sort by

63 publications mentioning hsa-mir-361

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-361. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 385
Other miRNAs from this paper: hsa-mir-146a, hsa-mir-301a, hsa-mir-448
Functional studies showed that overexpression of miR-361-5p suppressed the glycolysis and proliferation of breast cancer cells by targeting FGFR1, the invasion and metastasis by targeting MMP-1. An inverse expression pattern was also found between miR-361-5p and FGFR1 or MMP-1 in clinical samples. [score:11]
Altogether, these results indicated that miR-361-5p suppressed the invasion and metastasis of BC by targeting MMP-1. Fig. 5MiR-361-5p suppresses the invasion and metastasis of BC by targeting MMP-1. a Schematic diagram of the luciferase reporter containing the WT or MUT miR-361-5p binding sequence in the 3’UTR of MMP-1 mRNA. [score:9]
Thus, our results provide evidence that miR-361-5p inhibits glycolytic metabolism, proliferation and invasion of BC cells and reveal the specific regulatory mechanism of miR-361-5p in BC, suggesting that miR-361-5p and its target genes may serve as potential therapeutic targets for BC patients. [score:8]
As a tumor suppressor, miR-361-5p inhibited BC cells aerobic glycolysis and proliferation by directly targeting FGFR1, a promoter of glycolytic pathway. [score:8]
c Schematic diagram of the mechanism that miR-361-5p inhibits BC progression In this study, we found that the expression of miR-361-5p was downregulated in breast cancer and was associated with poor prognosis. [score:8]
Furthermore, we demonstrated that miR-361-5p inhibited breast cancer cells invasion and metastasis by targeting MMP-1. An inverse expression pattern was also found between miR-361-5p and FGFR1 or MMP-1 in a cohort of 60 BC tissues. [score:7]
These data support the mechanism that miR-361-5p targets FGFR1 and MMP-1 respectively, inhibits BC cell glycolysis and proliferation, invasion and metastasis, and finally suppresses BC progression (Fig.   6c). [score:7]
We found that BC tissues with high miR-361-5p expression showed low IHC score of FGFR1 and MMP-1. Reversely, BC tissues with low miR-361-5p expression tended to show high expression of FGFR1 and MMP-1 (Fig.   6a). [score:7]
MiR-361-5p suppresses the invasion and metastasis of BC by targeting MMP-1. Clinical relevance of miR-361-5p, FGFR1 and MMP-1 expression in BC patients. [score:7]
Consistently, we detected that overexpression of miR-361-5p in BC cells decreased the expression level of MMP-1 mRNA and protein, whereas anti-miR-361-5p increased the expression level of MMP-1 mRNA and protein (Fig.   5c). [score:7]
Our results indicate that miR-361-5p inhibits breast cancer cells glycolysis and invasion by respectively repressing FGFR1 and MMP-1, suggesting that miR-361-5p and its targets may serve as therapeutic targets in breast cancer treatment. [score:7]
e Lung metastasis mo del was used to detect the metastatic ability of BC cells in SCID mice Given that miR-361-5p downregulated FGFR1 and MMP-1 in BC cells to suppress tumor progression, we next explored whether this relationship existed in clinical samples. [score:6]
Altogether, these data suggest that the expression of miR-361-5p is decreased in breast cancer and its downregulation is associated with poor prognosis. [score:6]
These results suggested that miR-361-5p directly inhibited MMP-1 expression by binding to its 3′-UTR. [score:6]
To explore the clinical significance of miR-361-5p down-regulation in BC, we further detected the relationship between clinicopathologic data and miR-361-5p expression levels. [score:6]
Consistent with these studies, we found that FGFR1 reverted the anti-glycolytic function of miR-361-5p by upregulating the activity of PDHK1 and LDHA, which enrich the mechanism that miR-361-5p inhibited BC cells glycolysis and proliferation. [score:6]
Our study found that miR-361-5p was down-regulated in breast cancer tissues and the expression of miR-361-5p was positively associated with prognosis in BC patients. [score:6]
Functional studies showed that overexpression of miR-361-5p suppressed the proliferation, invasion and metastasis of breast cancer cells both in vivo and in vitro. [score:5]
Consistent with those studies, we observed that miR-361-5p was down-regulated in breast cancer compared with normal breast tissue, and decreased miR-361-5p expression was correlated with poor DFS. [score:5]
a Representative IHC staining images of FGFR1 and MMP-1 expression in high/low miR-361-5p expression BC tissues. [score:5]
By coincidence, our previous study has demonstrated that miR-361-5p inhibits the malignant phenotype of colorectal and gastric cancer by targeting SND1 [12]. [score:5]
Here we reported that miR-361-5p was down-regulated in breast cancer tissue compared with normal breast tissue and the expression of miR-361-5p was positively associated with prognosis in BC patients. [score:5]
c Schematic diagram of the mechanism that miR-361-5p inhibits BC progression To decide the role of miR-361-5p in breast cancer, we first examined the expression levels of miR-361-5p in normal breast and BC tissues in a group of 60 BC patients by qRT-PCR and ISH. [score:5]
Due to the fact that FGFR1 overexpression only partly converted the invasion ability of miR-361-5p -transfected cells, we questioned the possibility that another target of miR-361-5p might mediate its anti-metastatic phenotype. [score:5]
d Kaplan-Meier survival test was used to test the relationship between miR-361-5p expression and disease-free survival of BC patients. [score:5]
Meanwhile, miR-361-5p also targeted MMP-1 to suppress BC cells invasion and metastasis. [score:5]
Meanwhile, considering that several studies reported miR-361-5p to act its function by targeting some other factors, such as Twist1, VEGFA and FOXM1 [30– 32], it remains to be explored whether other targets may contribute to the anti-tumor effect of miR-361-5p. [score:5]
However, overexpression of FGFR1 significantly increased the phosphorylation of these proteins in miR-361-5p -overexpressed or control cells (Fig.   4i). [score:5]
Similarly, Cao et al. reported that the clinical outcomes of patients with positive miR-361-5p expression was better than that of patients with negative miR-361-5p expression [11]. [score:5]
Mechanistically, we found that miR-361-5p inhibited the proliferation of BC cells by suppressing glycolysis. [score:5]
Our results suggest that miR-361-5p and its target genes may serve as therapeutic targets in breast cancer treatment. [score:5]
Importantly, Kaplan-Meier analysis indicated that patients with higher miR-361-5p expression showed significantly better disease-free survival (Fig.   1d). [score:5]
b The relationship between miR-361-5p expression and FGFR1 (left panel) and MMP-1 (right panel) expression in clinical samples. [score:5]
To conclude, these results suggest that miR-361-5p controls the redirection of BC cellular glucose metabolism and inhibits glycolysis. [score:4]
Therefore, the results indicated that FGFR1 reverted the anti-glycolytic function of miR-361-5p by upregulating the activity of PDHK1 and LDHA (Fig.   4i). [score:4]
Fig. 1Downregulation of miR-361-5p in breast cancer and its association with poor prognosis. [score:4]
As shown in Fig.   2a, real-time cell proliferation assays indicated that miR-361-5p overexpression significantly inhibited growth of MDA-MB-231 cells. [score:4]
Thus, it is possible that miR-361-5p suppressed BC cells growth by regulating the balance between glycolytic metabolism and mitochondrial oxidative phosphorylation. [score:4]
b Colony formation assays in BC cell with miR-361-5p overexpression or inhibition. [score:4]
To decide whether FGFR1 was the direct target of miR-361-5p, we constructed luciferase reporters containing FGFR1–3’UTR with a conserved miR-361-5p binding sequence or mutated miR-361-5p binding sequence. [score:4]
Using western blot analysis, we found that miR-361-5p transfection downregulated the phosphorylation of PDHK1 and LDHA in BC cells. [score:4]
Consistent with that, we demonstrated that MMP-1 was a direct functional target of miR-361-5p and mediated the anti-metastatic phenotype of miR-361-5p in BC cells. [score:4]
To examine whether MMP-1 was a direct target of miR-361-5p, luciferase reporters containing MMP-1-3’UTR with a conserved miR-361-5p binding sequence or mutated miR-361-5p binding sequence were constructed. [score:4]
These results demonstrated that FGFR1 was a direct target of miR-361-5p. [score:4]
a Real-time cell proliferation assays in BC cells with miR-361-5p overexpression or inhibition. [score:4]
In addition, we were the first to analyze the functional roles of miR-361-5p in BC cells and found that miR-361-5p suppressed breast cancer cells proliferation, invasion and metastasis both in vitro and in vivo. [score:3]
It was observed that decreased miR-361-5p expression was correlated with larger tumor size and lymph node metastasis (Table  1). [score:3]
b Quantitative RT-PCR was used to detect the expression of miR-361-5p in BC tissues and corresponding normal tissues. [score:3]
So we argued that there might be other targets which mediated the anti-metastatic phenotype of miR-361-5p in BC cells. [score:3]
a ISH was used to compare the expression of miR-361-5p in BC tissues and corresponding normal tissues in a group of 60 patients. [score:3]
In contrast, MMP-1 overexpression in MDA-MB-231 cells raised the number of invading cells and restored the decreased the ability of invasion in miR-361-5p -transfected cells. [score:3]
We next examined the expression of miR-361-5p in different BC cell lines. [score:3]
Conversely, miR-361-5p inhibitors promoted the growth of MCF-7 cells. [score:3]
FGFR1, a promoter of glycolysis-related enzyme, was identified as the target of miR-361-5p that promoted glycolysis and repressed oxidative phosphorylation. [score:3]
As shown in Fig.   1c, we also found that miR-361-5p expression was closely associated with TNM stage. [score:3]
Consistent with these findings, miR-361-5p significantly decreased the expression levels of both FGFR1 mRNA and protein (Fig.   4a). [score:3]
Positive expression of miR-361-5p has been proved to indicate better prognosis for BC patients [11]. [score:3]
Morever, another recent study also showed that increased expression of miR-361-5p predicted improved BC survival [23]. [score:3]
Meanwhile, overexpression of FGFR1 in BC cells reverted decreased glucose uptake and lactate production of miR-361-5p -transfected cells (Fig.   4d and e). [score:3]
It was observed that miR-361-5p inhibited the luciferase activity of WT 3’UTR-reporter, but not the MUT 3’UTR-reporter (Fig.   4b). [score:3]
Based on these results, miR-361-5p could be recognized as a tumor suppressive miRNA in BC. [score:3]
MMP-1 was noted because it contains a putative target sequence of miR-361-5p in the 3’UTR (Fig.   5a) and it was closely correlated with tumor cell invasion [18]. [score:3]
