrossing miR-34 mutant mice. [score:1]
We therefore examined the effects of DNA damage on thymocytes from wild-type, p53 [−/−], and miR-34 [T KO/T KO] mice. [score:1]
Figure S6Bone marrow, spleen and thymus analysis of age- and sex-matched wild-type and miR-34 [T KO/T KO] mice. [score:1]
A conclusive test for this hypothesis will require the generation of compound miR-34 and miR-449 mutant animals, but several lines of evidence suggest that this explanation is not particularly likely. [score:1]
A full histological examination (Figure S3), complete blood cell count (Figure S4), and serum chemistry analysis (Figure S5) did not detect any statistically significant defects in adult miR-34 [T KO/T KO] mice of both sexes. [score:1]
Promoter hyper-methylation of miR-34a is observed in non-small-cell lung cancers and melanomas [27], [28], and silencing of miR-34a and miR-34b∼c has been described in human epithelial ovarian cancers [29]. [score:1]
[1 to 20 of 135 sentences]
5
[+] score: 258
More importantly, other potential miR-34 target genes were inhibited in addition to Bcl-2. As shown in Figure 4, Notch1 and HMGA2 were inhibited by all three miR-34a, b, c mimics, while miR-34b mimic inhibited Notch2 and 4, and miR-34c mimic inhibited Notch1-4. Notch1-2 knockdown by miR-34 mimics has been confirmed by Western blot (data not shown). [score:12]
As shown in Figure 3, revealed that transfection of miR-34 mimics downregulated target gene Bcl-2 expression at the protein level, but had no obvious effect on Bcl-xL and Mcl-1 expression, indicating that the Bcl-2 knockdown by miR-34 mimics was sequence-specific. [score:11]
Figure 4 Quantitative real-time PCR shows that restoration of miR-34 by downregulates target gene expression. [score:8]
Figure 3 Restoration of miR-34 by downregulates target gene Bcl-2 expression. [score:8]
This strategy was explored in the current study, where p53 downstream target miR-34 was restored in p53-mutant gastric cancer Kato III cells with a high level of Bcl-2 and low levels of miR-34, resulting in downregulation of Bcl-2 and Notch/HMGA2, tumor cell growth inhibition and accumulation in G1 phase, and chemosensitization and Caspase-3 activation/apoptosis. [score:8]
Bcl-2 is a direct target of miR-34, and our data have shown that miR-34 restoration inhibits Bcl-2 expression. [score:8]
The expression of miR-34 is dramatically reduced in 6 of 14 (43%) non-small cell lung cancers (NSCLC) and the restoration of miR-34 expression inhibits growth of NSCLC cells [10]. [score:7]
As a target of miR-34, Bax was also downregulated by miR-34. [score:6]
He et al. reported that ectopic expression of miR-34 induces cell cycle arrest in both primary and tumor-derived cell lines, which is consistent with the observed ability of miR-34 to downregulate a program of genes promoting cell cycle progression [12]. [score:6]
The mechanism of miR-34 -mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. [score:6]
The mechanism of miR-34 -mediated suppression of self-renewal might be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. [score:6]
The mechanism of miR-34 -mediated suppression of gastric cancer cell self-renewal might be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, implying that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. [score:6]
Since miR-34 is a downstream target of the p53 pathway and Bcl-2 is a direct target of miR-34, our data with Kato III are consistent with the cells' p53-mutant status, i. e., Kato III has mutant p53, the lowest level of miR-34, and the highest level of Bcl-2. Therefore, we focused on this cell line for the current study of the effect of miR-34 restoration. [score:6]
MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. [score:6]
Expression of miR-34 and target genes in human gastric cancer cell lines. [score:5]
This multi-mode action of miR-34 provides a therapeutic advantage over other molecular therapies, in that miR-34 has multiple targets and can work on multiple cell signalling pathways simultaneously, leading to synergistic effects that may translate into improved clinical efficacy for gastric cancer patients with p53 deficiency and multidrug resistance. [score:5]
Recently, miRNA miR-34 was identified as a p53 target and a potential tumor suppressor [4, 8- 12]. [score:5]
More significantly, miR-34 potently inhibits tumorsphere formation and growth in p53-mutant human gastric cancer cells, providing the first proof-of-concept that there is a potential link between the tumor suppressor miR-34 and gastric cancer cell self-renewal, which involves the presumed gastric cancer stem cells. [score:5]
We next examined these gastric cancer cell lines for the expression level of miR-34 and target genes using qRT-PCR. [score:5]
As shown in Figure 5, the transfected miR-34 mimics effectively inhibited luciferase reporter gene expression, which is controlled by Bcl-2 3'UTR in the promoter region. [score:5]
Quantitative real-time PCR was performed to determine the expression levels of potential miR-34 target genes. [score:5]
Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. [score:5]
In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. [score:5]
Bommer et al. reported that the abundance of the three-member miRNA34 family is directly regulated by p53 in cell lines and tissues, and the Bcl-2 protein is regulated directly by miR-34 [10]. [score:5]
Our results demonstrate that in p53 -deficient human gastric cancer cells, restoration of functional microRNA miR-34 inhibits cell growth, induces apoptosis, and leads to chemosensitization, indicating that miR-34 may restore, at least in part, the p53 tumor-suppressing function. [score:5]
The results demonstrate that the transfected miR-34a, b, c are functional, and confirm that Bcl-2 is a direct target of miR-34, consistent with earlier reports [8, 10, 16]. [score:4]
Delineating the role of miR-34 in regulation of cell growth and tumor progression, as well as its potential relationship to cancer stem cells, will help us better understand the p53 tumor suppressor signalling network, facilitate our research in carcinogenesis and cancer therapy, and serve as a basis for our exploration of novel strategies in cancer diagnosis, treatment, and prevention. [score:4]
miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. [score:3]
miR-34 restoration chemosensitizes gastric cancer cells with a high level of Bcl-2. miR-34 restoration inhibits gastric cancer cell growth. [score:3]
Another important implication from the current study is that our data provide a potential link between tumor suppressor miR-34 and the presumed gastric cancer stem cells. [score:3]
Fold increase was calculated by dividing the normalized target gene expression of the treated sample with that of the untreated control, with the value from the NC mimic set as 1. For cell cycle analysis by flow cytometry, Kato III cells were transfected with miR-34 mimics or NC mimic in 6-well plates, trypsinized 24 hours later and washed with phosphate-buffered saline, and fixed in 70% ethanol on ice. [score:3]
However, our data indicate that miR-34 restoration inhibits tumorspheres from p53-mutant gastric cancer cells, suggesting that miR-34 might be involved in the self-renewal of the presumed gastric cancer stem cells. [score:3]
Our study suggests that restoration of the tumor-suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer. [score:3]
Since part of the p53 tumor-suppressing function is via promoting apoptosis [19, 20], we next examined the effect of miR-34 restoration on apoptosis. [score:3]
Our data provide the first evidence that miR-34 is able to inhibit tumorsphere formation and growth in p53-mutant gastric cancer cells, implying that miR-34 might play a role in the self-renewal of gastric cancer cells, presumably gastric cancer stem cells. [score:3]
of the potential miR-34 target protein Bcl-2 48 hours after of Kato III cells (100 pmol per well in 6-well plates). [score:3]
Taken together, these published studies establish that miR-34 is a new tumor suppressor functioning downstream of the p53 pathway, and provide impetus to explore the functional restoration of miR-34 as a novel therapy for cancers lacking p53 signalling. [score:3]
Our results demonstrate that in p53 -deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. [score:3]
Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer. [score:3]
Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. [score:3]
Figure 9 Restoration of miR-34 by MIF lentiviral system inhibits Kato III tumorspheres. [score:3]
miR-34 restoration inhibits gastric cancer tumorspheres. [score:3]
miR-34 restoration could thus rebuild, at least in part, the p53 tumor-suppressing signalling network in gastric cancer cells lacking p53 function. [score:3]
It has been reported that miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells [10, 12, 14]. [score:3]
miR-34 restoration inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. [score:3]
Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. [score:3]
Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. [score:3]
However, mutation in the Bcl-2 3'UTR complimentary to the miR-34 root sequence abolished this effect, indicating that the observed reporter activity is miR-34 sequence-specific. [score:2]
Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. [score:2]
As shown in Figure 9, restoration of miR-34 by MIF lentiviral system inhibited Kato III tumorsphere formation and growth; the stable cells with functional miR-34a restoration had significantly fewer tumorspheres, and the formed tumorspheres were significantly smaller, as compared with that of the MIF control (P < 0.001, Student's t-test, n = 3). [score:2]
The role of miR-34 in gastric cancer has not been reported previously. [score:1]
and using human primary gastric cancer tissues to identify the true side population of the assumed gastric cancer stem cells, and to delineate the role of miR-34 in these tumor-initiating cells. [score:1]
Cells in each well were also co -transfected with 100 pmol of each miR-34 mimics or NC mimic as indicated, using Lipofectamine 2000. [score:1]
This effect on cell cycle is similar to that of p53 restoration as we previously reported [18- 23], indicating that miR-34 restoration can restore p53 signalling, at least in part, in the cells lacking a functional p53 pathway. [score:1]
miR-34 mimic transfection. [score:1]
A. of Kato III cells after miR-34 restoration. [score:1]
As shown in Figure 6A, the miR-34 mimics induced an accumulation of Kato III cells in G1 phase and a reduction of cells in S phase, consistent with other reports on miR-34 restoration in various tumor mo dels [4, 8, 10, 12, 13, 16, 17]. [score:1]
Transfection of miR-34 mimics in p53-mutant gastric cancer cells. [score:1]
miR-34 restoration results in Kato III cell accumulation in G1 phase and caspase-3 activation. [score:1]
For miR-34 restoration, we transfected the Kato III cells with miR-34 mimics. [score:1]
Figure 6 Restoration of miR-34 in Kato III cells resulted in G1 block and caspase-3 activation. [score:1]
Since no cellular markers for gastric cancer stem cells have been wi dely accepted thus far, in the current study we employed tumorsphere culture to explore whether there is any link between miR-34 and tumorsphere-forming cells. [score:1]
In the current study, we examined the effects of functional restoration of miR-34 by miR-34 mimics and lentiviral miR-34a on human gastric cancer cells, and the effect of miR-34 on tumorsphere formation and growth of p53-mutant gastric cancer cells. [score:1]
was performed 24 hours after transfected with miR-34 mimics or negative control mimic (NC mimic). [score:1]
KATO3 cells were transfected with Bcl-2 3'UTR luciferase reporter plasmid or its mutant, plus the control β-galactosidase plasmid and 100 pmol of each miR-34 mimic or NC mimic. [score:1]
miRNA miR-34a, b, c mimics, antagonists, and negative control miRNA mimic (NC mimic) were obtained from Dharmacon (Chicago, IL) with the sequences for hsa-miR-34a: 5'- uggcagugucuuagcugguugu-3' ; hsa-miR-34b: 5'- caaucacuaacuccacugccau-3' ; hsa-miR-34c: 5'- aggcaguguaguuagcugauugc-3'. [score:1]
Cells in each well were also co -transfected with 100 pmol of each miR-34 mimic or NC mimic as indicated, using Lipofectamine 2000. [score:1]
Figure 8 Restoration of miR-34 in Kato III cells delays cell growth. [score:1]
Our data suggest that miR-34 may hold significant promise as a novel molecular therapy for human gastric cancer, potentially for gastric cancer stem cells. [score:1]
Briefly, Kato III cells were transfected with miR-34 mimics or NC mimic for 24 h, plated in 96-well plates (5,000 cells/well), and treated with serially diluted chemotherapeutic agents in triplicate. [score:1]
As shown in Figure 6B, transient transfection of miR-34 mimics resulted in significantly increased caspase-3 activation, a key indication of the cells undergoing apoptosis. [score:1]
Our data demonstrate that miR-34 restoration can chemosensitize those gastric cancer cells that have high levels of Bcl-2 and low basal levels of miR-34, which are dependent on Bcl-2 for survival and drug resistance. [score:1]
However, for gastric cancer MKN-45 cells that have a low level of Bcl-2 and a high level of miR-34, miR-34 restoration showed no chemosensitization (Figure 7B). [score:1]
To evaluate the long-term effects of miR-34 restoration, we have employed a lentiviral system to express miR-34a and have generated stable cells. [score:1]
Thus far, there is limited study on miRNA and gastric cancer; the link between p53 downstream target miR-34 and gastric cancer has not been established; and the role of miR-34 in gastric cancer remains to be investigated. [score:1]
[1 to 20 of 75 sentences]
6
[+] score: 247
Other miRNAs from this paper: hsa-mir-21, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-34a, hsa-mir-34c
The fact that miR-34 family is up-regulated in human cancer and its up-regulation is associated with poor prognosis, seems to be conflicted with tumor suppressive role of miR-34 demonstrated in previous reports. [score:9]
In addition, the association between miR-34 expression and TP53 mutation, global gene expression was examined to clarify possible mechanisms of miR-34 regulation. [score:7]
The average expression of miR-34b and miR-34c was used to analyze the association of miR-34b/c expression and global mRNA expression. [score:7]
Additionally, TP53 mRNA expression was not associated with miR-34a (R = 0.005, p = 0.97) or miR-34b/c (R = 0.013, p = 0.92) expression based on microarray expression values of TP53 (S1 Table). [score:7]
Considering the tumor suppressive function of miR-34 as shown previously, we had expected that miR-34 family was suppressed in human colon cancer and decreased expression was associated with poor prognosis when we started the present study. [score:7]
Although it has been well known that miR-34 was direct target of p53, a recent study demonstrated that mouse mo dels that contain deletions for miR-34a, miR-34b and miR-34c still retain p53 function and the expression of these microRNAs is largely independent of p53 status [38]. [score:6]
In addition, Wang et al. demonstrated that the miR-34a expression was higher in rectal cancer having more advanced TNM stage [28], and Svoboda et al. demonstrated that miR-34b up-regulation was associated with poor prognosis in triple -negative (ER-, PgR-, HER2-) breast cancer patients [34]. [score:6]
3) The expression of miR-34 family was not associated with TP53 mutational status although pathway analysis showed association between miR-34 expression and TP53 transcriptional activity. [score:6]
Ingenuity Pathway Analysis (IPA) predicts transcription regulators that potentially associated with miR-34 up-regulation. [score:5]
One possible explanation of our findings is that miR-34 up-regulation in stromal tissues might reflect inflammation of tumor tissues, as it is well known that inflammation contributes to the development of cancer, including colon cancer [35]. [score:5]
Hence, miR-34b/c expression detected in macro-dissected tumor samples (as shown in Fig 1) seems to mainly represent stromal expression of miR-34b/c. [score:5]
On the basis of these findings, we analyzed epithelial and stromal expression of miR-34 separately using laser microdissection technique to examine if cancer cells express miR-34. [score:5]
To examine where the miR-34 family is expressed in, we extracted RNA from cancer epithelium, cancer stroma, normal adjacent epithelium and normal adjacent stroma separately using laser microdissection for miR-34 expression analysis (S3 Fig). [score:5]
S2 Fig Kaplan-Meier survival analysis of all stage cases in the American cohort (A) and Chinese cohort (B) stratified by median miR-34a expression and combined miR-34b/c expression. [score:5]
Several converging evidence demonstrated that ectopic expression of miR-34 family induces apoptosis, senescence, cell cycle arrest and inhibits migration and invasion [9, 13]. [score:5]
Expression of miR-34 is lost in colon cancer which can be re-expressed by a novel agent CDF. [score:5]
We further examined the publicly available microarray dataset (GSE35602), in which miRNA expression profiles of micro-dissected colon cancer stromal and epithelial tissues were analyzed, demonstrating a clear trend of higher miR-34b and -34c expression in cancer stroma (S4 Fig). [score:5]
Considering the fact that miR-34 was expressed in stromal tissues predominantly, miR-34 detected in macro-dissected cancer tissues seems to be mainly regulated by cancer stromal tissues harboring wild-type p53. [score:4]
List of Transcription Regulators that are potentially involved with miR-34b/c expression predicted by Ingenuity Pathway Analysis in 56 tumors. [score:4]
List of Transcription Regulators that are potentially involved with miR-34b/c expression predicted by Ingenuity Pathway Analysis in 56 colon tumors. [score:4]
To address this, we examined whether miR-34 expression was associated with TP53 mutational status. [score:4]
That may be a plausible explanation that the expression of miR-34 family was not associated with TP53 mutational status of cancer. [score:4]
As shown in Fig 3, the expression of miR-34 family was not associated with TP53 mutational status. [score:4]
Although previous reports have demonstrated that down-regulation of miR-34 family members was associated with poor prognosis in several types of malignancies [17– 20], the prognostic value of miR-34 family in colon cancer has not been systematically studied. [score:4]
The association between miR-34 expression and TP53 mutation. [score:4]
However, the reason for the up-regulation of miR-34 in stromal tissue is still unclear. [score:4]
Contrary to our expectations, the expression of miR-34 family was not associated with TP53 mutational status in either the American and Chinese cohorts (Fig 3A and 3B). [score:4]
TP53 mutation is not associated with the expression of miR-34 family. [score:4]
Since miR-34a, miR-34b, and miR-34c were each systematically altered in colon tumors, we next attempted to determine possible reasons for this altered expression. [score:3]
There was no significant association between miR-34a expression and TNM staging (Fig 2A and 2B left panels), while increased miR-34b and -34c were associated with higher TNM staging in both cohorts (test for trend, P<0.05; Fig 2A middle and right panels, P<0.01; Fig 2B middle and right panels). [score:3]
Thus, we used combined miR-34b/c expression into the following survival analysis. [score:3]
2) Increased expression of miR-34b/c was observed in more advanced tumors and associated with poor prognosis. [score:3]
In addition, the expression levels of miR-34 seemed to be the highest in cancer stromal tissues. [score:3]
Correlation analysis between Affymetrix microarray data and miR-34 family expression in 56 colon tumors. [score:3]
There was no significant correlation between tumor/stroma ratio and expression levels of miR-34 (S5 Fig). [score:3]
Increased expression of miR-34b/c was associated with active transcriptional activity of TP53, SMAD3, CBL, SNAI1, HTT, TWIST1 and CTNNB1 while it was associated with reduced transcriptional activity of MYCN, AHR, SMAD7, MYC, SPDEF and PPARG (Table 2, S2 Table). [score:3]
The finding may demonstrate one more possibility that different level of miR-34 expression could be significant for miR-34 -mediated interaction between human colon cancer and stroma. [score:3]
In agreement with this, the expression of miR-34b and -34c were highly correlated in both tumors and non-tumor tissues from each cohort (Pearson’s correlation r>0.9, P<0.0001; S1A and S1B Fig). [score:3]
These findings suggest that colon cancer stroma is mainly responsible for increased miR-34b/c expression, which were associated with advanced TNM stage and poor prognosis. [score:3]
This microarray data are consistent with our own qRT-PCR analysis using LMD samples, indicating that miR-34b and -34c are expressed at higher levels in stomal tissues. [score:3]
Correlation between miR-34 expression and survival. [score:3]
Ingenuity Pathway Analysis (IPA 8.0, Redwood city, CA) was performed to identify molecules and pathways potentially involved with the expression of miR-34 family. [score:3]
In colorectal cancer, prior studies have focused on a tumor suppressive function for miR-34 family as shown in many kinds of malignancy [9]. [score:3]
The high expression of miR-34b/c is associated with advanced colon tumor and poor prognosis. [score:3]
The comparison of miR-34 expression between colon epithelium and stroma with laser microdissection (LMD) technique. [score:3]
Correlation analysis of miR-34b/c expression in tumor and non-tumor tissue was performed. [score:3]
As a matter of fact, the present data is consistent with several recent reports analyzing miR-34 expression and its prognostic value. [score:3]
To our knowledge, this is the largest and systematic study analyzing miR-34 expression in human colon cancer. [score:3]
miR-34 family tends to be expressed predominantly in stromal tissue. [score:3]
On the other hand, colon cancer patients with high expression of both miR-34b and -34c in tumor showed significant poor prognosis (log-rank P<0.05; Fig 2C right panel). [score:3]
S1 Fig Correlation analysis of miR-34b/c expression in tumor and non-tumor tissue was performed. [score:3]
The expression of miR-34b and -34c strictly parallels. [score:3]
Therefore, miR-34 family is thought to be important mediator of p53’s tumor-suppressive activities. [score:3]
MiR-34b and miR-34c are co-transcribed from a bicistronic transcript and their expression should be highly correlated [9]. [score:3]
Besides, the miR-34a and miR-34b/c genes display varying levels of DNA methylation in numerous types of tumors including colorectal cancer, and may therefore represent tumor suppressor genes [14– 16]. [score:3]
The miR-34 family is largely considered to be a tumor suppressor miRNA [9]. [score:2]
4) The expression of miR-34b and -34c were increased significantly in stromal tissues compared with epitheliums. [score:2]
Taken together, the fact that miR-34b/c was increased in cancer stromal tissues, especially in more advanced colon cancer, might be associated with inflammation contributing to cancer progression. [score:1]
These findings based on LMD analyses suggest that stromal cells serve the major source of miR-34b/c rather than epithelial cells. [score:1]
*Cases with low miR-34b and/or low miR-34c. [score:1]
To evaluate the issue, we set out to systematically study the expression of the miR-34 family in two large, independent cohorts of colon cancer patients. [score:1]
The miR-34 family does not associated with increased stromal area. [score:1]
Further analysis is needed to clarify the function and miR-34 -mediated interaction between human colon cancer and stroma. [score:1]
In addition, we have performed H&E on 82 of the tissues from the American cohort to examine if there was an association with increased stromal area and any of the miR-34 family. [score:1]
This family consists of three members: miR-34a, generated from a transcriptional unit on the human chromosome 1p36, and miR-34b and miR-34c, which are generated by processing of a bicistronic transcript from chromosome 11q23. [score:1]
MiR-34b and -34c expression levels in stroma were significantly higher as compared with that of epithelium in both cancer tissues and in normal adjacent tissues (Fig 4 middle and right panels). [score:1]
In order to investigate potential reasons for the altered expression of the miR-34 family, we used Affymetrix microarray data to identify genes that correlated with miR-34a and -34b/c and examined these genes with Ingenuity Pathway Analysis (IPA). [score:1]
Several studies indicate that p53 can bind to the promoter and activate the transcription of miR-34 family [10– 12]. [score:1]
In multivariate analysis, miR-34b/c was not significantly associated with survival when adjusted for TNM staging (data not shown). [score:1]
MiR-34a, -34b and -34c are increased in colon cancer, and increased miR-34b/c is associated with advanced tumors and poor prognosis. [score:1]
We performed TaqMan qRT-PCR of miR-34a, miR-34b and miR-34c in colon tumors and adjacent non-tumor tissues from both the American and the Chinese cohorts. [score:1]
Dot plots represent miR-34b/c threshold cycle values from TaqMan qRT-PCR normalized to U66. [score:1]
In conclusion, we showed novel aspects of miR-34 family in human colon cancer. [score:1]
The demonstrated findings imply that increased miR-34 in stromal tissues may have important roles in colon cancer progression. [score:1]
**Cases with both high miR-34b and high miR-34c. [score:1]
[1 to 20 of 75 sentences]
7
[+] score: 228
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
Interestingly, miR-34b overexpression also caused a significant downregulation of IGF1 expression, at RNA and protein levels, in MDA-PCa-2b but not DU-145 cells (Figure 4A and 4B). [score:8]
Expression profiling of 84 genes showed that several genes were downregulated upon miR-34b overexpression in MDA-PCa-2b cells when compared to DU-145 transfected cells (Figure 3). [score:7]
Prediction based on TargetScan, miRwalk, RNA22 and miRanda analysis suggested that AR, BcL2, ETV1 and PDPK1 genes could be direct targets for miR-34b since it has a seed region able to bind to the 3’-UTR of these genes. [score:6]
It is well-known that miRNAs play a central role in the regulation of gene expression and miR-34b has been reported to be a tumor suppressor in many types of cancers [18, 21]. [score:6]
B. down-regulated genes in MDA-PCa-2b upon miR-34b overexpression with potential miR-34b binding sites. [score:6]
C. miR-34b binding sites in AR and ETV1 3′-UTR mediate the down-regulation of AR and ETV1 protein expression by miR-34b. [score:6]
From the genes downregulated in MDA-PCa-2b upon miR-34b transfection, we used miRwalk, TargetScan, miRanda and RNA22 to predict potential miR-34b binding sites and selected AR, BcL2, ETV1, NRIP1, PDPK1, PPP2R1B, SCAF11 and SFRP1 genes for further studies (Figure 3B). [score:6]
We performed lentiviral vector -mediated expression of miR-34b in MDA-PCa-2b and DU-145 cells and subsequently we performed real-time PCR to validated differently expressed genes identified by. [score:5]
Also, luciferase reporter assay showed a significantly lower level of luciferase activity in miR-34b stably expressed HeLa cells when cells were transfected with the miR-34b binding site containing vectors, indicating a direct interaction between miR-34b and AR or ETV1 expression (Figure 4C). [score:5]
In the current study, we demonstrate that low miR-34b expression is responsible for aberrant expression of AR associated with prostate cancer progression and aggressiveness, especially among African-American men. [score:5]
Although DU-145 cells, which express high levels of miR-34b, do not express AR, we examined the relationship between AR and miR-34b levels in Caucasian and African-American FFPE samples by IHC to determine whether our findings have clinical relevance. [score:5]
Real-time PCR confirmed that 4 genes (AR, BcL2, ETV1 and PDPK1) with miR-34b binding site were downregulated in MDA-PCA-2b cells transfected with miR-34b mimic (Figure 4A). [score:4]
Luciferase assay results clearly indicate that miR-34b regulates AR and ETV1 by direct binding to 3’-UTR of mRNA leading to translational repression (Figure 4C). [score:4]
AR and ETV1 expression are regulated by miR-34b. [score:4]
Promoter regions of mir-34a and mir-34b/c contain a match to the canonical p53 binding site and are direct p53 targets, which induce apoptosis, cell cycle arrest and senescence [16, 17]. [score:4]
Moreover, our study found low expression of miR-34b in African-American tissue samples compared to Caucasians, and its expression was inversely correlated with AR staining (Figure 1 and 5). [score:4]
showed that AR and ETV1 were significantly downregulated in miR-34b-3p MDA-PCa-2b transfected cells. [score:4]
Interesting, MDA-PCa-2b cells transfected with miR-34b-3p did not show on increase in p21 [Cip1], p27 [Kip1] expression, suggesting that regulation of the cell cycle in these cells lines occurs by another mechanism (Figure 2F). [score:4]
Based on our Western blot results, DU-145 cells transfected with miR-34b-3p showed high expression of p21 [Cip1], p27 [Kip1], both involved in the regulation of cell cycle G1 arrest (Figure 2D). [score:4]
Pathway analysis for down-regulated genes in MDA-PCA-2b cells transfected with miR-34b-3p mimic. [score:4]
D. Inverse correlation between the expression of AR protein analyzed by IHC and miR-34b analyzed by qPCR. [score:3]
To determine the role played by miR-34b in differences between African-Americans and Caucasians, miR-34b was overexpressed in MDA-PCa-2b and DU-145 cells. [score:3]
In order to induce miR-34b-3p expression, cells were transfected with a mirVana miR-34b-3p Mimics (Thermo Fisher Scientific) using Lipofectamine RNAi Max (Thermo Fisher Scientific). [score:3]
These indicate that our clinical data demonstrate that miR-34b correlates with AR expression and are associated with aggressiveness of prostate cancer in African-American males. [score:3]
We confirmed increased miR-34b expression by qRT-PCR after transfection of miR-34b-3p mimic (Figure 1D, 1F). [score:3]
Our showed that AR was significantly downregulated in MDA-PCA-2b cells transfected with miR-34b compared with control. [score:3]
The expression of miR-34b and miR-34c is low across all prostate cancers, due to allelic deletions and/or the loss of heterozygosity that frequently occurs at 11q23 [22]. [score:3]
After overexpression of miR-34b-3p, the fraction of cells undergoing apoptosis was quantified by using Annexin V/7AAD staining. [score:3]
We also observed inverse correlation of miR-34b and AR expression in our African-American tissue samples, suggesting that our clinical data demonstrate that miR-34b and AR are associated with aggressiveness of African-American prostate cancer (Figure 5C). [score:3]
Gene expression changes in MDA-PCa-2b and DU-145 cells transfected with miR-34b-3p mimic was analyzed using RT2 Profiler PCR Array. [score:3]
miR-34b is a well-described tumor suppressor in a number of malignancies including colorectal, pancreatic, mammary, ovarian, urothelial, renal cell carcinomas and soft tissue sarcomas [18]. [score:3]
To investigate if miR-34b expression could potentially be associated with biological differences between African-American and Caucasian prostate cancer, tumors samples were collected from 81 African-American and 62 Caucasian patients with localized disease. [score:3]
We then treated MDA-PCa-2b and DU-145 cell lines with 5-AZA-CdR and found no change in the expression of miR-34b in DU-145 or MDA-PCa-2b cells (Supplemental Figure 1B). [score:3]
PCR array analysis was performed to determine the molecular effects of miR-34b overexpression in MDA-PCa-2b and DU-145 cells. [score:3]
miR-34b expression in prostate cancer patients and cell viability in prostate cancer cell lines. [score:3]
Of the 84 genes represented in the Human Prostate Cancer RT [2] Profiler PCR Array PAHS-135Z (Qiagen), heat map shows the expression levels of genes in MDA-PCA-2b or DU-145 cells after transfection with miR-34b-3p mimic (Figure 3A). [score:3]
A. qPCR analysis for miR-34b-3p expression in Caucasians (CaA, n=62) and African-Americans (AfA, n=81) normalized by RNU48 (p<0.03). [score:3]
Figure 1 A. qPCR analysis for miR-34b-3p expression in Caucasians (CaA, n=62) and African-Americans (AfA, n=81) normalized by RNU48 (p<0.03). [score:3]
was performed to determine the molecular effects of miR-34b overexpression in MDA-PCa-2b and DU-145 cells. [score:3]
Although IGF1 is not predicted to have a miR-34b binding site, IGF1 is closely related to the AR pathway and is one of the pathways that were significantly altered upon miR-34b overexpression in our pathway analysis (Table 1). [score:3]
Interestingly, level of AR in African-American samples inversely correlates with miR-34b expression (Figure 5C). [score:3]
In order to identify pathways and genes relevant to racial disparity, gene expression profiling analysis was performed using a prostate cancer pathway-focused PCR array with miR-34b transfected DU-145 and MDA-PCa-2b cells. [score:3]
In order to mimic the tissue sample results and help us identify mechanisms related to racial disparity, we selected two cell lines, DU-145 and MDA-PCa-2b, which express different levels of miR-34b. [score:3]
Effects of miR-34b overexpression on cell cycle and apoptosis of MDA-PCa-2b and DU-145 cells. [score:3]
Cells were infected with lentivirus containing either miR-34b-3p or empty in pmiR-lenti plasmid (Abm) to generate stable miR-34b-3p expression clones after growing with puromycin containing media (5μg/ml) for two weeks. [score:3]
miR-34b overexpression decreases the cell viability of an African-American cell line more than Caucasian cell line. [score:3]
C. qPCR analysis for miR-34b-3p expression in DU-145 and MDA-PCa-2b cell lines. [score:3]
The cell cycle profile of MDA-PCa-2b and DU-145 cell lines overexpressed with miR-34b-3p showed an increase in the G1 phase (MDA-PCa-2b, NC 54.4% compared to miR-34b-3p transfected cells 74.7); (DU-145, NC 72.9% vs miR-34b-3p transfected cells 82.8%) suggesting that miR-34b-3p can induce G1 arrest in these cells lines (Figure 2C and 2E). [score:2]
