sort by

193 publications mentioning hsa-mir-302b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-302b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 392
At the same time, the expression of AKT2 was down-regulated, and CCND1 and CDK2 were reduced by miR-302b, while the expression of CDK inhibitor p27 was up-regulated (Figure  4). [score:13]
However, transfection of miR-302b inhibitor can increase the expression of EGFR at protein level (Figure  2C), suggesting that miR302b inhibit EGFR expression at translational level but not transcription level in SMMC-7721 cells. [score:11]
The re -expression of miR-302b reduced the expression of AKT2, pAKT2, and its downstream gene CCND1, CDK2, and up-regulated CDK inhibitor p27 in SMMC-7721 cells (Figure  4A). [score:10]
A- results of miR-302b -targeted EGFR and non-direct targeted cell cycle regulation proteins in SMMC-7721 cells after transfection of miR-302b over -expression construct and miR-ctrl. [score:9]
Taken together, our data demonstrated that miR-302b targeted at EFGR and suppressed its expression at translation level in SMMC-7721 cells. [score:9]
The silencing of EGFR by miR-302b or siEGFR led to the down-regulation of cell-cycle related proteins, such as AKT2, CCND1, and CDK2, strongly suggesting that miR-302b suppresses the growth of SMMC-7721 cells by targeting EGFR involved the EGFR/AKT2/CCND1 pathway. [score:8]
We searched for miR-302b target genes using three computer-aided miRNA target prediction programs, RegRNA, DIANA and TargetScan. [score:7]
In addition, we proved that the re -expression of miR-302b did not affect the mRNA expression of EGFR (P > 0.05), but could suppress EGFR at the protein level (50%). [score:7]
The results showed that the effect of miR-302b re -expression on the cell proliferation was consistent with that of siEGFR in SMMC-7721cells, suggesting that miR-302b may suppress the growth of SMMC-7721 cells by targeting the EGFR/AKT2/CCND1 signaling pathway. [score:7]
These findings demonstrated that the effect of miR-302b re -expression on cell proliferation was consistent with that of siEGFR on SMMC-7721 cells, suggesting that miR-302b may inhibit the growth of SMMC-7721 cells through targeting EGFR. [score:7]
The dual-luciferase reporter assays demonstrated that miR-302b targeted directly to EGFR through the suppression of translation (Figure  2B). [score:7]
We demonstrated that miR-302b was frequently down-regulated, whereas EGFR was up-regulated in 27 pairs of clinical HCC and non-tumorous counterparts. [score:7]
The re -expression of miR-302b suppresses the growth of hepatoma cells may due to targeting the EGFR/AKT2/CCND1 pathway, suggesting that miR-302b may be an effector in gene therapy of HCC. [score:7]
The value under each lane indicates the expression level of EGFR, which is represented by the intensity ratio between miR-302b or inhibitor and miR-ctrl or inhibitor-ctrl groups. [score:7]
Interestingly, as shown in Figure  2D, miR-302b expression level in vivo was inversely-correlated with EGFR mRNA expression level, which was verified by Pearson’s correlation coefficient test, suggesting that miR-302b may relate to EGFR mRNA expression level. [score:7]
The value under each lane indicates the relative expression level of the proliferation-related gene, which is represented by the intensity ratio between miR-302b and miR-ctrl or inhibitor and inhibitor-ctrl groups. [score:7]
Our study showed that the expression of the miR-302b was frequently down-regulated in clinical HCC tissues and in SMMC-7721 cells (Figure  1). [score:6]
Figure 3 Overexpression of miR-302b and knockdown of miR-302b-target gene EGFR decrease hepatoma cell growth and induce G1/S arrest in vitro. [score:6]
In this study, we discover that miR302b suppresses tumor proliferation may due to directly targeting EGFR in human hepatocellular carcinoma (HCC). [score:6]
The high -expression of EGFR is related to the down-regulation of miR-302b in HCC. [score:6]
EGFR 3′UTR-MS5′-CAAGAAGCTTGCTGGCAGCGTTTGC-3′EGFR 3′UTR-MA5′-TCGAGCAAACGCTGCCAGCAAGCTTCTTGAGCT-3′siRNA-ctrl-S5′-ACCGAACGTGTCACGT-3′siRNA-ctrl-A5′-ACGTGACACGTTCGGAGAATT-3′siEGFR-S5′-AACACAGTGGAGCGAATTCCT-3′siEGFR-A5′-AGGAATTCGCTCCACTGTGTT-3′miR-302b RT5′-TGCTTAAGTGCTTCCATGTT-3′miR-302b-F5′-ATCCAGTGCGTGTCGTG-3′miR-302b-R5′-TGCTTAAGTGCTTCCATGTT-3′Inhibitor-ctrl5′-TGACTGTACTGACTCGACTG-3′MiR-302b inhibitor5′ -TGATTTTGTACCTTCTGGAAT-3EGFR-F5′-GCCTTGACTGAGGACAGCA-3′EGFR-R5′-TTTGGGAACGGACTGGTTTA-3′β-actin-F5′-CGGGAAGCTTGTCATCAATGG-3′β-actin-R5′-GGCAGTGATGGCATGGACTG-3′U6 RT5′-GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACAAAATATGG-3′U6-F5′-TGCGGGTGCTCGCTTCGGCAGC-3′ U6-R 5′ CCAGTGCAGGGTCCGAGGT 3′ Total RNA was extracted using Trizol solution (Invitrogen, USA) according to the manufacturer’s protocol, and RNAse-free DNase was used to remove DNA contamination. [score:5]