c The expression level of mRNA and protein in BC cells transfected with miR-361-5p or anti-miR-361-5p. [score:3]
To conclude, miR-361-5p suppresses breast cancer cells proliferation, invasion and metastasis both in vitro and in vivo. [score:3]
The expression of miR-361-5p is decreased in breast cancer which is associated with poor prognosis. [score:3]
Using bioinformatic methods, we happened to find that FGFR1 might be a potential target of miR-361-5p among the numerous candidates, for it was reported to promote aerobic glycolysis by phosphorylating several glycolytic enzymes [14]. [score:3]
Nevertheless, we found that decreased miR-361-5p expression was also correlated with larger tumor size, lymph node metastasis and higher TNM stage, which was not significantly evidenced in the previous study. [score:3]
To further elucidate the anti-metastatic function of miR-361-5p in BC, bioinformatic methods were used to predict other targets of miR-361-5p. [score:3]
e The relative expression of miR-361-5p was detected in different BC cell lines by qRT-PCR. [score:3]
Fig. 6Clinical relevance of miR-361-5p, FGFR1 and MMP-1 expression in BC patients. [score:3]
To test whether FGFR1 was the functional target of miR-361-5p in inhibiting glycolysis, we measured the extracellular acidification rate (ECAR) which was the surrogate of glycolysis. [score:3]
To decide the role of miR-361-5p in breast cancer, we first examined the expression levels of miR-361-5p in normal breast and BC tissues in a group of 60 BC patients by qRT-PCR and ISH. [score:3]
A reverse relationship of expression between miR-361-5p and FGFR1 or MMP-1 was observed (Fig.   6b). [score:3]
FGFR1 mediated the anti-glycolytic function of miR-361-5p by regulating the activity of PDHK1 and LDHA. [score:2]
MiR-361-5p has been proved to be a tumor suppressor in colorectal cancer and gastric cancer in our previous study. [score:2]
MiR-361-5p, known as a tumor suppressor, was reported to play functional roles in several cancers [21, 22]. [score:2]
Differences among variables were evaluated by χ [2] or Fisher’s exact χ [2] -test Given the correlation of miR-361-5p expression and prognosis in BC patients, we further detected the biology effect of miR-361-5p deregulation on breast cancer cells. [score:2]
The expression levels of miR-361-5p were found to be markedly lower in BC cells lines, especially highly metastatic cells (MDA-MB-231, MDA-MB-468), compared with spontaneously immortal MCF-10A cells (Fig.   1e). [score:2]
MiR-361-5p inhibits glycolysis and increases mitochondrial metabolism in BC cells. [score:2]
MiR-361-5p suppresses breast cancer cells proliferation, invasion and metastasis both in vitro and in vivo. [score:2]
As shown in Fig.   5d, on one hand, MCF-7 cells transfected with siMMP-1 showed decreased invasion ability compared with control cells, on the other hand, siMMP-1 restored the enhanced invasion ability of miR-361-5p -inhibited MCF-7 cells. [score:2]
However, the role of miR-361-5p and its regulatory mechanism in BC have rarely been discussed. [score:2]
Meanwhile, we observed that mice injected with MDA-MB-231 cells overexpressing miR-361-5p exhibited less lung metastatic nodes compared with the control group. [score:2]
Matrigel-coated transwell assays indicated that MCF-7 cells transfected with anti-miR-361-5p showed significantly enhanced invasion ability, whereas overexpressing miR-361-5p in MDA-MB-231 cells decreased the invasion ability of cancer cells (Fig.   2c). [score:2]
Fig. 4FGFR1 mediated the anti-glycolytic function of miR-361-5p by regulating the activity of PDHK1 and LDHA. [score:2]
We found that miR-361-5p expression was significantly decreased in 49 of 60 BC tissues compared with corresponding normal breast tissues (Fig.   1a and b). [score:2]
However, numbers of invading cells of the anti-miR-361-5p group were higher than that of the NC group, suggesting that glycolysis was not necessary for the enhanced BC invasion (data not shown). [score:1]
Conversely, siFGFR1 markedly reverted the enhanced rate of glucose uptake and lactate production in anti-miR-361-5p -transfected BC cells (Fig.   4f and g). [score:1]
Consistent with the results in vitro, MCF-7 cells transfected with anti-miR-361-5p showed enhanced tumorigenic ability in vivo. [score:1]
We found that in contrast to control MDA-MB-231 cells, where GULT1 was mostly observed in plasma membrane, GLUT1 was found in the cytoplasm of miR-361-5p -transfected cells (Fig.   4h). [score:1]
In this study, we sought to reveal how miR-361-5p exerts influence on BC progression, identify and characterize its target genes. [score:1]
Conversely, transfection with anti-miR-361-5p in MCF-7 cells markedly increased the number of lung metastatic nodes in node mice. [score:1]
Consistent with these results, there were no difference at proliferation rate between BC cells transfected with NC and miR-361-5p under glucose deprivation (Fig.   3a). [score:1]
For detecting miR-361-5p, the Mir-VanaTM MiRNA Isolation Kit (Ambion, USA) was used to isolate total RNA from cell lines and patient samples following the manufacturer’s instructions. [score:1]
c Relative expression of miR-361-5p was measured in BC tissues of different tumor stages by qRT-PCR. [score:1]
These data demonstrated that declined glycolysis in miR-361-5p cells does not attribute solely to increased mitochondrial oxidative phosphorylation. [score:1]
In comparison with the control group, tumorigenic ability dramatically decreased in the miR-361-5p group (Fig.   2d). [score:1]
miR-361-5p Glycolysis FGFR1 MMP-1 Warburg effect was first described as a common metabolic feature of cancer cells almost 90 years ago, which has also been known as aerobic glycolysis nowadays [1]. [score:1]
For the stable transfection of anti-miR-361-5p, anti-miR-361-5p sequence were amplified from miRZip-361-5p construct (System Biosciences) and cloned into pSilencer4.1 system. [score:1]
Glucose uptake (d) and lactate production (e) were detected in BC cells transfected with or without miR-361-5p or FGFR1. [score:1]
BC cells were then transfected with the pSliencer vector containing the antisense sequence of miR-361-5p. [score:1]
However, siFGFR1 transfection failed to convert the increased invasion ability of anti-miR-361-5p -transfected cells (Fig.   4k), indicating that FGFR1 could not affected the anti-metastatic function of miR-361-5p in BC cells. [score:1]
e Effect of miR-361-5p on tumor metastasis in SCID mice injected with indicated cells. [score:1]
We found that miR-361-5p was able to decrease the luciferase activity of WT 3’UTR-reporter, but not the MUT 3’UTR-reporter (Fig.   5b). [score:1]
In this study, we aim to find out the function of miR-361-5p in breast cancer progression and elaborate the mechanism that miR-361-5p acts its function in breast cancer. [score:1]
Meanwhile, we found that miR-361-5p cells consumed less glucose and released less lactate into the substrate (Fig.   3f). [score:1]
Glucose uptake (f) and lactate production (g) were detected in BC cell transfected with or without anti-miR-361-5p or siFGFR1. [score:1]
However, FGFR1 reversed the effect of miR-361-5p on subcellular translocation of GLUT1 (Fig.   4h). [score:1]
MiR-361-5p mimics, miR-control, FGFR1 siRNA, MMP-1 siRNA or siRNA negative control were purchased from Genepharma (China). [score:1]
It was observed that BC cells transfected with anti-NC and anti-miR-361-5p showed similar rate of proliferation under, indicating that glycolysis might be required by the increased BC proliferation. [score:1]
FGFR1 3′-UTR, mutated FGFR1 3′-UTR, MMP-1 3′-UTR, mutated MMP-1 3′-UTR, or control luciferase reporter plasmid was cotransfected with miR-361-5p mimics or negative control (Ambion) using Lipofectamine 3000 (Thermofisher, USA). [score:1]
[1 to 20 of 111 sentences]
2
[+] score: 372
In contrast, expression of p-JAK2, PKA, MMP2 and MMP9 was significantly up-regulated and p-Rac1was down-regulated in NSCLC cells that stably expressed miR-361-3p inhibitor. [score:13]
Enforced expression of miR-361-3p inhibited the expression of SH2B1 significantly and the restoration of SH2B1 expression reversed the inhibitory effects of miR-361-3p on NSCLC cell proliferation and metastasis. [score:11]
In contrast, downexpression of p-JAK2, PKA, MMP2 and MMP9 and overexpression of p-Rac1 were detected in SPC-A-1 cells with stable down-regulation of miR-361-3p SH2B1 exhibited lower SH2B1 expression (Fig.   7d, lane 3). [score:10]
For further study, we examined the expression of SH2B1 signaling downstream target genes and found that expression of p-JAK2, PKA, MMP2 and MMP9 were decreased and p-Rac1 was increased in NSCLC cells that stably overexpressed miR-361-3p. [score:9]
Thus, down-regulation of p-Rac1 through inhibition of SH2B1 could be a mechanism by which miR-361-3p suppresses cell proliferation, migration and invasion. [score:8]
miR-361-3p functions as a novel tumor suppressor in NSCLC and the anti-oncogenic activity may involve its inhibition of the target gene SH2B1. [score:7]
Therefore, down-regulation of miR-361-3p suppresses lung cancer progression and metastasis through regulation of SH2B1. [score:7]
Down-regulation of miR-361-3p promoted cell growth, proliferation, colony formation, invasion and migration in vitro, and promoted proliferation and metastasis in vivo (P < 0.01); whereas up-regulation of miR-361-3p had the contrary effects. [score:7]
Overexpression of p-JAK2, PKA, MMP2 and MMP9 and downexpression of p-Rac1 were detected in A549 and HTB-182 cells that stably overexpressed miR-361-3p (Fig.   7d, lane 1–2). [score:7]
To investigate whether SH2B1 expression may interfere or mimic the function of miR-361-3p, NSCLC cells were transfected by SH2B1 siRNA or SH2B1 expression vector to inhibit or restore the SH2B1 expression. [score:7]
In the present study, we certified that miR-361-3p was frequently down-regulated in NSCLC, and first found that the reduced miR-361-3p expression was closely related to advanced stage and lymph node metastasis of NSCLC. [score:6]
and immunohistochemical staining were applied to analyze the expression of target proteins and downstream molecule, and the luciferase reporter assay to assess the target genes of miR-361-3p in non-small cell lung cancer cells. [score:6]
a up-regulated miR-361-3p suppressed migration and invasion in vitro in A549. [score:6]
Our study provides solid evidence to support that miR-361-3p inhibit proliferation and metastasis of NSCLC by directly targeting SH2B1. [score:6]
To this end miR-361-3p stably overexpressed A549 [miR-361-precursor] and HTB-182 [miR-361-precursor] cells and stably downregulated in SPCA-1 [anti-miR-361-3p] cells were generated. [score:6]
Moreover, knockdown expression of SH2B1 abrogated the effects induced by miR-361-3p -inhibitor. [score:6]
b up-regulated miR-361-3p suppressed migration and invasion in vitro in HTB-182. [score:6]