Since MDA-PCa-2b cells have miR-34b-3p deletion, this may be a factor causing the difference in cell cycle regulation. [score:2]
In this study, we provide novel insight into the role and regulation of miR-34b in African-American and Caucasian prostate cancer. [score:2]
miR-34b target genes and luciferase reporter assay. [score:2]
Also, miR-34b can be epigenetically regulated through promoter hypermethylation in some prostate cancer cell lines and human tumor specimens. [score:2]
Clinicopathologic information is summarized in Supplemental Table 1. Expression analysis of miR-34b by qRT-PCR revealed that this miRNA was significantly correlated with race using Fisher's exact test (p=0.03) in African-American samples compared to Caucasian samples (Figure 1A). [score:2]
We report that miR-34b expression is lower in African-American prostate tumor samples compared to Caucasians. [score:2]
The African-American cell line, MDA-PCa-2b, expresses significantly lower amounts of miR-34b-3p compared to Caucasian cell line, DU-145 (Figure 1C). [score:2]
In summary, we have demonstrated that miR-34b expression is lower in African-American compared to Caucasian tissue samples and is inversely correlated with high AR level leading to cell proliferation and cancer progression. [score:2]
We also found that miR-34b directly controls transcription of AR and ETV1 leading to cell death. [score:2]
Also, analysis from Taylor data indicated that prostate tumor samples express lower level of miR-34b compared to normal samples (Figure 1B). [score:2]
Lower expression of miR-34b in an African-American prostate cancer cell line and tissue samples compared to Caucasians. [score:2]
miR-34 mimic (MRX34) has become the first microRNA to reach phase 1 clinical trials for hepatocellular carcinoma and chronic lymphocytic leukemia [34– 37]. [score:1]
These data showed that miR-34b was deleted in 3.4% of prostate adenocarcinoma patients (5/149) from the Nelson Lab at the Fred Hutchinson Cancer Research Center, 1.5% (5/332) of prostate adenocarcinomas from the TCGA database and 0.7% (1/150) of metastatic prostate cancers from a published article [20]. [score:1]
We found miR-34b chromosomal loss in MDA-PCa-2b but not in DU-145 cells (Supplemental Figure 2). [score:1]
B. analysis of miR-34b levels on normal (N) and prostate tumor samples (T) from Taylor data. [score:1]
Interestingly, the decrease in cell viability by miR-34b-3p mimic was more significant in MDA-PCa-2b (p=0.003) than DU-145 (p=0.03), suggesting that miR-34b has a more potent effect on the African-American cell line (Figure 1E, 1G). [score:1]
miR-34b belongs to the miR-34 family of miRNAs: miR-34a, miR-34b, and miR-34c. [score:1]
D and F. MDA-PCa-2b cells or DU-145, respectively, were transfected with miR-34b-3p mimic for 72h and miR-34b-3p expression was evaluated by Taqman analysis. [score:1]
Further analysis in additional tumor samples is necessary to fully elucidate the deletion of miR-34b in African-American patients. [score:1]
This phase 1 clinical trial represents an important step forward not only for miR-34 but is valuable proof of principle for the rationale of using miRNAs as anticancer drugs [37]. [score:1]
Figure 2MDA-PCa- 2b and DU-145 cells were transfected with miR-34b mimic or negative control. [score:1]
Level of AR inversely correlates with miR-34b. [score:1]
A. qPCR analysis of AR, BCL2, ETV1, PDPK1 and IGF1 from MDA-PCa-2b or DU-145 cells transfected with miR-34b-3p mimic. [score:1]
We then sequenced the promoter region of miR-34b-3p and found a chromosomal deletion in miR-34b in MDA-PCA-2b cells but not in DU-145 cells (Supplemental Figure 2). [score:1]
miR-34b and miR-34c share a primary transcript on chromosome 11q23, whereas miR-34a is located at 1p36 and is encoded in its own transcript [15]. [score:1]
To determine whether our findings have clinical relevance, we examined the relationship between AR with miR-34b levels in the Caucasian and African-American FFPE samples by IHC. [score:1]
We concluded that miR-34b and AR play a pivotal role in the treatment of aggressive African-American prostate cancers. [score:1]
MDA-PCa- 2b and DU-145 cells were transfected with miR-34b mimic or negative control. [score:1]
Figure 4 A. qPCR analysis of AR, BCL2, ETV1, PDPK1 and IGF1 from MDA-PCa-2b or DU-145 cells transfected with miR-34b-3p mimic. [score:1]
cDNA was synthesized from MDA-PCa-2b and DU-145 cells transfected with miR-34b-3p mimic using RT [2] First Strand Kit (Qiagen) following the manufacturer's instructions. [score:1]
Cells were transfected with miR-34b-3p mimic or negative control and harvested at different time points. [score:1]
We analyzed the relationship of miR-34b-3p chromosomal abnormality with the cBioPortal web tool for exome analysis data. [score:1]
Chromosomal deletion in miR-34b in MDA-PCA-2b cell line. [score:1]
[1 to 20 of 81 sentences]
8
[+] score: 224
DKK1, whose expression is down-regulated by miR-34b, was chosen because its expression is also up-regulated in many cancers including myelomas, hepatocellular carcinomas, and breast and colorectal cancers [37], [38]. [score:11]
THBS2, whose expression is up-regulated by ectopically expressed miR-34b, was chosen because it has previously been suggested to modulate cell adhesion and migration [35] and because it can act as a potent endogenous inhibitor of tumor growth and angiogenesis [36]. [score:10]
The most differentially expressed genes were enriched for Gene Ontology categories of “cytoskeletal remo deling” (both TGF- and WNT -dependent and independent) and “cell adhesion” pathway network modules (Figure S3A), suggesting a direct or indirect mechanistic link between miR-34b expression and expression of genes related to cytoskeletal remo deling. [score:9]
Differential expression of putative miR-34b target genes in miR-34b–expressing melanoma cells. [score:7]
This target gene list was established from TargetScan 5.1 [62] utilizing the top 500 miR-34b targets, irrespective of conservation. [score:7]
It is worth noting that CAV1, found to be down-regulated in WM1552C/34b cells, was previously identified as a target for miR-34b [34]. [score:6]
In this study, we have identified many miRNA genes that are perturbed by treatment with a DNA methylation inhibitor, and have used deep sequencing to document a large collection of coding and non-coding RNA genes perturbed by the ectopic expression of miR-34b in melanoma cell lines. [score:5]
Figure S2 miR-34b expression in WM1552C/34b (stable ectopic expression), vector-only, cells treated with 5Aza-dC, or untransfected parental cells subjected to Deep Sequencing. [score:5]
Figure S3 Differential expression of mRNAs in miR-34b expressing melanoma cells. [score:5]
C) qRT-PCR validation of the differential expression of putative miR-34b targets CDC42 and FN1 in vector -transfected or miR-34b -transfected WM1552C cells. [score:5]
B) Pathway mapping of the top potential miR-34b targets reveals 15 targets all associated with the network of cytoskeletal rearrangement. [score:5]
A) A heat-map of the top potential miR-34b targets suggested by TargetScan 5.1, based on fold change and transcript differences between WM1552C/34b cells vs. [score:5]
Figure S4 Differential expression of miRNAs in miR-34b -expressing melanoma cells. [score:5]
0024922.g004 Figure 4 A) A heat-map of the top potential miR-34b targets suggested by TargetScan 5.1, based on fold change and transcript differences between WM1552C/34b cells vs. [score:5]
Next-generation sequencing revealed additional potential target genes that are modulated by the ectopic expression of miR-34b in melanoma cells, and many are predicted to function in a network of interacting products enriched for cytoskeletal proteins. [score:5]
Table S2 Differential expression of miRNAs in miR-34b expressing melanoma cells. [score:5]
Ectopic expression of miR-34b in the stage 3 and stage 4 melanoma cell lines caused a reduction in cell invasion, motility, and attachment rates, suggesting that the invasiveness of the WM1552C and A375 parental cell lines may be related to their low expression of miR-34b. [score:5]
Next-generation RNA sequencing also revealed a number of miRNAs that were differentially expressed in response to miR-34b expression (Figure S4A, Table S2), and several such miRNAs (miR-20b, -134, -140, and -199b) are reportedly involved in cancer progression [40], [41], [42], [43]. [score:5]
To understand the significance of miR-34b in malignant melanoma, we stably expressed the mir-34b gene in the stage 3 melanoma cell line WM1552C, and analyzed genome-wide gene expression patterns in the engineered cells (WM1552C/34b) by deep sequencing (Figure S2). [score:5]
Table S1 Differential expression of mRNAs in miR-34b -expressing melanoma cells. [score:5]
miR-34b expression was analyzed by qRT-PCR on patient samples, and are expressed as RQ. [score:5]
Several miRNAs, including miR-34b, -489, -375, -132, -142-3p, -200a, -145, -452, -21, -34c, -496, -let7e, -654, and -519b, were found to be up-regulated in WM1552C cells treated with 5-Aza-dC relative to untreated cells (Figure 1). [score:4]
Three miRNA genes (mir-34b, -34c, -375) whose products exhibited modulated expression in response to 5-Aza-dC treatment are known to contain CpG islands in their putative regulatory regions [20], [21]. [score:4]
RNA expression profiles for miR-34b were measured in WM1552C melanoma cells which were stably transfected with either an expression vector containing the mir-34b gene (WM152C/34b), an empty vector (WM1552C/VO), no vector (WM1552C or “wild type”) or parental cells treated with 5-Aza-dC. [score:3]
miR-34b expression in patient samples were tested by qRT-PCR and the results are shown as Figure S1. [score:3]
Since miR-34b expression appears to be epigenetically regulated in late-stage melanomas, we examined its effects on the functional phenotype of melanoma cells using various cell biology assays. [score:3]
Ectopic expression of miR-34b in melanoma cells modulates both coding and non-coding RNA genes. [score:3]
Construction of a melanoma cell lines stably expressing miR-34b. [score:3]
miR-34b expression was increased in a dose -dependent manner by treating WM1552C cells with 5-Aza-dC, with maximum induction observed at 10 µM 5-Aza-dC (Figure 2C), the same concentration that reversed most of the upstream CpG methylation (Figure 2B). [score:3]
0024922.g002 Figure 2 mir-34b 5′-UPS CpG island methylation in melanocytes, keratinocytes, and melanoma cells, and the effect of 5-Aza-dC demethylation on its expression in melanoma cells. [score:3]
Figure S1 miR-34b expression in patient samples. [score:3]
The fact that epigenetic silencing of miR-34b was shown in all three cancers but played an inhibitory role in oncogenesis for only one suggests that this miRNA may play distinct roles in unrelated cancers. [score:3]
mir-34b 5′-UPS CpG island methylation in melanocytes, keratinocytes, and melanoma cells, and the effect of 5-Aza-dC demethylation on its expression in melanoma cells. [score:3]
Mir-34 group of miRNAs are known to be useful therapeutic target for various cancers [58], and MIRNATherapeutics Inc. [score:3]
C) of miR-34b expression in WM1552C cells after treatment with various concentrations of 5-Aza-dC. [score:3]
We engineered two cell lines derived from metastatic melanoma to ectopically express miR-34b, and show that these cells exhibit reduced cell motility, decreased substrate attachment, and reduced invasion. [score:3]
We next examined the effect of miR-34b on the invasive properties of miR-34b -expressing cells. [score:3]
Of particular interest are the target genes of miR-34b. [score:3]
Similarly, ectopic expression of miR-34b in A375 cell line decreased cell adhesion significantly compared with vector -transfected cells within 30 minutes of plating (Figure 5B). [score:2]
We used direct DNA bisulfite and immunoprecipitated methylated DNA (methyl-DIP) deep sequencing to confirm that the upstream CpG island sequences of one such miRNA gene (miR-34b) are hypermethylated in advance melanomas. [score:2]
Taken together, these data suggest that miR-34b regulates genes associated with cytoskeletal remo deling, migration, and invasion. [score:2]
Taken together, these results highlight the importance of miR-34b regulation for cell adhesion, invasion, and motility in human melanomas. [score:2]
We have identified a group of epigenetically regulated miRNA genes in melanoma cells, including miR-34b, -489, -375, -132, -142-3p, -200a, -145, -452, -21, -34c, -496, -let7e, -654, and -519b. [score:2]
miR-34b was previously reported to be epigenetically regulated in several cancers, including melanoma, colorectal, and head and neck cancer [8], and reduces the oncogenic potential of a head and neck cancer-derived cell line [8]. [score:2]
These results identified network modules related to cytoskeletal remo deling and cell invasion, suggesting a mechanism by which miR-34b might regulate normal cell motility and cytokinesis. [score:2]
WM1552C and A375 melanoma cells (2.5×10 [5]) were seeded into single wells of a 6-well plate and transfected with 5 µg pcDNA4/myc-HisA (Vector Control) or pcDNA4/miR-34b using Fugene 6 (Roche). [score:1]
Our methyl-DIP deep-sequencing results confirmed that the upstream CpG island sequences of miR-34b and miR-34c are highly hypermethylated in melanoma. [score:1]
We next examined CpG island methylation of miR-34b in 24 melanoma patient samples separated into four groups: (a) primary melanoma, (b) regional metastases, (c) distant metastases, and (d) nodal metastases. [score:1]
Here, we report that cell lines derived from malignant melanomas and melanoma patient samples have hypermethylated CpG islands in the 5′-upstream regions of several miRNA-coding genes, including that of miR-34b. [score:1]
Of these, mir-34b was found to be the most responsive to 5-Aza-dC treatment. [score:1]
miR-34b CpG island methylation in melanoma patients and normal skinGiven the strong hypermethylation profile observed in the upstream sequences of miR-34b in late-stage melanoma cell lines, we next examined methylation levels in biopsied samples from patients with late-stage (Stage 3 and 4) melanoma. [score:1]
By contrast, CpG methylation of miR-34b was less extensive in stage 1 and 2 melanoma samples, normal melanocytes, and keratinocytes. [score:1]
com), a biopharmaceutical research company is currently focusing on miR-34 group of genes as therapeutics. [score:1]
CpG islands 5′UPS of mir-34b are hypermethylated in clinical melanoma samples. [score:1]
Interestingly, no miR-34b methylation was detected in nodal metastatic samples, but the significance of this observation remains unclear. [score:1]
Effect of miR-34b on cell migration. [score:1]
Several groups have previously reported the importance of miR-34b in human melanomas [48], [49], [50], [51], [52], [53], [54]. [score:1]
The effect of miR-34b on melanoma cell growth, adhesion, migration, and invasion. [score:1]
RNA samples isolated from miR-34b -transfected and nontransfected WM1552C cells were subjected to deep sequencing to identify gene networks around miR-34b. [score:1]
miR-34b has a distinct CpG island located between –631 and –395 bp upstream of its precursor RNA start site, which contains 22 CpG dinucleotides. [score:1]
Oligonucleotides complimentary to the hsa-miR-34b genomic sequences were constructed (miR-34b pre For – gtgctcggtttgtaggcagtg and miR-34b pre Rev – gtgccttgttttgatggcagtg), containing HindIII and BamHI sites on their respective 5′ and 3′ ends, then amplified from melanocyte genomic DNA (Amplitaq Gold, Applied Biosystems/Life Technologies). [score:1]
0024922.g003 Figure 3CpG islands 5′UPS of mir-34b are hypermethylated in clinical melanoma samples. [score:1]
Bisulfite conversion and sequencing of DNA from normal skin and nevi samples revealed that the 5′ upstream sequences of miR-34b were largely hypomethylated (Figure 3), except at two sites located near the 5′ end (sites #2 and #3). [score:1]
CpG island methylation at the 5′ upstream region of miR-34b in melanoma miR-34b has a distinct CpG island located between –631 and –395 bp upstream of its precursor RNA start site, which contains 22 CpG dinucleotides. [score:1]
Interestingly, all three miR-34 members (a, b, and c) are reported to be methylated and silenced to varying degrees in many cancers [34], [53], [55]. [score:1]
CpG island methylation at the 5′ upstream region of miR-34b in melanoma. [score:1]
The miR-34b methylation in melanoma patients indicates that methylation of this CpG island is detectable from patient samples, and may therefore hold the possibility of serving as a putative biomarker for stage 3 and 4 melanomas. [score:1]
These observations are consistent with the existence of a global network of miRNAs and coding genes that is perturbed by miR-34b in melanoma cells; future analysis of this network may provide candidates for melanoma biomarkers. [score:1]
Given the strong hypermethylation profile observed in the upstream sequences of miR-34b in late-stage melanoma cell lines, we next examined methylation levels in biopsied samples from patients with late-stage (Stage 3 and 4) melanoma. [score:1]
miR-34b CpG island methylation in melanoma patients and normal skin. [score:1]
D) Methyl-DIP deep sequencing of the upstream CpG island sequences of mir-34b in melanocytes, WM1552C, and 5-Aza-dC treated WM1552C cells. [score:1]
Lujambio et al. [8], showed that the miR-34b upstream DNA sequences are hypermethylated in melanoma patient samples. [score:1]
Effect of miR-34b on melanoma cell attachment and invasion. [score:1]
RNA expression profiles were measured in WM1552C melanoma cells stably transfected with the mir-34b gene (WM152C/34b) or empty vector (WM1552C/VO). [score:1]
RNA expression profiles were measured in WM1552C melanoma cells stably transfected with the mir-34b gene (WM152C/34b) or with empty vector WM1552C/VO). [score:1]
WM793B = Stage 1, WM278 = Stage 2, WM1552C = Stage 3, A375 = Stage 4. B) WM1552C cells were treated with 5-Aza-dC and the putative mir-34b promoter in nine clones was then examined for CpG island methylation (conventions as described in A). [score:1]
The vector construct was sequenced and the pre-hsa-miR-34b fragment was sub-cloned into pcDNA4/myc-HisA (Invitrogen/Life Technologies) using the HindIII and BamHI sites to create pcDNA4/miR-34b. [score:1]
[1 to 20 of 77 sentences]
9
[+] score: 197
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, hsa-mir-34c
We next examined whether SAMe and MTA treatment might influence miR-34a and miR-34b expression because they inhibit IL-6/STAT3 activation [6], which inhibits miR-34a expression [5], and they lower MAT2A expression [7], which contains possible binding sequences in its 3’UTR for miR-34a and miR-34b. [score:11]
MAT2A and MAT2B expression is upregulated in human prostate and pancreas cancers and down-regulated by SAMe, MTA, miR-34a and miR-34b. [score:9]
We suspect MTA is the mediator of SAMe on miR-34a and miR-34b expression, as MTA is a potent inhibitor of methylation [20] and previous studies have shown inhibiting DNA methylation raised the expression of both miRNAs [18, 19]. [score:9]
The aims of the current work were to examine whether miR-34 family members regulate MAT2A and MAT2B expression and whether SAMe and MTA target this axis in multiple human cancers where miR-34a has been reported to be down-regulated. [score:9]
In cancer cells miRNA-34a and miR-34b are often down-regulated, releasing the inhibition on MAT2A expression. [score:8]
In normal non-hepatic tissues, miR-34a and miR-34b negatively regulate MAT2A expression mainly by suppressing its protein translation. [score:8]
Figure 12 In normal non-hepatic tissues, miR-34a and miR-34b negatively regulate MAT2A expression mainly by suppressing its protein translation. [score:8]
MAT2A and MAT2B expression is down-regulated by SAMe, MTA, miR-34a and miR-34b in pancreatic cancer cell line. [score:6]
All three family members are direct transcriptional targets of p53 and many of the targets of the miR-34 family members are involved in cell cycle, apoptosis, invasion and migration [2, 4]. [score:6]
MAT2A and MAT2B expression is down-regulated by SAMe, MTA, miR-34a and miR-34b in prostate cancer cell line. [score:6]
SAMe and MTA induce the expression of miR-34a and miR-34b and all four treatments lower the expression of MAT2A and MAT2B. [score:5]
There are consensus binding sites for miR-34a and miR-34b in the MAT2A 3’-UTR based on three different miRNA prediction target databases (TargetScan, mirDB, miRSVR, Segal Lab of Computational Biology). [score:5]
Treatment with SAMe, MTA, overexpression of miR-34a or miR-34b lowered the expression of MAT2A and MAT2B mainly at the protein levels in both CWR22Rv-1 (Figure 8A and 8B) and MIA PaCa-2 (Figure 9A and 9B) cells. [score:5]
MiR-34 family members are transcriptional targets of p53 and p53 was shown to inhibit CRC metastasis by inducing miR-34a [5]. [score:5]
These findings raised the questions whether 1) SAMe and MTA can inhibit migration and invasion, 2) miR-34a and miR-34b can target MAT2A, and if so, 3) what is the role of MAT2A in mediating the effects of miR-34a/b. [score:5]
Overexpressing miR-34a or miR-34b reduced R KO cell migration, invasion and growth; whereas overexpressing either MAT2A or MAT2B had the opposite effects (Figure 4A–4C). [score:5]
In summary, we have identified MAT2A and MAT2B as direct and indirect targets of miR-34a and miR-34b, and that the two MAT proteins are important mediators of the effect of miR-34a/b on cancer cell growth, migration and invasion. [score:5]
SAMe and MTA induce the expression of miR-34a and miR-34b and all four treatments induce apoptosis and inhibit growth of colon cancer cells. [score:5]
When compared side by side, SAMe and MTA treatment for 24 hours exerted comparable effects on apoptosis and growth inhibition as overexpressing either miR-34a or miR-34b (Figure 2C and 2D). [score:4]
This signaling pathway is known to suppress miR-34a [5] but whether it regulates miR-34b is unknown. [score:4]
Thus, miR-34a and miR-34b could impact MAT2B expression and its downstream signaling pathway indirectly via MAT2A. [score:4]
Overexpressing either miR-34a or miR-34b had minimal to no influence on MAT2A mRNA levels but they reduced MATα2 levels by 45-60% (Figure 3A and 3B). [score:3]
Co -expressing either miR-34a or miR-34b with MAT2B had no influence on MAT2B’s inductive effect on migration, invasion or growth (Figure 4A–4C). [score:3]
CWR22Rv1 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Figure 8CWR22Rv1 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Both agents also lower MAT2A expression [7] and consensus binding sites for miR-34a and miR-34b are present in the MAT2A 3’-UTR. [score:3]
MIA PaCa-2 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Figure 9MIA PaCa-2 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Similar to the CRCs, SAMe and MTA treatment raised miR-34a and miR-34b expression (Figures 8C and 9C). [score:3]
The finding that overexpressing miR-34a or miR-34b had minimal to no influence on the inductive effect of MAT2A/MAT2B on CRC growth, migration or invasion supports an important role of these two MAT proteins in mediating the effects of miR-34a/b on these parameters. [score:3]
MiR-34a and miR-34b were overexpressed as describe above. [score:3]
Treatment with SAMe or MTA in cancer cells increases the expression of miR-34a and miR-34b. [score:3]
R KO (A) and SW620 (B) cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Both miR-34a and miR-34b have also been shown to behave as tumor suppressors in prostate and pancreatic cancers [1, 3, 27, 28]. [score:3]
Effects of SAMe, MTA, miR-34a and miR-34b on MAT2A and MAT2B expression. [score:3]
Figure 3R KO (A) and SW620 (B) cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
We found both SAMe and MTA inhibited CRC cell migration and invasion, which may be in part mediated by its inductive effect on miR-34a and miR-34b. [score:3]
Co -expressing miR-34b with MAT2A only reduced the effect of MAT2A on migration slightly, but had no effect on invasion or growth. [score:3]
Most of the published literature shows miR-34 family members as tumor suppressors [2, 4]. [score:3]
MATβ is a regulatory subunit that interacts with MATα2 [13] and there is no consensus binding site in the 3’UTR of MAT2B for either miR-34a or miR-34b. [score:2]
While miR-34a’s role in tumorigenesis has received a lot of attention, less is known about miR-34b. [score:1]
MiR-34a is part of a family that includes miR-34b and miR-34c, with miR-34a having its own transcript while the other two share a common primary transcript [4]. [score:1]
MiR-34a, miR-34b and empty vectors were purchased from Origene (Rockville, MD) and GeneCopoeia (Rockville, MD), respectively. [score:1]
R KO (C) and SW620 (D) cells were treated with 250 μM SAMe or MTA, overexpression of miR-34a or miR-34b as described in Methods for 24 hours and were processed for apoptosis, growth by BrdU, miR-34 and miR-34b transfection efficiency measurements. [score:1]
Silencing of miR-34b in CRC and miR-34a in Hodgkin lymphoma has been reported to be related to CpG island methylation [18, 19], which appears to contradict the role of SAMe as a methyl donor. [score:1]
Figure 4R KO cells were transfected with empty vector (EV), miR-34a, miR-34b, MAT2A or MAT2B expression vectors alone or in combination for 24 hours for measurement of cell migration (A), invasion (B) and growth (C) as described in Methods. [score:1]
SAMe and MTA treatment for 24 hours increased the mRNA levels of miR-34a and miR-34b in both CRC cell lines (Figure 2A) and a direct effect of miR-34a and miR-34b on MAT2A 3’UTR was confirmed using reporter assay (Figure 2B). [score:1]
Effects of MAT2A, MAT2B, miR-34a and miR-34b in colon cancer cell migration, invasion and growth. [score:1]
R KO cells were transfected with empty vector (EV), miR-34a, miR-34b, MAT2A or MAT2B expression vectors alone or in combination for 24 hours for measurement of cell migration (A), invasion (B) and growth (C) as described in Methods. [score:1]
[1 to 20 of 49 sentences]
10
[+] score: 182
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-1-2, hsa-mir-1-1, hsa-mir-34c
In addition, we confirmed the targeting of E2F1 by miR-34 and transactivation of miR-34 by p53, and thus revealed the dual mechanisms by which miR-34 controls expression of h-eag1: directly repressing h-eag1 at the post-transcriptional level and indirectly downregulating h-eag1 at the transcriptional level through repressing E2F1. [score:10]
Downregulation of miR-34 should produce the opposite changes and upregulation of h-eag1 may mediate the cell growth-promoting effect of miR-34 downregulation. [score:10]
p53 activates miR-34 transcription; upregulation of miR-34 represses E2F1 and h-eag1; repression of E2F1 downregulates expression of h- eag1. [score:9]
Indeed, downregulation of miR-34 has been found in a wide spectrum of tumors [36] in one hand and upregulation of h-eag1 in cancer tissues on the other hand, consistent with h-eag1 being a CNS-localized voltage-gated K [+] channel that is ectopically expressed in a majority of extracranial solid tumors [39]. [score:9]
Transfection of miR-34a markedly suppressed the luciferase activities and the effect was reversed by their multiple-target anti-miRNA antisense oligonucleotides (MT-AMO) (Fig. 2A ; Supporting Figures online; Figure S5), a single oligomer capable of targeting all three members of the miR-34 subfamily [28]. [score:7]
Moreover, in the presence of p53 inhibitor, exogenously applied miR-34a retained the full ability to downregulate E2F1 (Fig. 4C & 4D ) and h-eag1 (Fig. 4E & 4F ), suggesting that miR-34 mediates the regulatory role of p53 on E2F1 and h-eag1. [score:7]
Therefore, p53 negatively regulates h-eag1 expression by a negative feed-forward mechanism through the p53− miR-34−E2F1 pathway and inactivation of p53 activity as it is the case in many cancers can thus cause oncogenic overexpression of h-eag1 by relieving the negative feed-forward regulation. [score:7]
We first demonstrated that activation of p53 by nutlin-3 induced a cell growth arrest in SHSY5Y cells, and overexpression of E2F1 alleviated the cell growth inhibition and so did transfection with the MT-AMO to knock down miR-34 (Fig. 7A & 7B ). [score:6]
Our study herein revealed that miR-34, a known transcriptional target of p53, is an important negative regulator of h-eag1 through dual mechanisms by direct repression at the post-transcriptional level and indirect silencing at the transcriptional level via post-transcriptionally repressing E2F1 that we have established to be a transactivator of h- eag1. [score:6]
Intriguingly, it has been demonstrated that in vertebrates miR-34 is initially expressed widespread throughout the brain in early stage of development and expression becomes limited to the anterior region of the hindbrain in later stages [37]. [score:6]
The major finding includes identification of E2F1 as a key transcriptional activator of h- eag1 and miR-34 as an important translational inhibitor of h-eag1. [score:5]
When p53 activity increases in response to environmental and cellular stresses, miR-34 is deemed to increase, and the increased miR-34 will decrease E2F1 to diminish h- eag1 gene transcription and will also repress h-eag1 protein translation as well; diminishment of h-eag1 expression and function then results in a shut-down of cell proliferation or a cell cycle arrest. [score:5]
0020362.g004 Figure 4(A & B) Effects of p53 activation by Mdm2 inhibitor nutlin-3 (1 µM) on expression of miR-34, E2F1 and h- eag1 at mRNA and protein levels. [score:5]
miR-34 has been known to be a direct transcriptional target of p53 [33]– [36] and to mediate the apoptotic action of p53. [score:4]
These results indicate that miR-34 regulates h- eag1 expression through at least two mechanisms. [score:4]
Cells were pretreated with nutlin-3 to activate p53 and then transfected with the plasmid carrying E2F1 cDNA for overexpression (E2F1-P) or MT-AMO to knockdown miR-34; control cells (Ctl/Lipo) were mock -treated with lipofectamine 2000. [score:4]
Figure S5The multiple-target anti-miRNA antisense oligonucleotide fragment (MT-AMO) used to knock down all three different isoforms of has- miR-34 (miR-34a, miR-34b and miR-34c). [score:4]
It appears that h-eag1 is a terminal effecter component in the p53− miR-34−E2F1 pathway for expression regulation and functional signaling. [score:4]
We reasoned that if E2F1 and miR-34 are indeed important in the expression regulation of h-eag1, then we should see a positive correlation between E2F1 and eag1 levels and an inverse relationship between miR-34 and h- eag1 levels. [score:4]
These findings not only help us understand the molecular mechanisms for oncogenic overexpression of h-eag1 in tumorigenesis but also uncover the cell-cycle regulation through the p53− miR-34−E2F1−h-eag1 pathway. [score:4]
miR-34a, miR-34b, and miR-34c (Figure S4), and their antisense inhibitor oligonucleotides (MT-AMO) (Figure S5) were synthesized by Integrated DNA Technologies, Inc. [score:3]
Finally, we demonstrated that cell growth controls at the level of p53, miR-34 or E2F1 were related to h-eag1 expression. [score:3]
To experimentally establish miR-34:h- eag1 interaction, we inserted a fragment of 3′UTR of h- eag1 containing the miR-34 target sites into the position downstream the luciferase gene in the pMIR-REPORTTM vector. [score:3]
RA: retinoic acid, which has been shown to enhance miR-34 expression; E2F1/3: E2F1 and E2F3. [score:3]
And we identified multiple binding sites for a tumor-suppressor miRNA subfamily miR-34 (including miR-34a, miR-34b and miR-34c) in the 3′UTR of h- eag1 mRNA (Figure S4). [score:3]
Figure S9Expression correlations between E2F1 and h-eag1 and between miR-34 and h-eag1. [score:3]
Ctl: cells transfected with the luciferase vector alone; MT-AMO: the multiple-target anti-miRNA antisense oligonucleotides to miR-34a, miR-34b and miR-34c, co -transfected with the luciferase vector and miR-34a or miR-34c. [score:3]
Moreover, this low level of miR-34 may also explain the enriched expression of E2F1 in brain [40]. [score:3]
Figure S6Effects of miR-34b and miR-34c on expression of E2F1 (A) and h-eag1 (B) at the protein level in SHSY5Y cells, assessed by. [score:3]
Indeed, p53 activation by Mdm2 inhibitor nutlin-3 (1 µM) increased miR-34 level (Fig. 4A ), and simultaneously decreased E2F1 and h- eag1 mRNA concentrations (Fig. 4A ) and protein levels (Fig. 4B ). [score:3]
This low expression of miR-34 may partially underlie the high abundance of eag1 in brain [39]. [score:3]
First, miR-34 directly represses h-eag1 protein. [score:2]
Moreover, these findings place h-eag1 in the p53− miR-34−E2F1−h-eag1 pathway with h-eag as a terminal effecter component and with miR-34 (and E2F1) as a linker between p53 and h-eag1. [score:1]
Figure S8Multiple complementary motifs between each of the three isoforms of has- miR-34 and the 3′UTR of E2F1 mRNA. [score:1]
The MT-AMO tested in this study was designed to integrate the AMOs against miR-34a, miR-34b and miR-34c into one AMO unit. [score:1]
The same observations were expanded to miR-34b and miR-34c and to MCF-7 cells (Figure S6 & S7). [score:1]
This implies that h-eag1 executes the cell-cycle checkpoint signal from p53 transmitting along the p53− miR-34−E2F1−h-eag1 pathway (Fig. 6 ). [score:1]
miR-34 as a post-transcriptional repressor of h-eag1. [score:1]
MT-AMO: an antisense oligomer to miR-34a, miR-34b and miR-34c; miR+AMO: co-transfection of miR-34a and MT-AMO; NC-miR: scrambled negative control miRNA. [score:1]
Thus, changes of p53 activity are deemed to change the level of miR-34 thereby those of E2F1 and h-eag1 as well. [score:1]
0020362.g003 Figure 3 miR-34 as a post-transcriptional repressor of E2F1. [score:1]
We confirmed that transfection of miR-34a reduced E2F1 protein levels by ∼68% in SHSY5Y cells (Fig. 3A ) and the same results were obtained with miR-34b and miR-34c (Figure S6 & S8). [score:1]
Effects of the p53− miR-34−E2F1−h-eag1 pathway on cell proliferation. [score:1]
MT-AMO: an antisense oligomer to miR-34a, miR-34b and miR-34c; +MT-AMO: co-app;lication of miR-34c and MT-AMO. [score:1]
These above data allowed us to propose a new signaling pathway p53− miR-34−E2F1−h-eag1 (Fig. 6 ). [score:1]