There seemed to be a negative correlation between the expression of EGFR and that of miR-302b in HCC tissues (Figure  1A and B), implying that EGFR might be a novel target of miR-302b. [score:5]
The miR-302b expression was examined by qRT–PCR analysis and normalized to U6 expression. [score:5]
Among the 27 pairs of clinical tissues, down-regulation of miR-302b was observed in 22 (81%) HCC samples compared with their adjacent nontumorous liver tissues, whereas up-regulation of EGFR at mRNA level was found in 21 (78%) HCC tissues compared with adjacent nontumorous counterparts (Figure  1A and B). [score:5]
Meanwhile, after transfected miR-302b inhibitor into SMMC-7721 cells, the expression of EGFR at mRNA levels did not change. [score:5]
The results suggested that the reduced miR-302b expression and increased EGFR expression were frequent events in human HCC tissues. [score:5]
miR-302b suppresses HCC growth may due to targeting the EGFR/AKT2/CCND1 pathway. [score:5]
Re -expression of miR-302b resulted in the inhibition of proliferation in hepatocellular carcinoma SMMC-7721 cells. [score:5]
The miR-302b inhibited the growth of SMMC-7721 cells through targeting EGFR. [score:5]
Specified fragments of EGFR were chemically synthesized, and are shown in supporting Table  1. The luciferase-UTR reporter constructions were generated by introducing the Wt/Mut-EGFR 3′-UTR, carrying a putative miR-302b binding site into pmirGLO Dual-Luciferase miRNA Target Expression vector (Promega) between the XhoI and SacI sites. [score:5]
To validate the tumor suppressor role of miR-302b in clinical hepatoma, we analyzed the expression of miR-302b in 27 pairs of clinical HCCs and adjacent nontumorous liver tissues using quantitative real-time PCR (qRT–PCR) and normalized to an endogenous control (U6 RNA). [score:5]
To examine the effects of miR-302b on the growth of SMMC-7721 cells through targeting EGFR, we designed the siRNA for EGFR (siEGFR), which induced 50% decrease of EGFR expression both at the mRNA and protein levels in SMMC-7721 cells. [score:5]
Our results showed that miR-302b may inhibit the growth of SMMC-7721 cells through targeting EGFR, and that the cell cycle progression was arrested at the G0/G1-phase (Figure  3). [score:5]
showed that miR-302b overexpression resulted in the suppression of the SMMC-7721cells growth at 48 and 72 h, which was in accord with the effect of siEGFR (Figure  3B). [score:5]
25-bp regions (wt) miR-302b binding sites in the EGFR 3′ UTR was cloned into pmirGLO Dual-Luciferase miRNA Target Expression vector. [score:5]
C- EGFR mRNA and protein expression levels measured by qRT-PCR and western blot 48 h after transfecting with miR-ctrl, miR-302b, inhibitor-ctrl or miR-302b -inhibitor. [score:5]
Further, in vitro experiments proved that the re -expression of miR-302b inhibited HCC proliferation dramatically, and arrested the HCC cell cycle at the G1/S phase. [score:5]
Similar results were proved by the treatment of siEGFR (Figure  4B), suggesting that miR-302b may suppress the growth of SMMC-7721 cells by targeting the EGFR/AKT2/CCND1 signaling pathway. [score:5]
In this research, we examine the relationship between miR-302b and EGFR at both of the transcription level and translational level, in which miR-302b was verified to silence EGFR at translational level from in vitro and in vivo clinical samples. [score:5]
In this research, we analyzed the miR-302b targets by bioinformatics software, and found that miR-302b can target EGFR. [score:5]
MiR-302b inhibits cell proliferation through EGFR -dependent cell cycle regulationAKT is the key molecule in the signaling pathway, which is regulated by EGFR. [score:4]
Although miR-302 families have been suggested to be tumor repressors in human cancer, the mechanism by which they suppress tumor development remains to be defined. [score:4]
The silencing of EGFR by miR-302b or siEGFR led to down-regulation of proliferation-related proteins, such as AKT2, CCND1, and CDK2. [score:4]
Next, we found that miR-302b was frequently down-regulated in HCC tissues and cells. [score:4]
To determine whether EGFR was a direct target of miR-302b, we constructed pmirGLO-EGFR-3′UTR-wt and pmirGLO-EGFR-3′UTR-mut. [score:4]
MiR-302b is low-expressed and EGFR is high-expressed in HCC tissue samples and HCC cells. [score:4]