Importantly, ectopic SH2B1 expression could effectively impede the ability of miR-361-3p to inhibit proliferation and metastasis. [score:5]
Furthermore, enforced miR-361-3p expression inhibited lung cancer cell growth, proliferation, clone formation, migration and invasion in vitro, and tumorigenicity and intrapulmonary metastasis in vivo. [score:5]
Herein, we showed that miR-361-3p could suppress the carcinogenesis of NSCLC through inhibition of growth, proliferation, migration and invasion. [score:5]
Furthermore, we demonstrated that overexpression of miR-361-3p could suppress NSCLC cell proliferation, migration and invasion in vitro and in vivo. [score:5]
c Western blot results of SH2B1 protein in A549, HTB-182 and SPC-A-1 cells infected with miR-361-precursor lentivirus or anti-miR-361-p. d The representative IHC pictures showed the SH2B1 protein expression in NSCLC tissue with high or low miR-361-3p expression. [score:5]
These data indicate that miR-361-3p suppresses progression of NSCLC through inhibition of the versatile tumor-promoting SH2B1. [score:5]
Fig 4Overexpression of miR-361-3p inhibits NSCLC in vivo. [score:5]
Bioinformatics methods using bioinformatics software (DIANA TOOL, Targetscan, miRanda) to predict miR-361-3p potential target gene, combined with the literature and through the test screening, SH2B1 was selected as a further object of study. [score:5]
Therefore, future studies to identify additional novel targets of miR-361-3p and other miRNAs that can also regulate SH2B1 will allow us to have deep understanding of the mechanisms underlying the development and progression of NSCLC. [score:5]
In contrast, siSH2B1 -mediated inhibition of SH2B1 expression mimicked the effect of miR-361-3p on proliferation and colony formation capacity in SPC-A-1 cell [anti-miR-361-3p] (Figs.   6a, b and 7c). [score:5]
For training cohort, miR-361-3p expression was downregulated in NSCLC tissues compared with the matching normal lung tissues, the median was 0.70vs. [score:5]
The tumor-suppressive role of miR-361-3p is largely mediated by one of its target, Sh2B1. [score:5]
Overexpression of miR-361-3p inhibits tumor growth and metastasis of NSCLC cells in vivo. [score:5]
Taken together, these results indicated that SH2B1 was a direct downstream target for miR-361-3p in NSCLC cells. [score:4]
SH2B1 is identified as a target of miR-361-3p, but SH2B1 might not solely be explained the antioncogenic properties of miR-361-3p, because a single miRNA can potentially regulate dozens to hundreds of genes in tumorigenesis [39]. [score:4]
In conclusion, our results show that miR-361-3p is significantly downregulated in NSCLC. [score:4]
SH2B1 is a direct downstream target of miR-361-3p. [score:4]
These data indicate that miR-361-3p inhibits SH2B1 signaling in NSCLC, which involved tumor development and progression. [score:4]
We compared SH2B1 expression data from immunohistochemistry analysis with results of miR-361-3p expression level from qRT-PCR analysis on specimens of these NSCLC tissues. [score:4]
To explore whether miR-361-3p exerts its functions through the JAK2-SH2B1-Rac1 pathways that contribute to cancer proliferation, development and progression [20], we examined a number of the main SH2B1 signaling downstream target genes, including phosphorylation of Janus kinases 2(p-JAK2), phosphorylation of Rho GTPase Ras-related C3 botulinum toxin substrate 1(p-Rac1), cAMP-Protein Kinase Catalytic subunit (PKA), matrix metalloproteinase-2(MMP2), and MMP9. [score:4]
Fig. 5SH2B1 is a direct downstream target of miR-361-3p. [score:4]
b Low-level expression of miR-361-3p was associated with lymph node metastasis of NSCLC, c TNM Classification of NSCLC. [score:3]
In addition, western blot analysis showed that SH2B1 protein expression was clearly decreased in A549 cells and HTB-182 cells transfected with LV-miR-361-precursor, and increased in SPC-A-1 cells transfected with LV-anti-miR-361-3p (Fig.   5c). [score:3]
The specificity of this inhibition was demonstrated by the finding that the activity of a mutant SH2B1 3’-UTR with the putative binding site mutated was not affected by miR-361-3p (Fig.   5b). [score:3]
In addition, The SH2B1 was identified as a functional target of miR-361-3p. [score:3]
miR-361-3p was significantly decreased in NSCLC tissue and cell lines, and its expression levels were highly correlated with lymph node metastasis (P < 0.01) and TNM stages (P < 0.05). [score:3]
There was an inverse correlation between miR-361-3p and SH2B1 expressions in these specimens (Fig.   5d, e, R = −0.622, P < 0.001). [score:3]
In addition, miR-361-3p expression was significantly lower in NSCLC tissue which displayed lymph node metastasis than did not (Fig.   1b) (P <0.05), and decreased statistically with increasing stage of NSCLC (P < 0.05) (Fig. 1c). [score:3]
Furthermore, miR-361-3p expression was significantly inversely associated with metastasis and tumor nodes and Metastasis(TNM) stages of the patients (Table  1, P < 0.05). [score:3]
In previous research, we noticed that miR-361-3p was lowexpressed in NSCLC [17]. [score:3]
a The expression of miR-361-3p in 91 pairs of NSCLC tissues was significantly lower. [score:3]
Luciferase vectors containing the 3’-UTR of each gene were created and transfected along with or without the miR-361-3p expressing plasmid into cells. [score:3]
Furthermore, to explore the relationship between miR-361-3p and SH2B1 in clinical specimens, we examined SH2B1 expression using immunohistochemical analysis on FFPEs of 91 NSCLC specimens. [score:3]
Fig. 1Low expression of miR-361-3p is inversely associated with TNM Classification and lymph node metastasis of NSCLC. [score:3]
Spearman’s correlation analysis was used to determine correlation between miR-361-3p and SH2B1 expression. [score:3]
The restoration of SH2B1 expression enhanced the proliferation (Fig.   6a) and colony formation (Fig.   6b) of A549 [miR-361-precursor] and HTB-182 [miR-361-precursor]cells. [score:3]
b miR-361-3p inhibited NSCLC cells proliferation determined using colony formation. [score:3]
Recent studies have shown that miR-361 expression was alternant in several cancer types, for example squamous cell carcinoma [12], cervical cancer [13], prostate cancer [14], colorectal and gastric cancer [15], hepatocellular carcinoma [16]. [score:3]
The different levels of miR-361-3p expression were confirmed by real-time PCR (Fig.   1e). [score:3]
Therefore, the low miR-361-3p expression was closely related to the progression and metastasis of NSCLC. [score:3]
These results indicated that miR-361-3p inhibits NSCLC cell proliferation and metastasis in vitro. [score:3]
A549 and HTB-182 cells stably expressing miR-361-3p and negative control vector were injected subcutaneously into nude mice. [score:3]
As shown in Fig.   4, Immunohistochemistry confirmed that the expression of SH2B1 was significantly lower in A549 [miR-361-precursor] group than negative control groups (Fig.   4d). [score:3]
Levels of miR-361-3p and SH2B1 were normalized to U6 and β-actin, respectively, to yield a 2 [-ΔΔCt] value for relative expression of each transcript. [score:3]
The hsa-miR-361-3p -inhibition sequence was constructed as follows: (Forward) hsa-miR-anti-361-3p-AgeI-F AATTCAAAAATCCCCCAGGTGTGATTCTGATTT, (Reverse) hsa-miR-anti-361-3p -EcoRI-R CCGGAAATCAGAATCACACCTGGGGGATTTTTG. [score:3]
We found that the expression level of miR-361-3p in NSCLC was significantly lower in NSCLC tissues than in the corresponding normal lung tissues, and inversely associated with advanced stage and lymph node metastasis of NSCLC. [score:3]
The relationship between miR-361-3p expression and clinicopathologic parameters was analyzed using the Pearson χ [2] test. [score:3]
c down-regulated miR-361-3p enhanced migration and invasion in vitro in SPC-A-1 compared with controls. [score:3]
Furthermore, our evidence suggests that miR-361-3p is a potential therapeutic target in NSCLC. [score:3]
Remarkably, A549 a squamous cell carcinoma cell line, and HTB-182 an adenocarcinoma cell line, which expressed the lowest miR-361-3p level, consistent with the association of miR-361-3p with NSCLC metastasis as observed in NSCLC patient samples. [score:3]
e The inverse correlation between the expression of miR-361-3p and SH2B1 in the same set of NSCLC tissue specimens. [score:3]
These findings suggest the possibility for miR-361-3p as a therapeutic target in NSCLC. [score:3]
The versatile functions of miR-361-3p in tumor cell proliferation, migration and invasion suggest its potential application as a prognostic predictor and cancer therapeutic target. [score:3]
d miR-361-3p expression in NSCLC cell lines and HBE. [score:3]
These findings provide new insight into the molecular pathogenesis of NSCLC and implicate miR-361-3p as a potential prognostic biomarker and therapeutic target of NSCLC. [score:3]
The luciferase reporter assay showed that SH2B1 was a direct target gene of miR-361-3p. [score:3]
Moreover, the restoration of SH2B1 significantly attenuated miR-361-3p -mediated inhibition of A549 [miR-361-precursor] and HTB-182 [miR-361-precursor] cells migration and invasion (Fig.   7a, b). [score:3]
a miR-361-3p inhibited NSCLC cells proliferation determined using CCK8 assays. [score:2]
The qRT-PCR assays were performed to detect miR-361-3p and SH2B1 expression using the PrimeScript RT reagent Kit and SYBR Premix Ex Taq (GeneCopoeia, USA) according to the manufacturer’s instructions. [score:2]
Real-time quantitative PCR (qRT-PCR) was used to analyze the expression of miR-361-3p in NSCLC tissue and in compared adjacent non-cancerous tissues. [score:2]
MiR-361-3p -mediated control of SH2B1 expression was further validated by complementary gain- and loss-of-function approaches. [score:2]
Furthermore, transwell assays showed the migratory and invasive abilities was significantly decreased (Fig.   3a, b), whereas reduced miR-361-3p expression inSPC-A-1 [anti-miR-361-3p] cells resulted in the opposite result (Fig.   3c). [score:2]
Our report revealed a novel miR-361-SH2B1 axis in regulation of NSCLC. [score:2]
MiR-361-3p inhibits NSCLC cell proliferation, migration and invasion in vitro. [score:2]
The relative expression levels for miR-361-3p in these six NSCLC cell lines were 0.005, 0.091, 0.093, 0.118, 0.436, and 0.475, respectively, as compared with that of HBE cells, respectively (Fig.   1d). [score:2]
Further studies are required to fully understand the detailed mechanisms of miR-361-3p in NSCLC carcinogenesis and as a potential therapeutic approach. [score:1]
We then carried out a luciferase -based assay to validate whether these genes were indeed regulated by miR-361-3p. [score:1]
Among the candidates, SH2B1 exhibited one of the highest prediction scores and the most complementary structure with miR-361-3p (Fig.   5a). [score:1]
Measurement of luciferase activity revealed that miR-361-3p expression was associated with marked reduction of the activity of SH2B1 UTR. [score:1]