0020362.g006 Figure 6Proposed mo del of the p53− miR-34−E2F1−h-eag1 signaling pathway. [score:1]
Figure S4Multiple complementary motifs between each of the three isoforms of has- miR-34 and the 3′UTRs of h -eag1 mRNA (A) and h- erg1 mRNA (B). [score:1]
Proposed mo del of the p53− miR-34−E2F1−h-eag1 signaling pathway. [score:1]
Second, miR-34 represses E2F1 protein, leading to reduced transcription of h- eag1. [score:1]
This latter effect also explains partially the effectiveness of miR-34 to decrease h- eag1 mRNA. [score:1]
0020362.g007 Figure 7Effects of the p53− miR-34−E2F1−h-eag1 pathway on cell proliferation. [score:1]
These findings may be extended to h-erg-1 K [+] channel (or HERG): h-erg1 may also be a component of the p53− miR-34−E2F1 pathway, according to our data shown in Figures S3, S8 and S9. [score:1]
We analyzed the summation of the two bands to represent the total h-eag1 protein level and both bands were found affected by miR-34 and MT-AMO. [score:1]
Figure S7 miR-34 as a post-transcriptional repressor of h-eag1 in MCF-7 human breast cancer cells. [score:1]
0020362.g002 Figure 2 miR-34 as a post-transcriptional repressor of h-eag1. [score:1]
miR-34 as a post-transcriptional repressor of E2F1. [score:1]
Based on our findings, we were able to establish a novel signaling pathway: p53− miR-34−E2F1− h-eag1. [score:1]
In adult, miR-34 is absent from forebrain and midbrain and present only in the caudal ventral and lateral isthmus and hindbrain nuclei [38]. [score:1]
Recent studies have shown that members of the miR-34 family possess anti-proliferative potential and induce cell cycle arrest, senescence, and/or apoptosis [31]– [36]. [score:1]
[1 to 20 of 59 sentences]
11
[+] score: 172
Thrombospondin 1 (THBS1) expression was analysed since this transcript was predicted to be a target of the miR-34b-5p both by the TargetScan and by the MiRDB databases, and furthermore, the microarray data showed that THBS1 expression was reduced in miR-34b transfected cells, but up-regulated in cells transfected with miR-34c. [score:12]
In contrast, for miR-34b 40% of the down-regulated transcripts were predicted miR-34b-5p targets and 14% of the up-regulated transcripts were predicted miR-34b-5p targets (Supplementary data  S2). [score:11]
Only one transcript had opposite changed expression level, THBS1 that were downregulated by miR-34b and upregulated by miR-34c (Fig.   2a). [score:9]
A number of validated miR-34 family mRNA targets, such as cyclin -dependent kinase 4 (CDK4) [8], cyclin -dependent kinase 6 (CDK6), lymphoid enhancer -binding factor 1 (LEF1) [16], Met Proto-oncogene (MET) [17] and NOTCH1 [18] were among the 305 transcripts that were downregulated by both mimics. [score:6]
Nevertheless, similarities in the transcriptome changes and repression of CDK4 and CCND1 expression are observed, indicating that the annotated miR-34b still recognises some miR-34 target genes. [score:5]
We first assessed the expression of three selected miR-34 targets by qPCR. [score:5]
We observed changed expression of 101 genes known to be involved in cell migration upon introduction of miR-34c (p = 1.78E-08), while only 78 (p = 9.44E-07) genes were affected by over -expression of miR-34b. [score:5]
Functional analyses demonstrated that the miR-34b expressed in the MDA-MB-231 cells had tumour suppressive capacity resembling that of miR-34c, while the annotated miR-34b did not. [score:5]
To further validate the gene lists, we compared the transcripts that were changed by miR-34 mimics with genes identified as predicted targets of the miR-34 family using TargetScan software (version 7.1). [score:4]
MiR-34b and miR-34c are encoded from the same locus situated on chromosome 11q23, and expressed as a bicistronic transcript. [score:3]
Interestingly, the exposed nucleotides for miR-34b pairs perfectly to the predicted miR-34 binding site in the 3′ UTR of THBS1 mRNA, while as a result of the shift in the exposed nucleotides for miR-34b-5p’, this seed sequence is no longer complementary to the target mRNA. [score:3]
The IPA analyses revealed that miR-34c affected the expression levels of 50 genes involved in cell morphology while miR-34b only affected 30 (p = 3.46E-07 and p = 5.09E-03, respectively). [score:3]
In addition, about 25% of the predicted miR-34b target genes should by chance have the complementary base to the shift in miR-34b 5′ terminus. [score:3]
In line with this, we found that only the annotated miR-34b isoform reduced the THBS1 expression. [score:3]
15 transcripts were regulated by both miR-34b and miR-34c, all of these were regulated in a similar manner. [score:3]
35 transcripts were regulated by both miR-34b and miR-34c, all of these were changed in the same direction. [score:3]
CDK4 and cyclin D1 (CCND1) were chosen since these are validated miR-34 targets 8, 22. [score:3]
52 transcripts were regulated by both miR-34b and miR-34c, all of these were regulated in a similar manner. [score:3]
In conclusion, the miR-34 family is an important group of miRNAs with anti-tumorigenic effects, and the precise knowledge of the expressed isomiRs and their function is critical. [score:3]
We first examined the global transcription response to each miR-34 mimic by mRNA expression profiling using microarray 48 hours after transfection. [score:3]
Overexpression of any of the miR-34 isoforms decreased the transcript levels CDK4 and CCND1 48 h after transfection (Fig.   4b). [score:3]
Figure 4Comparing effects of the annotated and expressed miR-34b isoform. [score:3]
These levels are thought to be below the functional level [32], so it was expected that MDA-MB-231 cells could be targeted by miR-34 replacement therapy. [score:3]
Thus the expressed mature miR-34b-5p (hereafter referred to as miR-34b-5p’) was still 23 bases long, but the seed sequence was shifted one position (spanning nucleotides 2–8). [score:3]
The miR-34 miRNAs are tumour suppressors and are critical mediators in the p53 pathway 8, 9. In particular, it has been shown that the miR-34 family members reduce cell growth, induce apoptosis and affect cell migration 10, 11. [score:3]
We found that miR-34c was expressed at a higher level than miR-34b in control -transfected MDA-MB-231 cells (342 versus 19 reads, respectively, Supplementary data  S5). [score:3]
Gene expression analyses of miR-34b and miR-34c transfected cells identified a number of genes involved in cellular proliferation (165 and 212 genes, p = 1.49E-08 and p = 1.71E-10, respectively). [score:3]
The analysis predicted changes in several biological functions known to be regulated by the miR-34 family, such as cell growth, apoptosis, cell morphology and cell migration (Fig.   2b and Supplementary data  S3). [score:2]
76 mRNAs were regulated by both miR-34b and miR-34c, all of these were changed in a similar manner. [score:2]
IPA analysis revealed that miR-34c regulated 167 transcripts implicated in apoptosis, while miR-34b affected 105 transcripts involved in the same process (p = 8.39E-14 and p = 1.10E-04, respectively). [score:2]
For several species the original miR-34b-5p annotation is corrected, including mouse and gorilla, and is there in accordance with the miR-34b-5p’ identified here. [score:1]
In line with this, we observed that miR-34c had a profound effect on the cellular morphology of MDA-MB-231 cells 72 hours after transfection, whereas no clear morphological changes were observed for miR-34b transfected cells (Fig.   2e). [score:1]
We subsequently investigated whether the miR-34b-5p’ also was expressed in other cell types than MDA-MB-231 cells. [score:1]
We observed a reduced cell growth capacity after transfection with miR-34c, while miR-34b only had a minor, delayed effect on cell growth (Fig.   2c). [score:1]
We also noted that both endogenous miR-34b and the transfected mimics had reads with heterogeneous 3′ termini. [score:1]
Interestingly, in contrast to the miR-34b mimic, which as predicted reduced the mRNA levels of THBS1, an increase of mRNA levels was observed following introduction of either miR-34b-5p’ or miR-34c mimic. [score:1]
We separately introduced synthetic mimics representing human annotated versions of the miR-34b-5p (miR-34b) and miR-34c-5p (miR-34c) into the breast cancer cell line MDA-MB-231. [score:1]
Our experiments showed that caspase-3/7 activity was induced in miR-34c -transfected cells approximately 72 hours after transfection, while transfection with the miR-34b mimic did not induce caspase-3/7 activity (Fig.   2d). [score:1]
Interestingly, the miR-34b-5p’ seed sequence was identical to those annotated for miR-34a and miR-34c. [score:1]
In cells transfected with miR-34b we found three major groups of miR-34b-5p sequences. [score:1]
To identify the common and unique effects of the bicistronic miR-34b and miR-34c we introduced miR-34b and miR-34c mimics into the breast cancer cell line MDA-MB-231. [score:1]
Moreover, miR-34b-5p’, unlike the mimic representing the annotated miR-34b, induced apoptosis as indicated by increased caspase 3/7 activity, at even higher level than observed for cells transfected with miR-34c (Fig.   4d). [score:1]
In addition, unlike cells transfected with miR-34b, cells transfected with miR-34b-5p’ changed morphology, closely resembling cells transfected with miR-34c (Fig.   4e). [score:1]
In humans miR-34b-5p has an additional base at the 5′ end, shifting its seed sequence by one base, relative to the other miR-34 family members as annotated in databases like miRBase and miRNAMap 2.0 and found in scientific reviews 13– 15. [score:1]
Sequencing of miR-34b in these cells demonstrated that the endogenous miR-34b did not match the annotated miR-34b. [score:1]
Loss of miR-34 is strongly associated with cancer and miR-34 replacement therapy is currently in clinical trials for treatment of primary liver cancer and other selected cancer types with liver metastasis [12]. [score:1]
The miR-34 family seed sequence is highlighted in red. [score:1]
In our study, we found that mimics representing the annotated versions of human miR-34b-5p (miR-34b) and miR-34c-5p (miR-34c) affected different gene sets, and importantly, resulted in different cellular effects. [score:1]
To our surprise, the annotated miR-34b was hardly expressed in any of the investigated cells. [score:1]
Sequence alignment of the mature miR-34a-5p, miR-34b-5p and miR-34c-5p molecules, as annotated by miRBase, the primary repository for miRNA sequences. [score:1]
Cells were transiently transfected with mimics representing miR-34b or miR-34c or a negative control mimic. [score:1]
Both the 5p and the 3p miRNA arms were detected for endogenous miR-34b and miR-34c, with the 5p arm as the major product, accounting for 76% and 99.7%, respectively (Supplementary data  S5). [score:1]
Surprisingly, the miR-34b annotation appears to be based on very limited data. [score:1]
Altogether, this suggests that the miR-34b-5p’should be the reference miRNA, while the seed shifted version is an isomiR. [score:1]
The human miR-34 family consists of three members, miR-34a, miR-34b, and miR-34c. [score:1]
The analysis revealed that the levels of 777 and 1001 transcripts significantly changed upon introduction of miR-34b and miR-34c, respectively (Supplementary data  S1). [score:1]
Uridylation, as we found for miR-34b, is known to promote miRNA degradation [28]. [score:1]
MiR-34b-5p’ function closely resembles that of miR-34c. [score:1]
Figure 1 Mature human miR-34 family sequence. [score:1]
Surprisingly, we found that endogenous miR-34b-5p in MDA-MB-231 cells did not match the annotated miR-34b-5p sequence. [score:1]
Notably, the miR-34b-5p’ sequence is the annotated isoform of human miR-34b in a novel database (MiRGeneDB) in which miRNA genes are manually curated based on deep sequencing data [25]. [score:1]
These findings were in conflict with published data comparing miR-34 family members [8] and led us to sequence the endogenous miR-34b. [score:1]
Figure 3Sequencing data for miR-34b. [score:1]
In contrast, the annotated miR-34b had a weak or no effect on these functions. [score:1]
Instead, miR-34b-5p’ was the dominant variant in both cancerous (breast, sarcoma, melanoma, gastric and cervix cancer) and non-cancerous cells (mesenchymal stromal cells, osteoblasts, embryonic stem cells, gastric cells and normal cervix) 19– 21, 23. [score:1]
Importantly, we observed that the majority of transcripts with significantly changed levels were specific for each miR-34 isoform. [score:1]
Although miR-34b-5p significantly changed 777 transcripts, including a large number of transcripts involved in proliferation, apoptosis and cell migration, this mimic had hardly any effect on these phenotypes. [score:1]
MiR-34b-5p and miR-34c-5p exert different functions in MDA-MB-231 cells. [score:1]
The synthetic pre-miRNA precursors (Ambion, Grand Island, USA) hsa-miR-34b-5p (PM10743), hsa-miR-34c-5p (PM 11039), hsa-miR-34b-5p’ (AM17103) and Negative Control #2 oligos (AM 17111) were transiently transfected into the cells at a final concentration of 18 nM using the lipidic transfection agent INTERFERin (PolyPLUS, Illkirch, France), according to the manufacturer’s protocol. [score:1]
This cell line is derived from a highly aggressive metastatic breast cancer with low levels of endogenous miR-34. [score:1]
Furthermore, miR34b-5p’ reduced the growth of MDA-MB-231 cells more efficiently than miR-34b, although not quite as strong as observed for miR-34c (Fig.   4c). [score:1]
Degradation would be consistent with the observation that the levels of miR-34b in most of the samples are lower than miR-34c, even though they originate from the same transcript. [score:1]
The endogenous miR-34b-5p lacked the first annotated 5′ nucleotide and had an additional nucleotide at the 3′ end (Fig.   3a and Supplementary data  S5). [score:1]
Here 97 RPM (reads per million) matched the miR-34b-5p’ (equivalent to 50%), and only 3 RPM (equivalent to 1.5%) matched the annotated miR-34b-5p form. [score:1]
A recent study found that the annotated miR-34b and miR-449c represents minor variants in human airway epithelial cell, and propose that the annotated versions represent isomiRs [26]. [score:1]
Three libraries were sequenced, and miR-34b was identified as a single clone in only one of the libraries [24]. [score:1]
Reads with heterogeneous 3′ termini were observed for both endogenous miR-34b-5p and the transfected mimics. [score:1]
Figure 2Comparing effects of introducing miR-34b-5p and miR-34c-5p mimics into MDA-MB-231 cells. [score:1]
In fact, the initial cloning and sequencing of miR-34b was performed using mouse embryonic stem cells. [score:1]
The miR-34b sequencing data analyzed during this study are included in this published article (and its Supplementary Information files). [score:1]
[1 to 20 of 80 sentences]
12
[+] score: 168
About half the mRNAs down-regulated by miR-34b or miR-34c were also down-regulated by miR-34a, but less than a fifth (91 of 482) of the genes down-regulated after miR-34a overexpression were down-regulated by miR-34b or miR-34c (Fig 2A), suggesting that individual miR-34 miRNAs regulate unique targets. [score:18]
Activation of p53 by cellular stress leads to transcription of miR-34 miRNAs, which in turn can enhance p53 function by: (1) miR-34a -mediated inhibition of multiple negative regulators of p53 to further increase p53 transcriptional activity; and (2) miR-34a -mediated increase of p53 protein stability (miR-34a feed-forward loops); or inhibit p53 function by: (3) direct miR-34a -mediated inhibition of TP53; and (4) direct miR-34 inhibition of many p53-activated genes (negative feedback loops). [score:12]
Although mature miR-34b and miR-34c have sequences almost identical to miR-34a even outside the seed, over -expression of miR-34b or miR-34c, unlike over -expression of miR-34a, had little effect on p53 promoter activity and only weakly up-regulated the mRNA levels of p53 transcriptional targets. [score:10]
Consistent with this result, induction of 6 p53 transcriptional targets in HCT116 cells was significantly less after miR-34b or miR-34c overexpression than after miR-34a overexpression (Fig 1D), despite highly elevated miRNA overexpression (S1A Fig). [score:9]
Although miR-34b/c suppressed genes were also enriched for involvement in the cell cycle, most of the over-represented processes of the miR-34b/c suppressed genes had non-overlapping functions in protein metabolism/translation, cell adhesion/motility/migration, and apoptosis/cell death (Fig 2C and 2D), some of which are related to impaired development of ciliated tissues seen in KO mice [6, 7]. [score:8]
Although all three family members regulated cell cycle progression, miR-34b/c over -expression down-regulated mRNAs that mostly function in different biological processes than miR-34a. [score:7]
Functional Annotation Analysis of downregulated genes in HCT116 cells overexpressing miR-34 using DAVID Bioinformatics tool. [score:6]
482, 163 and 29 mRNAs were significantly down-regulated (fold decrease ≥ 1.5 fold relative to miRNA control) after miR-34a, miR-34b or miR-34c overexpression, respectively (Fig 2A and S1 Table). [score:6]
Genes down-regulated by miR-34 over -expression in HCT116 cells. [score:6]
As expected, miR-34 overexpression decreased the miR-34a target gene CDK6 and increased the p53-activated gene CDKN1A, assessed as controls. [score:5]
In mice, miR-34a is expressed in most tissues, while miR-34b/c are predominantly expressed in lung and testis [4, 5]. [score:5]
miR-34b-5p (hereafter designated miR-34b) overexpression had a modest, but significant, effect on 2 of the 4 promoters, while miR-34c did not significantly increase activity of any (Fig 1C), even though it was over-expressed more than a hundred fold above its endogenous level after genotoxic stress (data not shown). [score:5]
We set out to study how the different miR-34 miRNAs contribute to p53 function, analyze whether they regulate overlapping sets of targets and determine if miR-34 is essential for p53 -mediated function in human cells. [score:4]
To determine whether the miR-34 family might regulate non-overlapping mRNAs, we performed gene microarray analysis of HCT116 cells overexpressing each family member (S1B Fig). [score:4]
In addition, the lack of a strong effect of genetic deletion of miR-34a could also be secondary to functional redundancy provided by the other miR-34 members or other p53-regulated tumor suppressor miRNAs [45– 49] or by the p53-independent miR-449 family, which shares a seed sequence with miR-34 [50]. [score:4]
In mice, miR34b/c and the related miR-449 cluster are expressed specifically in multiciliated epithelia and their KO causes infertility and respiratory dysfunction [6, 7], supporting their distinct roles. [score:3]
A better knowledge of the mutual functional dependence between miR-34 and p53 will help to understand miR-34 tumor suppressor function. [score:3]
We next used luciferase reporter promoter assays, in p53-sufficient HCT116 cells, to assess whether miR-34 overexpression enhanced promoter activities of a sequence of 13 tandem repeats of the p53 binding site (pG13-luc) [16] or the promoters of p53-regulated genes, PUMA, CDKN1A (the gene encoding p21/WAF1) and BAX. [score:3]
Our observation that only miR-34a overexpression enhances p53 -mediated transcription was surprising since the miR-34 family active strands are highly homologous—the seed (residues 2–9) and residues 11–17 and 19–21 are identical (Fig 1C). [score:3]
An unexpected finding of this study was the weak effect of miR-34b or miR-34c over -expression on p53 function. [score:3]
Analysis of miR-34 levels in miR-34 over -expressing samples. [score:3]
Of note, for both experiments, miR-34c expression is ~ 9 fold less than in miR-34b transfected samples. [score:3]
Ectopic expression of miR-34a, but not miR-34b/c, increases p53 transcriptional activity. [score:3]
0132767.g002 Fig 2 (A) Overlap of genes down-regulated ≥ 1.5 fold in miR-34 OE HCT116 cells compared to control -transfected cells. [score:3]
Single colonies were tested for miR-34 expression by qRT-PCR and negative colonies were verified by sequencing. [score:3]
Overexpression of miR-34a, but not miR-34b/c, enhances p53 transcription in HCT116 cells. [score:3]
Since their initial identification as p53 transcriptional targets, the three members of the miR-34 family have been considered crucial mediators of the p53 response [39]. [score:2]
miR-34a and miR-34b/c regulate different biological processes. [score:2]
Here, we provide evidence showing that, despite sharing an identical seed sequence, miR-34b/c do not enhance p53 transcriptional activity and they regulate non-overlapping genes, involved in distinct biological processes. [score:2]
Multiple miRNAs, including the miR-34 family, are transcriptionally activated by p53. [score:1]
These data together suggest that miR-34a and miR-34b/c serve different biological functions. [score:1]
Our results showing that miR-34a is not essential for the p53 mediated response to stress are in agreement with data published by Concepcion et al reporting intact p53 function in miR-34 deficient mice [12]. [score:1]
The miR-34 family consists of 3 miRNAs—miR-34a on human chromosome 1p36 and miR-34b/c, co-transcribed on human chromosome 11q23. [score:1]
Genome-wide transcriptome analysis of miR-34 OE HCT116 cells. [score:1]
Thus sequence determinants outside the seed might profoundly affect miR-34 family function by an unknown mechanism that is worth exploring. [score:1]
Future experiments with miR-34 -deficient human cells should address the contribution of miR-34 in these other scenarios. [score:1]
Mean +/- SD of three independent experiments is shown in cells transfected with miR-34 family or cel-miR-67 (M-control) mimics. [score:1]
Thus miR-34 -mediated increased p53 transcription is largely limited to miR-34a. [score:1]
Because their levels are so low, endogenous miR-34b/c are unlikely to function in these cells. [score:1]
miR-34—a microRNA replacement therapy is headed to the clinic. [score:1]
Normalized Firefly luciferase activity, relative to Renilla luciferase activity, after miR-34 transfection is plotted as fold change relative to control miRNA -transfected sample. [score:1]
Alignment of the miR-34 family with the seed sequence highlighted in red is shown at top. [score:1]
miR-34b/c levels were analyzed by qRT-PCR. [score:1]
WT cells have <1 copy/cell of miR-34b and miR-34c, which only increases to 5 and 10 copies/cell, respectively, after DOX (Fig 6C). [score:1]
Three chromosome 5q11.2 miRNAs (miR-449a/b/c) share a seed sequence with miR-34, and have a tissue distribution similar to that of miR-34b/c [6, 7]. [score:1]
miR-34 levels in transfected samples from Fig 1D (A) and Fig 2 (B), analyzed by qRT-PCR. [score:1]
In this regard, it has been shown recently that somatic cells from miR-34 deficient mice can be reprogrammed more efficiently [51]. [score:1]
Here, we investigated in detail how the different miR-34 family members contribute to p53 function, the miR-34a targets that are relevant for its contribution and how much p53 relies on miR-34a. [score:1]
Although antagonizing miR-34a in human cells impairs p53 function in a few studies [4, 10, 11], mice genetically deficient in all miR-34 family genes have unimpaired stress responses [12]. [score:1]
[1 to 20 of 49 sentences]
13
[+] score: 149
S3 Fig (Panel A) The indicated cell lines were transfected with precursor miR-34b (p-miR-34b-3p), miR-34b inhibitor (a-miR-34b-3p) or with a non -targeting molecule (Ctrl) and analyzed for miR-34b-3p expression by qPCR. [score:7]
In summary, using an integrated discovery platform that included defined cell lines, a genetic mouse mo del of aggressive disease and clinically annotated human samples, we identified downregulation of miR34b and reciprocal increased levels of Sox2 as a biomarker of progressing prostate cancer while still at an androgen -dependent stage. [score:6]
Mechanistically, this pathway reflects epigenetic silencing and DNA copy number loss of the MIR34B/C locus on chromosome 11, resulting in deregulated expression of the downstream stemness target, Sox2 in PCa. [score:6]
Our findings that deregulation of a miR-34b/Sox2 axis occurs early during disease progression, selectively in androgen -dependent cells, suggests that this process may contribute to resistance to androgen ablation therapy, thus heralding an incurable disease stage. [score:6]
β-tubulin was a loading control (Panel C) Heatmap of miR-34b-3p predicted target genes (c-Myc, Met and Sox2) or of known Notch1 responsive genes (Hes-1 and CDKN1A) in prostate cell lines transfected with precursor, antagonist miR-34b or control molecules as in panel B. Red and blue represent high or low gene expression, respectively. [score:5]
For miRNA transfection, cells were seeded at a 5x10 [5] per well in six-well plates, and transfected with 150 pmol of miR-34b inhibitor (a-miR-34b; HSTUD0511), or miR-34b precursor (p-miR34b; HMI0511), or corresponding non -targeting sequences (a-Ctrl or p-Ctrl, respectively HMC0002 and NCSTUD001) in the presence of Lipofectamine 2000 (Life Technologies Inc. [score:5]
These findings may offer a straightforward molecular signature to identify patients at risk of aggressive disease, whereas it may be possible to therapeutically manipulate miR-34b levels as a strategy to oppose disease progression [49]. [score:5]
miR-34b targets expression analysis. [score:5]
Consistent with these observations, forced expression of miR-34b precursor sequences in different prostate cell lines but not antagonist (Panel A in S3 Fig), potently repressed endogenous Sox2 levels in BPH-1 cells (Fig 6A) whereas did not modulate the expression levels of c-Myc, Notch1 and Met (Panels B,C in S3 Fig). [score:5]
Consequently, loss of miR-34b inversely correlated with Sox2 expression in PCa and PIN lesions in humans, while undetectable in normal or hyperplastic epithelium and weakly expressed in myoepithelial cells as also previously described [31, 36, 38]. [score:5]
Consistent with these observations, we have shown here that forced expression of miR-34b potently suppressed the endogenous levels of the stemness factor, Sox2 [33, 34], selectively in androgen -dependent cells. [score:5]
Both CNV#1 and #2 were lost in BPH-1 and LNCaP cell lines, potentially reflecting simultaneous down-regulation of miR-34b/c. [score:4]
Importantly, deregulated miR-34b signaling appears to selectively segregate with androgen -dependent prostate cells, suggesting a potential role of this pathway in disease relapse and potentially in the transition to castrate-resistant stage. [score:4]
MiR-34b and miR-34c are transcribed from the same locus on chromosome 11 (cytogenetic band 11q23.1; Fig 5A), and their expression is regulated by epigenetics, such as CpG island methylation [29], and p53 function [32]. [score:4]
miR-34b expression modulation in prostate cell lines. [score:3]
Lastly, expression of miR-34b-3p accurately discriminated PIN or PCA samples from BPH, by ROC analysis (p<0.0001; S2 Fig). [score:3]
In this analysis, reduced miRNA levels correlated with clinico-pathological progression of PCa (Table 2), and differential expression of mir-31, miR-34b-3p and miR-452 could significantly discriminate patients according to biochemical relapse (Fig 4A). [score:3]
Together, these data suggest that decreased expression of miR-34b in PCa may involve a combination of epigenetic silencing and DNA copy number loss (S2 Table). [score:3]
MiR-34b-3p regulates the expression of stem cell-related factors, including c-Myc, Sox2, Met and Notch1 [33, 34], which have also been implicated in prostate cancer [35– 37]. [score:3]
0130060.g006 Fig 6 A) Sox2 expression was analyzed by immunoblotting in BPH-1 or DU145 cells after transfection with miR-34b mimics or control sequence for 72 h. Untr. [score:3]
The miR-34 family of miRNAs has been previously reported to suppress tumorigenesis by different mechanisms, including modulation of cell cycle transitions, EMT, metastasis, or cancer stemness [33]. [score:3]
In contrast, DU145 cells did not exhibit modulation of miR-34b/c expression, or allelic copy number loss (Fig 5D and 5E). [score:3]
Both miR-31 and miR-34b-3p were differentially expressed between PIN or PCa samples and BPH (p<0.001 by Mann Whitney test; Fig 4B). [score:3]
Sox2 is a miR-34b target in prostate cancer. [score:3]
Conversely, androgen-independent DU145 cells did not exhibit miR34b-modulation of Sox2 expression (Fig 6A), and LNCaP cells had no detectable levels of Sox2 (S4 Fig). [score:3]
p-miR-34b or a-miR-34b, precursor or antagonist miR-34b; p-Ctrl or a-Ctrl, non -targeting controls for precursor or antagonist molecules. [score:3]
Summary of epigenetic and genomic status of MIR34B/C locus according to miR-34b expression in the indicated prostate tissues or cell lines. [score:3]
MiR-31, miR-34b-3p, miR-205, miR-224 and miR-452 showed differential expression levels between normal, PIN and PCa matched samples (p<0.01 by Friedman test; Fig 3). [score:3]
Protein levels of the predicted target c-Myc and Notch1 were analyzed by western blotting (Panel B) in the indicated cell lines modulated for miR-34b levels. [score:3]
A) Sox2 expression was analyzed by immunoblotting in BPH-1 or DU145 cells after transfection with miR-34b mimics or control sequence for 72 h. Untr. [score:3]
Altogether this evidence suggests that miR-34b/Sox2 axe might be involved in the transition from indolent disease (hormone-sensitive PCa) to more aggressive phases. [score:3]
B, C) miR-34b-3p and miR-34c-5p expression in the indicated samples of normal prostate (pool of 10 specimens), benign hyperplasia (BPH), prostate cancer (PCa) or non-neoplastic (RWPE-1), hyperplastic (BPH-1) or tumor (LNCaP, DU145) prostate cell lines. [score:3]
Hyperplastic (BPH-1) or tumor (LNCaP and DU145) prostate cell lines were transfected with miR-34b mimic/inhibitor or controls for 72 hours and total RNA was purified as described above. [score:3]
In this analysis, only four miRNAs were differentially expressed in both human prostate cancer cell lines and tumor samples from TRAMP mice, including miR-34b-3p, miR-34c-5p, miR-138, and miR-224 (Fig 2C and 2D). [score:3]
MicroRNA-34b and MicroRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth. [score:2]
A miR-34b-3p-SOX2 axis is selectively deregulated in androgen -dependent PCa. [score:2]
miR-34b-3p is a biomarker of prostate cancer progression. [score:1]
A partial degree of methylation could be detected in all cell lines but BPH-1, in which MIR34B/C locus was epigenetically silenced (Fig 5F and 5G). [score:1]
In this study, we have shown that loss of miR-34b is associated with progression of prostate cancer, and can accurately discriminate between benign hyperplasia and PIN lesions or infiltrating prostatic adenocarcinoma in humans. [score:1]
S2 Fig Receiver operating curves (ROC) analysis was used to assess the accuracy of miR-34b-3p to discriminate between prostatic intraepithelial neoplasia (PIN), or prostatic carcinoma (PCa) and benign prostatic hyperplasia (BPH). [score:1]
When analyzed for epigenetic status by methylation-specific PCR, the CpG island upstream of the MIR34B/C locus (Fig 5F) was significantly more methylated in prostate cancers than normal or hyperplastic prostate samples (50% versus 30% or 0% respectively, p = 0.026 by chi-square test; Fig 5G). [score:1]
miR-34b-3p levels correctly discriminate between benign and neoplastic prostatic lesions. [score:1]
Therefore, we examined the BPH patients, a subset of PCa samples (randomly selected from series B; Table 1), normal prostate specimens, and non-tumorigenic or invasive prostate cell lines for potential allelic copy number variation, and methylation status of the CpG island of the MIR34B/C locus (Fig 5B–5G). [score:1]
F, G) Analysis of MIR34B/C CpG island epigenetic status was performed by methylation specific PCR in matched normal or neoplastic (PCa) prostate parenchyma, benign hyperplastic samples and prostate cell lines. [score:1]
0130060.g005 Fig 5 A) Schematic diagram of human MIR34B/C locus on chromosome 11q. [score:1]
MIR34B/C gene analysis in prostate cells and human tissues. [score:1]
Methylation analysis of MIR34B/C CpG island. [score:1]
p-miR-34b, precursor-miR-34b; a-miR-34b, antagomiR-34b; Ctrl, mock -transfected control. [score:1]
A) Schematic diagram of human MIR34B/C locus on chromosome 11q. [score:1]
[1 to 20 of 49 sentences]
14
[+] score: 145
It is imperative to recognize that (1) expression of miR-34b/34c/449 in normal tissues is lung-enriched and is reduced in lung cancer in general, whereas many other non-lung-enriched miRNAs could be also greatly differentially expressed between normal and cancerous lung tissues, (2) the predicted miR-34b/34c/449 targets from the developmental process GO term classify AD and SCC better than the predicted targets from other tested GO categories, whereas many other miRNAs and their target genes could be also differentially expressed between AD and SCC, and (3) the 17-gene signature is the final chosen predictor based on their best SAM false detection rate, whereas all 153 genes (the number of genes with eligible data points in Database 1 only) also gave the same prediction error rate as the 17 core genes did. [score:14]
The log2 -based background fluorescence intensity is between 5 and 6, so tumor lung and non-lung normal human tissues have essentially no miR-34b expression and some minimally detectable miR-34c, consistent with the TaqMan [®] -based results in the panel A. D, expression of the 17 "core" genes in specimens from the Database 1; blue bar, genes with higher expression in SCC; red bar, genes with higher expression in AD; *, two genes with higher expression in normal lung; scale bar represents fold change while gray in the heat map indicates missing data. [score:11]
It has been shown that the union of miRNA target genes predicted by three computational algorithms (miRanda, PicTar, and TargetScan) is one of the strategies that give the highest sensitivity [24], which predicted total 2414 unique gene symbols targeted by miR-34b/34c/449 (see Additional file 3 for complete list of genes), and 2033 of these genes were categorized in GO. [score:7]
Examining the predicted target sites of miR-34b/34c/449 in these 17 genes showed that most of the genes have target sites predicted by at least 2 of the 3 algorithms and at least 2 target sites predicted by at least one of the algorithms (Table 2). [score:7]
Since genes targeted by miRNAs determine the final biological activities of these miRNAs, miR-34b/34c/449 is likely to regulate expression of lung cancer markers that might define certain phenotypes of this tumor. [score:6]
Expression of a minimal set of 17 predicted miR-34b/34c/449 target genes derived from the developmental process GO category was identified from a training set to classify 41 AD and 17 SCC, and correctly predicted in average 87% of 354 AD and 82% of 282 SCC specimens from total 9 independent published datasets. [score:6]
Click here for file Summary of gene lists generated from random controls (predicted targets of miR-141/146b/216 and first and second sets of 17 random genes) and 11 TGF-beta pathway genes from predicted targets of miR-34b/34c/449. [score:5]
Click here for file A complete list of target genes for miR-34b/34c/449 predicted by miRanda, TargetScan, and PicTar. [score:5]
Therefore, it does not preclude the roles of other miR-34b/34c/449 targets, and other miRNAs and their targets. [score:5]
In one report expression of miR-34b and 34c were higher than 7 other tissue types [8], while the other one showed that precursor miR-34b and 34c expression was primarily in lung and testis [18]. [score:5]
A complete list of target genes for miR-34b/34c/449 predicted by miRanda, TargetScan, and PicTar. [score:5]
A search of miRNAs preferentially expressed in normal lung in our previously published dataset found a group of 3 miRNAs (miR-34b, miR-34c, and miR-449) that had approximately a thousand copies or less each cell in testes, fallopian tubes, lung, and trachea, while the rest of tissues examined had no or barely detectable levels of expression [9] (Figure 2A). [score:5]
Although miR-34a was initially identified having tumor-suppressing activity together with miR-34b/34c [20], miR-34a is rather ubiquitously expressed in most human tissues and not enriched in lung [9]; yet, this does not exclude the possibility of miR-34a involving in lung cancer tumorigenesis. [score:5]
Summary of gene lists generated from random controls (predicted targets of miR-141/146b/216 and first and second sets of 17 random genes) and 11 TGF-beta pathway genes from predicted targets of miR-34b/34c/449. [score:5]
Predicted target genes of miR-34b/34c/449 ontologically termed with developmental processes distinguish lung adenocarcinomas from squamous cell carcinomas. [score:4]
One is from our previous published miRNA expression profiles in the NCI-60 panel of cell lines derived from human cancers that used real-time PCR for quantitation [22], and the expression of miR-34b and miR-34c in 9 cell lines derived from lung was compared with that in normal lung tissue obtained from our body map data [9] (Figure 3, and Addition file 2 and its Table 1). [score:4]
Computationally predicted target genes of three microRNAs, miR-34b/34c/449, that were detected in human lung, testis, and fallopian tubes but not in other normal tissues, were filtered by representation of GO terms and their ability to classify lung cancer subtypes, followed by a meta-analysis of microarray data to classify AD and SCC. [score:3]
The third report did not have information for miR-34c but showed increased expression of miR-34b in lung [19]. [score:3]
Independent studies demonstrated reduced expression of miR-34b/34c in lung cancer. [score:3]
Figure 3 A similarity metric demonstrates the correlation of miR-34b/34c expression between lung cancer cell lines (blue letters). [score:3]
Expression of the four miRNA sequences quantitated in this study (miR-34b/34bN and miR-34c/34cN) in normal lung is from 90-fold to over 1,300-fold higher than in any of the lung cancer cell lines tested (Figure 2B). [score:3]
Lung-enriched expression of miR-34b/34c was also observed in three other independent studies. [score:3]
All NSCLC cell lines are in the blue bracket, suggesting that expression of miR-34b/34c/449 might be candidates to classify different types of lung cancer. [score:3]
Figure 2 A, expression of miR-34b/34c/449 is enriched in normal lung, fallopian tube, and testis. [score:3]
The promoter regions of miR-34b/34c genes have potential p53 -binding sites that have been experimentally verified, and both miRNAs are part of the p53 tumor suppressor network [20]. [score:3]
Another dataset used a bead -based technology to quantitate miRNAs [8], and the expression of both miR-34b and miR-34c is again significantly higher in normal lung than in 6 lung tumor specimens (Figure 2C, p = 0.004 and 0.002, respectively, by t-test). [score:3]
Two random sets of 17 genes were also selected to use the Database 1 as the training set and predict AD/SCC in the Database 2. Classification and prediction of AD and SCC subtypes using the miR-34b/34c/449 prediction targets and the 17-gene signature, respectively, are clearly better than randomized controls. [score:3]
Three miRNAs, miR-141/146b/216, were randomly chosen and all subsequently procedures followed the same workflow for the miR-34b/34c/449 including prediction of targets, screening of gene symbols and GO categories/terms, union of all selected genes, and clustering analysis of tumor specimens. [score:3]
This echoes the observation made by a separate group in which miR-34b expression was found decreased by more than 90% in 4 out of 5 AD and 2 out of 8 SCC [19]. [score:3]
C, expression of miR-34b/34c is reduced in both human and mouse primary lung cancer tissues compared to normal lung. [score:2]
B, expression of miR-34b/34c/449 is reduced in the 9 lung cancer cell lines of the NCI-60 panel compared to normal lung, represented by ΔC [T ](tumor cell line – normal lung). [score:2]
This gene signature probably represents the least but definitely not the most of miR-34b/34c/449-target genes that participate in tumorigenesis of lung cancer, but the data have suggested the significance of the TGF-beta pathway in these two lung cancer subtypes for future validation and certainly deserves further investigation. [score:1]
The calculation of the distance matrix was based on the ΔC [T ](the average C [T ]of miR-34b/34bN/34c/34cN between two cell lines), so the smaller the ΔC [T], the more similar expression levels of the four miRNA sequences are in the two cell lines (more red in the heat map). [score:1]
It might be important to appreciate the fact that miR-34b/34c are expressed in several organs (such as ovary) in additional to lung (unpublished data) in mice, and that whether roles of these two miRNAs underlying lung AD and SCC would be different between human and rodents, since animal mo dels might be used in the future to evaluate the activities of miR-34b/34c/449. [score:1]
[1 to 20 of 34 sentences]
15
[+] score: 132
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c, hsa-mir-449a, hsa-mir-449b, hsa-mir-449c
By looking more precisely at the three major families of regulators of small GTPases expressed during HAECs differentiation or after miR-34/449 transfection, we detected 23 distinct ARHGAPs, including ARHGAP1; we also detected 22 distinct ARHGEF transcripts but none of them were predicted as direct miR-34/449 targets; regarding the three known mammalian ARHGDI transcripts 40, only ARHGDIB was further analysed, as ARHGDIA expression levels did not change during HAECs differentiation or after miR-34/449 transfection and ARHGDIG was not detected (Supplementary Fig. 3b, see also GEO GSE22147). [score:9]
Considering that R-Ras activity can be increased by Notch pathway activation, as previously observed in another cellular mo del 39, and considering the early repression of Notch signalling by miR-34/449 during vertebrate multiciliogenesis 9, miR-34/449 is therefore able to control R-Ras function at two distinct levels: (1) directly, via the inhibition of RRAS expression, and (2) indirectly, via the inhibition of R-Ras activity through the repression of the Notch pathway. [score:9]
Previously, we knocked down miR-449 in Xenopus MCCs by injecting a cocktail of morpholino antisense oligonucleotides against miR-449a/b/c (449-MOs) into the prospective epidermis at the eight-cell stage 9. In Xenopus, miR-34b was detected in MCCs (Supplementary Fig. 2d–f), and in situ hybridization (ISH) experiments also revealed that 449-MOs not only blocked the expression of miR-449 but also blocked the expression of miR-34b (Supplementary Fig. 2f), suggesting that 449-MOs collectively inhibit miR-34/449 miRNAs (Supplementary Fig. 2e,f). [score:8]
Specifically, we looked for relevant miR-34/449 mRNA targets that were repressed during MCC differentiation and after overexpression of miR-34/449 in proliferating HAECs (Gene Expression Omnibus (GEO) data set GSE22147). [score:7]
RRAS2 expression remained at a very low level during MCC differentiation and in response to miR-449 overexpression, and was not altered by miR-34/449 knockdown or PO- RRAS protection (HAECs, see GEO GSE22147; Xenopus, Supplementary Fig. 4c). [score:6]
MiR-34/449 may initially downregulate the expression of several cell cycle-regulated genes and members of the Notch pathway to promote entry into differentiation. [score:6]
In a bid to identify such additional factors, we applied several miRNA target prediction tools 58 to identify putative miR-34/449 targets among the small GTPase pathways. [score:5]
Next, we focused on the three most significantly regulated miR-34/449 targets ARHGAP1, ARHGDIB and RRAS. [score:4]
We thus looked for other possible targets of miR-34/449 that would be directly related to actin dynamics. [score:4]
Of note, in Xenopus, the percentage of cells exhibiting defective apical actin meshwork was higher in miR-34/449 morphants (Fig. 2b) than in PO- Dll1 morphants (Fig. 2d), suggesting that miR-34/449 may affect additional targets. [score:3]
In control embryos and in miR-34/449 morphants, almost all rGBD-GFP -positive cells expressed the early MCC differentiation marker α-tubulin (Fig. 3c). [score:3]
In Xenopus epidermis, miR-449a and miR-34b were both specifically expressed in MCCs, and their levels in the developing epidermis showed a similar evolution (Supplementary Fig. 2d, see also ref. [score:3]
Thus, following the experimental inhibition of miR-34/449 in Xenopus, RhoA activation can still be detected in MCCs unable to grow cilia. [score:3]
These results establish ARHGAP1, ARHGDIB and RRAS transcripts as bona fide targets of miR-34/449. [score:3]
We found that in proliferating A549 cells, a human lung cell line devoid of miR-449 and miR-34b/c, miR-449 overexpression increased actin stress fibres and focal adhesion formation (Fig. 1c,d, see also Supplementary Fig. 3d,e). [score:3]
In conclusion, our data further document how the miR-34/449 family can participate to multiciliogenesis through the repression of several important targets. [score:3]
The huge induction of miR-449 expression at early ciliogenesis (stage EC) suggests that early effects were mainly mediated through miR-449, without excluding a later role for miR-34 (Supplementary Fig. 2a). [score:3]
Incidentally, the existence of five miR-34/449 -binding sites in the 3′-UTR of ARHGAP1 made elusive the assessment of a target protection of ARHGAP1 against a miR-34/449 action in primary HAEC cultures. [score:3]
This could also explain the lack of compensation of miR-34 in our antago-449 conditions, which do not alter the expression of miR-34. [score:3]
miR-34/449 targets components of the small GTPase pathways. [score:3]
These data posit the absence of R-Ras in miR-34/449 -expressing MCCs as a conserved feature across tetrapods. [score:3]
Collectively, these results suggest that, although the modulation of RhoA activity by miR-34/449 may play a role in the control of apical actin polymerization, other miR-34/449 targets contribute to the profound disruption of the actin cap observed after miR-34/449 inactivation. [score:3]
As miR-34 and miR-449 miRNAs share the same targets, we only used miR-449 in the rest of this study. [score:3]
We used target protection assays (cholesterol-conjugated modified oligonucleotides in HAECs or morpholino oligonucleotides in frog epidermis) to compete with the binding of miR-34/449 on sites identified within the human and Xenopus 3′-UTRs of RRAS mRNA. [score:2]
At the dose used for this assay, injection of MO-ATG- rras alone had no significant effect on either apical actin meshwork formation or multiciliogenesis (Fig. 7a–d), suggesting that rras expression may be already repressed by the presence of endogenous miR-34/449 in those MO-ATG- rras maturing MCCs. [score:2]
To invalidate miR-449 or miR-34b/c activity in human, we transfected HAECs with a cholesterol-conjugated antagomiR directed against miR-449 (Antago-449) or against miR-34 (Antago-34) and assessed MCC differentiation. [score:2]
In addition, miR-34/449 knockdown or protection of RRAS mRNA from miR-34/449 in frog epidermis led to an increase in rras transcript levels (Supplementary Fig. 4c). [score:2]
Collectively, these assays unambiguously establish that RRAS transcripts were specifically targeted by miR-34/449 in human and Xenopus MCCs. [score:2]
We designed target protection assays in which cholesterol-conjugated modified oligonucleotides were transfected in differentiating HAECs to compete with the binding of miR-34/449 on the site identified within the human 3′-UTR of ARHGDIB mRNA (PO- ARHGDIB). [score:2]
Thus, our data show that the miR-34/449 family clearly contributes to actin cytoskeleton remo delling in several independent mo dels. [score:1]
MiR-449 -mediated silencing of either ARHGAP1, ARHGDIB or RRAS was respectively abolished when miR-34/449-predicted binding sites were mutated (Fig. 4c). [score:1]
In human (Fig. 6a,b) and in Xenopus (Fig. 7a,d), protection of the RRAS transcript from miR-34/449 binding led to a strong reduction in apical actin meshwork and motile cilia formation. [score:1]
We also noticed a reduction of miR-449 levels when preventing miR-34/449 binding on Notch1 in differentiating HAECs (Fig. 1f) and on Dll1 in frog epidermis (Fig. 2f). [score:1]
Xenopus embryos at stage 34 were fixed in paraformaldehyde 4% overnight and frozen in 100% methanol at −20 °C overnight before performing ISH with digoxigenin -labelled locked nucleic acid (Exiquon) probes against miR34b (5′ -DIG- caatcagctaactacactgcctg -DIG-3′) 9. Human. [score:1]
We examined whether the miR-34/449 family can control the formation of the apical actin network, a prerequisite for basal body anchoring and cilium elongation. [score:1]
miR-34/449 control apical actin network assembly in MCCs. [score:1]
How to cite this article: Chevalier, B. et al. miR-34/449 control apical actin network formation during multiciliogenesis through small GTPase pathways. [score:1]
Our data unambiguously indicate that the repression of RRAS at a late step of MCC differentiation by miR-34/449 is required for apical actin network assembly and multiciliogenesis in human (Fig. 6) as well as in frog (Fig. 7). [score:1]
We observed that preventing the binding of miR-34/449 on Notch1 (PO- Notch1 in HAECs, Fig. 1a,b) or on the Notch ligand Dll1 (PO- Dll1 in Xenopus, Fig. 2c–f) with protector oligonucleotides coordinately blocked multiciliogenesis and apical actin network formation. [score:1]
These results establish that the miR-34/449 family interferes with MCC apical actin meshwork formation in both mo dels. [score:1]
Next, we addressed the precise mode of action of miR-34/449 in the construction of the apical actin network in MCCs. [score:1]
3′-Cholesterol linked 2′- O-methyl miR-449a/b or miR-34b/c antisense oligonucleotide (antagomiR, antago-449: 5′- c [s] u [s] c [s] uucaacacugccacau [s] u [s] u -Chol-3′, antago-34: 5′- g [s] c [s] a [s] aucagcuaacuacacugc [s] c [s] u -Chol-3′), Notch1 protector oligonucleotide 5′- a [s]a [s]a [s]aaggcaguguuucugug [s]u [s]a -Chol-3′ and RRAS protector oligonucleotide (PO- RRAS: 5′- c [s] g [s] u [s] uggcagugacauuuauu [s] u [s] u -Chol-3′) were purchased from Eurogentec (Seraing, Belgique). [score:1]
This is consistent with the need for an early repression of the Notch pathway by miR-34/449, to allow MCC differentiation. [score:1]
These observations point to the participation of miR-34/449 and R-Ras to actin network reorganization and their capacity to alter the RhoA activity. [score:1]
As the miR-34/449 family represses the Notch pathway during MCC differentiation 9, we assessed the contribution of the Notch signal to the actin web reorganization. [score:1]
miR-34/449 control apical actin assembly by repressing R-Ras. [score:1]
However, we cannot rule out discrete changes in the sub-cellular localization of activated RhoA in miR-34/449 -deficient embryos. [score:1]
Its repression by miR-34/449 appears to affect centriole maturation, but not apical actin network assembly 48. [score:1]
In a tentative mo del (Fig. 8d), we propose that the silencing of R-Ras by miR-34/449 in MCCs affects the interaction between R-Ras and FLNA, and favours a redistribution of FLNA in a cytoskeletal components involved into the anchoring of basal bodies. [score:1]
[1 to 20 of 49 sentences]
16
[+] score: 121
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, hsa-mir-34c
The relative intensity was normalized to the expression of the control sample Fig. 6 a Western blot analysis after Ant34 treatment (50 nM for 7 days as described above), b miR34 transduction and c p63 expression after Numb overexpression. [score:7]
In an opposite way as the inhibition, miR34 overexpression induces a downmodulation of cKit, Notch, and hey-1 expression (Fig.   5b). [score:7]
The mRNA expression on different LNA34 -treated CDCs showed that miR34 inhibition causes an increase of cKit, Notch-1 and hey-1 expression (Fig.   5a). [score:7]
Protein expression analysis after mir34 inhibition, overexpression or Numb transduction. [score:7]
The relative intensity was normalized to the expression of the control sample a Western blot analysis after Ant34 treatment (50 nM for 7 days as described above), b miR34 transduction and c p63 expression after Numb overexpression. [score:7]
It has been demonstrated in mouse mo del that miR34 inhibition reduces cardiac dysfunction 6, 7. Boon and coworkers [7] found that miR34 is implicated in cardiac aging and its downmodulation through LNA inhibition supports cardiac repair in mice after AMI. [score:5]
We observed an increased Numb expression by miR34 inhibition (Fig.   6a). [score:5]
It is worthy to note that LNA34 treatment enhances not only Notch mRNA, but also hey-1 expression, indicating that the Notch pathway is activated after miR34 inhibition. [score:5]
Gene expression analysis after mir34 inhibition or transduction. [score:5]
MiR34 expression directly correlates with age in human biopsies (r = 0.125037328, p = 0.010672365) On the basis of this evidence, we silenced miR34 using an LNA 8mer (Ant34). [score:4]
This indicates an indirect correlation between miR34 expression and proliferation in these cell populations. [score:4]
Our data demonstrate not only that Numb is regulated by miR34 in cardiac stem cells, but also that Numb overexpression itself induces an increase in cardiac progenitors growth (revised by Wu and Li [19] in other mo dels as mouse and drosophila). [score:4]
To confirm the regulative activity of miR34, we overexpressed in CDCs mature miR34 with lentiviral vector. [score:4]
It is possible to assess that in the dividing population miR34 is less expressed compared with the quiescent population (result of three independent experiments on five different CDCs populations p ≤ 0.05) We tested in our specimens the relation between age and miR34 relative expression [7]. [score:4]
Our study represents the first evidence that miR34 inhibition in human cardiac progenitor/stem cells could be proficiently employed in new therapeutic interventions for human cardiac pathologies. [score:3]
It is possible to observe a clear incorporation of Numb after overexpression, Rab5 was used as exosomal protein normalizer A recent report has demonstrated that the miR34 downmodulation after MI induces a functional recovery and an increase in the scar reduction in mice [7]. [score:3]
The two separated populations were examined for the ability to form spheres in culture (Fig.   1b) and for miR34 relative expression (Fig.   1c). [score:3]
Growth rate after mir34 inhibition. [score:3]
Moreover, by overexpressing miR34 we observed that Numb was also specifically downmodulated (Fig.   6b). [score:3]
Boon et al. [7] have shown that miR34 is involved in cardiac aging and its downmodulation through LNA inhibition supports cardiac repair in mice after AMI (acute myocardial infarction). [score:3]
The indication of this downmodulation by miR34 prompted us to test if the role of miR34 can be due to the Numb overexpression after Ant34 treatment. [score:3]
The ability of miR34 to downmodulate c-Kit has been demonstrated in colon cancer cells [16], where it has been linked to p53 expression. [score:3]
It is possible to assess that in the dividing population miR34 is less expressed compared with the quiescent population (result of three independent experiments on five different CDCs populations p ≤ 0.05) Real-time PCR of total RNA from 32 biopsies. [score:2]
Mir34 expression in cardiac human specimens vs age. [score:2]
MiR34 has been reported to target different genes in various cellular system that can account its function. [score:2]
In these cells, miR34 modulates, in vitro, various genes that are clearly involved in cardiac development and/or repair. [score:2]
As already found in cancer stem cells [17], miR34 plays an apparent bimodal role, regulating as Notch as Numb pairwise. [score:2]
MiR34 expression in Cardiac stem cells subpopulation. [score:2]
We observed that the less proliferating (CSFE++) cells had a higher expression of miR34 compared with the more proliferating cells (CSFE--). [score:2]
Our results show that miR34 has a complex role in human cardiac progenitor cells, where its downmodulation induces a cascade essential for cardiac repair, as assessed in mouse mo dels [7]. [score:1]
First, we tried to evaluate the miR34 expression in proliferating CSs cells. [score:1]
MiR34 expression directly correlates with age in human biopsies (r = 0.125037328, p = 0.010672365) a FACS analysis to evaluate Ant34a 5' FITC-LNA’s ability to enter into human CDCs/CSs by gymnosis after treatment (50 nM for 24 h). [score:1]
One of the most promising miRNAs in this regard is miR34 (reviewed by Li et al. [4]), which acts as a controller in reprogramming efficiency, while miR34 ablation shows a higher susceptibility to induced progenitor stem cells (iPSC) generation without compromising self-renewal and differentiation [5]. [score:1]
We observed, after miR34 downmodulation, an increase of Notch and its downstream-activated gene hey-1. In cardiac progenitor cells Notch-1 activation, with the nuclear translocation of Notch-1 intracellular domain (N1ICD), stimulates proliferative signaling such as G1/S cyclins and p38 (revised by Li and coworkers [24]) in vitro, induces myocytes differentiation [25], MAPK activity and promotes immature cardiomyocytes expansion. [score:1]
In particular, our results indicate that miR34 downmodulation plays a role in human cardiac progenitor proliferation. [score:1]
The authors deduced that the repair activity could be also due to the increased vascularization in the infarcted zone in in vivo mouse mo del, where LNA34 antisense (Ant34) treatment induces angiogenesis and promotes proliferation in endothelial progenitor cells and Human Umbilical Vein Endothelial Cells (HUVECs) 7, 8. The aim of this work was to establish whether the cardiac repair activity of miR34 inhibition could be used for human heart treatment, evaluating in vitro the influences of Ant34 in human heart cardiac stem cells. [score:1]
Our study indicates, for the first time, to the best of our knowledge, that the role of miR34 downmodulation in cardiac repair can also be held by Numb, which has been found to be important in cardiac morphogenesis [19]. [score:1]
[1 to 20 of 37 sentences]
17
[+] score: 117
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
Systemic overexpression of miR-34, which is broadly expressed and regulates physiological processes, could target genes in healthy tissues and cause side effects such as cardiovascular disease, although this may be minimised by the use of the particular liposome formulation [92]. [score:10]
[41] In the mouse, miR-34a is located on chromosome 4, while miR-34b/c are located on chromosome 9. Analysis of miR-34a tissue distribution in the mouse shows that it is ubiquitously expressed but with the highest levels of expression in the brain, while miR-34b/c are mainly expressed in the lung [23], although, in general, the basal expression of miR-34a is higher than that of miR-34b/c. [score:9]
[41] In the mouse, miR-34a is located on chromosome 4, while miR-34b/c are located on chromosome 9. Analysis of miR-34a tissue distribution in the mouse shows that it is ubiquitously expressed but with the highest levels of expression in the brain, while miR-34b/c are mainly expressed in the lung [23], although, in general, the basal expression of miR-34a is higher than that of miR-34b/c. [score:9]
This down-regulation is associated with hypermethylation of the neighboring CpG island; and DAC (5-aza-2'-deoxycytidine) treatment rapidly restores miR-34b/c expression. [score:6]
In addition, since a considerable number of oncogenes are direct targets of miR-34, and cancer is now considered a multipathway disease [34- 36], this therapeutic approach would allow the use of only one bullet to hit more than one pathway deregulated by the loss of miR-34. [score:6]
In addition, the correlation between miR-34 family expression and patient survival would not always support its tumor suppressor role. [score:5]
Ectopic expression of the members of the miR-34 family can recapitulate some biological functions of p53 such as apoptosis [20, 45] and cell cycle arrest [46, 47], at least in some cell types, although other studies have failed to demonstrate an apoptotic effect of overexpressed miR-34 [44, 48]. [score:5]
Despite the lack of spontaneous tumours in miR-34 knockout mice, there is evidence, at least in some cancers, for miR-34 dysregulation. [score:3]
Moreover, miR-34 knockout mice are born with the normal Men delian ratio, are fertile, and are not, as might be expected, a phenocopy of the p53 knockout. [score:3]
miR34 expression in human cancer. [score:3]
miR-34 Targets list in Cancer. [score:3]
The miR-34 family, which consists of miR-34a, b and c, has attracted a lot of attention since it plays a key role as a tumor suppressor in several cancers [16- 18]. [score:3]
Therefore, we would predict that the reduction of miR-34 expression is associated with poor prognosis and survival. [score:3]
In this subset of cells, including CD44+ cells from individual patients tumours, expression of miR-34a, but not miR-34b/c, is also reduced and this does correlate with p53 status [54]. [score:3]
In particular, the miR-34 family binds to the 3'-UTRs of genes such as CDK4 and CDK6 [50, 51] (cell cycle) [19], Bcl-2 [24, 52] (apoptosis), SNAIL [29, 32] (epithelial mesenchymal transition) [53] and CD44 (migration and metastasis) [54], and the miR-34 family thus represses their expression. [score:3]
Thus, while, miR-34 expression is reduced in some tissues in p53 null mice, in others it remains unaffected, confirming the promiscuity and cell context dependency referred to above. [score:3]
Mir-34b/c is also downregulated in colorectal cancer (CRC). [score:3]
In contrast, miR-34b/c are mainly expressed in the ovary, testes, trachea and lung (http://mirnamap. [score:3]
In human ovarian cancer (83 samples) miR-34 family expression was found to be reduced when compared to six (apparently mouse) ovarian surface epithelium cell samples. [score:2]
The last 7 years of studies have clearly shown that the miR-34 family is a master regulator of tumor biology. [score:2]
Figure 1 summarizes regulators and functions of the miR-34 family. [score:2]
TAp73 is a direct transcriptional activator of miR-34a, since it binds to p53 consensus elements in the miR-34a promoter, but TAp73 does not activate miR-34b and c. This role of the TAp73/miR-34a axis in neuronal differentiation is consistent with the predominantly neuronal phenotype of TAp73 null mice. [score:2]
The miR-34 family acts on apoptosis and cell cycle through the repression of many proteins involved in the regulation of these two biological processes. [score:2]
Clearly, future studies are required in order to have a more coherent picture of the miR-34 family regulation in cancer and whether this family can be used as a prognostic biomarker [80, 81]. [score:2]
The miR-34 Family: origin, regulation and function. [score:2]
Thus, miR34 null mice do not develop spontaneous tumors like p53 knockout mice [55]. [score:2]
Although, as mentioned above, the miR-34 family is regulated by p53, it would be more correct to say the p53 family [42]. [score:2]
The miR-34 family regulators and their functions. [score:2]
As a result of these and other studies, a miR-34 analogue has become the first microRNA to enter the clinic after a surprisingly swift 6 years passage from the bench to bedside. [score:1]
Although this is at first sight surprising, this correlation analysis of the human hepatocellular carcinoma dataset is in agreement with a previous report, and may be further evidence for the cell context dependency of the biological effects of miR-34. [score:1]
On the other hand, the phase 1 clinical trail that has recently started represents an important step forward not only for miR-34 itself, but forms a valuable proof of principle study for the rationale of using miRNAs as anticancer drugs. [score:1]
Methylation of the miR-34b/c CpG island was frequently observed in CRC cell lines and in primary CRC tumors (101 of 111, 90%), but not in normal colonic mucosa [63, 64]. [score:1]
In mammals, the miR-34 family consists of three homologous transcripts miR-34a, miR-34b and miR-34c. [score:1]
Moreover, systemic delivery of miR-34 in a mouse mo del of hepatocellular carcinoma resulted in a reduced tumor burden and prolonged survival [33]. [score:1]
In particular, miR-34 null mice do not show increased spontaneous or irradiation -induced tumorigenesis, and show only small and subtle differences from wild-type mice in other p53 -dependent functions such as replicative senescence and the DNA damage response [55, 56]. [score:1]
Survival correlation of miR-34 family in several human cancer datasets. [score:1]
miR-34 family survival analysis in cancer. [score:1]
The miR-34 gene was first identified in C. elegans where it encodes a single miR that is evolutionarily conserved in several invertebrates [37, 38]. [score:1]
However, the genes coding for both miR-34b and miR-34c map to chromosome 11q23.1 and are located within intron 1 and exon 2 respectively, of the same primary transcript. [score:1]
However, it should be remembered that miR-34 and p53 have independent functions. [score:1]
Indeed, although the endpoint of this clinical trial at this stage is to investigate the safety, pharmacokinetics and pharmacodynamics of the miR-34 mimetic in patients with unresectable primary liver cancer, it might shed light on two main challenges for miRNA -based therapies: i) delivery system and ii) potential off-target effects. [score:1]
There is also some evidence for the involvement of the miR-34 family, again particularly miR-34a, in cancer stem cells (CSCs). [score:1]
[1 to 20 of 42 sentences]
18
[+] score: 93
Eight targets resulted significantly downregulated after treatment with 5′-AZA: CDK6 and DNMT3B (validated targets of miR-29a-3p), E2F3 (validated target of miR-34b-3p), and OLFM3 and IFNAR1 (predicted targets of miR-517a-3p) were downregulated in both cell lines. [score:15]
DNMT3A (validated target of miR-29a-3p), BCL2 (validated target of both miR-34b-3p and miR-181c-5p), CCNE2 (validated target of miR-34b-3p) were downregulated only in SH-SY5Y (Figure 1). [score:10]
In silico analysis of DE miRNAs targets allowed to select four validated targets for both miR-29a-3p (CDK6, DNMT3A, DNMT3B, RAN) and miR-181c-5p (BCL2, GATA6, KIT, SIRT); five validated targets for miR-34b-3p (BCL2, CCNE2, CDK4, E2F3, MYB); four predicted targets for miR-517a-3p (IFNAR1, OLFM3, TNIP1, WEE1) (Supplementary Table S4). [score:9]
CDK6, DNMT3A, DNMT3B (targets of miR-29a-3p) and CCNE2, E2F3 (targets of miR-34b-3p) were downregulated in both cell lines after transfection with the respective miRNAs mimics, compared to matched scramble -transfected cells in at least one time point (Figure 2). [score:7]
Expression of miR-34b-3p is known to be epigenetically regulated by 5′-AZA [23], but to date its altered expression has not been associated with neuroblastoma. [score:6]
Single TaqMan expression assays (STAs), extended to miR-34b (another member of the miR-34 cluster), revealed that miR-29a-3p, 34b-3p, 181-c-5p and 517a-3p are upregulated in at least three different neuroblastoma cell lines (Table 1). [score:5]
A network of protein-protein interactions was generated from nodes CDK6, DNMT3A, DNMT3B (targets of miR-29a-3p) and CCNE2 and E2F3 (targets of miR-34b-3p) and extended to their first neighbor interactants. [score:5]
CDK6, DNMT3A, DNMT3B (targets of miR-29a-3p), CCNE2 and E2F3 (targets of miR-34b-3p) were given as input and interactions among them and their first interactants were automatically retrieved. [score:5]
MiR-34a (another member of the miR-34 family) is a known tumor suppressor in neuroblastoma; it has been suggested as an epigenetic target for treatment of diffuse large B-cell lymphoma by 5′-AZA [10, 24, 25]. [score:5]
A similar consideration may be made for CDK6, DNMT3A, DNMT3B and E2F3, which we propose as targets for miR-29a-3p and miR-34b-3p: their increased expression is related to poor prognosis. [score:5]
Our data suggest tumor-suppressor properties also for miR-34b-3p in neuroblastoma: its increased expression is linked to decreased levels of neuroblastoma cell viability. [score:5]
A negative correlation (even though statistically not significant) among miR-29a-3p, DNMT3A (r = −0.48) and DNMT3B (r = −0.60), as well as among miR-34b-3p and its candidate targets CCNE2 (r = −0.14) and E2F3 (r = −0.19) was observed. [score:3]
MiR-34b-3p was significantly downregulated in SK-N-BE(2)-C and GI-ME-N (Supplementary Figure S2A). [score:3]