The result showed that compared with the control group, with forced expression of miR-361-3p impaired in both A549 [miR-361-precursor] and HTB-182 [miR-361-precursor] cells, Cell Counting Kit-8(CCK8) (Fig.   2a) and colony formation assays (Fig.   2b) showed that cell proliferation were significantly repressed. [score:1]
LV-miR-361-precursor, LV -negative control transfected A549 and HTB-182 or anti-miR-361-3p, or pGC FU -RNAi-NC-LV (Negative control) transfected SPC-A-1 cells (3000 cells/well, 5 wells/group) were allowed to grow in 96-well plates. [score:1]
To confirm, we evaluated the expression of miR-361-3p in 91 pairs of frozen NSCLC tissues and the corresponding normal lung tissues which located 5 cm apart from tumor by quantitative reverse transcriptase PCR (qRT-PCR). [score:1]
On the contrary, the cell proliferation of SPCA-1 [anti-miR-361-3p] cells was significantly enhanced. [score:1]
This study examined the role of miR-361-3p in non-small cell lung cancer (NSCLC). [score:1]
We also evaluated miR-361-3p expression in six NSCLC cell lines (A549, HTB-182, PC-9, NCI-H1299, LTEP-A-2, SPC-A-1) and a normal human bronchial epithelial cell line (HBE). [score:1]
, Shanghai, China) to generate pGC-FU-miR-361 and the pGC-FU-3FLAG-SV40-EGFP Vector only as negative control. [score:1]
A549 [miR-361-precursor] and HTB-182 [miR-361-precursor] cells grown in 96-well plate were transfected with 100 ng of SH2B1-3′UTR-Wt or SH2B1-3′UTR-Mut, using the Lipofectamie 3000 (Invitrogen, USA). [score:1]
miR-361-3p Progression NSCLC SH2B1 Lung cancer is the highest mortality malignant tumor in China and African Americans [1, 2]. [score:1]
Such researches imply that miR-361 may play important roles in cancer depending on the tumor type. [score:1]
Gain- and loss-of-function of SH2B1 abrogated or mimicked impact of miR-361-3p on cell proliferation and metastasis. [score:1]
The intrapulmonary metastasis rate of A549 [vector] was 80 %, whereas no metastasis was found in A549 [miR-361-precursor] group (Fig.   4b, d). [score:1]
In this study, we aimed to evaluate the possible roles and related target genes of miR-361-3p in tumorigenesis of NSCLC. [score:1]
The hsa-mir-361-precursor sequence was constructed as follows: (Forward) hsa-miR-361-Age I-F GAGGATCCCCGGGTACCGGTGCAGTGGCACGCTTGACAGTGATTTTTTTCCTGGGATTTGGGAGC, (Reverse) hsa-miR-361-Nhe I-R CACACATTCCACAGGCTAGTAGGGAGCTCAACCATACCAG. [score:1]
e The level of miR-361-3p was significantly changed in NSCLC cells after infected with miR-361-3p lentivirus or anti-miR-361-3p. [score:1]
a The NSCLC mouse subcutaneous implantation mo del in mice was constructed by using A549&HTB-182 cells infected with negative control and miR-361-precursor. [score:1]
Expression of miR-361-3p is inversely associated with clinicopathologic characteristics and prognosis of NSCLC. [score:1]
Accumulating evidence suggests that miR-361 plays important roles in human carcinogenesis. [score:1]
The average tumor volume of A549 cells stably transfected with miR-361-precursor was significantly smaller than tumors in the negative control group (Fig.   4a). [score:1]
[1 to 20 of 105 sentences]
3
[+] score: 258
VEGFA and miR-361-5p Expression Levels are Inversely Correlated in Skin-derived Cells in vitro Next, we used quantitative reverse transcription PCR (qRT-PCR) to determine the expression levels of endogenous miR-361-5p and VEGFA mRNA in four skin-derived human cell lines: (1) the VEGFA-secreting epithelial cell lines A431 and HaCaT; (2) primary dermal lymphatic (LEC) and blood vascular (BEC) endothelial cells, which are targeted by VEGFA but express only low levels of it themselves [78], [79]. [score:9]
It is of interest that miR-361-5p is predicted to target mRNAs coding for other proteins acting in angiogenesis (a list of potential miR-361-5p targets compiled from five miRNA target prediction algorithms is given in Table S2; pathways enriched among the Gene Ontology annotations of candidates are shown in Table S3; putative targets acting downstream of VEGFA are highlighted in a pathway map in Figure S2). [score:9]
Having established that miR-361-5p levels are lower in those skin-derived cell lines that exhibited higher levels of VEGFA expression in vitro, we hypothesized that its expression may be lower in SCC, and that it may thus contribute to the initiation or maintenance of high VEGFA expression, either directly or indirectly. [score:9]
Indeed, while the reliability of miRNA target prediction software is often questionable at the level of individual targets, the strong enrichment of VEGFA-related pathways among predicted miR-361-5p targets (Table S2, Table S3, Figure S2) indicates that the miRNA may have potential roles in regulating angiogenesis and other VEGFA-related functions, both upstream and downstream of the VEGFA/VEGF receptor axis. [score:8]
Next, we used quantitative reverse transcription PCR (qRT-PCR) to determine the expression levels of endogenous miR-361-5p and VEGFA mRNA in four skin-derived human cell lines: (1) the VEGFA-secreting epithelial cell lines A431 and HaCaT; (2) primary dermal lymphatic (LEC) and blood vascular (BEC) endothelial cells, which are targeted by VEGFA but express only low levels of it themselves [78], [79]. [score:7]
This analysis revealed that only three miRNA/MRE pairs were predicted by all five algorithms (Table S1): Two MREs, predicted to be targeted by miR-29b and miR-205, have already been shown to regulate VEGFA expression [42], [45], [46], [51]; the third MRE, predicted to be regulated by miR-361-5p, is located in the downstream conserved region. [score:7]
No targets for miR-361-5p have been experimentally confirmed so far, but it has been shown that the transfection of a miR-361-5p mimic in hypoxia -induced CNE cells leads to reduced VEGFA protein levels, as determined by – supporting the idea that this miRNA may regulate VEGFA expression [35], [36]. [score:6]
The pathways most strongly enriched among predicted miR-361-5p targets include upstream regulators of VEGFA expression, such as the EGF and FGF signaling pathways (P = 7.2 × 10 [−6] and 2.6 × 10 [−5], respectively), as well as the VEGF pathway and angiogenesis (P = 0.0085 and 0.0016). [score:6]
Importantly, significant changes in secreted VEGFA levels were found for miR-361-5p mimics and antisense inhibitors in A431 (∼26/24% decrease/increase for mimics and antisense inhibitors, respectively; P = 0.0045 and 0.0181; unpaired t-test, two-tailed; Figure 2C) and HaCaT cells (∼19/17% decrease/increase for mimics and antisense inhibitors, respectively; P = 0.0150 and 0.0233; unpaired t-test, two-tailed; Figure 2D), when compared to the corresponding control oligonucleotides. [score:6]
In summary, we found that out of a panel of six miRNAs targeting VEGFA, only miR-361-5p levels were decreased in SCC expressing high levels of VEGFA, indicating that miR-361-5p dysregulation could contribute to the observed elevated VEGFA levels in SCC. [score:6]
It cannot be ruled out that the results are due to secondary effects on non-targets or other miR-361-5p targets acting in the same pathway, which could in turn lead to altered VEGFA production/secretion. [score:5]
Moreover, in this scenario the impact of increased miR-361-5p levels in unstimulated A431 and miR-361-5p inhibition in unstimulated HaCaT cells should be proportional to the amount of added miRNA mimic or antisense inhibitor. [score:5]
However, data obtained from stimulated A431 cells, which express slightly more VEGFA than HaCaT cells, yet proved responsive to miR-361-5p inhibition, speaks against such a simple mo del. [score:5]
Although the co-transfection of wild type and mutant reporters with miR-361-5p antisense inhibitor or control did not lead to significant differential luciferase activities, these data indicate that the putative miR-361-5p MRE possesses regulatory potential, and that it is subject to regulation by miR-361-5p. [score:5]
As comprehensive data on the expression of miR-361-5p are currently unavailable, further studies should also reveal its association with other tumor types and targets, either acting in the same, or in different pathways. [score:5]
Next we tested the effects of miR-361-5p mimics and antisense inhibitors in a setting where VEGFA expression is induced by treatment with TNF-α (10 ng/mL, 24 h; Figure 2C/D) [16]. [score:5]
In order to gain first insights into the regulation of miR-361-5p, we also determined the expression levels of the miRNA’s ‘host gene’ CHM. [score:4]
While miRNA expression did not differ significantly within the two groups of cells (fold difference between A431 and HaCaT = 1.04+0.97–0.50; fold difference between BEC and LEC = 1.94+3.77–1.28), miR-361-5p levels were significantly higher in the endothelial cells compared to the VEGFA -expressing epithelial cells (fold differences between LEC/BEC and A431/HaCaT ranging from 23.72 to 47.82; P values between 0.0064 and 0.0120; unpaired t-test, two tailed; Figure 3A). [score:4]
Conversely, VEGFA levels were not affected in A431 cells transfected with increasing amounts of miRNA-361-5p antisense inhibitor when compared to cells transfected with a control (Figure 2A), while in HaCaT cells we detected elevated VEGFA levels for all tested antisense inhibitor concentrations (up to ∼39% when transfecting 10 nM; P = 0.0150; unpaired t-test, two-tailed; Figure 2B). [score:4]
The effects of overexpression and inhibition of miR-361-5p on proliferation and migration of A431 and HaCaT cells were assessed with (A) 4-methylumbelliferone -based proliferation and (B) monolayer wound healing (“scratch”) assays. [score:4]
A difference in VEGFA miR-361-5p MRE occupancy by endogenous miR-361-5p between HaCaT and A431 cells could potentially explain the differential effects of miR-361-5p mimic or antisense inhibitor on the levels of secreted VEGFA in unstimulated cells: A high occupancy (‘saturation’) of the MRE in HaCaT cells, which express similar miR-361-5p but lower VEGFA levels compared to A431, could account for the absence of a significant decrease in VEGFA secretion upon the addition of miR-361-5p mimic. [score:4]
Endogenous VEGFA Expression is Regulated by microRNA-361-5p. [score:4]
These results indicate that miR-361-5p might affect cancer development or progression by modulating VEGFA expression in particular tumor types. [score:4]
Figure S2 Pathway analysis of predicted miR-361-5p targets. [score:3]
To check whether endogenous VEGFA levels could be affected by miR-361-5p, we chose to alter levels of the miRNA in epidermoid squamous cell carcinoma-derived A431 cells [76] and keratinocytes derived from normal skin that transformed spontaneously in vitro (HaCaT) [77] – both of which are known to express high levels of VEGFA, as well as low levels of miR-361-5p (see the following paragraph). [score:3]