In conclusion, our experimental data demonstrate that miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p are involved in neuroblastoma and are potential new therapeutic targets in neuroblastoma. [score:3]
Expression profiling of 754 miRNAs, combined with methylation assays of specific CpG islands and in silico analyses, allowed us to focus on miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p. [score:2]
MiR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p regulate neuroblastoma cell viability. [score:2]
Cells were transiently reverse -transfected with 30 pmoles of miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics or equal amounts of scrambled molecules for 24h and 48h, by using siPORTNeoFX Transfection Agent (Ambion [®], Austin, TX), according to the manufacturer's instruction. [score:1]
Transfection with miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics determined a significant decrease of cell viability, both in SK-N-BE(2)-C and in SH-SY5Y. [score:1]
Briefly, 1.2 x 10 [4] cells / well were reverse -transfected with miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics or equal amounts of scrambled molecules and were grown for 24h and 48h. [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 92
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
The re -expression of miR-34 led to a marked reduction in the expression of its target gene, Notch-1. The loss of expression of miR-34 in colon cancer is in part due to promoter hypermethylation of miR-34, which can be re-expressed with our novel agent CDF, suggesting that CDF could be a novel demethylating agent for restoring the expression of miR-34 family, and thus CDF could become a newer therapeutic agent for the treatment of colon cancer. [score:13]
Our current observation on colorectal cancer tissues and those reported by others show that miR-34 is downregulated in colorectal cancer, suggesting that downregulation of this microRNA may partly contribute to the unregulated cellular growth and drug resistance that occurs in colorectal cancer. [score:8]
Indeed, up-regulation of miR-34 has been shown to induce cell-cycle arrest, inhibition of invasion and migration and p53 induced apoptosis [16, 17]. [score:6]
Numerous cellular events, including deregulated expression of microRNAs (miRNAs), specifically the family of miR-34 consisting of miR-34a, b and c, is known to regulate the processes of growth and metastasis. [score:5]
Emerging evidence suggests that p53 acts as a transcription factor to increase the expression of the miR-34 family members which, in turn, modulate cell cycle progression, senescence and apoptosis, inhibition of invasion and migration [12, 13]. [score:5]
Our current observation that CDF induces the expression of miR-34a and miR-34c in chemo resistant and p53 defficient colon cancer cells, which suggests that CDF is effective in re -expressing miR-34 and could be a potential therapeutic agent for colorectal cancer. [score:5]
Moreover, we also assessed the expression of miR-34 in colon cancer cell lines treated with our newly developed synthetic analogue of curcumin referred as difluorinated curcumin (CDF) compared to well known inhibitor of methyl transferase. [score:4]
It is essential to develop the strategy for restoring the expression of miRs specifically the family of miR-34 which are dysregulated in cancer. [score:4]
In view of this, it is tempting to speculate that p53 -mediated processes of apoptosis in colon cancer cells could be affected by down-regulation of miR-34. [score:4]
Members of the miR-34 family act as a tumor suppressor, hence their reduction or loss in colonic mucosa leads to malignancy as reported in other cancers [30]. [score:3]
Family of miR-34 that includes 34a, b and c has been reported to inhibit CSLCs [9]. [score:3]
Additionally, we used HCT116 CR cells to examine how CDF acts for miR34 expression in drug resistance. [score:3]
Silencing of miR-34 expression due to its promoter hypermethylation of the CpG site has been documented in colon cancer [28, 31], suggesting that the use of demethylating agents like azacitidine (Aza-dC) and decitabine could be useful for the treatment of solid tumors [32] although these agents show unacceptable side effects. [score:3]
We further extended our study for CpG methylation analysis of the miR-34a promoter only, since its expression was found to be relatively higher than miR-34b, miR-34c in all human tissues except lung [33]. [score:3]
The expression of miR-34a and miR-34b/c in different cancers has earlier been shown to be silenced by CpG methylation in the promoter region in different cancer [31]. [score:3]
Our primary objective was, therefore to determine whether, CDF would modulate miR-34 expression in colon cancer cells. [score:3]
Therefore, demthylation is likely to enhance the expression of miR-34. [score:3]
So far, no studies have been performed to determine whether of miR-34 could be expressed in colon cancer by any novel agent(s). [score:3]
Archival formalin-fixed paraffin-embedded tissues from normal colonic mucosa and colon tumors were obtained from the Pathology Service of the John D. Dingell VA Medical Center; Detroit through the Wayne State University IRB approved protocol to isolated RNA for assessing the expression of miR-34 family. [score:3]
The family of miR-34, that includes miR-34a, b and c, has been known to regulate several cellular events, including cell cycle, cell migration and apoptosis [16, 17]. [score:2]
To investigate whether the effect of CDF on miR-34 expression is p53 dependent, we extended our study using HCT116p53−/− and SW620 (p53 mutant, where G > A mutation in codon 273 of the p53 gene results in an Arg > His substitution) cell lines. [score:2]
Although the reason is unclear, why CDF could not induce miR-34 in HCT116Wt cell, one possibility could be the over growth making CDF less available to induce miR-34. [score:1]
However, little is known whether agent(s) that modulates colon CSLCs would also modulate the family of miR-34 in colon cancer cells or not. [score:1]
To determine the miRNA-34 levels, RNA isolated from FFPE tissues using miRNeasy FFPE Kit (Qiagen) and from cultured cells using miREasy kit (Qiagen) was utilized. [score:1]
This relevant information prompted us to determine whether CDF could be utilized to modulate the family of miR-34, and if so, whether CDF -induced modulation of miR-34 could in part be attributed to epigenetic alterations, specifically the methylation status of the promoter of miR-34. [score:1]
[1 to 20 of 25 sentences]
20
[+] score: 89
Strikingly, 13 of the 22 upregulated genes contained 3′UTR miR-34 ‘seed’ matches and were predicted targets of the miR-34 family (Fig. 5 A–B). [score:6]
We performed a microRNA -expression screening and identified 5 members of the miR-34 family (miR-34bc and miR-449abc) as highly expressed from late meiosis to the sperm stage. [score:5]
MiR-34b/c stood out from this analysis due to the binary nature of their expression, essentially being absent in SSCs to representing one of the most abundantly expressed miRNAs in post mitotic germ cells (Fig. 2A–B). [score:5]
The miR-34b/c -targeted mice were then crossed to the FLP expressing transgenic mice (FLPeR) [42] to remove the frt flanked neo [r] cassette, resulting in the generation of the miR-34bc [Fl] allele. [score:5]
Mice heterozygous for the miR-34bc [Fl], targeted Dcr and miR-449 targeted alleles were crossed to Deleter Cre [43] to generate the miR-34b [−], Dcr [FH] and miR-449 [−] alleles, respectively. [score:5]
From the 9 validated miR-34 target genes identified, the forkhead transcription factor FoxJ2 merits special interest as it contains two highly conserved miR-34 binding sites and has been shown that transgenic levels of FoxJ2 overexpression are incompatible with male fertility [40]. [score:5]
In contrast, miR-449a displayed the binary expression as miR-34b/c during spermatogenesis but had an overall lower expression (Fig. 2A–B). [score:5]
MiR-34a and miR-34b/c loci are direct p53 target genes with the ability to repress induced reprogramming [33]– [35]. [score:4]
The word corresponding to seed matching miR-34 family (Red) is enriched in the up-regulated genes. [score:4]
With the similarity of expression of miR-34b/c and miR-449 loci and their potential to be functionally redundant with respect to spermatogenesis, we generated miR-34bc [−/−];449 [−/−] mice (Fig. 3A) that were born in Men delian ratios. [score:3]
The expression of the miR-34 family members is summarized from the array data. [score:3]
Both the miR-34b/c and miR-449 showed highly restricted expression profiles across an assortment of mouse tissues (Fig. 2C) [32]. [score:3]
miR-34b/c and miR-449 are selectively expressed in post-mitotic spermatogenesis. [score:3]
For the miR-34bc loss of function allele, the targeting strategy allows for Cre -mediated deletion of the hairpins that encode both miR-34b and miR-34c. [score:3]
Our analysis identifies miR-34b/c and miR-449 loci as specifically and abundantly expressed in post-mitotic germ cells. [score:3]
To generate this allele, a targeting construct was generated that contains the 5′ 3.65 kb and 3′ 4.6 kb homology arms, an frt flanked neo cassette with a loxP site 5′ of the miR-34b/c encoding sequences and a second 3′ loxP site. [score:3]
Northern blotting of testicular RNA revealed the robust expression of miR-34b/c and miR-449a at postnatal day 14, a time when the appearance of pachytene spermatocytes is observed. [score:3]
The onset of the phenotype in miR-34bc [−/−];449 [−/−] mice perfectly coincided with the expression domain of miR34b/c observed in wild type adult spermatogenesis. [score:3]
Next we wanted to determine the precise onset of miR-34b/c and miR-449a during spermatogenesis and we decided to take advantage of the first wave of spermatogenesis, as it proceeds in a near synchronous manner with the appearance of successive spermatogenic populations across juvenile mouse development (Fig. S1A). [score:2]
Thus in combination with the histological analysis we can conclude that the miR-34 family has multiple functions during spermatogenesis both in regulating meiosis as well as the later stages of spermiogenesis (Fig. 4F). [score:2]
This unbiased approach revealed a highly significant enrichment (p = 2.44×10 [−9]) for the complementary seed match of miR-34 family (CACTGCC) in the cohort of most unregulated genes (Fig. 5D). [score:2]
Representative images from one of three independent experiments are shown for panel E and F. The miR-34 family genes are proven important regulators of cell fate and physiology. [score:2]
The miR34a locus also regulates cardiac function upon aging, however none of the individual miR-34 family gene disruptions affects fertility in mice (Fig. S2) [32], [34]– [36]. [score:2]
Position of the DNA encoding the pre-miR-34b and pre-miR-34c are indicated. [score:1]
Our study identifies the miR-34b/c and miR-449 as the first miRNA loci required for mammalian spermatogenesis. [score:1]
The miR-34b/c miRNAs are part of a miR-34 family encompassing six miRNAs (miR-34a, b, c and 449a, b, c) encoded by three distinct loci (miR-34a, miR-34b/c and miR-449) (Fig. 2B). [score:1]
Also indicated is the gene function as well as number of miR-34 binding sites. [score:1]
Representative images from one of three independent experiments are shown for panel E and F. (A) qRT-PCR of miR-34a, miR-34b, miR-34c and miR-449a from control (Ctl) and miR-34bc [−/−];449 [−/−] adult testis. [score:1]
A 9 kb DNA fragment corresponds to the wild-type miR-34b/c locus, integration of the loxP site 3′ of introduces an additional HindIII site, thus decreasing the size of the HindIII DNA fragment recognized to 5 kb. [score:1]
Having established that loss of both miR-34b/c and miR-449 loci results in oligoasthenoteratozoospermia, we next wanted to define the etiology of this disorder. [score:1]
The miR-34b and miR-34c miRNAs are derived from a single non-coding transcriptional unit. [score:1]
[1 to 20 of 31 sentences]
21
[+] score: 85
In this study, we demonstrated that the expression of miR-34 family members is generally down-regulated in late-gestational fetal KCs by NGS. [score:6]
6. The miRNA-34 Family is Down-regulated in Late-gestational Fetal KCs and Extensively Targets the TGF-β Pathway. [score:6]
Although the potential target genes of miR-34b-5p are TGF-βRII and SMAD3, as predicted by miRanda, miR-34b-5p may have regulatory effects on the miR-34c-5p potential target genes TGF-β3, TGF-βRII, SMAD4 and SAR1A. [score:6]
The overexpression of the novel miRNA candidates and miRNA-34 family members in early- to mid-gestational fetal KCs may contribute to scarless wound healing by targeting the TGF-β pathway. [score:5]
The overexpression of miR-34 family members may suppress the TGF-β signal pathway and leads to a loss of control of miR-34a. [score:5]
Moreover, the significantly differentially expressed miRNAs, including some novel miRNA candidates and miR-34 family members, extensively target the TGF-β pathway. [score:5]
We considered that the expression of miRNA-34 family members is generally down-regulated in late-gestational fetal KCs. [score:5]
The expression levels of miR-34a-3p, miR-34b-5p, and miR-34c-3p were changed by more than 2.0-fold, suggesting that these miRNAs are expressed at significantly lower levels. [score:5]
We considered that the overexpression of miR-34 family members may contribute to scarless wound healing in mid-gestational fetal KCs by targeting the TGF-β pathway. [score:4]
Among all of the TGF-β pathway-related miRNAs, five known miRNAs (miR-3180-3p, miR-34b-5p, miR-877-3p, miR-936, and miR-940) and 10 novel miRNA candidates (seq-915_x4024, seq-5118_x304, seq-6713_x208, seq-14465_x69, seq-18595_x48, seq-19788_x44, seq-38785_x17, seq-38875_x17, seq-48658_x13, and seq-52107_x11) target pathway members that positively regulate the pathway. [score:4]
TGF-βRII and SMAD3 were potential target genes of miR-34b-5p. [score:3]
Furthermore, we predicted that miR-34 family members may extensively suppress the TGF-β signal pathway. [score:3]
To predict potential target genes of miRNA-34 family members, we used the miRanda online software. [score:3]
Thirty-three differentially expressed miRNAs and miR-34 family members are correlated with the transforming growth factor-β (TGF-β) pathway. [score:3]
The results showed that the miRNA-34 family may extensively suppress genes that play important roles in the TGF-β pathway, including TGF-β3, TGF-βRI, TGF-βRII, SMAD3, SMAD4 and SAR1A (Fig 4b and 4c). [score:3]
With the exception of miR-34a-5p, the expression levels of miR-34 family members in late-gestational fetal KCs were significantly lower (p value <0.05). [score:3]
The potential target genes of miR-34b-3p were TGF-βRI, SMAD4 and SAR1A. [score:3]
With the exception of miR-34a-5p (p value = 0.078), the expression levels of miR-34 family members in late-gestational fetal KCs were significantly lower than those in mid-gestational fetal KCs (Fig 4b). [score:3]
However, the regulatory effects between miR-34 family members and TGF-β signal pathway are markedly more complicated. [score:2]
Therefore, there are six mature miR-34 miRNAs: miR-34a-3p, miR-34a-5p, miR-34b-3p and miR-34b-5p, miR-34c-3p and miR-34c-5p. [score:1]
Nucleotides 1–10 from the sequence of miR-34c-3p and nucleotides 2–11 from the sequence of miR-34b-3p are matched perfectly. [score:1]
Nucleotides 2–10 from the sequence of miR-34b-5p are perfectly matched to nucleotides 1–9 from the sequence of miR-34c-5p. [score:1]
The human miR-34 miRNA precursor family consists of three members encoded by two different transcripts: miR-34a, which is encoded by its own transcript, and miR-34b and miR-34c, which share a common primary transcript. [score:1]
MiR-34a-3p, miR-34b-5p, and miR-34c-3p changed by more than 2.0-fold. [score:1]
Furthermore, the mature sequences of miR-34 are highly similar to each other. [score:1]
Although the mature sequences of miRNA-34 family members were highly similar to each others’, mature miR-34b does not have the same seed sequences as the others. [score:1]
Of all the miR-34 family members, miR-34a has been well studied. [score:1]
[1 to 20 of 27 sentences]
22
[+] score: 71
The miR-34a and the miR-34b/c loci are direct transcriptional targets of the TP53 tumor suppressor (Chang et al., 2007; He et al., 2007; Raver-Shapira et al., 2007; Tarasov et al., 2007), the levels of which, in turn, are indirectly augmented by miR-34. [score:7]
MK5 is a MYC target gene that encodes a kinase that phosphorylates and activates FOXO3A, which then directly activates the expression of the miR-34b/c promoter (Kress et al., 2011). [score:6]
MiRNAs also modulate inflammatory pathways mediated by the transcription factors NFΚB and STAT3 by directly inhibiting IL-6 (via Let-7 miRNAs, which are inhibited by LIN28B) or the IL-6 receptor (via miR-34 and miR-125b). [score:6]
First, miR-34 directly represses Mdm4 (HDM4 in humans), which encodes a RING-finger protein that binds to TP53 and blocks its ability to activate target genes (Okada et al., 2014). [score:4]
This relationship might be integral to the tumor-suppressive properties of miR-34 miRNAs; the negative regulation of Wnt signaling might also mediate miR-34 -driven repression of intestinal stem cell fate (see below). [score:4]
Known relationships between canonical Wnt signaling and miRNAs are illustrated in Fig.  3. Also operating upstream of Wnt, the miR-34 family (miR-34a/b/c) directly targets and represses multiple effectors of Wnt signaling, including WNT1, WNT3, LRP6 (a Wnt ligand co-receptor), β-catenin and LEF1 (an HMG-box transcription factor that, like TCF4, interacts with β-catenin) (Kim et al., 2011). [score:4]
Known relationships between canonical Wnt signaling and miRNAs are illustrated in Fig.  3. Also operating upstream of Wnt, the miR-34 family (miR-34a/b/c) directly targets and represses multiple effectors of Wnt signaling, including WNT1, WNT3, LRP6 (a Wnt ligand co-receptor), β-catenin and LEF1 (an HMG-box transcription factor that, like TCF4, interacts with β-catenin) (Kim et al., 2011). [score:4]
p53 regulates nuclear GSK-3 levels through miR-34 -mediated Axin2 suppression in colorectal cancer cells. [score:4]
These miRNAs regulate mRNAs involved in the cell cycle (Ebner and Selbach, 2014), growth (Kress et al., 2011), DNA damage (Takeda and Venkitaraman, 2015) and apoptosis (Ebner and Selbach, 2014); these interactions are likely to be associated with the tumor-suppressive properties of miR-34 miRNAs and their ability to induce apoptosis and senescence (Tazawa et al., 2007). [score:4]
p53 and microRNA-34 are suppressors of canonical Wnt signaling. [score:3]
A positive feedback between p53 and miR-34 miRNAs mediates tumor suppression. [score:3]
Lastly, several miRNAs have effects on EMT in CRC tumorigenesis, with miR-15/16 and miR-34 (which are transcriptionally activated by TP53) inhibiting this process, while miR-21 enhances EMT. [score:3]
Aside from acting as an effector of TP53, miR-34a expression downstream of the canonical oncogenic transcription factors, MYC and STAT3, described above, provides negative feedback on tumor cell proliferation, survival and metastasis, which highlights the multifaceted mechanisms by which miR-34 represses tumorigenesis. [score:3]
Thus, both MYC and TP53 can promote miR-34 expression. [score:3]
Studies using cultured human CRC cells (Bu et al., 2013) and mouse mo dels (Bu et al., 2016) indicate that miR-34 also regulates IESC and CRC stem cell division. [score:2]
In summary, many miRNAs act as regulators of the Wnt pathway at multiple levels of the signaling cascade, and some miRNAs, such as miR-34, are capable of restraining both Wnt and Notch signaling pathways. [score:2]
Second, miR-34 promotes modest (and probably indirect) stimulation of the TP53 promoter (Gao et al., 2015). [score:2]
The transcription of miR-34 is directly stimulated by TP53, providing insight into how TP53 can repress Wnt signaling (Kim et al., 2011). [score:2]
Independent of TP53, miR-34 is induced by FOXO3A (forkhead box O3a transcription factor) in a feedback loop involving MK5 and MYC. [score:1]
The connection of miR-34 with TNFα and IL-6 also highlights the key role of inflammation, which increases the risk and fuels the progression of CRC (Lasry et al., 2016). [score:1]
The miR-34 family consists of miR-34a, transcribed at one locus, and miR-34b and miR-34c, co-transcribed at another locus. [score:1]
Repression of c-Kit by p53 is mediated by miR-34 and is associated with reduced chemoresistance, migration and stemness. [score:1]
The miR-34 anti-oncomiR family and TP53. [score:1]
[1 to 20 of 23 sentences]
23
[+] score: 64
miRNA Expression in cancers Expression in neurodegenerative disorders Target genes Reference Silenced in breast cancer and cancer metastasis by DNA methylation Decreased in Huntington’s disease REST/CoREST Chan et al. (2005), O’Donnell et al. (2005), Lanni et al. (2012) miR-29a/29b-1 Decreased in various cancers Decreased in Alzheimer’s disease MCL1, DNMT3A, DNMT3B, BACE1 Lujambio et al. (2008), Du et al. (2012), Junn and Mouradian (2012) miR-34b/34c Silenced in colon cancer and cancer metastasis by DNA methylation Decreased in Parkinson’s disease MET, CCNE2, CDK4, CDK6 Fabbri et al. (2007a), Mott et al. (2007) Aberrant DNA methylation at CpG island promoters of tumor suppressor genes is one of the most important mechanisms of human carcinogenesis. [score:15]
Interestingly, several miRNAs differentially expressed in neurodegenerative diseases such as, miR-29 family, and miR-34 family are considered to be potential tumor suppressor miRNAs (Table 1). [score:6]
MicroRNA profiling of Parkinson’s disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial function. [score:6]
miR-34b/c downregulation induced a decrease in the expression of DJ1 and Parkin, two proteins associated to familial forms of PD. [score:6]
DJ1 and Parkin expression was reduced in PD brain samples displaying strong miR-34b/c downregulation. [score:6]
These data suggest that early deregulation of miR-34b/c, which are direct targets of p53, in PD triggers downstream transcriptome alterations underlying mitochondrial dysfunction and oxidative stress, which ultimately compromise cell viability (Minones-Moyano et al., 2011). [score:5]
miRNA expression profiles revealed decreased expression of miR-34b and miR-34c in brain areas with variable neuropathological affectation at clinical stages of PD. [score:5]
Moreover, they have shown that DJ1 and Parkin are indirect targets of miR-34b/c. [score:4]
Downregulation of miR-34b/c was detected in pre-motor stages of PD. [score:4]
miR-34b and miR-34c are also reported to be direct targets of p53 and silenced by aberrant CpG island methylation in colorectal cancer (Toyota et al., 2008). [score:4]
miR-34 b/34c. [score:1]
Depletion of miR-34b or miR-34c in differentiated SH-SY5Y dopaminergic neuronal cells resulted in a moderate reduction in cell viability that was accompanied by altered mitochondrial function and dynamics, oxidative stress and reduction in total cellular adenosine triphosphate content. [score:1]
Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancer. [score:1]
[1 to 20 of 13 sentences]
24
[+] score: 60
Moreover, restoring expression of miR-15a/16-1 indirectly affects expression of miR-34 family by modulating p53 expression and downregulation of miR-29 and miR-181b in aggressive CLL contributes to overexpression of Tcl1 [43]. [score:13]
Besides, miR-15a/16-1 target TP53 while miR-34 targets ZAP-70 mRNA expression [32]. [score:7]
While no expression of miR-34b/c was detected, downregulation of miR-34a was observed in 17p deleted and/or TP53 mutated cases and in fludarabine-refractory cases even in the absence of 17p deletion/ TP53 mutation. [score:7]
11q deleted region includes the miR-34b/c cluster locus [30], while deletion of 17p leads to abrogation of the p53 tumor suppressor [31], and 13q deletion involves miR15a/16-1 downregulation. [score:6]
MicroRNA-34b/c and microRNA-34a11q deleted region includes the miR-34b/c cluster locus [30], while deletion of 17p leads to abrogation of the p53 tumor suppressor [31], and 13q deletion involves miR15a/16-1 downregulation. [score:6]
MiR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 family members, the most deregulated microRNAs in CLL, were found to regulate important genes, helping to clarify molecular steps of disease onset/progression. [score:5]
Zenz et al. studied miR-34a and miR-34b/c expression in refractory CLL with and without 17p deletion or TP53 mutation [33]. [score:4]
MiR-34 family members are involved in a fine-regulated feedback circuitry with p53 and miR-15a/16-1 in 13q deleted CLL, suggesting bidirectional interplay between microRNAs and genes. [score:3]
Several TP53 binding sites were found upstream miR-15a/16-1 on chromosome 13, miR-34b/c on chromosome 11, and miR-34a on chromosome 1. Thus, TP53 could induce the expression of these microRNAs [32]. [score:3]
TP53 transactivation of miR-34b/c is ineffective, since the locus is deleted, leading to a higher expression of ZAP-70 which correlates with poor prognosis [32] (Figure  1). [score:3]
Moreover, increased p53 levels in patients with 13q deletions associate with transactivation of miR-34b/c leading to reduced levels of ZAP-70, positively correlating with survival [3]. [score:1]
CLL patients with 11q deletion, instead, show lower levels of miR-34b/c and higher levels of ZAP-70. [score:1]
MicroRNA-15a/16-1. MicroRNA-34b/c and microRNA-34a. [score:1]
[1 to 20 of 13 sentences]
25
[+] score: 59
In addition, we also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. Further studies will be aimed at identifying the mechanism of promotion of p53 expression and its mechanism of negatively regulating let-7. In 2007, several groups identified the miR-34 family of miRNAs (miR-34a, b, and c) as a direct transcriptional target of the key tumor suppressor p53 [26]– [29], [36], [37]. [score:14]
One possible mechanism for the sensitization of cells to -mediated apoptosis is suggested by data showing that miR-34 targets CD44, which has been shown to inhibit -mediated apoptosis by directly binding the region required forL engagement. [score:6]
expression affects the ability of cells to upregulate miR-34 in response to genotoxic stress. [score:6]
In 2007, several groups identified the miR-34 family of miRNAs (miR-34a, b, and c) as a direct transcriptional target of the key tumor suppressor p53 [26]– [29], [36], [37]. [score:6]
The importance of miR-34a and miR-34b is highlighted by their loss of expression in more than a dozen different cancers [37], [38] suggesting a crucial role for miR-34 in suppressing tumorigenesis. [score:5]
It appears that the mere presence of p53 or can affect expression levels of miRNAs, although stimulation through did not have a major effect on the expression of either let-7 or miR-34 (data not shown). [score:5]
Although miR-34b and miR-34c are minor species in these cells, these miRNAs also displayed an enhanced response to etoposide treatment in overexpressing cells (Figure 3B ). [score:3]
Moreover a CD44 variant (CD44v6) binds the miR-34 target, c-Met, and this interaction is required for c-Met signaling [42]. [score:3]
miR-34a is ubiquitously expressed, whereas in most tissues miR-34b and miR-34c are minor species [37]. [score:3]
Induction of pluripotency by Oct24, Sox2, Klf4, and c-Myc in mouse embryonic fibroblasts induces all three miR-34 species to cooperatively inhibit reprogramming by repressing Nanog, Sox2, and N-myc [63]. [score:3]
miR-34 is a selective marker for cancer cells that are sensitive to -mediated apoptosis. [score:1]
Such miRNAs include the let-7 [20], miR-200 [60], and miR-34 families of miRNAs [61]– [64]. [score:1]
In addition, pancreatic cancer cells frequently display miR-34 loss due to epigenetic silencing by methylation. [score:1]
Let-7. p53 and miR-34. [score:1]
Taking into account the role of miR-34 as an effector for p53, it is not surprising that miR-34 also participates in protecting both stem cells themselves and the organism from pluripotent cells that have turned rogue. [score:1]
[1 to 20 of 15 sentences]
26
[+] score: 52
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
0067581.g002 Figure 2(a) qRT-PCR showing PDGFR-α and PDGFR-β mRNAs downregulation in Calu-6 and H1703 cells after miR-34 and miR-34c but not miR-34b enforced expression (b) miR-34a and miR-34c enforced expression decreases endogenous levels of PDGFR-α/β protein levels in H1703 and Calu-6 NSCLC. [score:8]
Moreover, we demonstrate that PDGFR-β is a miR-34a/c direct target while we did not see any significant effect on the expression of PDGFR-α and PDGFR-β after miR-34b enforced expression. [score:8]
In 2007, reports from several laboratories showed that members of the miR-34 family are direct p53 targets, and that their upregulation induced apoptosis and cell-cycle arrest [16, 17]. [score:7]
Among the miRNAs, miR-34 family members play important tumor suppressive roles, as they are directly regulated by p53 and compose the p53 network [16, 17]. [score:5]
MiR-34a or miR-34c and not miR-34b forced expression decreases PDGFRβ expression levels and reduces the activation of the ERK1/2. [score:5]
Luciferase and western blot experiments demonstrated that PDGFR-α and PDGFR-β are direct targets of miR-34a and miR-34c but not of miR-34b. [score:4]
Interestingly, increased expression of miR-34a and miR-34c, and not miR-34b, upon transfection, confirmed by qRT-PCR (data not shown), significantly decreased luciferase activity, indicating a direct interaction between the miRNAs and PDGFRα and PDGFRβ 3’ UTRs (Figure 1c,d). [score:4]
Taken together the results indicate that miR-34a and miR-34c and not miR-34b directly target PDGFR-α and PDGFR-β. [score:4]
Moreover, the promoter region of miR-34a, miR-34b and miR-34c contains CpG islands and aberrant CpG methylation reduces miR-34 family expression in multiple types of cancer [18, 19, 20]. [score:3]
MiR-34a and -34c (and not miR-34b) overexpression significantly reduced PDGFR-α and PDGFR-β mRNAs (Figure 2a) and the endogenous protein levels, compared to the cells transfected with a scrambled pre-miR (Figure 2b). [score:2]
In mammalians, the miR-34 family comprises three processed miRNAs that are encoded by two different genes: miR-34a is encoded by its own transcript, whereas miR-34b and miR-34c share a common primary transcript. [score:1]
A previous study indicated that miR-34 methylation was present in NSCLC and was significantly related to an unfavorable clinical outcome [20]. [score:1]
[1 to 20 of 12 sentences]
27
[+] score: 50
Thus, by computing the correlation coefficient using the NCI-60 expression profiling data, we quantified the correlation strength between miR-34 familiy and telomerase reverse transcriptase (hTERT) expression profile in different cancer cell lines (except neurologic cancer cells). [score:5]
Our data showed that miR-34a, miR-34b and miR-34c were underexpressed in more than half HCC samples compared with the adjacent tissues, suggesting that down-regulation of miR-34 famlily might be involved in the hepatic carcinogenesis (P < 0.05, Figure 1A–1B). [score:5]
Expression correlation between miR-34 family and hTERT or TP53 expression profile were analyzed using those two database. [score:5]
Kaplan–Meier curves showed that patients with underexpressed miR-34a and miR-34b had poorer overall survival and higher recurrence rates than those with higher expression (P < 0.05), whereas no substantial difference was observed for miR-34c (P > 0.05, Figure 1C–1D). [score:5]
The miR-34 family is frequently downregulated in cancer partly due to the inactivation of p53 [19]. [score:4]
miR-34 family is frequently down-regulated in HCC and associates with poor prognosis. [score:4]
To gain insight into the biological role of miR-34 family in human HCC development, we examined the expression levels of miR-34 family in 75 paired HCC samples by qRT-PCR. [score:4]
Recently, the miR-34 family (a, b and c) has gained attention as they were identified as p53 targets and regulate p53 -mediated cycle arrest and apoptosis [18]. [score:4]
Figure 2 (A, B) Relationship between miR-34 family levels and hTERT mRNA expression in NCI-60 cell lines. [score:3]
Figure 1 (A, B) miR-34a, miR-34b and miR-34c expression were significantly decreased in HCC compared with the corresponding adjacent tissues using qRT-PCR analyses. [score:2]
In addition, this relationship was also verified by the multivariate Cox regression analysis, which demonstrates that both miR-34a and miR-34b could be independent prognostic factors for the overall survival and recurrence in HCC patients underwent surgical resection (Table 1). [score:1]
We then examined the relationship between miR-34 family and telomerase activity in 75 HCC samples by qRT-PCR. [score:1]
Correlation of miR-34 family levels with telomerase activity. [score:1]
Previous reports showed that miR-34 -induced senescence in cancer cell is all in the form of telomere-independent cell cycle arrest. [score:1]
To further explore the potential roles of miR-34 family in affecting malignant characteristics, the expression levels of miR-34 family in tumor tissues were used to build a signature of prognosis. [score:1]
miR-34 family expression is associated with malignant characteristics in patients with HCC. [score:1]
Previous studies demonstrated that miR-34 family could induce cellular senescence by participating in cell cycle arrest. [score:1]
Until recently, it was unknown whether miR-34 family could induce cellular senescence in HCC in a telomere -dependent way. [score:1]
By analyzing nutlin-3a -treated cells, Kumamoto et al. firstly demonstrated that miR-34 family was involved in the p53 -dependent senescence pathway [28]. [score:1]
[1 to 20 of 19 sentences]
28
[+] score: 50
The miR-34 family is worth special attention because two of its members, mmu-miR-34a and mmu-miR-34b-5p, were significantly up-regulated one day after ENU exposure and maintained increased expression at the 5 subsequent time points up to PTD 30, while another family member, mmu-miR-34c, displayed significant over -expression at multiple time points from PTD 3 to 30. [score:8]
The miR34 family genes are the direct transcription targets of tumor suppressor p53 [32, 38]. [score:6]
Two miRNAs, mmu-miR-34a and mmu-miR-34b-5p, were up-regulated at all posttreatment time points except day 120. [score:4]
Up-regulation of miR-34a and miR-34b/c caused a cell-cycle arrest in the G1 phase [32]. [score:4]
Their expressions were enhanced by 3.21-fold (miR-34a), 3.11-fold (miR-34b) and 2.37-fold (miR-34c) on PTD 1 and the fold changes continued to increase and peaked at PTDs 7 or 15. [score:3]
TaqMan qPCR confirmation of the temporal expression changes of miR-34 family miRNAs. [score:3]
miR-34b/c inhibits cell proliferation and colony formation in soft agar [39]. [score:3]
TaqMan MicroRNA Assays were used to confirm the temporal expression changes of 3 miR-34 family members, mmu-miR-34a, mmu-miR-34b-5p, and mmu-miR-34c, as well as a miR-762 family member, mmu-miR-762. [score:2]
Confirmation of the temporal expression changes of three miR-34 family miRNAs and one miR-762 family miRNA by individual TaqMan assays. [score:2]
Figure 3 The temporal expression changes of three miR-34 family members and one miR-762 family member as determined by PCR arrays and individual TaqMan assays. [score:2]
A comparison of miR-34 family miRNA expression measured by the two different platforms is shown in Figure 3. The results from the two real-time PCR assay platforms are very consistent and show similar temporal kinetics of miRNA expression for miR-34 family miRNAs, rising from day 1 or 3, reaching peaks at day 15, and decreasing until the end of observation, day 120. [score:2]
Among these miRNAs, the miR-34 family is worth special attention. [score:1]
Interestingly, our results found that miR-34b and miR-34c changed in correlated manner at all the sampling time points (Figure 3). [score:1]
Our results indicate that the miR-34 family of miRNAs seems to have the potential to be valuable biomarkers for toxicological application. [score:1]
These biological processes controlled by miRNAs in the miR-34 family are related to ENU cytotoxicity, genotoxicity, and carcinogenicity. [score:1]
miR-34b-5p + + + + + + + + + + +Induction of cell cycle arrest by joining p53 network [55]. [score:1]
Moreover, miRNAs in the miR-34 family worth further study to explore their potential as biomarkers for exposure of genotoxic carcinogens. [score:1]
miRNAs in miR-34 family play important roles in various p53-initiated biological processes. [score:1]
Introduction of miR-34a and miR-34b/c into primary human diploid fibroblasts induces cellular senescence [35]. [score:1]
Another miRNA, mmu-miR-762 that is not similar with miR-34 family miRNAs in sequence, were also examined to confirm the array data. [score:1]
miR-34b and miR-34c are encoded by the same primary transcript from chromosome 11 in human or chromosome 9 in mouse while miR-34a is located in a different chromosome [35]. [score:1]
The promoter region of miR-34a and miR-34b/c each contain a palindromic sequence that matches the canonical p53 binding site and can be bound by p53 as shown by chromatin immunoprecipitation [32]. [score:1]
[1 to 20 of 22 sentences]
29
[+] score: 50
In return, some validated targets of miR-34b are anti-apoptotic factors and post-translational p53 inhibitors, which indicate that miR-34b can stabilize p53 in response to genotoxic stress [51]. [score:7]
Among the differentially expressed miRNAs in control and exposed mice, precursor and mature forms of miR-34b-5p were up-regulated in EDC-exposed animals (Table  2). [score:6]
Once activated, miR-34b and p53 may contribute directly to the regulation of apoptosis, cell cycle, and proliferative gene targets [50]. [score:5]
We selected miR-34b-5p since its precursor and mature form were up-regulated and it had been implicated in apoptosis, a process that was seen to increase after exposure to the mixture of EDCs. [score:4]
In conclusion, chronic exposure to a mixture of five EDCs induces changes in the expression profiles of specific miRNAs (such as miR-34b-5p, miR-7686-5p and miR-1291), along with alterations in the miRNAs/isomiRs association (in particular for miR-15b-5p, miR-18b-5p, miR-20b-5p, and miR-1981-5p) regulating mRNAs implicated in key biological process in the testes (Table  3). [score:4]
Besides miR-34b-5p, we found that miR-7686-5p levels were significantly up-regulated in exposed mice (Table  2). [score:4]
Thus, it is possible that the up-regulation of miR-34b-5p explains in part the increase of germ cell apoptosis that we observe in exposed testes. [score:4]
One of them, miR-34b-5p, was abundantly expressed in the testes. [score:3]
Hence, we suggest an important relationship between exposure to mixtures of EDCs and testicular damage due to changes in the expression of miRNAs, such as miR-34b-5p. [score:3]
Wu J Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesisProc. [score:2]
Furthermore, miR-34b is an important factor in the maintenance of spermatogenesis as it is necessary to the control of post-mitotic germ cell development and apoptosis. [score:2]
miR-34b-5p is involved in the regulation of genes relevant for cell cycle control, apoptosis, and infertility 23, 24. [score:2]
The results of RT-qPCR showed that miR-34b-5p, miR-7a-1-3p, and miR-99b-5p levels were similar to those found using sncRNA-Seq. [score:1]
Previous reports revealed that miR-34b/c deficiency is correlated with oligoasthenoteratozoospermia and infertility in mice 23, 24 along with “Sertoli cell only” syndrome, mixed atrophy, and arresting of germ cell differentiation in the biopsies of infertile patients 45, 46. [score:1]
Comazzetto S Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 lociPLoS Genet. [score:1]
These reports and our in silico analysis (Table  3) indicate that miR-34b-5p could be a pro-apoptotic factor induced in germ cells after EDCs exposure. [score:1]
[1 to 20 of 16 sentences]
30
[+] score: 48
Although expression of intragenic miR-9-1 is host gene-independent [9], we cannot exclude the possibility that the expression of miR-34b and miR-210 genes may also be coordinately controlled by regulatory mechanisms of their host genes. [score:6]
Thus, CpG islands of 9 disease-related miR genes, including 5 extragenic miR genes or gene clusters (miR-9-3, miR-137, miR-200b/200a/429, miR-203, and miR-375) and 4 intragenic genes or gene clusters (miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210), were selected as the representative genes in the present study (Additional file 1: Table S1). [score:3]
The expression levels of miRNA-9 and miRNA-34b were similar between SMs and GCs. [score:3]
However, a solid relationship between miR methylation and expression has not been thoroughly established as only weak supporting evidence has been provided in many of the previous studies, as we have summarized for 9 tested miR genes/clusters (extragenic miR-9-3, miR-137, miR-200b/200a/429, miR-203, miR-375; intragenic miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210) in this present study (Additional file 1: Table S2) [19- 27]. [score:3]
It has been suggested that methylation of the CpG islands that are associated with miR genes (i. e. miR-203, miR-152, miR-124-1, miR-34b/c, miR-129-2, miR-9-1, miR-130b, miR-124-2, and miR-181c) might inversely correlate with their expression levels [12- 17]. [score:3]
As a tumor suppressor gene, miR-34b/c methylation has also frequently been reported in many carcinomas including GCs [14, 51, 52]. [score:3]
Previous studies have suggested that mature miRNA-34b and miRNA-34c are targets of P53 [50]. [score:3]
This help explain why a significant inverse methylation -expression relationship was not observed for miRNA-34b, miRNA-210, or miRNA-375 as the average proportion of methylated miR-34b, miR-210, or miR-375 in SM and GC samples was relatively low (2% ~ 15%). [score:3]
In addition, we found that the prevalence of miR-34b methylation between SM and GC samples was similar; this is consistent with a recent report that miR-34b methylation might be an early field-effect in the development of GCs [55]. [score:2]
These findings strongly suggest that methylation of these miR CpG islands is related to the development of GCs (trend-test, miR-9-1, P < 0.001; miR-9-3, P < 0.001; miR-34b, P = 0.008; miR-137, P < 0.001; miR-210, P = 0.001; Table 1). [score:2]
The miRNA levels were then analyzed using a TaqMan Gene Expression Master Mix kit (Life Technologies) with the corresponding probe and primers (Life Technologies, miR-375 #TM000564, miR-34b #TM000427, miR-137 #TM000593, and miR-9 #TM000583). [score:2]
Inversed relationship between miR methylation of CpG islands and their corresponding expression levelsTo investigate the relationship between the above aberrant miR methylation and the transcription of the corresponding miR gene, we quantified the mature miRNA levels of miR-9-1, miR-9-3, miR-34b, miR-137, miR-210, miR-200b, (and miR-375), whose methylation status is related to the development of GC (and GC host adaptation) as described above, in a set of human cell lines with different methylation status of miR CpG islands. [score:2]
Similarly, the overall survival of GC patients with high miR-34b methylation (the proportion of methylated miR-34b > 4%) was likely longer than those with low miR-34b methylation (P = 0.119; Figure 4B). [score:1]
These results confirmed that miR-9-1 and miR-137 methylation was a tumor-specific event and that miR-9-3, miR-34b, and miR-210 methylation, as well as miR-200b demethylation, was a field-effect that occurred during gastric carcinogenesis. [score:1]
Methylation frequency of 5 miR CpG islands (miR-9-1, miR-9-3, miR-137, miR-34b, and miR-210) gradually increased while the proportion of methylated miR-200b gradually decreased during gastric carcinogenesis (Ps < 0.01). [score:1]
DHPLC chromatogram of methylated and unmethylated miR-34b in various cell lines. [score:1]
Such a relationship was not observed for miR-34b and miR-210 (Figure 3L, N). [score:1]
In the present study, we found that methylation or demethylation of all 7 tested miR CpG islands (GC-related miR-9-1, miR-34b, miR-9-3, miR-137, miR-210, miR-200b and host-related miR-375) was consistently, inversely correlated to a statistically significant level with their corresponding miRNA levels in a number of human cell lines in vitro. [score:1]
miR-34b and miR-34c constitute a miR gene cluster. [score:1]
As expected a significant difference in the positive rate or the proportion of methylated miR-9-3, miR-34b, miR-210, and miR-200b was not observed between GC and SM samples. [score:1]
In the present study, we did not find a significant correlation between miR-34b methylation and GC invasion; however, a higher proportion of methylated miR-34b was observed in stage I ~ II GCs than in stage III ~ IV GCs (P = 0.025). [score:1]
The overall survival of GC patients with methylated miR-34b (the proportion > 4%) was likely to be longer than in those patients without the methylation. [score:1]
Except for miR-9-1 and miR-137, the methylation positive rates or proportions of methylated miR-9-3, miR-34b, miR-210, and miR-200b in GCs were similar to those in SMs (Table 1). [score:1]
miR-34b methylation has been reported to relate to the invasiveness of non-small lung carcinoma, colorectal carcinoma, GC, and melanoma [53- 55]. [score:1]
As is consistent with others’ reports [14, 15, 19, 25, 27, 36- 40], miR-9-1, miR-9-3, miR-34b, miR-137, and miR-375 methylation was observed in gastric carcinogenesis in the present study. [score:1]
[1 to 20 of 25 sentences]
31
[+] score: 47
Furthermore, seven miRNAs were expressed more highly in C57BL/6J mice and were mainly downregulated across the time course (miR-92b-3p, miR-34b-5p, miR-672-5p, miR-31-5p, miR-34c-5p, miR-34b-3p, and miR-182-5p; listed in descending order according to the heat map in Figure 5). [score:6]
Five of these [miR-34b-3p, miR-34c-5p, miR-34b-5p, miR-92b-3p, and miR-182-5p; as well as miR-31-5p, which was identified through literature search (41)] belonged to the aforementioned seven miRNAs which were expressed more highly in the C57BL/6J mice and downregulated throughout the time course. [score:6]
These are comprised of miRNAs with a lower (miR-34b-5p and miR-92b-3p) or higher (miR-467e-5p) expression in DBA/2J vs C57BL/6J mice throughout the time course and those that are more highly expressed at 48 or 120 hpi only (miR-223-3p and miR-21a-3p). [score:5]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
The RT-qPCR analysis confirmed the higher expression of miR-223-3p, miR-21a-3p, and miR-467e-5p in DBA/2J and the lower expression of miR-34b-5p and miR-92b-3p after infection, compared to C57BL/6J (Figure 8B). [score:4]
When FC values were used, RT-qPCR detected changes in miR-21a-3p, miR-223-3p, and miR-34b-5p expression in the same direction as measured by RNAseq, whereas no significant regulation was observed for miR-467e-5p and miR-92b-3p (Figure 8A). [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
These 20 miRNAs (which included miR34 families, which are strongly associated with regulation of apoptosis and the PI3k-Akt pathway [e. g., Figure 6]) thus constituted part of a highly regulated response that can predominate in either strain, depending on the time after infection, and is likely to play a role in host susceptibility. [score:3]
The RT-qPCR data differed in a minor way from the RNAseq data in that expression of miR-34b-5p and miR-92b-3p at t = 0 did not differ significantly between the mouse strains (Figure 8B). [score:3]
Many miRNAs whose expression differed between DBA/2J and C57BL/6J mice during infection belong to the miR-467, miR-449, and miR-34 families. [score:3]
Higher abundance of antiapoptotic (e. g., miR-467 family) and lower abundance of proapoptotic miRNAs (e. g., miR-34 family) and those regulating the PI3K-Akt pathway (e. g., miR-31-5p) were associated with the more susceptible DBA/2J strain. [score:2]
The miR-34 and miR-449 families control epithelial barrier repair (65) and regulate multiciliogenesis via the Delta/Notch pathway (66, 67), which might help transport virions out of the respiratory tract (68) and reduce end-organ damage. [score:2]
Of note, miR-31-5p, miR-379-5p, miR-7a-5p, as well as some members of the miR-449 (-5p) and miR-34 (-5p) families were moderately to highly abundant (>10 CPM), making it more likely that they would bind to a biologically relevant number of viral RNAs. [score:1]
Using the ViTa Database, the human homologs of miR-135b-5p, miR-147-3p, miR-31-5p, miR-379-5p, miR-7a-5p, as well as the miR-449 (-5p) and miR-34 (-5p) families, were predicted to bind to viral RNA segments of influenza A/Puerto Rico/8/34/Mount Sinai (H1N1). [score:1]
[1 to 20 of 14 sentences]
32
[+] score: 44
The strong tumor-suppressive effects observed for miR-34 are likely due to the combined modulation of several target mRNAs involved in different oncogenic processes, rather than regulation of a single target, since none of the miR-34 target mRNAs alone can fully recapitulate the miR-34 loss-of-function phenotype (Kaller et al, 2011). [score:10]
Notably, p53, a well-known tumor suppressor that plays a key role in suppressing cancer by regulating cell cycle, apoptosis and DNA repair, has been shown to transcriptionally activate the expression of all miR-34 family members (Chang et al, 2007). [score:8]
Indeed, the seed -targeting 8-mer LNA was effective in inhibiting all three miR-34 family members in two different cardiac stress mo dels and attenuated cardiac remo deling and atrial enlargement, whereas inhibition of miR-34a alone with a 15-mer LNA -modified provided no benefit in the MI mo del (Bernardo et al, 2012). [score:7]
On the other hand, miR-34 can stimulate p53 activity by targeting and down -regulating SIRT1, an NAD [+] -dependent lysine deacetylase that removes protective acetyl groups on p53, causing p53 ubiquitylation and proteasome -mediated degradation (Yamakuchi et al, 2008), thereby establishing a positive feedback loop. [score:4]
The miR-34 family of miRNAs is consistently down-regulated in a broad range of malignancies. [score:4]
Based on its strong tumor-suppressive effects in vitro, many efforts have focused on increasing miR-34 levels in cancer cells by usings. [score:3]
The second study asked whether inhibition of the miR-34 family (miR-34a, -34b and -34c) by a subcutaneously delivered 8-mer LNA could provide a therapeutic benefit in mice with preexisting pathological cardiac remo deling and dysfunction due to MI (Bernardo et al, 2012). [score:3]
In most cases, the miR-34 mimic was delivered directly by intratumoral injections, which is only therapeutically feasible for easily accessible and localized tumors that have not yet metastasized (Wiggins et al, 2010). [score:2]
The miR-34 family has been shown to control cellular proliferation, cell cycle and apoptosis. [score:1]
In May 2013, Mirna Therapeutics announced the commencement of a phase 1 study of the liposome-formulated miR-34 mimic -based drug, designated as MRX34, in patients with primary liver cancer or metastatic cancer with liver involvement. [score:1]
miR-34 -based cancer therapeutics. [score:1]
[1 to 20 of 11 sentences]
33
[+] score: 44
Members of the miR-34 gene family (miR-34a, miR-34b, and miR-34c) are direct targets of p53, and their ectopic expression in cancer cells induces cell cycle arrest and apoptosis (Bommer et al., 2007; He et al., 2007). [score:6]
Introduction of miR-34b/c into cancer cells leads to the downregulation of candidate target genes, including MET, CDK4, cyclin E2 (CCNE2), and MYC (Lujambio et al., 2008; Toyota et al., 2008). [score:6]
Interestingly, ectopic expression of miR-34b in prostate cancer cells suppressed DNMTs and HDACs and induced partial demethylation and active chromatin modification of the endogenous miR-34b gene, which suggests a positive feedback loop. [score:5]
p53 -mediated activation of miRNA34 candidate tumor-suppressor genes. [score:3]
These findings, as well as their contribution to the p53 network, strongly imply that miR-34 family members act as tumor suppressors in cancer. [score:3]
miRNA-34b inhibits prostate cancer through demethylation, active chromatin modifications, and AKT pathways. [score:3]
miR-34b was recently shown to target both DNMTs and HDACs in prostate cancer cells (Majid et al., 2013). [score:3]
As in other malignancies, miR-34b is silenced in association with CpG island methylation in prostate cancer, and low miR-34b expression is strongly associated with poor survival. [score:3]
Methylation of miR-34b/c has also been linked to cancer metastasis (Lujambio et al., 2008) and invasion (Watanabe et al., 2012). [score:1]
In addition, miR-34b/c methylation was found to be elevated in the background gastric mucosa of multiple GC patients (Suzuki et al., 2010), and a subsequent study revealed that miR-34b/c methylation could be a marker for predicting the risk of metachronous GC (Suzuki et al., 2013). [score:1]
Aberrant methylation of microRNA-34b/c is a predictive marker of metachronous gastric cancer risk. [score:1]
Epigenetic inactivation of the MIR34B/C in multiple myeloma. [score:1]
Within the human genome, miR-34a is located on chromosome 1p36, while miR-34b and miR-34c are co-transcribed from a single transcription unit on chromosome 11q23. [score:1]
Frequent concomitant inactivation of miR-34a and miR-34b/c by CpG methylation in colorectal, pancreatic, mammary, ovarian, urothelial, and renal cell carcinomas and soft tissue sarcomas. [score:1]
Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancer. [score:1]
Methylation -associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defect. [score:1]
For instance, the CpG island of miR-34b/c is methylated in more than 90% of primary CRCs, and methylation was detected in 75% of fecal specimens from CRC patients and in 16% of specimens from high-grade dysplasia patients, suggesting miR-34b/c methylation could be a useful feces -based screening marker (Kalimutho et al., 2011). [score:1]
Epigenetically silenced miR-34b/c as a novel faecal -based screening marker for colorectal cancer. [score:1]
DNA hypermethylation of microRNA-34b/c has prognostic value for stage non-small cell lung cancer. [score:1]
In addition, genome-wide screening for miRNA genes with reduced levels of H3K4me3 and increased levels of H3K9me2 led to the identification of 13 miRNA genes, including the miR-124 family, miR-9 family, and miR-34b/c, that are epigenetically silenced in acute lymphoblastic leukemia (ALL; Roman-Gomez et al., 2009). [score:1]
[1 to 20 of 20 sentences]
34
[+] score: 43
The mir-34 genes induce cell cycle arrest, cellular senescence, and apoptosis when ectopically expressed (Bommer et al., 2007; He et al., 2007; Welch et al., 2007) through the downregulation of multiple target genes such as Bcl-2, Cyclin D1, Cyclin E2, CDK4, CDK6, c-Myc, and c-Met (Hermeking, 2010). [score:8]
In mice, mir-34a is ubiquitously expressed, with the highest expression being in the brain, whereas mir-34b/c is mainly expressed in the lung (Bommer et al., 2007). [score:7]
Lujambio et al. analyzed the miRNA expression profile of three metastatic cancer cell lines with and without the DNMT inhibitor 5-aza-2’-deoxycytidine and reported that the DNA methylation of three miRNAs (mir-9, mir-34b/c, and mir-148a) was associated with the metastasis of human cancers including lung cancer (Lujambio et al., 2008). [score:5]
mir-34a and mir-34b/c are intergenic miRNAs, and their expressions are regulated by the DNA methylation of their own promoters. [score:4]
Our research team analyzed the expressions of 55 in silico selected candidate miRNAs treated with or without 5-aza-2’-deoxycytidine and found that mir-34b/c and mir-126 are silenced by DNA methylation in NSCLC (Watanabe et al., 2012). [score:3]
p53 -mediated activation of miRNA34 candidate tumor-suppressor genes. [score:3]
In lung cancer, mir-34a and mir-34b/c are targets of epigenetic silencing by DNA methylation (Lodygin et al., 2008; Gallardo et al., 2009; Wang et al., 2011; Watanabe et al., 2012). [score:3]
MicroRNA-34b and MicroRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth. [score:2]
The CpG island methylation of mir-34b/c has also been reported in colorectal cancer (Toyota et al., 2008), oral squamous cell cancer (Kozaki et al., 2008), melanoma, and breast cancer (Lujambio et al., 2008). [score:1]
Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancer. [score:1]
In primary SCLC, mir-34a and mir-34b/c were methylated in 15% and 67% of the cases, respectively. [score:1]
DNA hypermethylation of microRNA-34b/c has prognostic value for stage non-small cell lung cancer. [score:1]
The miR-34 family in cancer and apoptosis. [score:1]
The DNA methylation of mir-34b/c is associated with a poorer prognosis in patients with NSCLC (Wang et al., 2011). [score:1]
We previously reported that mir-34b/c is methylated in 41% of primary NSCLC cases and that mir-34b/c methylation is associated with lymphatic invasion (Watanabe et al., 2012). [score:1]
Frequent methylation and oncogenic role of microRNA-34b/c in small-cell lung cancer. [score:1]
[1 to 20 of 16 sentences]
35
[+] score: 43
Kumamoto K Nutlin-3a activates p53 to both down-regulate inhibitor of growth 2 and up-regulate mir-34a, mir-34b, and mir-34c expression, and induce senescenceCancer Res. [score:11]
Recent reports demonstrate that inhibition of the miR-34 family does not promote tumorigenesis, supporting the potential for therapeutic suppression of this family as a treatment for BPD [56]. [score:5]
To address whether miR-34 expression was required and sufficient for the hyperoxia -induced lung injury and inflammation leading to the BPD pulmonary phenotype, we next asked whether only miR-34a overexpression itself was sufficient, in the absence of hyperoxia i. e., in RA. [score:5]
Given that the miR-34 family has been implicated in the p53 tumor suppressor network, and that p53 pathway defects are common features of human cancer [25], miR-34 inhibition therapy is considered a promising therapeutic approach [26]. [score:4]
Of note, miR-34 family members also have been recognized as tumor suppressor miRNAs. [score:3]
miR-34 overexpression in RA restores the BPD phenotype. [score:3]
Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc. [score:3]
a Representative graphs showing miR-34 expression in WT NB mice exposed to hyperoxia for 2, 4, and 7 days after birth and in the BPD mo del. [score:3]
In addition, in the PN7 HALI mo del, Ang1 treatment showed improved Ki67 staining levels similar to that of the miR-34 (−/−) mice lungs (Supplementary Fig.   7). [score:1]
b The wild-type Ang1 3′ UTR reporter vector was co -transfected into the MLE12 cells with either the N. C. mimic or miR-34a mimic c The WT Tie2 3′ UTR reporter vector was co -transfected into the MLE12 cells with either the N. C. mimic or miR-34-a mimic. [score:1]
Choi YJ miR-34 miRNAs provide a barrier for somatic cell reprogrammingNat. [score:1]
Concepcion CP Intact p53 -dependent responses in miR-34 -deficient micePLoS Genet. [score:1]
In addition, miR34a−/− mice [71] and conditional miR-34 [fl/fl] [72] (JAX laboratory) and SPC-CreER (gift from Brigid Hogan, PhD, Duke University, USA) were housed in the Yale and Drexel Universities Animal Care Facilities (New Haven, CT and Phila delphia, PA, respectively). [score:1]
Representative bar graph showing tamoxifen deletion of miR-34a in Spc CRE positive miR-34 KO lungs (T2-miR34a [−/−]). [score:1]
[1 to 20 of 14 sentences]
36
[+] score: 41
MiRNA families such as miR-200 (cfa-miR-200a, cfa-miR-200b and cfa-miR-200c), Mirlet-7 (cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7g and cfa-let-7f), miR-125 (cfa-miR-125a and cfa-miR-125b), miR-146 (cfa-miR-146a and cfa-miR-146b), miR-34 (cfa-miR-34a, cfa-miR-34b and cfa-miR-34c), miR-23 (cfa-miR-23a and cfa-miR-23b), cfa-miR-184, cfa-miR-214 and cfa-miR-141 were significantly up-regulated with testicular RA intervention via administration of CYP26B1 inhibitor and all-trans-RA (Figure 5). [score:6]
Up-regulated miRNAs (cfa-let-7, cfa-miR-200, cfa-miR-125, cfa-miR-34, cfa-miR-23, cfa-miR-146 clusters, cfa-miR-184 and cfa-miR-214) in adult canine testis treated with DMSO, RA or CYP26B1 inhibitor. [score:6]
In dogs, cfa-miR-34a, cfa-miR-34b and cfa-miR-34c are transcribed from regions of chromosome 5. In murine testis, miR-34a, miR-34b and miR-34c are expressed from post-natal day 11 (P11) and the expression is increased steadily to its highest enrichment at P60. [score:5]
In the present investigation, cfa-miR-34 clusters have been up-regulated significantly by exogenous RA and CYP26B1 inhibitor in canine testis. [score:4]
It has also been observed that enhancement of miR-34 cluster is higher with the CYP26B1 inhibitor treatment than direct RA administration. [score:4]
Mir-21, mir-34c and mir-221/222 control self-renewal of undifferentiated spermatogonia [19], Mirc1, Mirc3 and Mirlet7 regulate spermatogonial differentiation [9], [20], mir-15a and mir-184 mediate differentiation of spermatocytes [18], [19], miR-18, miR-34b, miR-34c, miR-184, miR-383, miR-449 and miR-469 mediate meiotic division of spermatocytes to spermatids [21], [23]– [25] and miR-469, miR-34c regulate differentiation of spermatid to form spermatozoa [24], [25]. [score:3]
Target genes and their biological functions for miR-34 and miR-125 clusters are given in Table S2. [score:3]
Among dysregulated miRNAs in this study, an association network was created for let-7, miR-200, miR-34 and miR-125 families. [score:2]
Additionally, a number of previous studies demonstrated that several miRNA species including miR-34 cluster regulate murine spermatogenesis. [score:2]
Table S2 Associated genes and their biological function for miR34 and miR125 clusters (with references). [score:1]
0099433.g007 Figure 7 Let-7, miR-200, miR-34 and miR-125 clusters are chosen to create networks. [score:1]
These previous findings together support the association of miR-34 clusters, RA signaling and murine spermatogenesis. [score:1]
The results of the current study support the role of cfa-miR-34 clusters with RA -induced spermatogenesis in dogs. [score:1]
In mammals, miR-34 miRNA family members were discovered computationally and then verified experimentally. [score:1]
Let-7, miR-200, miR-34 and miR-125 clusters are chosen to create networks. [score:1]
[1 to 20 of 15 sentences]
37
[+] score: 34
Additionally, miR-29a and miR-34b showed the most dramatic changes in their expression levels, whereas the expression of miR-25 and mir-125b was associated with the course of disease. [score:7]
Although a trend toward the overexpression of miR-33, miR-34 and miR-92a was observed, no evidence for a statistically significant difference in miRNA expression at this early stage of the disease was found. [score:7]
- Illumina Hi-Seq 2000, small RNAs from fly heads Drosophila mo dels: UAS-Atxn3-70Q and UAS-Atxn3-19Q[56] miR-34b is upregulated, and miR-25, −125b, −29a are downregulated in SCA3 patients. [score:7]
Specifically, the upregulation of miR-34 in this fly mo del extended the median lifespan and reduced the neurodegeneration induced by human polyQ disease protein. [score:6]
Moreover, mir-34b was previously shown to be elevated in the plasma of pre-manifest Huntington’s disease (HD) patients and predicted to be a protective factor for HD [60]. [score:3]
The microarray analysis validated by qRT-PCR revealed that miR-25, miR-125b, miR-29a and miR-34b were differentially expressed in SCA3 patients. [score:3]
A protective role of miRNAs in age -associated processes and polyQ disorders was further supported by demonstrating that miR-34b mitigates the toxicity of ataxin-3 in Drosophila [57]. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 33
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, hsa-mir-34c
A key regulator of tumor suppression, miR-34 is a direct transcriptional target of the tumor suppressor p53, given that the miR-34a promoter region contains a p53 -binding site [17]. [score:9]
Given that miR-34 was a candidate regulator, we determined PRKD1 mRNA expression and protein translation levels following ectopic expression of miR-34a, miR-34b, and miR-34c. [score:8]
Expression levels of miR-34b and miR-34c were also detected, however, no significant downregulation of either variant in MCF-7-ADR cells was observed (Supplementary Figure 1A, 1B). [score:6]
Although miR-34a, miR-34b, and miR-34c have the same seed sequence, the results indicated that PKD/PKCμ was downregulated only by miR-34a (Figure 1B). [score:4]
β-actin was used as the loading control and qRT-PCR was performed to validate PRKD1 mRNA and miR-34 variant expression. [score:3]
HEK293T cells were transiently transfected with 3′-UTR reporter constructs (1.5 μg/well in 6-well plates) and 15 nM of miR-34 family precursors (Ambion), using Lipofectamine 2000 (Invitrogen). [score:1]
The seed sequences of miR-34 from PRKD1 were mutated using PCR -based methods and the reporter constructs were verified by sequencing. [score:1]
B. Proteins, mRNAs and totalRNAs were obtained after 48-h transfection of miRNA-34 variants. [score:1]
[1 to 20 of 8 sentences]
39
[+] score: 33
The down-regulation of miR-34 upregulates MET and BCL2, which leads to cell proliferation [64, 65, 66]. [score:7]
Decreased expression of miR-34 in lung cancer induces increased -expression of miR-34 target genes, such as BCL2, MET, PDGFRA, and PDGFRB, which leads to TNF-related apoptosis-inducing ligand (TRAIL) -induced cell death. [score:7]
MiR-34, which is transcribed by TP53, directly binds to the PD-L1 3′ untranslated region and downregulates it. [score:6]
A recent study found that tumor PD-L1 expression is regulated by TP53 via miR-34 [67]. [score:4]
Bommer G. T. Gerin I. Feng Y. Kaczorowski A. J. Kuick R. Love R. E. Zhai Y. Giordano T. J. Qin Z. S. Moore B. B. p53 -mediated activation of miRNA34 candidate tumor-suppressor genesCurr. [score:3]
MiR-34 is an important component of TP53 tumor suppressor function [30]. [score:2]
MiR-34 MiR-34 is directly transcribed by TP53, responding to DNA damage and oncogenic stress. [score:1]
MiR-34 is directly transcribed by TP53, responding to DNA damage and oncogenic stress. [score:1]
Kasinski A. L. Slack F. J. miRNA-34 prevents cancer initiation and progression in a therapeutically resistant K-ras and p53 -induced mouse mo del of lung adenocarcinomaCancer Res. [score:1]
The identified TP53/ miR-34/PD-L1 axis deserves consideration for the improvement of emerging immunotherapy. [score:1]
[1 to 20 of 10 sentences]
40
[+] score: 31
miR-34a is expressed at higher levels than miR-34b/c in most of the tissues including colorectal tissues, with the exception of the lung, where miR-34b/c is dominantly expressed [118]. [score:5]
Analyses of Apc [Min/+] mice carrying targeted deletions of the miR-34a and miR-34b/c genes showed that miR-34a/b/c suppress tumor formation caused by loss of Apc and modulate proliferation, apoptosis and tumor -associated immune defense [130]. [score:5]
The tumor-suppressive function of QKI-5 is described in more detail in Section 4.3. miR-34 family is highly conserved in the evolutionary context. [score:3]
The tumor-suppressive function of QKI-5 is described in more detail in Section 4.3. miR-34 family is highly conserved in the evolutionary context. [score:3]
Corney D. C. Flesken-Nikitin A. Godwin A. K. Wang W. Nikitin A. Y. MicroRNA-34b and microRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growthCancer Res. [score:3]
Jiang L. Hermeking H. miR-34a and miR-34b/c suppress intestinal tumorigenesisCancer Res. [score:3]
Bommer G. T. Gerin I. Feng Y. Kaczorowski A. J. Kuick R. Love R. E. Zhai Y. Giordano T. J. Qin Z. S. Moore B. B. P53 -mediated activation of miRNA34 candidate tumor-suppressor genesCurr. [score:3]
Because of these broad anti-oncogenic function, miR-34 has been considered to be a novel therapeutic target, and MRX34, miR-34a mimics, becomes the first miRNA mimics to reach clinical trial for cancer therapy [131, 132]. [score:2]
miR-34a is encoded by its own transcript located within the chromosome 1 p 36, while miR-34b and miR-34c are generated by processing a bicistronic transcript from chromosome 11q23. [score:1]
Bader A. G. miR-34—A microRNA replacement therapy is headed to the clinicFront. [score:1]
In vertebrates, miR-34 family consists of three members: miR-34a, miR-34b and miR-34c, which are generated from two distinct genomic loci. [score:1]
Hermeking H. The miR-34 family in cancer and apoptosisCell Death Differ. [score:1]
[1 to 20 of 12 sentences]
41
[+] score: 31