Taken together, these findings demonstrate that miR-361-5p affects the levels of secreted VEGFA, further suggesting that the miRNA is able to repress endogenous VEGFA expression in vitro. [score:3]
We have shown that miR-361-5p is expressed in a number of cell types derived from human skin. [score:3]
de/rnahybrid/) was used online, with default settings and the following sequences: UUAUCAGAAUCUCCAGGGGUAC (miR-361-5p, microRNA) and UGUAUAUAUGTGAUUCUGAUAAA (VEGFA 3′-UTR fragment containing the putative miR-361-5p MRE, target RNA). [score:3]
0049568.g002 Figure 2A431 and HaCaT cells were transfected with the indicated concentrations of miR-361-5p mimics, antisense inhibitors, or controls, either in the presence (A, B) or absence (C, D) of TNF-α. [score:3]
Similarly, our data indicate an apparent difference in expression levels between the coding region and the downstream region of the 3′-UTR within but not in between both clinical sample groups, suggesting that alternative polyadenylation may indeed limit the availability of the miR-361-5p MRE (Figure S4). [score:3]
In the present study, we have used miRNA target prediction algorithms and luciferase reporter assays to identify a new microRNA recognition element (MRE) in a downstream conserved region of the VEGFA 3′-UTR, and we have confirmed the repressive effect of miR-361-5p on VEGFA expression in vitro with luciferase reporter assays and. [score:3]
Fold differences ± S. D. in expression levels with regards to the references (RNU6B and ACTB, for miRNA-361-5p and miRNA-361-5p, respectively) are plotted. [score:3]
Pathways significantly enriched among predicted miR-361-5p targets are given. [score:3]
Cells were transfected with 50 nM of miR-361-5p mimics, antisense inhibitors, or controls, and made responsive by exposition to reduced serum concentrations (72 and 12 hours, respectively). [score:3]
VEGFA and miR-361-5p Expression Levels are Inversely Correlated in Skin-derived Cells in vitro. [score:3]
Table S2 Predicted miR-361-5p targets. [score:3]
Considering the observed relation between miRNA and VEGFA levels, it is possible that miR-361-5p might play a role in maintaining the functional balance of differential VEGFA expression between epithelial and endothelial cells in the skin. [score:3]
Table S3 Gene set enrichment analysis of predicted miR-361-5p targets. [score:3]
A manually curated representation of the VEGF signaling pathway available at KEGG [100] was color-coded according to the number of algorithms that predict an individual gene to be targeted by miR-361-5p. [score:3]
Mutation of the putative recognition element abolishes miRNA-361-5p -mediated regulation of a VEGFA 3′-UTR reporter. [score:3]
Furthermore, we have shown that levels of miR-361-5p, but not those of the known VEGFA -regulating miRNAs miR-20b, -34a, -93, -126, and -205, inversely correlate with VEGFA expression in SCC compared to healthy skin samples, corresponding to previously reported findings [86]. [score:3]
qRT-PCR analysis of miR-361-5p (A) and VEGFA (B) expression in A431, HaCaT, primary human dermal lymphatic (LEC) and blood endothelial cells (BEC). [score:3]
With a Spearman’s rank correlation coefficient of the ΔC [T] values of r = −0.80 (two-tailed) across all cell lines, the expression levels of miR-361-5p and VEGFA correlated well in an inverse manner, although this correlation did not reach significance. [score:3]
In summary, these data indicate that miR-361-5p is expressed in all of the tested skin-derived cell lines, with the highest levels occurring in endothelial cells. [score:3]
VEGFA is a Putative Target of microRNA-361-5p. [score:3]
0049568.g003 Figure 3qRT-PCR analysis of miR-361-5p (A) and VEGFA (B) expression in A431, HaCaT, primary human dermal lymphatic (LEC) and blood endothelial cells (BEC). [score:3]
The mutation in the putative miR-361-5p recognition element was introduced using the QuikChange I site-directed mutagenesis kit (Stratagene) according to the manufacturer’s recommendations. [score:3]
For the pathway analysis, predicted targets for miR-361-5p were converted to Entrez identifiers using DAVID [98] (http://david. [score:3]
Likewise, the absence of an effect of miR-361-5p inhibition on luciferase reporter activity in HEK293 cells could also be explained by a relatively low MRE occupancy. [score:3]
Conversely, a low occupancy of the MRE in unstimulated A431 cells could render the cells unresponsive to miR-361-5p inhibition. [score:3]
VEGFA and miR-361-5p expression levels are inversely correlated in human skin-derived cell lines. [score:3]
A431 and HaCaT cells were transfected with the indicated concentrations of miR-361-5p mimics, antisense inhibitors, or controls, either in the presence (A, B) or absence (C, D) of TNF-α. [score:3]
We therefore measured the expression of miR-361-5p and several other VEGFA -regulating miRNAs in five samples of SCC obtained from patients and in five healthy skin samples using qRT-PCR. [score:2]
Loss-of-function mutations of miR-361-5p may thus potentially contribute to the observed variations in VEGFA levels. [score:2]
Interestingly, many of the observed mutations/ deletions in the CHM alleles of patients also affect miR-361-5p [90]. [score:2]
Moreover, previous findings in an experimental SCC mo del, demonstrating that elevated VEGFA levels were associated with increased tumor cell invasion and angiogenesis [10], indicate an indirect mechanism by which miR-361-5p might promote SCC progression. [score:2]
In the SCC samples, miR-361-5p and CHM levels were significantly decreased compared to healthy skin samples (fold difference between SCC and healthy skin for the miR-361-5p assay: 0.44+0.33–0.19; P = 0.0220; unpaired t-test with Welch’s correction, two-tailed; P = 0.0159; Mann-Whitney U = 1, n1 = n2 = 5, two-tailed; fold difference between SCC and healthy skin for the CHM assay: 0.40+0.53–0.23; P = 0.0456; unpaired t-test with Welch’s correction, two-tailed; P = 0.0952; Mann-Whitney U = 4, n1 = n2 = 5, two-tailed), whereas all other tested miRNAs either did not exhibit considerably reduced expression levels or, as seen for miR-126, even appeared to be increasingly expressed (fold difference between SCC and healthy skin of 3.72+10.99–2.78; P = 0.0699; unpaired t-test with Welch’s correction, two-tailed; P = 0.0952; Mann-Whitney U = 4, n1 = n2 = 5, two-tailed; Figure 4A and S4B). [score:2]
Therefore, detailed studies into the regulation of miRNA 361 should consider analyzing primary transcripts levels as well as those of miR-361-5p and-3p, their precursors, as well as CHM/Rab escort protein 1 protein levels. [score:2]
Next, we measured the expression of miR-361-5p and the known VEGFA -regulating miRNAs miR-20b, miR-34a, miR-93, miR-126 and miR-205. [score:2]
MicroRNA-361-5p Targets the VEGFA 3′-UTR. [score:2]
When overexpressing the miR-361-5p mimic together with the wild type VEGFA 3′-UTR luciferase reporter, relative Renilla activity was decreased by approximately 25% compared to the control precursor (P = 0.0327; unpaired t-test, two-tailed), as well as the mutated reporter (P = 0.0263; unpaired t-test, two-tailed), which did not change relative to the control (Figure 1C). [score:2]
We also found that miR-361-5p levels were lower in those skin-derived cell lines that express high levels of VEGFA, as well as in SCC tumors compared to healthy skin. [score:2]
Using luciferase reporter assays, we have shown that miR-361-5p can target the VEGFA message via a recognition motif that is located in the downstream conserved region of the VEGFA 3′-UTR. [score:2]
Of note, miR-361-5p levels (∼3.6-fold lower than RNU6B) were very consistent between samples (Figure S4A) and correlated fairly well with CHM mRNA levels (r = 0.53, P = 0.0587; Spearman’s rank correlation, one-tailed; data not shown). [score:1]
To gain first insights into possible functions of miR-361-5p, we analyzed the impact of altered miR-361-5p levels on proliferation (Figure S5A/B) and migration (Figure S5C/D) of A431 and HaCaT cells. [score:1]
With regards to SCC, studies with larger sample numbers and follow-up data should establish the value of miR-361-5p as a diagnostic and prognostic marker. [score:1]
One possibility is certainly that miR-361-5p transcription is dependent on its “host gene” CHM. [score:1]
The miR-361-5p binding site analyzed in this study is indicated in red. [score:1]
0049568.g001 Figure 1(A) Schematic representation of the luciferase reporter constructs, indicating the VEGFA 3′-UTR fragment fused to Renilla luciferase, the predicted miRNA recognition element (MRE) for miR-361-5p, and the firefly luciferase gene used for normalization. [score:1]
This may indicate a potential role for miR-361-5p in upholding the physiological balance of VEGFA levels in the skin. [score:1]
Additionally, we also generated a mutant of the putative miR-361-5p MRE, in which three nucleotide residues are deleted (Figure 1B; effective deletion relative to the miRNA seed region = 2 nucleotides). [score:1]
MIR361 is encoded on the × chromosome, in an intron between exons 9 and 10 of CHM/choroideremia (Rab escort protein 1) and gives rise to two mature miRNA species, miRNA-361-3p and the predominant miRNA-361-5p. [score:1]
Figure S1 Overview of the human VEGFA 3′-UTR, hsa-mir-361 and their predicted hybrid structure. [score:1]
VEGFA levels were significantly decreased in A431 cells (up to ∼30% when transfecting 10 nM; P = 0.0063; unpaired t-test, two-tailed; Figure 2A), while we only observed a slight decrease in VEGFA levels in HaCaT cells (up to ∼11% when transfecting 30 nM; P = 0.0502; unpaired t-test, two-tailed; Figure 2B) when comparing transfection of miR-361-5p mimic and control. [score:1]
Impact of altered miRNA-361-5p levels on secretion of endogenous VEGFA. [score:1]
The miR-361-5p sequence was obtained from miRBase [97] (Release 17, http://www. [score:1]
We then determined VEGFA levels in the culture supernatants of both cell lines transfected with different amounts of miRNA-361-5p mimic or control using (Figure 2A/B). [score:1]
The absence of such a miRNA dose-response could indicate that one or more additional factors differentially modulate miR-361-5p activity in the two cell lines, systemically or specifically, by influencing the availability, accessibility or functionality of the miRNA or its recognition element. [score:1]
Although we did not observe a similar inverse correlation between CHM and VEGFA mRNA levels, the correlation between CHM and miR-361-5p levels may be an indication that transcription of the miRNA precursor is dependent on CHM transcription. [score:1]
Of note, an additional potential miR-361-5p MRE (located between nucleotides 1900 and 1921 of the 3′-UTR) was predicted by microRNA. [score:1]
Figure S5 Effects of altered miR-361-5p levels on the proliferative and migratory properties of skin-derived cells. [score:1]
[1 to 20 of 81 sentences]
4
[+] score: 62