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
When focusing on the miRNA differential expression patterns in NOA, three studies pinpointed four miRNAs that are involved in spermatogenesis [36, 52, 55]: hsa-miR-34b*, hsa-miR-34c-5p and hsa-miR-122, which are downregulated [52, 55], and hsa-miR-429, which is upregulated [36, 52]. [score:9]
In patients with asthenozoospermia, two studies found that hsa-miR-27a [47, 56, 57], hsa-miR-548b-5p, hsa-miR-548c-5p and hsa-miR-548d-5p are up-regulated [47], while hsa-miR-34b-3p [47, 51], hsa-miR-520 h and hsa-miR-520d-3p are downregulated [47]. [score:7]
Among the ten most expressed miRNAs, three directly control spermatogenesis because they are involved in the regulation of the E2F-pRB pathway during male meiosis (hsa-miR-34b-3p), in cell cycle progression (hsa-miR-132-3p) and in sperm differentiation (hsa-miR-191-5p). [score:5]
These miRNAs are expressed in spermatozoa and are involved in spermatogenesis (hsa-miR-34b-3p, hsa-miR-27a), embryonic development (hsa-miR-520 family) or in signaling pathways and human tumorigenesis (hsa-miR-548 family). [score:4]
Then, Abu-Halima et al. showed that hsa-miR-34b*, hsa-miR-34b, hsa-miR-34c-5p, hsa-miR-449a and hsa-miR-449b, which are structurally similar, are downregulated in testes of infertile men with different histopathologic patterns (the most common feature of male-factor infertility). [score:4]
Among them, hsa-miR-15a, hsa-miR-15b, hsa-miR-30, hsa-miR-34b, hsa-miR-34c-5p and hsa-miR-193b-5p have a direct role in spermatogenesis [51, 53]. [score:2]
[1 to 20 of 6 sentences]
42
[+] score: 30
This response leads to the activation of Snail1, that along with the upregulation of other genes responsible for loss of adherence, represents a signal promoting cell migration and metastasis (present work, Figure 4 adherens junction); (iii) miR-34 downregulation contributes to the abnormal expression of Snail1, which is normally antagonized by miR-34 and whose pathological expression has been linked to cancer cell epithelial-mesenchymal transition; (iv) miR-200 downregulation contributes to the epithelial-mesenchymal transition as well. [score:14]
All these data strengthen the correlation between high zinc levels, Sanil1 upregulation, miR-34, and miR-200 family members downregulation. [score:7]
Two major miRNAs were downregulated in our samples: a miR-34 family member (−1.1 fold change) and a miR-200 family member (−1.2 fold change). [score:4]
Namely, in the absence of a functional p53 and of a decrease of miRNA-34, Snail1 is upregulated, as we found in our samples. [score:4]
Very interestingly, a decrease in miR-34, which normally antagonizes Snail1, was recently described as part of the p53/miRNA-34 axis. [score:1]
[1 to 20 of 5 sentences]
43
[+] score: 29
MicroRNA Expression in cancer Function Mechanism of deregulation Targets Let-7a-2 Down in breast, lung, colon, ovarian, and stomach cancer Tumor suppressor Repressed by MYC KRAS, HMGA2, MYC, DICER, BCLXL, IMP-1, CDC34, IL6 miR-15/16 Down in CLL, prostate cancer, and pituitary adenomas Tumor suppressor Genomic loss, mutated, activated by p53 BCL2, COX2, CHECK1, CCNE1, CCND1, CCND2, BMI-1, FGF2, FGFR1, VEGF, VEGFR2, CDC25a miR-29 family Down in AML, CLL, lung and breast cancer, lymphoma, hepatocarcinoma, rhabdomyosarcoma Tumor suppressor Genomic loss, activated by p53, repressed by MYC CDK6, MCL1, TCL1, DNMT1, DNMT3a, DNMT3b miR-34 family Down in colon, lung, breast, kidney, and bladder cancer Tumor suppressor Repressed by MYC SIRT1, BCL2, NOTCH, HMGA2, MYC, MET, AXL. [score:14]
Frequent downregulation of miR-34 family in human ovarian cancers. [score:4]
In accordance with the loss of TP53, miR-34 members (miR-34a, b, c) have been found strongly repressed in ovarian cancer: miR-34a expression is decreased in 100% and miR-34b*/c in 72% of EOC with p53 mutation (Corney et al., 2010). [score:4]
These signatures included three known tumor-suppressors miRNAs, mir-15a, mir-34a, and mir-34b. [score:3]
An interesting example of multi mechanism control of miRNA expression in ovarian cancer is represented by the miR-34 family. [score:3]
miR-34 clusters are part of the transcriptional program activated by p53 (He et al., 2007). [score:1]
[1 to 20 of 6 sentences]
44
[+] score: 29
Using miR-34 direct up-regulation by doxorubicin, we show here that p53 induction results in the down-regulation of Dll1 via miR-34 transcriptional control. [score:8]
For this reason, we performed additional Dll1 3’-UTR reporter activity assays using miR-34b- and miR-34c-containing expression constructs, and showed that both miR-34b and miR-34c down-regulate Dll1 3’-UTR to the same levels as those seen with miR-34a (Fig. S5D). [score:5]
An additional question was raised whether other miR-34 family members can have synergistic actions on Dll1 down-regulation. [score:4]
We thus asked whether by targeting Dll1, miR-34 can impair the proliferation rate of MB cells. [score:3]
The MiR-34 family is directly regulated by the transcription factor p53 [9], [10], [11], and all of the members of this family (miR-34a, mi-R34b and miR-34c) share high sequence similarities [12]. [score:3]
These data provide further supporting evidence that the whole miR-34 family (miR-34a, miR-34b and miR-34c) can regulate Notch signaling through Dll1 in MB. [score:2]
This activation can be explained by the relatively high expression of miR-34 in this clone, as compared to clone #2 (Fig. S1C). [score:2]
This evidence led to a mo del for the potential therapeutic use of miR-34 as a radio-sensitizing agent in p53-mutant breast cancer [14]. [score:1]
Several studies have confirmed that the miR-34 family is required for normal cell responses to DNA damage following irradiation in vivo. [score:1]
[1 to 20 of 9 sentences]
45
[+] score: 28
The relationship between miR-71 or miR-34 expression levels and mf counts tended to follow a similar pattern. [score:3]
In C. elegans, both miR-71 and miR-34 showed stage-specific up-regulation in dauer larvae compared to late second-stage larvae [57]. [score:3]
Five highly abundant mature nematode-derived miRNA sequences (bma-miR-100d_R+1, bma-miR-100c_R+1_1ss12CT, asu-miR-71, cel-miR-34-5p_R+1_1ss1AT, and bma-miR-228), were selected for amplification by RT-qPCR. [score:1]
In contrast, neither miR-71 nor miR-34 was detected in samples from four uninfected dogs. [score:1]
Both miR-71 and miR-34 were detected in all four samples from dogs infected with D. immitis (Table 3). [score:1]
Like miR-71, miR-34 promotes longevity in C. elegans [55]. [score:1]
Number of positive RT-qPCR reactions for miR-71, miR-34 and miR-223. [score:1]
The sample ranking was highly similar for miR-34, with Dim4 and Dim1 alternating with the highest copy numbers. [score:1]
Further efforts to validate D. immitis/ B. pahangi miR-71 and miR-34 as diagnostic candidates are necessary, as the resulting copy numbers displayed extreme variation. [score:1]
Isoforms of miR-100 were the most abundant, followed by miR-71, miR-34, miR-228, miR-50, and miR-57. [score:1]
A possible explanation is that miR-34 may be released in higher proportions by mf than by adults. [score:1]
As miR-71 and miR-34 were previously reported in B. pahangi whole-worm extracts [28], we attempted their amplification from two B. pahangi-infected dogs. [score:1]
The most abundant of the detected miRNAs was miR-71, followed by miR-34 and miR-223. [score:1]
0002971.g001 Figure 1A: miR-71, only D. immitis and B. pahangi-infected samples; B: miR-34, only D. immitis and B. pahangi-infected samples; C: miR-223, all samples. [score:1]
Table S8 Detailed RT-qPCR information for miR-34. [score:1]
In terms of absolute copy numbers, miR-34 was approximately 12 times more abundant in infected dog plasma than in the whole adult extract [46]. [score:1]
A: miR-71, only D. immitis and B. pahangi-infected samples; B: miR-34, only D. immitis and B. pahangi-infected samples; C: miR-223, all samples. [score:1]
In contrast, the maximum copy number variation between experiments using the same sample was 1.7-fold for miR-34 and 3.8-fold for miR-223. [score:1]
Black bars = experiment 1; gray bars = experiment 2; white bars = experiment 3. A: miR-71; B: miR-34. [score:1]
0002971.g002 Figure 2A: miR-71; B: miR-34. [score:1]
Figure 2 shows the relationship between mf counts per ml dog blood (D. immitis and B. pahangi) and miR-71 and miR-34 copy numbers (from one experiment only; gray bars in Figure 1) per ml dog plasma. [score:1]
The miR-34 family has been described in a number of species. [score:1]
Both miR-71 and miR-34 were detected in B. pahangi-infected dog plasma. [score:1]
Similarly, >13-fold difference in miR-34 levels (2.5*10 [5]–3.4*10 [6] copy number per ml plasma) was observed for the same four samples showing comparable mf counts. [score:1]
[1 to 20 of 24 sentences]
46
[+] score: 28
miR-15b, miR-16, miR-181b and miR-34 have the same downstream target, B-cell lymphoma 2 (BCL-2), which exhibits an antiapoptotic function; overexpression of these miRNAs inhibits the expression of BCL-2 and induces apoptosis. [score:9]
miR-34 molecules act as tumor suppressors by regulating the expression of the corresponding targets. [score:8]
Restoration of miR-34b and miR-34c promotes the repression of cell growth, which demonstrates that miR-34b and miR-34c function as tumor-suppressor genes (46). [score:3]
The miR-34 family, itself targeted by p53 via a positive feedback mechanism, is universally inactivated in various types of cancer. [score:3]
The authors also demonstrated that DNA methylation of miR-34b and miR-34c was associated with H. pylori infection in normal individuals, and that the methylation levels of miR-34b and miR-34c in the non-cancerous gastric mucosae of patients with multiple GC were higher than those of patients with single GC. [score:1]
Therefore, the aberrant methylation of miR-34b and miR-34c may be a diagnostic or predictive biomarker, and the re -expression of miR-34b and miR-34c using demethylation drugs may be a novel therapeutic strategy for GC or a useful preventative measure. [score:1]
Recently, Suzuki et al (47) found that aberrant methylated miR-34b and miR-34c could be an important predictive biomarker of metachronous GC risk. [score:1]
miR-124a and miR-34b/miR-34c. [score:1]
In addition to the miR-124a family, miR-34b and miR-34c have also been observed to be silenced by aberrant promoter -associated CGI methylation in the majority of GC cell lines and tissues. [score:1]
[1 to 20 of 9 sentences]
47
[+] score: 27
Moreover, it was reported by the same authors that miR-34 inhibits cell invasion, proliferation and tumorigenesis, whereas c-Met over -expression partially reversed the cell death and cell cycle arrest induced by miR-34 in brain tumors and glioma [20, 21]. [score:5]
Particularly in glioblastoma and ovarian cancer, miR-34 family members’ a–b–c expression was inversely correlated with c-Met expression [19, 20, 21]. [score:5]
Corney D. C. Hwang C. I. Matoso A. Vogt M. Flesken-Nikitin A. Godwin A. K. Kamat A. A. Sood A. K. Ellenson L. H. Hermeking H. Frequent downregulation of miR-34 family in human ovarian cancers Clin. [score:4]
Hereafter, c-Met was established as a bona fide miR-34 target in different tumors such as melanoma, lung, colon, breast and gastric cancer cells [18]. [score:3]
Indeed He and colleagues demonstrated for the first time the direct interaction between miR-34 and c-Met in mouse embryonic fibroblasts (MEF) cells [17]. [score:2]
Several studies pointed out miR-34 as one of the main miR -regulating c-Met. [score:2]
The miR-34 family, consist of miR-34a, miR-34b and miR-34c that are frequently silenced in a variety of tumors, indicating their role in tumorigenesis. [score:1]
Vogt M. Munding J. Grüner M. Liffers S. -T. Verdoodt B. Hauk J. Steinstraesser L. Tannapfel A. Hermeking H. Frequent concomitant inactivation of miR-34a and miR-34b/c by CpG methylation in colorectal, pancreatic, mammary, ovarian, urothelial, and renal cell carcinomas and soft tissue sarcomas Virchows Arch. [score:1]
They found that miR-34 was able to overcome HGF -induced gefitinib resistance in HCC827 and PC-9 cells by modulating c-Met and downstream pathway molecules, suggesting a new strategy for reversing HGF -induced resistance to gefitinib in lung cancers [24]. [score:1]
Importantly, miR-34 blocked the phosphorylation signal cascade of c-Met, Akt, ERK and compromised c-Met -driven invasion [18]. [score:1]
MiR-34a is transcribed from chromosome 1, a locus deleted in neuroblastoma, breast, thyroid, and cervical cancer [13, 14, 15, 16], while miR-34b and miR-34c are co-transcribed from a region on chromosome 11. [score:1]
2.1. miR-34 Family Members. [score:1]
[1 to 20 of 12 sentences]
48
[+] score: 27
A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
Among the downregulated miRNAs; miR-1, miR-29c, and miR-34b showed more declined expression in the female subjects, compared to the male counterpart. [score:5]
0064396.g003 Figure 3 A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
MiR-1, miR-26a, miR-29c, miR-34b, miR-451 and miR-1246 are downregulated in PH subjects. [score:4]
The expression of miR-34b and miR-1 showed strongest declined pattern among the PH subjects. [score:3]
The expression of miR-34b was 0.34±0.1 and 0.12±0.08 (p<0.05) in moderate and severe PH respectively, compared to the control counterparts. [score:2]
On the contrary, our data revealed a set of declined miRNAs which includes miR-26a, miR-29c, miR-34b and miR-451and; can be used as biomarker as well. [score:1]
We choose the following miRNAs for validation:MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
We choose the following miRNAs for validation: MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
[1 to 20 of 9 sentences]
49
[+] score: 26
As a direct target of p53, miR-34 targeting can potentially have effects on any number of cancer types. [score:6]
Thus, its downregulation in the respective cancers in those organs would likely benefit the greatest from a miR-34 mimetic like MXR34. [score:4]
0060301) 19053174 Corney DC Hwang CI Matoso A Vogt M Flesken-Nikitin A Godwin AK Kamat AA Sood AK Ellenson LH Hermeking H 2010 Frequent downregulation of miR-34 family in human ovarian cancers. [score:4]
The miR-34a is a member of miR-34 family that target TGF-β/Smad4 signaling in T-regulatory (Treg) cell tumor recruitment. [score:4]
Some of the roles of miR-34 have already been discussed, as one of its targets is Smad4. [score:3]
Analysis of miR-34 in human epithelial ovarian cancer showed that there was a 100% decrease in miR-34, and a 72% decrease in miR-34b*/c in the context of p53 mutation (Corney et al. 2010). [score:2]
Wild type p53 correlated with a 93% decrease in miR-34 in ovarian cancer cells. [score:1]
Clinically, stage III and stage IV tumors were analyzed where reduced miR-34 was significant (P = 0.0029, P = 0.0171, respectively). [score:1]
In these phase I studies, miR mimetics have been used to restore miR-34 (MRX34) and miR-16 (TargomiRs) activity. [score:1]
[1 to 20 of 9 sentences]
50
[+] score: 26
Both the miR-34 family and miR-204 miRNAs are well known tumor suppressors in several cancers (He et al., 2007; Li et al., 2016) and have been linked to suppression of epithelial to mesenchymal transition (EMT; Hahn et al., 2013; Morizane et al., 2014; Li et al., 2016; Liu et al., 2016). [score:5]
This suggests that controlled upregulation of miR-34 family miRNAs is important, both in embryonic and adult animals. [score:4]
The authors also find DCX to be a direct target of the miR-34-5p/449-5p family. [score:4]
The authors found that miR-34 over -expression ameliorated age-related neurodegeneration and increased median lifespan. [score:3]
In a study by Liu et al. (2012), Drosophila miR-34 was found to display increased brain expression, specifically in old animals. [score:3]
A recent paper reported that inactivation of two miRNA clusters, miR-34b/c and miR-449 clusters, with identical seed sequences, affected brain development, and microtubule dynamics (Wu et al., 2014). [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
Altogether, every member of the miR-34-5p/449-5p family of miRNAs, all sharing identical seed sequences, have been found to affect brain development. [score:2]
The microRNA miR-34 modulates ageing and neurodegeneration in Drosophila. [score:1]
[1 to 20 of 9 sentences]
51
[+] score: 26
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
Indeed, the miR-34 family members function as tumor suppressors, inducing apoptosis, cell cycle arrest and senescence, in part, through their interaction with the p53 tumor suppressor network [33, 37– 39]. [score:5]
The miR-34 family, most notably miR-34a, is frequently lost or down-regulated in human malignancies including neuroblastoma, breast, lung, and colorectal carcinomas, and osteosarcoma. [score:4]
Among the miRNAs implicated in cancer development and progression, the miR-34 family has been intensively studied and data indicate family members function as tumor suppressors in a variety of human cancers [25, 26]. [score:4]
Indeed, a variety of miRNA formulations and target-specific delivery strategies have accelerated the clinical development of miR-34 mimics, Miravirsen (Santaris Pharma) and MRX34 (Mirna Therapeutics) which recently entered first-in-human phase I clinical trials (NCT01829971) in patients with advanced solid tumors [50– 52]. [score:4]
Furthermore, p53 -mediated transcriptional regulation of the miR-34 family is conserved across different cell types [33– 37]. [score:2]
MiR-34 genes exhibited minimal deletions, loss of heterozygosity (LOH), and epigenetic inactivation in human OSA tumor tissues, demonstrating that other genetic and epigenetic mechanisms may account for the observed decrease expression [30]. [score:2]
Deletions of the gene regions harboring these transcripts or CpG promoter methylation with miR-34 gene silencing are frequently observed in human malignancies including neuroblastoma, glioma, breast cancer, non-small cell lung cancer, colorectal cancer, and osteosarcoma [27– 32]. [score:1]
The mature miR-34a sequence is located within the second exon of its non-coding host gene whereas miR-34b and miR-34c are co-transcribed and located within a single non-coding precursor (miR-34b/c) [25]. [score:1]
Effects of miR-34 on OSA cell line migration and invasiveness appear to be at least partially mediated through repression of CD44, the receptor for hyaluronic acid and a well-established marker of cancer cell stemness [43]. [score:1]
The miR-34 family consists of three evolutionarily conserved miRNAs: MiR-34a, MiR-34b and MiR-34c. [score:1]
miR-34: from bench to bedside. [score:1]
[1 to 20 of 11 sentences]
52
[+] score: 25
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
mir34b/c inhibits the cell cycle and prevents translation of c- myc mRNA and hence the production of c-MYC, a protein that is important for cell cycle regulation. [score:6]
Hence, MK5 may through FOXO3a -mediated phosphorylation promote angiogenesis by enhancing the expression of VEGF, but reduce invasiveness by upregulation of miR-34b. [score:6]
FOXO3a also stimulates expression of miR34b, a microRNA that causes cell cycle G1 arrest and suppresses cell invasion of melanoma cells [85, 86]. [score:5]
MK5 predominantly phosphorylates FOXO3a at Ser-215 in vivo (and at other sites in vitro as well) and MK5 -mediated phosphorylation of this site is required for the upregulation of miR-34b/c levels. [score:4]
The authors went on to show that MK5 induced expression of the microRNAs miR-34b and miR-34c by phosphorylating the transcription factor FOXO3a which binds the pre-miR-34 promoter. [score:3]
The miR-34b/c binds c- myc mRNA, resulting in reduced c-MYC protein levels. [score:1]
[1 to 20 of 6 sentences]
53
[+] score: 24
In turn, miR34 also acts as a tumor suppressor gene, via inhibition of bcl2, notch1/2 and c-met, all central pro-survival and pro-proliferative molecules [70, 71]. [score:5]
Re -expression of miR34 in this population triggers a loss of the CSC population, as demonstrated by a marked reduction in the CD44+/CD133+ subset, as well as inhibition of spherule formation and in vivo tumor growth. [score:5]
Studies examining the effects of tumor suppressor genes on miRNAs have demonstrated that p53 activates the transcription of the miR34 family of miRNAs. [score:3]
Bommer G. T. Gerin I. Feng Y. Kaczorowski A. J. Kuick R. Love R. E. Zhai Y. Giordano T. J. Qin Z. S. Moore B. B. p53 -mediated activation of miRNA34 candidate tumor-suppressor genesCurr. [score:3]
Importantly, overexpression of miR34 in these cells restored their chemo- and radiotherapy sensitivity. [score:3]
These observations suggest that miR34 is an important negative regulator of cancer stem cell renewal and may hold promise as a form of molecular therapy in pancreatic cancer [72]. [score:2]
Using an adenoviral- delivery system, these authors demonstrate that miR34 can drive neural differentiation of tumor neurospheres and impair tumor growth in a mouse mo del of medulloblastoma. [score:1]
CD44+/CD133+ cancer stem cell populations in p53-mutated pancreatic cancer cell lines contain low levels of miR34 and high levels of bcl2 and notch1/2. [score:1]
miR34 in p53-Mutated Pancreatic Cancer Stem Cells. [score:1]
[1 to 20 of 9 sentences]
54
[+] score: 24
Since our in vitro study has shown that overexpressing miR-34 inhibits muscle development, we believe the miR-34c overexpression experiment alone would be sufficient to demonstrate the role of miR-34c in vivo. [score:8]
Another miR-34 family member miR-34c also has been shown to inhibit rat vascular smooth muscle cell proliferation [27]. [score:3]
The full-length blot images are presented in Supplementary Figure  1. Overexpressing miR-34c inhibits PSCs proliferation in vitroFirst, we investigated the role of miR-34 in PSCs proliferation. [score:3]
But, the role of miR-34 plays in pig skeletal muscle development has not been reported. [score:2]
Through the dual-luciferase reporter assay, we found N1ICD decreased the pGL3-basic-miR-34 upstream recombinant vector relative luciferase activity, but this inhibition was abolished by the mutated CSL-N1ICD complex binding site (GTGGGAA) (Fig.   6F). [score:2]
In human, three miR-34 precursors are produced from two transcriptional units, miR-34a precursor is transcribed from chromosome 1, and miR-34b and miR-34c precursors are co-transcribed from a region on chromosome 11 [23]. [score:1]
As shown in Fig.   6E the miR-34 upstream of its genomic site (about 4600 bp) is inserted into the pGL3-basic vector. [score:1]
So we constructed the pGL3-basic-miR-34 upstream recombinant vector (pGL3-basic-miR-34 upstream). [score:1]
The miR-34 family members (miR-34a, miR-34b, and miR-34c) were discovered computationally [20] and later verified by experiment 21, 22. [score:1]
N1ICD with pGL3-basic-miR-34 upstream recombinant vector relative or pGL3-basic-miR-34 upstream (mut) recombinant vector were transfected into HEK-293T cells respectively. [score:1]
Lanes 1–7 represent DL 10000, pGL3-basic, double digested pGL3-basic, double digested miR-34 upstream of its genomic site, pGL3-basic-miR-34 upstream recombinant vector, double digested pGL3-basic-miR-34 upstream recombinant vector, DL5000, respectively. [score:1]
[1 to 20 of 11 sentences]
55
[+] score: 24
Recent data have shown that genes coding for the miR-34 family are direct transactivational targets of p53 and their over -expression results in the induction of apoptosis, cell cycle arrest and senescence [13- 16] (Fig. 1). [score:6]
Taken together, these data indicate that p53 directly activates the expression of miR-34 genes, which play an important role in p53 -mediated apoptotic pathway. [score:4]
Prominent among them is the finding that miR-34 family is a direct transactivational target of p53 and it induces apoptosis, cell cycle arrest and senescence [12- 15]. [score:4]
Bommer et al. [17] showed that miR-34 family members may be tissue specific with miR-34a being expressed at higher level than miR-34b/c with the exception of the lungs. [score:3]
A direct molecular explanation of how miR-34 interferes in the p53 pathway and apoptosis is highlighted in the result published by Lowenstein and colleagues [18]. [score:2]
In mammals, the miR-34 family members are made up of three miRNAs encoded by two different genes: miR-34b/c (who share a common primary transcript) and miR-34a (encoded on its own. [score:1]
Paradoxically, miR-29 acted in a fashion different from miR-34 since it is an apoptotic inducer only in the presence of wild type p53 gene. [score:1]
The miR-34 story set the precedence and a number of papers have now been published showing that other miRNAs interfere the p53 pathway, in a p53-independent manner (miR-34), partial p53 -dependent manner (miR-192, miR-194, miR-215, and miR-21) or a p53 -dependent manner (miR-29). [score:1]
Furthermore, miRNAs is implicated in every aspect of cellular outcome of p53 activation: apoptosis (miR-34 and miR-29), cell cycle arrest (miR-192, miR-194, and miR-215), and senescence (miR-34). [score:1]
miR-34 Family and Apoptosis. [score:1]
[1 to 20 of 10 sentences]
56
[+] score: 24
c-Myc overexpression partially rescued RhoA expression (Fig. 5A, compare lane 4 with 3) and miR-34 -induced suppression of invasion (Fig. 5B), suggesting that miR-34a inhibits invasion, at least partially, via RhoA reduction by targeting c-Myc. [score:11]
c-Met reversed miR-34 -induced suppression of invasion, indicating that miR-34a inhibits invasion, at least partially, by targeting c-Met (Figs. 7B and C). [score:7]
p53 has been found to target the miR-34 family [4], [5], [6] and the ectopic expression of miR-34 genes has drastic effects on cell proliferation and survival. [score:5]
The results clearly revealed that miR-34 reduced invasion of PC-3 cells to 20% of that of controls (Figs. 2A and B). [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
MiR-1a, miR-140 and miR-449 were significantly up-regulated in both tissues, while miR-455, miR-34b and miR-34c were only up-regulated with AIV infection in tracheae. [score:7]
Cluster mir-34b-mir-34c was up-regulated in tracheae. [score:4]
When tissues in the state of virus infection were compared, 28 and 23 miRNAs were specifically and highly expressed in lungs, respectively, and only 6 miRNAs (miR-1a-1 and 2, miR-1b, miR-34b, 34c and miR-449) were highly expressed in tracheae (Table 5). [score:4]
And the mir-34b-mir-34c cluster was the only significantly up-regulated cluster in the AIV infected trachea. [score:4]
MiR-34b and miR34c, whose target genes are B-cell CLL-pymphoma 2 & 11, might be involved in the B-cell differentiation. [score:3]
We hypothesize that miR-34b, miR-34c, miR-206, miR-1458 and miR-1612 might be some of the most important miRNAs associated with AIV infection. [score:1]
[1 to 20 of 6 sentences]
58
[+] score: 23
For miR-277–3p, miR-987–5p and miR-34–5p their cognate miRNA precursors also increase upon Dis3 knockdown, suggesting that Dis3 normally affects their expression via indirect means, perhaps by increasing the expression of specific transcription factors. [score:7]
[37] Wing phenotypes are not always seen when miRNAs are overexpressed in the wing; for example, no phenotype is seen when miR-34 is overexpressed using MS1096-GAL4. [score:5]
In contrast, the levels of the pri/pre-miRNAs are increased in levels in Dis3 -depleted cells for miR-277–3p, miR-34–5p, miR-317–5p and miR-987–5p suggesting that these miRNAs are not direct targets of Dis3. [score:4]
Using this stringent filtering method, we identified 6 miRNAs whose expression increased ≥2-fold in the knockdown samples compared to both parental controls (miR-277–3p, miR-987–5p, miR-252–5p, miR-34–5p, and miR-7–3p and miR-317–5p). [score:3]
The set of miRNAs that increase ≥2-fold; by RNA-seq upon Dis3 depletion are miR-277–3p, miR-987–5p, miR-252–5p, miR-34–5p and miR-317–5p (Table 2). [score:1]
* miR-317 is located in close proximity to miR-34 and miR-277. [score:1]
The microRNA miR-34 modulates ageing and neurodegeneration in Drosophila. [score:1]
A similar effect is seen for miR-34–5p although the changes in levels are not so pronounced. [score:1]
[1 to 20 of 8 sentences]
59
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
Similarly, miR-34, an established p53 effector that is typically downregulated in malignant lung cancer [105], was upregulated in microadenomas but not in adenomas, as demonstrated in the present study. [score:7]
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
Thus, maintenance of miR-34 expression is a prerequisite to avoid the passage from benign to malignant cancer lesions in lung tissue. [score:3]
The identity, fold-change variation, direction of alteration, and biological function of these miRNAs are reported in Table 2. In mice bearing adenomas, 5 miRNAs (miR-34b, miR-106a, miR-499, miR-466, and miR-493) were altered in the blood serum but not in lung. [score:2]
[1 to 20 of 5 sentences]
60
[+] score: 22
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-23b, hsa-mir-142, hsa-mir-106b
The miRNA inhibitors (anti-miR-23b-5p, anti-miR-34b-3p, anti-miR-106b-5p, anti-miR-142–5p, anti-miR-20a-5p), miRNA inhibitor negative control, miR-106b-5p mimic and negative control mimic were designed and synthesized by RiboBio. [score:5]
In contrast, among the predicted miRNAs that might target SETD2, the expression of miR-23b-5p, miR-34b-3p, miR-106b-5p and miR-142–5p were significantly higher in ccRCC cell lines and tissues, while miR-20a-5p showed no significant difference (Figure 1G). [score:5]
SETD2 was lowly expressed and inversely correlated with endogenous miR-23b-5p, miR-34b-3p and miR-106b-5p in ccRCC tissues and cell lines. [score:3]
Moreover, correlation analysis indicated that miR-23b-5p, miR-34b-3p and miR-106b-5p were inversely correlated with the expression of SETD2 in ccRCC (p < 0. 0001, Figure 1H). [score:3]
To investigate whether the predicted microRNAs could regulate the expression of SETD2, we respectively transfected 100 nM synthesized antagomirs against miR-23b-5p, miR-34b-3p, miR-106b-5p, miR-142–5p and miR-20a-5p into 786-O as well as SN12-PM6 cells. [score:2]
Low levels of SETD2 were inversely correlated with endogenous miR-23b-5p, miR-34b-3p and miR-106b-5p in ccRCC tissues and cell lines. [score:1]
786-O and SN12-PM6 cells were transfected for 72 h with 100 nM anti-miR negative control, anti-miR-23b-5p, anti-miR-34b-3p, anti-miR-106b-5p, anti-miR-142–5p or anti-miR-20a-5p. [score:1]
Figure 2786-O and SN12-PM6 cells were transfected for 72 h with 100 nM anti-miR negative control, anti-miR-23b-5p, anti-miR-34b-3p, anti-miR-106b-5p, anti-miR-142–5p or anti-miR-20a-5p. [score:1]
The microRNAs including miR-23b-5p, miR-34b-3p, miR-106b-5p, miR-142–5p and miR-20a-5p were tested among HK-2,786-O and SN12-PM6 cell lines (F) as well as ccRCC tissues (G) by real-time RT-PCR, using U6 as an internal control. [score:1]
[1 to 20 of 9 sentences]
61
[+] score: 22
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
The miR-34 family has been identified as a p53 target and plays a key role as regulator of tumor suppression in many cancers controlling cell cycle arrest and apoptosis [20]– [22]. [score:6]
In p53-mutant pancreatic cancer cells, restoration of miR-34 expression significantly inhibited cell growth inducing apoptosis and cell cycle arrest [24]. [score:5]
In U2-OS and U2-OS175 cells, miR-34a promoter was unmethylated in both gene alleles, while MG63 and Saos-2 showed CpG methylation of the two alleles in accordance with very low expression levels and lack of miR-34 induction after etoposide exposure. [score:3]
MiR-34s form an evolutionary conserved miRNA family that comprises three processed miRNAs encoded by two different genes, miR-34a and miR-34b/c which are targets of p53 [12]. [score:3]
This suggested that recruitment of p53 by miR-34 was not impaired by expression of dominant negative p53. [score:3]
Previous studies wi dely validated the action of p53 on the target miR-34a using a primer for pri-miR and for pre-miR-34 as well as for mature miR-34 [13], [14]. [score:2]
[1 to 20 of 6 sentences]
62
[+] score: 22
In this case, ectopic expression of miR-34 in colorectal cancer cells inhibited cell proliferation and sensitized cancer cells to 5-FU. [score:5]
Similar to the down-regulation of the miR-15/16-1 cluster, another miRNA frequently lost in cancer is represented by the miR-34 family. [score:4]
Loss of expression of the miR-34b/c cluster has also been associated with the hypermethylation of their CpG -associated promoter region in gastric cancer, while the same chromosomal region was not methylated in normal gastric mucosa (23). [score:3]
Recently, miR-34 family knock-out mice have been generated, and no obvious developmental or pathological abnormalities were observed at up to 12 months of age (30). [score:3]
However, miR-34 inhibition has been shown to enhance the apoptotic response to bortezomib in Myc-transformed B-cells, clearly demonstrating that miRNA involvement in chemotherapy is context -dependent (88). [score:3]
Like miR-21, miR-34 has also been shown to modulate cancer cell sensitivity to 5-FU (87). [score:1]
However, the authors showed that miR-34 -deficient mouse embryonic fibroblasts accelerate the reprogramming, not as expected through cell proliferation, but instead, at least partly, by post-transcriptional derepression of pluripotency genes, such as Sox2, N-Myc, and Nanog (30). [score:1]
The miR-34 family has been shown to be transcriptionally activated by p53, and it represents one of the main effectors of p53 -induced apoptosis, senescence, and cell cycle arrest. [score:1]
These miRNAs, miR-34a on chromosome 1p36 and the miR-34b/c cluster on chromosome 11q23, are frequently deleted in neuroblastoma, breast, pancreas, hepatic, and colon carcinoma (22). [score:1]
[1 to 20 of 9 sentences]
63
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
MicroRNA profiling of Parkinson’s disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial function. [score:6]
Furthermore, miR-34 represses autophagy by directly inhibiting the expression of the autophagy-related protein Atg9 in mammalian cells (Yang et al., 2013). [score:6]
Alternative polyadenylation and miR-34 family members regulate tau expression. [score:4]
Minones-Moyano et al. (2011) demonstrated that miRNA-34b/c regulate DJ-1/PARK7 and Parkin protein expression in SHSY-5Y cell mo del and in the brains of patients afflicted with PD. [score:4]