As miR361-3p and miR1470 were indicated to be significantly upregulated in stages 3 and 4, the target mRNAs of these two were analyzed, and the target data sets of the two were obtained from target gene prediction databases, including TargetScan (www. [score:12]
For example, the GO term 0008219 is correlated with cell death, and nine mRNAs (NM_171982, NM_022470, NM_145725, NM_000332, NM_001098517, NM_001004426, NM_152240, NM_002598 and NM_004394) that were downregulated in the disease and may be regulated by miR-361-3p were enriched in this GO term, while almost eight lncRNAs that neighbored the mRNAs were also enriched in the same GO term (Table 12, Supplementary Material). [score:7]
In the clustering map of the union set of differentially expressed, only 2 (miR361-3p and miR1470) were significantly upregulated in stages 3 and 4. are endogenous small ncRNAs that are ~22 nt in length. [score:6]
The mRNAs that were both targets of miR361-3p or miR1470 and downregulated in stages 3 and 4 were obtained. [score:6]
In the clustering map of the union set of differentially expressed, only 2 (miR361-3p and miR1470) were significantly upregulated in stages 3 and 4. Similarities between and mRNAsmiRNAs are endogenous small ncRNAs that are ~22 nt in length. [score:6]
Functions shared by lncRNAs, and mRNAsThe mRNAs that were both targets of miR361-3p or miR1470 and downregulated in stages 3 and 4 were obtained. [score:6]
There were 5,247 target mRNAs of miR361-3p, and 526 target mRNAs of miR1470 (Table 6, Supplementary Material). [score:5]
A total of 642 target mRNAs of miR361-3p, and 71 target mRNAs of miR1470 were identified as miRNA -associated mRNAs (Table 8, Supplementary Material). [score:5]
Based on the analysis, the cross-linked diagrams of miR361-3p and miR1470 are depicted in Fig. 4; the three types of RNA shared similarities in the majority of the stages of disease progression. [score:3]
Hughes et al (54) confirmed that miR-361-3p expression was significantly increased in clear cell renal cell carcinoma compared with that in normal renal tissues. [score:2]
miR-361-3p is a highly conserved X-linked miRNA that was demonstrated to be dysregulated in the serum of patients with lung cancer, and may be a blood -based marker for discriminating between malignant and benign lung tumors (52). [score:2]
A total of twenty-six GO terms were observed in the present study, of which miR-361-3p and miR-1470 shared similarities in GO functional enrichment involved in cancer, including cell cycle, cell death, cell communication, signal transduction and apoptotic process. [score:1]
Tanaka et al (53) reported that miR-361-3p was an oncogenic miRNA in human oral cancer cells. [score:1]
[1 to 20 of 13 sentences]
5
[+] score: 49
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
HDI Upregulates Selected miRNAs that Target AicdaWe have shown by qRT-PCR that miR-155, miR-181b, and miR-361, which silence AID by targeting Aicda 3′ UTR, were significantly upregulated by HDI (16). [score:11]
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
In addition to the targeting sites for miR-155, miR-181b, and miR-361, the 3′ UTR of mouse Aicda mRNA also contains the putative target sites for miR-125a, miR-351, miR-92b, miR-26a, and miR-103 (identified by using miRNA -targeting prediction tools: TargetScan. [score:9]
We have further shown that HDI, such as VPA and butyrate, inhibit AID and Blimp1 expression by upregulating miR-155, miR-181b, and miR-361, which silenced AICDA/Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silenced PRDM1/Prdm1 mRNA (16). [score:8]
We have shown by qRT-PCR that miR-155, miR-181b, and miR-361, which silence AID by targeting Aicda 3′ UTR, were significantly upregulated by HDI (16). [score:6]
Some miRNAs, including miR-155, miR-181b, and miR-361, can silence AID expression, whereas miR-30a and miR-125b can silence Blimp-1 expression (16). [score:5]
[1 to 20 of 6 sentences]
6
[+] score: 34
A high proportion (5/6 = 80%) of mimics affected differentiation in the expected manner (Figure 3): ectopic expression of miR-486-5p, miR-1249 and miR-361-3p resulted in increased expression of the differentiation marker MCK, whereas inhibition of these miRNAs reduced MCK expression (Figure 3a, b); conversely, ectopic expression of let-7 miRNAs (miR-98 and another member of the family, let-7g) decreased MCK expression, whereas inhibition of these miRNAs increased MCK expression (Figure 3c). [score:17]
Under differentiation conditions, ectopic miR-1249, miR-361-3p and miR-486-5p all induced precocious differentiation, and inhibition of let-7 miRNAs had the same effect (Figure S2a). [score:3]
83 *** hsa-mir-346 7.13 *** 69.13 *** hsa-mir-361-3p 4.51 *** 9.6 *** hsa-mir-483-3p 3.56 *** 68.61 *** hsa-mir-486-5p 2.85 *** 34.48 *** hsa-mir-574-3p 2.61 *** 43.22 *** hsa-mir-629* 16.62 *** 67.23 *** hsa-mir-885-5p 4.75 *** 43.73 *** Inhibited differentiation & high cell count hsa-mir-193b 38.04 *** 102.74 * Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-369-3p 61.75 *** 103.6 * hsa-mir-381 61.75 *** 105.31 * hsa-mir-886-5p 38.04 *** 112.86 *** hsa-mir-940 21.37 *** 112.35 *** Enhanced differentiation hsa-mir-98 104.51 * 87.82 *** High cell count hsa-mir-631 92.63 ** 103.43 *** 1see Material and Methods; 2 *: p<0.05; **: p<0.01; *** p<0.005; − = not significant. [score:3]
In this category, miR-361-3p inhibition dramatically decreased the number of cells, suggesting that this miRNA controls pathways involved in cell survival. [score:3]
html) for four hit miRNAs: miR-486-5p, miR-361, miR-365 and miR-1249 (list of the targets tested in Figure S3d). [score:3]
This selection of hits included two pro-differentiation miRNAs, miR-1249 and miR-365; one anti-differentiation miRNA, miR-98; and a miRNA required for myoblast survival, miR-361-3p – note that miR-98 and miR-365 have similar expression profiles but have opposite effects on differentiation. [score:3]
Although miR-1249, miR-361-3p and miR-486-5p mimics all impacted on differentiation in a similar manner, detailed analysis of the phenotypes of treated cells showed subtle differences in the morphology of differentiated myotubes (Figure 3d, e, g). [score:1]
Figure S2 a: early differentiation of cells treated with miR-1249, miR-361-3p, miR-486-5p mimics or let-7 LNA antisenses. [score:1]
[1 to 20 of 8 sentences]
7
[+] score: 31
The quantitative PCR results confirmed the expression of two most upregulated (hsa-miR-361-5p and hsa-miR-214) and downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs in the same 35 GC pairs (Figure 1B). [score:9]
Two most upregulated (hsa-miR-361-5p and hsa-miR-214) and two most downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs were further validated using qRT-PCR in GC tissue pairs. [score:7]
B. Validation of two most differentially upregulated (miR-214 and miR-361-5p) and downregulated (miR-148a and miR-1225-5p) miRNAs in tumor and corresponding nontumorous pairs used for microarray analysis. [score:7]
The average mRNA expression levels in cancerous tissues were increased by 2.81- and 1.92-fold (p < 0.01 for both) for hsa-miR-361-5p and hsa-miR-214, but decreased by 4.76- and 6.25-fold (p < 0.01 for both) for hsa-miR-148a and hsa-miR-1225-5p relative to those in the adjacent normal tissues. [score:3]
Consistently, in this study both miRNA array and quantitative PCR analysis showed that there was a significant increase in the level of miR-361-5p expression between GC tumors and their corresponding nontumorous tissues. [score:3]
MiR-361-5p was also often aberrantly expressed in some human cancers, such as cervical and prostate cancer [41, 42]. [score:2]
[1 to 20 of 6 sentences]
8
[+] score: 22
According to the results of TargetScan analysis, totally 2743 bovine genes were predicted as the targets of c-miRNAs significantly down-regulated by grazing (miR-19b, miR-148a, miR-150, miR-221, miR-223 miR-320a, miR-361, and miR-486). [score:8]
MiR-19b and miR-361 are expressed in bovine adipose tissue. [score:3]
Expression of miR-361 was shown to be altered by treatment with palmitate and oleate in mouse muscle C2C12 cells [24]. [score:3]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
Therefore, miR-361 might be associated with changes in fatty acid content at the potential miR-361 recipient cells less in grazing cattle than in the housed cattle. [score:1]
Grazing -induced miRNAs: miR-19b, miR-150, miR-223, miR-320a, miR-361. [score:1]
At 2 mo, the levels of miR-19b, miR-150, miR-223, miR-320a, and miR-361 in the grazing cattle were lower than in the housed cattle (P = 0.015, 0.020, 0.026, 0.023, and 0.089, respectively). [score:1]
No exercise -induced changes in circulating miR-19b, miR-150, miR-320a, or miR-361 have ever been reported, which may indicate the specificity of changes in those miRNAs to the grazing movements of cattle. [score:1]
The results of qRT-PCR normalized with the let-7g level showed that the levels of miR-19b, miR-148a, miR-150, miR-221, and miR-361, and miR-486 in the grazing cattle were lower than those in the housed cattle at 1 mo of grazing (P = 0.013, 0.014, 0.093, 0.011, 0.041, and 0.023, respectively) (Fig 6A). [score:1]
[1 to 20 of 9 sentences]
9
[+] score: 18
Five representative differentially expressed miRNAs (hsa-miR-181a, hsa-miR-769-5p, hsa-miR-361-5p, hsa-miR-1304, and hsa-miR-608) were selected to undergo RT-qPCR validation based on highest fold-change as well as putative targets as identified by the TargetScan web tool (Fig. 5a). [score:7]
RT-qPCR indicated that miR-181a, miR-769-5p, and miR-361-5p were all down-regulated in siRNA -transfected A549 and SK-LU1 cells when compared to non -transfected cells, while miR-608 was up-regulated. [score:6]
Bioinformatic analyses predicted that the five significantly dysregulated miRNAs (hsa-miR-181a, hsa-miR-769-5p, hsa-miR-361-5p, hsa-miR-1304, and hsa-miR-608) were linked to various apoptotic signaling pathways, including the PI3K/AKT, WNT, TGF-β, MAPK/ERK and the intrinsic pathway, and all were implicated as those directly affected by Bcl-xL levels. [score:3]
All experiments were carried out with three independent biological replicates and presented as mean ± S. D. (A) RT-qPCR of the five miRNAs (hsa-miR-181a, hsa-miR-769-5p, hsa-miR-361-5p, hsa-miR-1304, and hsa-miR-608) validated against microarray results, and presented as normalized fold-change values. [score:1]
0081735.g005 Figure 5(A) RT-qPCR of the five miRNAs (hsa-miR-181a, hsa-miR-769-5p, hsa-miR-361-5p, hsa-miR-1304, and hsa-miR-608) validated against microarray results, and presented as normalized fold-change values. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 13
Finally, we demonstrate that several miRNAs including miR-361 and miR 194 are downregulated in blood, suggesting that dysregulation of the miRNA biogenesis in 22q11DS occurs in blood and that the degree of dysregulation can correlate with psychiatric, neurocognitive and immunological features of 22q11DS. [score:6]
Specifically, six miRNAs (miR-185, miR-15b-3p, miR-363, miR-324-5p, miR-361-5p, and miR-194) were dysregulated in individuals with 22q11DS when examining left hippocampal volume (Figure 5 ), and also with right hippocampal volume (Figure 6 ), while the expression level of two miRNAs (miR-361-5p, and miR-194) significantly decreased with increased whole brain volume (Figure 7 ). [score:4]
A number of miRNAs including miR-194, miR-361, miR-150 and miR-185 were found to be dysregulated in 22q11DS. [score:2]
In particular, highly significant lower expression levels were observed for miR-194, miR-361 and miR-185 in individuals with 22q11DS across all of our phenotypic neuronal measures. [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 11
Twelve radiation -suppressed miRNAs were identified, i. e. let-7d, miR-15a, miR-17, miR-30d, miR-92a, miR-197, miR-221, miR-320b, miR-342, miR-361, miR-501 and miR-671, and a significantly different expression between prostate cancer and the corresponding adjacent part was found, including 11 upregulated and 1 downregulated (Fig. 3B). [score:11]
[1 to 20 of 1 sentences]
12
[+] score: 11
Of the 27 hairpins (30% of those tested) for which the observed change in the relative expression of the hairpin arms was exclusively associated with infection, three of them (miR-199b, miR-361, miR-582) showed a change in the identity of the dominant miRNA arm upon infection with at least one bacterium (Fig. 3B, S7 Fig. and S7 Table). [score:3]
However, in two cases (miR-361 and miR-582 expression following YRS infection for 48h) we observed a clear switch in the dominant miRNA sequence. [score:3]
To validate these observations, we measured the expression of one arm-switch miRNAmiR-361 – by qPCR, and obtained a highly concordant tendency of the change in relative expression upon infection (S6B Fig. ). [score:3]
To quantify miRNA expression levels, cDNA was synthesized and quantitative real-time PCR (qPCR) performed using the Qiagen miScript PCR system and primers (miScript II RT Kit: 218161; miScript SYBR Green PCR kit: 218073; miR-92b-3p MS00032144; miR-132-3p MS00003458; miR-155–5p MS00031486; miR-212-3p MS00003815; miR-361-5p MS00004032; miR-361-3p MS00009555; U6 MS00033740) in a 7900 Real-time PCR system (Applied Biosystem). [score:2]
[1 to 20 of 4 sentences]
13
[+] score: 11
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-384, hsa-mir-1246
MiR-361-5p and miR-30a are down-regulated in CRC and their over -expression inhibits the progression of CRC by directly binding to the 3'UTR of their target genes [19, 20]. [score:11]
[1 to 20 of 1 sentences]
14
[+] score: 10
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-221, hsa-mir-184, hsa-mir-33b
Up to date, the limited information relative to the postranscriptional regulation of SND1 identifies SND1 transcript as a target of miR-184 in malignant gliomas and breast cancer [21, 57] and miR-361-5p in colorectal and gastric cancer [58] and links miRNAs suppression with SND1 upregulation and cancer development and progression. [score:10]
[1 to 20 of 1 sentences]
15
[+] score: 10
Among these 54 miRNAs, miR-16, miR-20a, miR-20b, let-7b, miR-17-5p, miR-27a, miR-106a, miR-106b, miR-107, miR-193a, miR-210, miR-320, and miR-361 were predicted to target VEGF. [score:3]
0000116.g005 Figure 5(A) CNE cells were transfected or co -transfected with miR-20a and miR-106b, which share the same binding site, or with miR-20a and miR-361, which target different binding sites. [score:3]
Compared to single transfection with miR-20a, miR-106b, or miR-361, co-transfection of miR-20a with miR-361 exhibited additive repression on VEGF expression, suggesting a coordinate action of these miRNAs (Fig. 5A). [score:2]
To investigate whether different combinations of miRNAs have different contributions towards VEGF regulation, we performed co-transfection experiments using miR-20a with miR-106b, which share the same binding site, and miR-20a with miR-361, which target their own binding sites. [score:2]
[1 to 20 of 4 sentences]
16
[+] score: 10
On the other hand, the significantly differentially expressed miR-361-3p is known to act as a tumor suppressor by interfering with the cell cycle. [score:5]
Thus, the downregulation of eca-miR-361-3p in severe equine asthma might lead to the increased proliferation of CD4 [+] T-cells, or it might exhibit a yet unknown function in CD4 [+] T-cell differentiation. [score:4]
Using DESeq2, we identified 11 miRNAs as statistically significant DEmiRs after accounting for the level of hemolysis: eca-miR-128, eca-miR-744, eca-miR-197, eca-miR-103 and the closely related eca-miR-107a, eca-miR-30d, eca-miR-140-3p, eca-miR-7, eca-miR-361-3p, eca-miR-148b-3p and eca-miR-215. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 9
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
The following miRNAs were tested for their potential to repress Twist1 translation in the human lung carcinoma cell line H1299: miR-33, miR-145a, miR-151, miR-326, miR-337, miR-361, miR-378a, miR-381, miR-409 and miR-543 (Fig. 1). [score:3]
The miRBase accession numbers for miRNAs are: mmu-miR-33 (MI0000707), mmu-miR-145a (MI0000169), mmu-miR-151 (MI0000173), mmu-miR-326 (MI0000598), mmu-miR-337 (MI0000615), mmu-miR-361 (MI0000761), mmu-miR-378a (MI0000795), mmu-miR-381 (MI0000798), mmu-miR-409 (MI0001160) and mmu-miR-543 (MI0003519). [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 9
In GC, oncogenic miRNAs such as miR-21 [12], miR-362 [13] and miR-296-5p [14] are abnormally upregulated, and tumor suppressing miRNAs such as miR-506 [15], miR-129-5p [16] and miR-361-5p [17] are significantly downregulated. [score:9]
[1 to 20 of 1 sentences]
19
[+] score: 8
The highest up-regulation was detected for miR-501-5p (+6.8) and for miR-361-5p (+8.4). [score:4]
In detail we confirmed the up-regulation of miR-23b (UVA), miR-361-5p (UVB), miR-191 (UVA and UVB) and miR-376c (UVA and UVB). [score:4]
[1 to 20 of 2 sentences]
20
[+] score: 8
At the same time, since CCND1 has been shown to be a hypothetical gene target for miR-449b and miR-194, whereas VEGFA for miR-361-5p, we have analyzed also the expression levels of CCND1 (Hs00765553_m1) and VEGFA (Hs00900055_m1) mRNAs in MDA-MB-231 cells subjected to the same conditions, in order to confirm the coherence of our results (Supplementary Figure 5). [score:5]
Moreover, about 4.5% of miRNAs, including miR-148a, miR-154, miR-194, miR-361-5p and miR-449b, was specifically expressed only in treated MDA-MB-231 cells undergone to STS (Supplementary Figure 3). [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 8
Other miRNAs from this paper: rno-mir-361
Wang et al. found that miR-361 regulated prohibitin expression and was involved in the regulation of mitochondrial network in cardiomyocytes [40]. [score:5]
In our study, after miR-361 antagomir transfection under the treatment of high glucose for 48 h, the level of PHB protein expression of H9c2 cardiomyoblasts was significantly increased. [score:3]
[1 to 20 of 2 sentences]
22
[+] score: 8
Among the altered microRNAs by TLDA analysis, only miR-197 was significantly downregulated, and miR-361-5p was the most upregulated microRNA as judged by differential expression, but this marked change was not validated by individual qRT-PCR assays. [score:8]
[1 to 20 of 1 sentences]
23
[+] score: 8
Other miRNAs from this paper: hsa-mir-155
Bcl6 could promote AID expression by inhibiting miR-155 and mir-361, so how EBNA3C regulates AID expression without the help of Bcl6 needs to be further explored [2]. [score:8]
[1 to 20 of 1 sentences]
24
[+] score: 7
The top five differentially upregulated miRNAs in LGDN (Table  2) were: miR-141 (625-fold), miR-101 (208-fold), miR-22 (111-fold), miR-16 (61-fold), and miR-486 (35-fold); whereas, the top five downregulated were: miR-451a (513-fold), miR-378c (104-fold), miR-361 (95-fold), miR-122 (81-fold), and miR-30c (78-fold). [score:7]
[1 to 20 of 1 sentences]
25
[+] score: 7
Each of these miRNAs was significantly enriched in specific tissues/organs, except for fca-miR-26a, fca-miR-151-3p, fca-miR-361-5p and fca-miR-chrC2_23051-3p, which were constitutively expressed in all tissues/organs examined. [score:3]
miR-151 and miR-361 were expressed at very consistent levels in all of the deep sequencing samples (not shown) and, thus, qRT-PCR values were normalized to these two miRs. [score:3]
001190), hsa-miR-361 (no. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 7
Strikingly, expression levels of 5 miRNAs shown to be increased in centenarians (hsa-miR-148a, hsa-miR-345, hsa-miR-361-5p, hsa-miR-192, hsa-miR-454) have been demonstrated to be down-regulated during cellular senescence (Table 5). [score:6]
1E-1653.37hsa-miR-99bCentenarian97 (15.32)276 (83.78)2.15E-244.96E-223.09hsa-miR-181a*Centenarian627 (24.30)1641 (307.63)4.5E-1231E-1202.84hsa-miR-363Centenarian4732 (260.52)11971 (2286.46)002.75hsa-miR-21*Centenarian2529 (286.89)6313 (1153.62)002.71hsa-miR-92b*Centenarian99 (11.67)245 (42.00)2.45E-185.66E-162.69hsa-miR-20b*Centenarian319 (77.91)708 (84.88)5.78E-421.33E-392.41hsa-miR-148aCentenarian11599 (1225.92)25583 (655.62)002.40hsa-miR-1975Centenarian1654 (86.54)3529 (335.65)2. 1E-1884.9E-1862.32hsa-miR-502-3pCentenarian191 (13.48)387 (14.66)4.03E-209.31E-182.20hsa-miR-181cCentenarian153 (6.46)310 (63.42)1.8E-164.15E-142.20hsa-miR-1259Centenarian106 (25.78)210 (29.26)4.01E-119.27E-092.15hsa-miR-148a*Centenarian339 (46.74)656 (14.26)3.38E-307.82E-282.10hsa-miR-192Centenarian7126 (1026.34)13754 (2446.01)002.10hsa-miR-361-5pCentenarian307 (20.35)587 (89.41)1.65E-263.81E-242.08hsa-miR-9Centenarian341 (26.37)629 (37. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Moreover, miR-361-5p, miR-1184 and miR-218-1* were the top among the upregulated miRNAs while miR-1265, miR-20b*, miR-520d-5p and miR-506 were the top among the downregulated miRNAs in the SE animals. [score:7]
[1 to 20 of 1 sentences]
28
[+] score: 7
In cSCC most of the altered miRNAs are downregulated (miR-125b, miR-34a, miR-214, miR-124, miR-361, miR-193b, miR-365a, miR-20a, miR-199a) [19– 25] whereas only a small number of miRNAs have been found to be upregulated and act as onco-miRNAs, being involved in angiogenesis, colony formation, migration and invasion, and metastatic spread (miR-365, miR-9, miR-184, miR-21, miR-31, miR-135b, miR-205, let-7a) [25– 34]. [score:7]
[1 to 20 of 1 sentences]
29
[+] score: 6
Furthermore, miRNAs have a role in the course of therapy; patients with lung cancer who have undergone surgical treatment show an increase in miR-625 and miR-361-3p, with similar expression levels as those in individuals with benign diseases and healthy persons, emphasizing that these miRNAs might have a protective influence on the development of lung cancer [54]. [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
Among the down-regulated miRNAs, miR-361-5p [47] and miR-27b (homologous to miR-27a, sharing 20 out of 21 nts) [48] were reported as tumor suppressors. [score:6]