miRNA-34 mutations extend the life of Caenorhabditis elegans by increasing autophagic flux. [score:2]
[1 to 20 of 5 sentences]
64
[+] score: 21
Among the downregulated targets of the miR-34 family were well-characterized p53 targets like CDK4/6, cyclin E2, E2F5, BIRC3 and Bcl-2. Notably, these effects were nearly identical irrespective of whether miR-34-a, miR-34-b or miR-34-c was introduced [26- 28]. [score:6]
A recent study on lymph node metastases of several malignant tumors, including CRC, identified three specific miRNAs (miR-148a, miR-34b/c and miR-9), specifically downregulated by CpG island hyper-methylation [61]. [score:4]
Loss of 1p36, the genomic interval harboring miR-34a, is common in diverse human cancers [26] but one of the other mechanisms responsible for decrease of miR-34 family expression levels seems to be CpG island hypermethylation. [score:3]
After treatment with demethylating agents, miR-34b/c expression was restored. [score:3]
Like p53, members of the miR-34 family can be considered as tumor suppressors to date, making them potential candidates for causing cancer by way of their inactivation. [score:2]
miR-34b/c were found to be epigenetically silenced in 9 of 9 cell lines examined and in 101 of 111 primary CRC tumors, but they were not in normal colonic epithelium. [score:1]
This suggests a positive feedback loop between p53 and miR-34 [29]. [score:1]
Decreased levels of the miR-34 family have been found in many tumors, including CRC [24]. [score:1]
[1 to 20 of 8 sentences]
65
[+] score: 21
Among the differentially expressed miRNAs, up-regulated miRNAs including miR-34b-5p, miR-578, miR-1304, and miR-324-5p and down-regulated miRNAs including miR-7-5p, and miR-34b-3p were analyzed using primers for mature mRNAs (B). [score:8]
miR-34b-5p showed 1.8 fold increases in expression, whereas miR-7-5p and miR-34b-3p showed 2.0 and 1.6 fold decreases in expression, respectively (p<0.05). [score:5]
The differential expression of miRNAs from array experiments was confirmed by further analysis of selected miRNAs, including miR-7-5p, miR-34b-3p, miR-34b-5p, miR-578, miR-1304, and miR-324-5p, using qRT-PCR. [score:3]
Changes in expression of miR-34 family [40] and miR-221 [41] have been reported to be associated with GEM resistance in pancreatic cancers. [score:3]
Our result also showed changes in these genes, i. e., an increased level of miR-34b-5p and decreased levels of miR-34b-3p, miR-34c-3p, and miR-221 were observed in spheroids cultures of Panc-1 cells. [score:1]
A greater than 1.5 fold increase was observed for 36 miRNAs, including miR-136-5p and miR-34a-5p, and a lower than 1.5 fold decrease was seen for 85 miRNAs including miR-7-5p and miR-34b-3p in spheroids cultured on concave microwell plates. [score:1]
[1 to 20 of 6 sentences]
66
[+] score: 21
Using 15 down-regulated miRNAs (let-7 g, miR-101, miR-133a, miR-150, miR-15a, miR-16, miR-29b, miR-29c, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b and miR-342), known to be associated with cancer, we found 16.5% and 11.0% of our PLS-predicted miRNA-targets, on average, were also predicted as targets for the corresponding miRNAs by TargetScan5.1 and miRanda, respectively (Table 2). [score:10]
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
With the aid of IPA pathway designer, we found that 27 of the 31 down-regulated miRNAs were linked to one or more mRNA networks and 20 of them (let-7 g, miR-101, miR-126, miR-133a, miR-142-5p, miR-150, miR-15a, miR-26b, miR-28, miR-29b, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b, miR-99a, mmu-miR-151, mmu-miR-342 and rno-miR-151) were involved in all of the top 4 networks. [score:4]
[1 to 20 of 3 sentences]
67
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
miR-34 and miR-449 are also involved in the inhibition of NSCLC cell migration and invasion by suppression of AXL and SNAIL-1, respectively a tyrosine-kinase receptor and a zinc-finger protein involved in cellular migration, proliferation and cancer cell epithelial-mesenchymal transition [123- 124]. [score:5]
Interestingly, Trang et al. used synthetic tumor suppressors miR-34 and let-7 mimics complexed with a novel neutral lipid emulsion to target a KRAS-activated mouse mo del of NSCLC. [score:5]
The miR-34 family consists of tumor-suppressive miRNAs (miR-34a, miR-34b, miR-34c) reported to be under p53 regulation and involved in controlling apoptosis and G1 cell cycle arrest. [score:4]
Specifically, Wang Z. et al. demonstrated that patients affected by NSCLC and underwent curative surgery (without receiving any subsequent adjuvant therapy) with aberrant DNA methylation of miR-34b/c (but not 34a), had a high probability of recurrence, poor overall survival and poor disease-free survival [185]. [score:3]
MiR-34 reduced expression has been found in various cancers, including NSCLC [120- 121]. [score:2]
The same role of miR-34b/c aberrant methylation was reported even in SCLC [187]. [score:1]
The miR-449 cluster (miR-449a, miR-449b, miR-449c) belongs to the same family as miR-34 (p53- responsive microRNAs) [122]. [score:1]
[1 to 20 of 7 sentences]
68
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
Microarray analysis of nasal mucosa identified several miRNAs with altered expression in acute RSV -positive infants (down-regulated miR-34b, miR-34c, miR-125b, miR-29c, mir125a, miR-429 and miR-27b and up-regulated miR-155, miR-31, miR-203a, miR-16 and let-7d) as compared to healthy infants [86]. [score:8]
Interestingly, the members of the miR-34/449 family were highly repressed in asthma; in vivo experiments have shown that their expression levels are also decreased after IL-13 treatment. [score:3]
[1 to 20 of 3 sentences]
69
[+] score: 20
In mice, miR-34a is ubiquitously expressed with the highest expression in the brain [7], whereas miR-34b and c are mainly expressed in lung tissue [8]. [score:7]
Importantly, several reports showed that members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [8]– [13]. [score:7]
In addition, members of the miR-34 family have been identified as direct p53 targets. [score:4]
miR-34a is a member of the miR-34 family, which in mammals also includes miR-34b, and -34c [6]. [score:1]
miR-34a is encoded by its own transcript, whereas miR-34b and miR-34c share a common primary transcript. [score:1]
[1 to 20 of 5 sentences]
70
[+] score: 19
The tumor suppressor p53 responding to a myriad different types of stress (among them hypoxia) and contributing to the pathology of NDDs binds directly to response elements within the miR-34a and miR-34b/c promoters that contain inverted repeats creating local cruciform structures (Coufal et al., 2013). [score:4]
The remarkable role of miR-34 in development and disease (Rokavec et al., 2014) is explained by the existence of the p53/miR-34 axis. [score:4]
The p53/miR-34 axis in development and disease. [score:4]
Also, HS leads to down -expression of mir-277 cluster (mir-34, mir-317) and mir-306 cluster (mir-9c, mir-9b, mir-79). [score:3]
Therefore, miR34 is involved in negative regulation of aging and death of neurons (Ghosh et al., 2008; Maciotta et al., 2013; Feng et al., 2014). [score:2]
As show in this study, additional binding site for mir-34 is created by the insertion of S-element from Tc1/mariner family in agn ts3 (Figure S3). [score:1]
A biomarker for AD is miR-34. [score:1]
[1 to 20 of 7 sentences]
71
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
As quoted above, up-regulation of miRNAs, including miR-17-92 cluster, miR-106a, and miR-34, occurs during tamoxifen -induced hepatocarcinogenesis in female rats (Pogribny et al., 2007), also long-term-administration of 2-AAF resulted in disruption of regulatory miR-34a-p53 feed-back loop (Pogribny et al., 2009). [score:5]
In rats, tamoxifen up-regulate miR-17-92 cluster, miR-106a, and miR-34 (Pogribny et al., 2007). [score:4]
4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), a tobacco carcinogen, down-regulate miR-34, miR-101, miR-126, and miR-199 (Kalscheuer et al., 2008). [score:4]
[1 to 20 of 4 sentences]
72
[+] score: 19
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
MiR-15a [11], miR-21 [12, 13], miR-34 [14], members of the miR-200 family [12, 15], miR-214 [11], miR-221 [16], members of the let7 family [15], and miR-320c [17] have been reported to play roles in gemcitabine chemoresistance in pancreatic cancer. [score:1]
In contrast, the chemoresistance to gemcitabine was merely slightly repressed in human PDAC cells treated with miR-34-5p or miR-203 mimics (Supplementary Figure 2). [score:1]
[1 to 20 of 6 sentences]
73
[+] score: 18
Interestingly, several reports indicate that miR-34 family members are direct transcriptional targets of the tumor suppressor p53 and suggest that some cellular roles of p53, including those related to the regulation of cellular proliferation and apoptosis, could be mediated by these miRNAs [55, 56]. [score:7]
Corney D. C. Hwang C. I. Matoso A. Vogt M. Flesken-Nikitin A. Godwin A. K. Kamat A. A. Sood A. K. Ellenson L. H. Hermeking H. Frequent downregulation of mir-34 family in human ovarian cancers Clin. [score:4]
Decreased expression of miR-34 has been observed in lung, ovarian, CLL and colorectal cancer [50, 51, 52, 53]. [score:3]
The miR-34 family, which comprises miR-34a, b and c, has also received considerable attention for its potential role as tumor suppressor in several human malignancies. [score:3]
Vogt M. Munding J. Gruner M. Liffers S. T. Verdoodt B. Hauk J. Steinstraesser L. Tannapfel A. Hermeking H. Frequent concomitant inactivation of mir-34a and mir-34b/c by cpg methylation in colorectal, pancreatic, mammary, ovarian, urothelial, and renal cell carcinomas and soft tissue sarcomas Virchows Arch. [score:1]
[1 to 20 of 5 sentences]
74
[+] score: 18
Therefore, the p53 network suppressed tumor formation through a number of coordinated interactions and several transcriptional targets including the role played by miR-34 family members in inhibiting unregulated cell proliferation and tumor development [58, 59]. [score:9]
The authors compared microRNA expression profile of wild-type and p-53 -deficient cells and found that the expression of microRNA family members (miR-34a-c) reflected the p53 status and the genes encoding miR-34 family members were transcriptional targets of p53 in vivo and in vitro. [score:6]
The first microRNAs involved in the p-53 tumor suppressor network were reported in 2007 and they belong to the miR-34 family, these being miR-34a, miR-34b, and miR-34c [57]. [score:3]
[1 to 20 of 3 sentences]
75
[+] score: 18
miR-34a and miR-34b/c represent the most highly upregulated miRNAs induced by the tumor suppressor, p53 [77, 78]. [score:6]
Additionally, miR-34 expression is inactivated through epigenetic methylation of its promoter, a reaction that dominates over its transactivation by p53 and occurs in a variety of human malignancies, including those arising in the skin (63%), bladder (33%), lung (29%), breast (25%), kidney (21%), pancreas (16%), and colon (13%) [84]. [score:3]
Likewise, loss of miR-34 expression in prostate cancers has been linked to their acquisition of chemoresistant phenotypes [80]. [score:3]
Collectively, these findings suggest that developing and implementing novel measures capable of re -expressing miR-34 in human carcinomas may provide a unique approach to alleviate metastatic progression and disease recurrence. [score:3]
These functional characteristics underlie the belief that targeting and manipulating either the expression or activity of miRNAs may provide novel inroads to treat human cancers, a supposition currently being evaluated in phase I clinical trials for MRX34 (a miR-34 mimetic) against late-stage hepatocellular carcinomas and a variety of lymphomas ([5]; ClinicalTrials. [score:1]
miR-34 family. [score:1]
Indeed, the growth of lung tumors in mice was severely compromised by the delivery of miRNA mimics for let-7b and miR-34 [121], as was that of prostate tumors following the administration of miRNA mimics for miR-15a and miR-16 [59]. [score:1]
[1 to 20 of 7 sentences]
76
[+] score: 18
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
The miR-34b and miR-34c were found frequently downregulated by aberrant methylation in MM, resulting in the loss of tumor-suppressive p53 function and the acquisition of a malignant phenotype [62]. [score:6]
The inhibition of these endogenous miRNAs by using antagomiRs dramatically increased Met expression and, conversely, transfection of miR-34b and miR-34c impaired Met signaling and the invasive growth program in cells of lung carcinoma and other cancers [63]. [score:5]
Tanaka N. Toyooka S. Soh J. Tsukuda K. Shien K. Furukawa M. Muraoka T. Maki Y. Ueno T. Yamamoto H. Downregulation of microRNA-34 induces cell proliferation and invasion of human mesothelial cells Oncol. [score:4]
This suggests a key role of the balance between miR-34 family members and Met in the early carcinogenic process of MM [64]. [score:1]
Kubo T. Toyooka S. Tsukuda K. Sakaguchi M. Fukazawa T. Soh J. Asano H. Ueno T. Muraoka T. Yamamoto H. Epigenetic silencing of microRNA-34b/c plays an important role in the pathogenesis of malignant pleural mesothelioma Clin. [score:1]
The importance of Met in the process of HM transformation to MM and acquisition of the invasive phenotype was also confirmed by the role played by two microRNA-34 (miRNA-34) family members. [score:1]
[1 to 20 of 6 sentences]
77
[+] score: 17
Ultimately, according to the miRNAs’ fold change and expression level, five up-regulated miRNAs (miR-630, miR-222-5p, miR-210-3p, miR-34a-5p and miR-34b-5p) and two down-regulated miRNAs (miR-335-3p and miR-15b-3p) were chosen for microarray validation by RT-PCR (Table  1). [score:9]
b Quantitative real-time RT-PCR validation of five up-regulated and two down-regulated miRNAs (mean ± SD, n = 3) Table 1 Fold change of the seven selected miRNAs and their forward primer sequences used for RT-PCR miRNA Name Fold Change Forward Primer for RT-PCR miR-630 4.14 GCGAGTATTCTGTACCAGGGAAGGT miR-222-5p 3.84 CGCTCAGTAGCCAGTGTAGATCCT miR-210-3p 3.23 CTGTGCGTGTGACAGCGG miR-34a-5p 2.59 CTGGCAGTGTCTTAGCTGGTTGT miR-34b-5p 2.44 GCGTAGGCAGTGTCATTAGCTGATTG miR-335-3p 0.45 CGGCGTTTTTCATTATTGCTCCTGACC miR-15b-3p 0.33 CGGGCGAATCATTATTTGCTGCTCTA To identify the connections between the grading of nuclear opacity and expression levels of miRNAs, Pearson correlation coefficient was introduced (Fig.   3). [score:7]
However, for miR-222-5p, miR-210-3p, miR-34b-5p and miR-15b-3p, the relations were moderate (R = 0.436, 0.428, 0.398, 0.489) and statistically insignificant (P > 0.05). [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 17
[31] The p53-miR-34 regulatory axis is another example of how transcriptional factor regulates miRNA expression to mediate tumor suppressive function. [score:7]
[31] The p53-miR-34 regulatory axis is another example of how transcriptional factor regulates miRNA expression to mediate tumor suppressive function. [score:7]
Similar to p53 -mediated phenotypes, miR-34 family including miR-34a/b/c promotes cell-cycle arrest, cell senescence and apoptosis in cancer, [33] implying p53 and miR-34 are in the same regulatory pathway. [score:2]
Using similar approach, Lujambio et al. [50] discovered miR-148a, and miR-34b/c cluster is subject to specific hypermethylation -associated silencing in cancer cells. [score:1]
[1 to 20 of 4 sentences]
79
[+] score: 17
miR-34 cooperates with p53 in suppression of prostate cancer by joint regulation of stem cell compartment. [score:4]
p53 is deleted in many cancer types and p53 promotes transcription of miR-34, hence its low expression. [score:3]
miR-34 also becomes an important tumor suppressor in many sarcoma types. [score:3]
A positive feedback between p53 and miR-34 miRNAs mediates tumor suppression. [score:3]
In fact, miR-34 replacement therapy has shown promise against cancer cell survival, stemness, metastasis, and chemoresistance in various cancer cell types and animal mo dels and is under Phase I clinical trial undertaken by MiRNA Therapeutics (Bader, 2012). [score:1]
miR-34–a microRNA replacement therapy is headed to the clinic. [score:1]
Another commonly decreased level miRNA found in various cancers is miR-34 (Cheng et al., 2014; Okada et al., 2014). [score:1]
For instance, miR-34 levels inversely correlate with poor patient survival outcomes indicating its potential role as a diagnostic marker in (Marino et al., 2014). [score:1]
[1 to 20 of 8 sentences]
80
[+] score: 17
miR-21 Most common oncomiR in a wide range of cancers, acting as an anti-apoptotic factor targeting a network of p53, transforming growth factor beta (TGF-β), and mitochondrial apoptosis tumor suppressor genes miR-10b Commonly upregulated miRNA in glioblastoma, located in HOX cluster miR-128 miRNA associated with glioma stem cell properties and neuronal differentiation via Bmi-1 and epidermal growth factor receptor (EGFR)/platelet-derived growth factor (PDGF)/AKT signaling pathways miR-34b One of the most elucidated tumor suppressor miRNAs, considered a key regulator of tumor suppressor pathways; one of the promising targets for miRNA replacement therapy miR-196 Extremely highly expressed miRNA in glioblastoma showing significant association with overall survival Based on molecular pathological perspectives, GBM is a heterogeneous tumor. [score:16]
miR-34 – a microRNA replacement therapy is headed to the clinic. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 16
To probe the susceptibility of TGFBR2 to repression by non-expressed miRNAs, we tested two mimics of miRNAs not expressed in HaCaT cells: miR-373, which is predicted to target TGFBR2, and miR-34b, which is predicted not to target TGFBR2. [score:9]
miR-34b, which does not have a predicted target site, was used as a negative control. [score:3]
Transfection of miR-373 did cause a decrease in TGFBR2 mRNA levels (Figure 10A), but consistent with target prediction, we did not observe an effect for miR-34b. [score:3]
miR-20a UAAAGUGCUUAUAGUGCAGGUAG miR-20a* ACUGCAUUAUGAGCACUUAAAGU miR-34b UAGGCAGUGUCAUUAGCUGAUUG miR-34b* AUCACUAACUCCACUGCCAUCA miR-373 GAAGUGCUUCGAUUUUGGGGUGU miR-373* ACUCAAAAUGGGGGCGCUUUCC We used antibodies recognizing phospho-tail SMAD2 Ser-465/467 (Cell Signaling, Danvers, MA, USA) and murine antibodies against α-tubulin (Sigma-Aldrich, St. [score:1]
[1 to 20 of 4 sentences]
82
[+] score: 16
Members of the miR-34 family of miRNAs are direct targets of p53 and function as tumor suppressors, inhibiting reprogramming through the repression of pluripotency genes such as Nanog, Sox2, and N-myc (Choi et al., 2011) (Figure 2). [score:8]
Evidence that let-7 and miR-34 family members are tumor suppressor miRNAs (Takamizawa et al., 2004; Johnson et al., 2005; Tazawa et al., 2007) suggests that stem cell-specific miRNAs play important roles in tumor initiation and development. [score:4]
The expression levels of miR-34 and let-7 family members increase during differentiation. [score:3]
miR-34 miRNAs provide a barrier for somatic cell reprogramming. [score:1]
[1 to 20 of 4 sentences]
83
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Expression of the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218 is upregulated in luminal cells of Ezh2 -deficient samples compared to littermate controls. [score:5]
For example, expression of the BTG4 gene, which harbors the MaSC/basal-specific miRNAs miR-34b and miR-34c, and the TRP3 gene that encompasses miR-204, is not detectable in mammary epithelium. [score:3]
MiR-34b, miR-204 and miR-218 are expressed highly in the MaSC/basal subset. [score:3]
MiRNAs were extracted from MaSC/basal and luminal cells sorted from either control or Ezh2 -deficient mouse mammary glands, and quantitative RT-PCR was then performed for the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218, as their promoter regions were enriched for H3K27me3 marks in the luminal subsets (Fig.   6a). [score:1]
Moreover, H3K4me3 was found to be associated with active miRNAs in colorectal cancer cell lines, whereas hypermethylation of promoter CpG islands caused epigenetic silencing of miR-124 and mir-34b/c [68– 71]. [score:1]
Suzuki H Yamamoto E Nojima M Kai M Yamano HO Yoshikawa K Methylation -associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defectCarcinogenesis. [score:1]
Toyota M Suzuki H Sasaki Y Maruyama R Imai K Shinomura Y Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancerCancer Res. [score:1]
a Track files or read coverage graphs for H3K4me3 and H3K27me3 marks present in the 3 kb upstream region of miR-34b (top panel), miR-204 (middle panel) and miR-218 (bottom panel) in each epithelial subset. [score:1]
[1 to 20 of 8 sentences]
84
[+] score: 16
Since we observed that PI3K-C2β regulates activation of the transcription factor STAT3, which in turn can also be involved in miR-34 family regulation [44], we then tested whether STAT3 could be involved in PI3K-C2β -dependent regulation of miR-449a in MCF7 cells. [score:4]
Upregulation of miR-34b (Supplementary Figure S3D), miR-34c (Supplementary Figure S3E) and miR-449b (Supplementary Figure S3F) was also confirmed in T47D lacking PI3K-C2β compared to control cells, although the levels of these miRs were much lower compared to the levels of miR449-a. Taken together these data indicated that PI3K-C2β regulates miR levels, in particular it down modulates miR-449a levels. [score:3]
miR-449a belongs to the miR-34 family, which is expressed at a low level in several cancer cell lines and solid tumors including breast cancer [38]. [score:3]
This analysis revealed a selective upregulation of 16 miRs in T47D cells lacking PI3K-C2β compared to control cells, including 5 miRs belonging to the same family: miR-449a, miR-449b, miR-34b, miR-34b*, miR-34c-5p (Figure 3D). [score:3]
Interestingly, members of the miR-34 family have been shown to regulate cyclin B1 levels [20, 21] therefore, they could potentially be involved in the PI3K-C2β -mediated regulation of cyclin B1. [score:3]
[1 to 20 of 5 sentences]
85
[+] score: 16
Functional validation of predicted microRNA targets: miR-34 inhibits BCL2 protein expression and induces apoptosis in Par-4 -overexpressing cells. [score:9]
For example, miR-221, and miR-222 are up-regulated, while miR-34a, miR-18a, miR-30d and miR-34b are down-regulated in colon cancer [54- 56]. [score:7]
[1 to 20 of 2 sentences]
86
[+] score: 16
Intriguingly, miR-34 and HMGA1 generate an intricate regulatory loop since HMGA1 is able to negatively regulate the expression of miR-34 (Puca, unpublished observations) and p53 (61), being the latter able to induce the expression of miR-34. [score:7]
In this process, HMGA1 has a central role since, upon its overexpression, alters miR-34 pathway by acting directly and indirectly on it, through the repression of p53 (Figure 1C). [score:5]
MicroRNAs of the miR-34b family have been found regularly underexpressed in human carcinomas and the attempt to restore their physiological levels in cancer cells currently would represent an innovative and fascinating cancer therapy (60). [score:3]
Several recent reports have highlighted the post-transcriptional repression of HMGA proteins by non-coding RNAs and, in particular, numerous miRNAs with this activity have been identified (let-7a, miR-15, miR-16, miR-26a, miR-34b, miR-196a2, miR-326, miR-432, miR-548c-3p, miR-570, miR-603) (53, 54). [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 16
miR-34 is involved in regulating the p53 pathway and inhibits cancer cell growth by directly targeting oncogenes such as Myc, c-Met, Bcl-2, CDK4, CDK6, Cyclin D1, and Cyclin E2 [42, 43, 46]. [score:7]
The expression levels of miR-34 are decreased in most human cancers [42– 44], including several epithelial cancers, melanomas, neuroblastomas, leukemias and sarcoma [45]. [score:3]
MRX34 is a liposome-formulated mimic of the tumor suppressor miR-34 (Mirna Therapeutics, Austin, TX). [score:3]
Anti-miR-122 therapy against chronic hepatitis C. miR-34 mimics as a therapeutic against primary and metastatic liver cancer. [score:1]
In addition to the current success of anti-miR122 therapy against chronic hepatitis C and the ongoing studies of miR-34 mimics against liver cancers in human clinical trials, the results of preclinical studies will likely lead to human clinical trials in the near future. [score:1]
In addition to miravirsen, a clinical trial of MRX34 as a mimic of miR-34 is ongoing. [score:1]
[1 to 20 of 6 sentences]
88
[+] score: 15
For example, to re-introduce miR-34 and its tumor suppressor capabilities, transfection with miR-34 mimics into cancer cells was shown to block the cell cycle in the G1 phase, significantly increasing activation of caspase-3, and knocked down its downfield targets of bcl-2, Notch, and HMGA2 [127]. [score:6]
In this sense, a lentiviral system restored the tumor suppressor effect of miR-34 in pancreatic cancer stem cells [128]. [score:3]
Therapeutic delivery of synthetic mi -RNA, using a neutral lipid emulsion (NLE), exhibited tumor -inhibitory effects of let-7 and miR-34 formulations in an autochthonous transgenic mouse mo del of lung cancer. [score:3]
The miRNA mimic, is therefore restored miR-34 with its tumor suppressor potential; however, the transfection of the miR-34 mimics can only last a couple of days and the long-term biological effects were not observed very effectively. [score:3]
[1 to 20 of 4 sentences]
89
[+] score: 15
There were no microRNAs regulated after 1 hour in culture, however after 4 hours in culture miR-491-3p, miR-34b, miR-595, miR-328 miR-1281 and miR-483-3p were significantly upregulated, with none being downregulated. [score:8]
However, after 4 hours in culture, significant upregulation was seen for miR-491-3p, miR-34b, miR-595, miR-328, miR-1281 and miR-483-3p, with no microRNAs being significantly downregulated. [score:7]
[1 to 20 of 2 sentences]
90
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
The miR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 represent the most frequently deregulated miRNAs reported in CLL, and these microRNAs have been associated with disease progression, prognosis, and drug resistance [1] (Table  1). [score:4]
The mutation of TP53 in CLL was associated with unfavorable treatment response and clinical outcome [26], and in some CLL patients inactivation of TP53 correlates with reduced miR-34 expression [27]. [score:4]
For example, miR-34 is known to target more than 24 different oncogenes involved in cell proliferation, drug resistance and metastasis. [score:3]
In addition to miR-34, 3 other miRNAs-miR-182-5p, miR-7-5p and miR-320c/d-have also been found as p53 targets in CLL [28]. [score:3]
In 2013, Texas–based Mirna Therapeutics launched it phase clinical trial for a miR-34 mimic: MRX34 [185]. [score:1]
[1 to 20 of 5 sentences]
91
[+] score: 15
Similarly, miR-34b and miR-34c (miR-34 family members) are up-regulated during rat cardiac hypertrophy (Feng et al. 2014), in the aged hearts of mice (Boon et al. 2013), in mouse hearts with myocardial infarction (Bernardo et al. 2012) and in diabetic ischaemic heart failure patients (Greco et al. 2012). [score:4]
In the present study, an early up-regulation of miR-34 family members was identified, which indicated that apoptosis could be a very early molecular event that induces cardiac cell loss in hiPSC-CMs after repeated exposure to DOX. [score:4]
DOX -induced up-regulation of miR-34b and miR-34c was reported in a mouse mo del (Desai et al. 2014) and in rat hearts (Vacchi-Suzzi et al. 2012). [score:4]
The miR-34 family members are involved in cardiac ageing, cardiac diseases and in cardiac apoptotic events. [score:3]
[1 to 20 of 4 sentences]
92
[+] score: 15
Studies have indicated that miR-34b targets the α-synuclein mRNA3′-UTR in two distinct sites and represses translation of this protein [86]. [score:5]
[53] Parkinson's disease miR-34b SNCA rs10024743 T>G (unspecified) in vitro: reporter gene assay in SH-SY5Y human neuroblastoma cells (with pre-miR or miR inhibitor; internal control). [score:4]
Kabaria et al. [54] have identified a SNP, rs10024743 (T>G), in the 3′-UTR of α-synuclein, which is localized in the target site 1 of miR-34b. [score:3]
This SNP diminishes the miR-34b -mediated repression of α-synuclein levels due to disruption of the miRNA : mRNA association. [score:1]
SCNA | miR-34b. [score:1]
Importantly, in PD patients' brains, the level of miR-34b in the substantia nigra is decreased. [score:1]
[1 to 20 of 6 sentences]
93
[+] score: 15
At present, it was found that p53 regulated PDL-1 via miR-34, which directly binded to the PDL-1 3′untranslated region in mo dels of NSCLC [98]. [score:5]
P53 regulated PDL-1 via miR-34, and miR-34 enhanced T cell activation via targeting diacylglycerol kinase ζ. [score:4]
What's more, it was also reported that miR-34 enhanced T cell activation via targeting diacylglycerol kinase ζ [99] (Figure 2A). [score:3]
In addition, lncRNAs could be precursors of miRNAs and act as ceRNAs to alter the distribution of miRNA molecules on their targets [6, 101] (Figure 2B), for example, it was found that lncRNA ARSR acted as a ceRNA for miR-34 and miR-449 and finally promoted Sunitinib resistance in renal cancer [102]. [score:3]
[1 to 20 of 4 sentences]
94
[+] score: 14
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c
Interestingly, the introduction of miR-34a and miR-34b/c induced cellular senescence in primary human diploid fibroblasts, and overexpression of miR-34a induced apoptosis in tumor cells. [score:3]
Ectopic expression of miR-34 genes leads to marked effects on cell proliferation and survival, due to cell-cycle arrest in the G1 phase [47, 48]. [score:3]
The IPA analysis also revealed that curcumin and mir-34 signaling were the two most important upstream regulators for the dysregulated histone-modifying enzymes in pediatric ALL, with p values of 2.83 × 10 [−6] and 2.45 × 10 [−5], respectively (Figure 6C). [score:3]
This study provides the first indication that other histone-modifying enzymes, in addition to SIRT1, may be dys-regulated by miR-34 in pediatric ALL. [score:2]
Additionally, IPA indicated that curcumin and miR-34 may be the major upstream regulators of histone-modifying enzymes in normal karyotype B cell pediatric ALL, future studies will seek to validate these results, and examine the role of curcumin and miR-34 in the molecular basis of leukemia. [score:2]
In the future, we will seek to validate these results, and examine the role of curcumin and miR-34 in the molecular basis of leukemia. [score:1]
[1 to 20 of 6 sentences]
95
[+] score: 14
In particular, the following target proteins were downregulated: PTEN which is known to be targeted by miR-21 [28], [29], cyclin D1 which is known to be targeted by miR-100, miR-99a and miR-223 [30] and Bcl-2 which is known to be targeted directly by miR-34, miR-181b and miR-16 [31], [32], [33] or indirectly modulated by miR-21 [34]. [score:14]
[1 to 20 of 1 sentences]
96
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Down-regulation of the tumor suppressors miR-34b and miR-34c has been described in PD and linked to decreased expression of parkin protein (Minones-Moyano et al., 2011). [score:8]
MicroRNA profiling of Parkinson’s disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial function. [score:6]
[1 to 20 of 2 sentences]
97
[+] score: 14
The results found that miR-18a was overexpressed and 33 miRNAs (e. g. miR-34b, miR-34c, let-7 family) were down-regulated in NPC tissues of which these miRNAs are involved in the pathway of nervous system development and sensory perception of sound being associated with NPC development. [score:8]
Tumour suppressive miRNAs, including miR-34 family, miR-143, and miR-145, are significantly down-regulated in NPC. [score:6]
[1 to 20 of 2 sentences]
98
[+] score: 14
As expected, the tumor suppressor miR-34b was silenced by DNA methylation in the EC cells [16], as shown by its upregulation in the HI and HEC-1 cells treated with 5-AZA. [score:6]
DNA methylation -based silencing of tumor suppressive miRNAs, such as miR-34b [16] and miR-124 [17], occurs in various human cancers and stimulates metastasis. [score:3]
The expression of miR-124 was significantly increased after treating with 5-AZA or a combination of 5-AZA plus TSA (Figure 5A, 5B), but the miR-124 and miR-34b levels remained relatively unchanged in cells treated with TSA alone (Figure 5A, 5B). [score:3]
A, B. HI and HEC-1 cells were treated with 5-aza-2′-deoxycytidine (5-AZA), Trichostatin A, or both, after which, quantitative PCR was used to measure the expression levels of miR-124 (A) and miR-34b (B). [score:1]
Figure 5 A, B. HI and HEC-1 cells were treated with 5-aza-2′-deoxycytidine (5-AZA), Trichostatin A, or both, after which, quantitative PCR was used to measure the expression levels of miR-124 (A) and miR-34b (B). [score:1]
[1 to 20 of 5 sentences]
99
[+] score: 13
Eighteen miRNAs, including miR-34b, miR-326, miR-432, miR-548c-3p, miR-570, and miR-603, were drastically and constantly downregulated in GH adenomas, whereas only miR-320 was significantly upregulated. [score:7]
miR-34b and miR-548c-3p were demonstrated to regulate both HMGA1 and HMGA2 expression, whereas miR-326, miR-432, and miR-570 target HMGA2 only. [score:6]
[1 to 20 of 2 sentences]
100
[+] score: 13
Phylogenetic analysis, target gene prediction and pathway analysis showed that, among the 13 conserved miRNAs (miR-1, miR-100, miR-10a, miR-124, miR-125, miR-184, miR-33, miR-34, miR-7, miR-9, miR-92a, miR-92b and miR-let7), several highly conserved miRNAs (miR-1, miR-7 and miR-34) targeted the same or similar genes leading to the same pathways in shrimp, fruit fly and human (Figure 3b). [score:5]
Some miRNAs, such as miR-34 and miR-S12, could target 7–8 genes. [score:3]
Among the differentially expressed miRNAs found, miR-1, miR-7 and miR-34 are highly conserved and mediate similar pathways, suggesting that some beneficial miRNAs have been preserved in animals during evolution. [score:3]
In our study, phylogenetic analysis showed that the miR-1, miR-7 and miR-34 are highly conserved in shrimp, fruit fly and human and function in similar pathways. [score:1]
Evolutionary analysis showed that three of them, miR-1, miR-7 and miR-34, are highly conserved in shrimp, fruit fly and humans and function in the similar pathways. [score:1]
[1 to 20 of 5 sentences]