[1 to 20 of 1 sentences]
31
[+] score: 5
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 5
We also found miRNAs with high diagnostic potential e. g. high MI value, that were not yet related to cancer as for example hsa-miR-527 or hsa-mir-361-5p that were both up-regulated in blood cells of lung cancer patients. [score:4]
The miRNA hsa-miR-361-5p showed the highest MI with a value of 0.446. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 5
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
Most of these serum-specific miRNAs were expressed in both breeds (Warmbloods and ponies), although we identified two miRNAs expressed solely in Warmblood (eca-let-7f, eca-miR-361-5p) and 20 other solely in ponies (Fig.   6d). [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 4
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-27a, hsa-mir-27b, hsa-mir-26a-2, hsa-mir-539
Wang K, Liu CY, Zhang XJ, Feng C, Zhou LY, Zhao Y et al (2014) miR-361-regulated prohibitin inhibits mitochondrial fission and apoptosis and protects heart from ischemia injury. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 4
P38 MAPKs (MAPK11, MAPK13, and MAPK14) were found to be regulated by miR-769-5p, miR-146b-5p, let-7g, miR-30b, miR-31, miR-361-3p, and miR-362-3p (Figure 7), which were all down expressed in H1N1 critically ill patients. [score:4]
[1 to 20 of 1 sentences]
36
[+] score: 4
Wang K. Sun T. Li N. Wang Y. Wang J. X. Zhou L. Y. Long B. Liu C. Y. Liu F. Li P. F. MDRL lncRNA regulates the processing of miR-484 primary transcript by targeting miR-361 PLoS Genet. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
MiRNA-144 was found to be highly expressed in the PBMC compared to miRNA-361-5P, miRNA-889, and miRNA-576-3p that were significantly down regulated in active tuberculosis patients. [score:3]
However, increased level of miRNA-361-5p, miRNA-889, and miRNA-576-3p have been reported in tuberculosis infected serum as non-invasive molecular biomarker for rapid diagnosis and prevention of tuberculosis infection (Qi et al., 2012). [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 4
28E-02hsa-miR-331-3p1402470.826.46E-02hsa-miR-149-3p961630.776.79E-02hsa-miR-181a-5p105716130.618.50E-02hsa-miR-30a-5p2493760.596.94E-02hsa-miR-197374511230.596.02E-02hsa-miR-4497457465460.524.68E-02Down-regulated (n = 20*)hsa-miR-1127403079−2.051.94E-02hsa-miR-26b-5p794198−2.002.30E-02hsa-miR-44541262488−1.373.93E-02hsa-miR-361-5p652259−1.333.53E-02hsa-miR-151a-5p694302−1.203.90E-02hsa-miR-26a-5p97024314−1.177.22E-03hsa-miR-378a-3p683307−1.157.26E-02hsa-miR-5190311141−1.149.06E-02hsa-miR-5100775363−1.102.89E-02hsa-miR-151b609288−1.086. [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 3
The respective part of the network is also presented in Fig.   6. VEGFA is targeted by five miRNAs, the previously mentioned miR-140-5p and also miR-378a-3p, miR-361-5p, miR-93-5p and miR-17-5p. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
Other miRNAs from this paper: hsa-mir-155
For instance, AEG-1, Sam-68, FTS, miR-361-5p induce EMT, while LMX-1, SFPR1 and miR-155 suppress EMT in cervical cancer [4]. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
e The expression of miR-361. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
A set of three miRNAs, i. e. miR-361-5p, miR-889, and miR-576-3p, was identified that specifically indicated TB disease. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Considering all differentially expressed miRNAs, we detected miR-150, miR-361, miR-130b, miR-181b and members of miRNA clusters miR-17-5p, miR-106a, miR-20a and miR-20b as the most variable miRNAs (FDR = 0.0077) (Table 1). [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Many miRNAs that were shown to have altered expression in previous studies of male infertility, including hsa-miR-30c-1 [12], hsa-mir-34b [13], mir-371 [14], hsa-mir-29c [13], and miR-361 [15], were also enriched in our study. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
Interestingly, some miRNAs were found to target more than one gene of SIV-H1N1/2009, for example, the binding sites for ssc-miR-361-3p located in both viral PB2 and HA, and the binding sites for ssc-miR-136 located in both viral NA and NP. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Other miRNAs from this paper: hsa-mir-22, hsa-mir-25, hsa-mir-363, hsa-mir-940
Recently, it has been reported that miR-940, miR-363, miR-25, and miR-269-5p function as oncogenes in gastric cancer [10– 12], whereas miR-22, and miR-361-5p function as tumor suppress genes [13– 15]. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 2
While some miRNAs were significant in many scenarios (including hsa-miR-106a (130 comparisons), hsa-miR-361-5p (130 comparisons), hsa-miR-17 (125 comparisons), hsa-miR-423-5p (125 comparisons), hsa-miR-320d (122 comparisons), and hsa-miR-20a (120 comparisons)), others were significantly dysregulated in just a few comparisons (including hsa-miR-506 (3 comparisons), hsa-miR-202* (5 comparisons), hsa-miR-361-3p (6 comparisons), hsa-miR-429 (7 comparisons), hsa-miR-548a-3p (9 comparisons), or hsa-miR-518e (9 comparisons)). [score:2]
[1 to 20 of 1 sentences]
48
[+] score: 2
Pre-clinical studies in healthy mice and in vitro studies using estrogen have identified miRNAs either regulated by estrogen (miR-203, miR-126, miR-23a, miR-21, miR-24, miR-27a and b, and miR-106a and b) or encoded by X-chromosome (miR-98, miR-652, miR-221, miR-222, miR-223, miR-361, miR-421, miR-325, miR-188, miR-92a, miR-424, miR-503, miR-505). [score:2]
[1 to 20 of 1 sentences]
49
[+] score: 2
Figure 2A shows the difference in the mapping of the four selected mouse miRNAs (mmu-miR-124, mmu-miR-153, mmu-miR-361 and mmu-miR-98; only four miRNAs were selected for simplicity). [score:1]
The results of miRror2.0 for the input of mmu miR-98, mmu miR-124, mmu miR-153 and mmu miR-361 are shown. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 2
Individual TaqMan assays (Applied Biosystems) were used to analyse the expression of the following mature mouse miRNAs: miR-181c, miR-9, miR-20b, miR-21, miR-30c, miR-148b, miR-361, miR-409-3p and Let-7i. [score:2]
[1 to 20 of 1 sentences]
51
[+] score: 2
To validate the differential expression of the selected 20 miRNAs, reverse-transcribed and pre-amplified miRNA fractions from 10 additional BM-infiltrating and 10 primary tumors were amplified in a 96 well plate in triplicate using the specific TaqMan [©] human microRNA assays (hsa-miR-324-3p, catalog #002161; hsa-miR-516-3p, catalog #001149; hsa-miR-628-5p, catalog #002433; hsa-miR-659-3p, catalog #001514; hsa-miR-10b, catalog #002218; hsa-miR-128, catalog #002216; mmu-miR-137, catalog #01129; mmu-miR-140, catalog #001187; hsa-miR-16, catalog #000391, hsa-miR-191, catalog #002299; hsa-miR-301, catalog #000528; hsa-miR-361-3p, catalog #002116; hsa-miR-365, catalog #001020; hsa-miR-548d-3p, catalog #001605; hsa-miR-572, catalog #001614; hsa-miR-576-5p, catalog #002350, hsa-miR-616, catalog #001589; hsa-miR-628-3p, catalog #002434; hsa-miR-873, catalog #002356; hsa-miR-98, catalog #000577; U6 snRNA, catalog #001973, Life Technologies). [score:2]
[1 to 20 of 1 sentences]
52
[+] score: 2
The miRNAs differentially regulated by prenatal stress includes miR-23a (up), miR-129-2 (up), miR-361 (down), let-7f (up), miR-17-5p (down), miR-98 (up), miR-425 (down), miR-345-5p (down), miR-9 (up), miR216-5p (up), miR-667 (up), and miR-505 (down) (Figure 3A). [score:2]
[1 to 20 of 1 sentences]
53
[+] score: 2
8 of these miRNAs have been previously associated with the regulation of SLE (hsa-miR-361-3p [26], hsa-miR-145-5p [27], hsa-miR-410-3p [28], hsa-miR-125 [29], hsa-miR-199a-5p [26], hsa-miR-550b-2-5p [5], hsa-miR-106a-5p [30], and hsa-miR-183-5p [31]). [score:2]
[1 to 20 of 1 sentences]
54
[+] score: 1
hsa-miR-2355-3p2.000.001622hsa-miR-133b4.300.009926hsa-miR-451a2.200.0108517hsa-miR-4664-3p4.310.000228hsa-miR-130b-3p2.300.0462722hsa-miR-44314.350.003682hsa-miR-486-5p2.320.002088hsa-miR-4804-3p4.360.000235hsa-miR-361-5p2.330.04722Xhsa-miR-18b-3p4.620.00191Xhsa-miR-3156-3p2.500.0072910hsa-miR-675-3p4.680.0002811hsa-miR-4728-3p2.670.0002917hsa-miR-550b-3p4.720.013827hsa-miR-3191-5p2.670.0002019hsa-miR-551a4.750. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
In order to provide a set of reference miRNAs one could suggest the intersection of the best 15 reference genes from both algorithms geNormPlus and NormFinder (miR-10b-3p, miR-1260a, miR-127-3p, miR-1274a, miR-181a-5p, miR-181a-2-3p, miR-195-5p, miR-26b-5p, miR-28-5p, miR-30a-3p, miR-30a-5p, miR-30d-5p, miR-361-5p, miR-720, miR-92a-3p). [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
Serum microRNA-29a and microRNA-361-5p as potential diagnostic biomarkers for active pulmonary tuberculosis. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
In the contrary, the 5p arm of hsa-mir-361 is the major miRNA in tumor tissue and the 3p arm miRNA is the major one in normal tissue. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
In this study, many miRNAs (miR-10a, miR-21, miR-145, miR-212, miR-339, miR-361) responded to capecitabine chemoradiotherapy in individual tumor samples. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
3 ✓ hsa-mir-30e ↓ ↓ ↑ ↑ 1p34.2 - hsa-mir-422a ↓ ↓ ↓ ↑ 15q22.31 - hsa-mir-132 ↓ ↓ ↓ 17p13.3 - hsa-mir-205 ↓ ↓↔↑ ↓ ↓↔↑ 1q32.2 - hsa-mir-375 ↑ ↑ 2q35 - hsa-mir-1274b ↑ ↑ ↑ 19q13.43 - hsa-mir-361 ↓ ↓ ↑ ↓↔↑ Xq21.2 - Abbreviations: Br, Breast; Ce, Cervical; En, Endometrial; Ov, Ovarian; Pr, Prostate; Te, Testicular; Re, Renal; Co, Colorectal; Ga, Gastric; Li, Liver; Pn, Pancreatic; Gl, Glioblastoma; Ln, Lung; In, Intestinal Neuroendocrine; Bl, Bladder; PCSR, Potential Cancer-Susceptibility Region. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
The top ten miRNAs with the highest absolute loadings for the second principal component (PC2) were hsa-miR-320a, hsa-miR-26b-5p, hsa-miR-421, hsa-miR-29a-3p, hsa-miR-450b-5p, hsa-miR-155-5p, hsa-miR-26a-5p, hsa-miR-30c-5p, hsa-miR-32-5p and hsa-miR-361-5p. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
50E-0367mmu-miR-339-5pmir-3390.206.807.92E-037.53E-028mmu-miR-34c-5pmir-340.246.689.54E-066.88E-0477mmu-miR-34a-5pmir-340.179.541.17E-029.66E-0245mmu-miR-340-5pmir-3400.178.511.71E-032.45E-0217mmu-miR-361-5pmir-3610.247.887.74E-052.90E-0319mmu-miR-376b-3pmir-3680.268.451.05E-043.50E-0356mmu-miR-376a-3pmir-3680.1910.215.63E-036.40E-0223mmu-miR-434-3pmir-4340.2210.461.76E-044. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
A combination of the serum levels of miR-361-5p, miR-889 and miR-576-3p were shown to distinguish pulmonary tuberculosis patients from healthy individuals [26]. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
Moreover, the histone demethylase Jarid1b could also repress let-7e as well as miR-1246, miR-1826, and miR-361-5p by removing the active mark H3K4me3 in breast cancer [34]. [score:1]
[1 to 20 of 1 sentences]