A- qRT–PCR analysis of miR-302b expression in 27 paired HCC tissues and their corresponding adjacent nontumorous livers. [score:3]
A- qRT-PCR analysis of miR-302b in SMMC-7721 cells transfected with miR-302b over -expression construct and miR-ctrl (left). [score:3]
Thus, we supposed that miR-302b might be a novel tumor-suppressor miRNA. [score:3]
D- Inverse correlation between miR-302b and EGFR expression in HCC tissues. [score:3]
Although miR-302 has been suggested to have tumor suppressor potential, the present studies focused on the self-renewal and proliferation properties of miR-302b in the stemness maintenance of embryonic stem cells (ESCs) or tumor stem cell properties in advanced cancer cells [17, 18]. [score:3]
Moreover, miR-302b and siEGFR suppressed cell proliferation at the G0/G1 phase at 24 h, 48 h and 72 h time points (Figure  3D). [score:3]
Comparing the human sequence with interspecies homology, we found that the miR-302b targeting sequence was highly conserved among different species. [score:3]
D- Cell cycles determined in SMMC-7721 cells after transfection of miR-302b over -expression construct or siEGFR at 24 h, 48 h, 72 h, with miR-ctrl or siRNA-ctrl as the respective controls. [score:3]
Figure 4 MiR-302b inhibits cell proliferation through EGFR -dependent cell cycle regulation. [score:3]
pcDNA™6.2-GW/EmGFP-miR vector (Invitrogen) was used to construct vectors of re -expression miR-302b. [score:3]
Finally, to determine the growth fraction of HCC cells after overexpression of miR-302b/siEGFR, we performed Ki-67 immunofluorescence staining. [score:3]
C- qRT–PCR analysis of miR-302b expression in normal hepatocytes (HL-7702 cells) and HCC cells (Bel7402, Hep3B, HepG2, SMMC-7721 cells), (**P < 0.01, *P < 0.05, Student’s t-test). [score:3]
The SMMC-7721 cells were transfected with miR-302b re -expression vector, miR-ctrl, siEGFR or siRNA -ctrl. [score:3]
B- The effects of miR-302b or siEGFR on SMMC-7721 cell proliferation were determined by at 24 h, 48 h, and 72 h after transfecting of miR-302b over -expression construct or siEGFR, with miR-ctrl or siRNA-ctrl as the respective controls (*P < 0.05, **P <0.01, Student’s t-test). [score:3]
The data were summarized as mean ± s. d. The culture of SMMC-7721 cells and the transfection of miR-302b expression vector, miR-ctrl, siEGFR, and siRNA-ctrl were performed as above. [score:3]
In order to prove the biological effects of miR-302b on inhibition of EGFR, siEGFR was used. [score:3]
QRT-PCR was used to assess miR-302b and EGFR expression in 27 pairs of clinical hepatocellular carcinoma tissues and their corresponding adjacent nontumorous liver tissues. [score:3]
E- Expression of Ki-67 was verified by immunofluorescence staining after transfecting with miR-ctrl, miR-302b, siRNA-ctrl, or siEGFR. [score:3]
Moreover, we found that miR-302b was down-regulated in examined HCC cells compared with normal hepatocytes (HL-7702 cells) (Figure  1C). [score:3]
MiR-302b inhibits cell proliferation through EGFR -dependent cell cycle regulation. [score:3]
C- Representative results of colony formation of SMMC-7721 after transfection of miR-302b re -expression or siEGFR. [score:3]
The cells were seeded into 96-well plates at a density of 1 × 10 [5] cells/well with 100 uL of 1640, supplemented with 10% fetal bovine serum without antibiotics for 24 h. Thereafter, 0.2 ug of the miR-302b ctrl (empty vector), miR-302b expression vector, siEGFR or siRNA-ctrl oligonucleotide in 25 μl of 1640 and 0.5 μl of lipofectamine 2000 (Invitrogen, USA) in 25 μl of 1640 were preincubated for 5 min at room temperature, respectively, and then mixed together and incubated for additional 25 min at room temperature. [score:3]
A few of the miR-302b targets have been found, including AKT1, CCNA, CDK2, CCND1/D2, and BMI-1 [40]. [score:3]
The expression of miR-302b was normalized to U6 snRNA. [score:3]
Through bioinformatics analysis, we got the predicted fragment of targeted gene (EGFR), which was associated with miR302b. [score:3]
Other studies have demonstrated the tumor suppressive activity of miR-302 in human pluripotent stem cell by both the CCNE-CDK2 and CCND-CDK4/6 pathways in G1-S cell cycle transition. [score:3]
At the same time, we transfected miR-302b into SMMC-7721 cells and observed a thirty-fold increase of the miR-302b expression (Figure  3A). [score:3]
The dual-luciferase reporter assays further demonstrated that EGFR was a novel target of miR-302b. [score:2]
To further examine the inhibitory role of miR-302b and siEGFR in SMMC-7721 cells, colony formation assay was employed. [score:2]
Luciferase assays were performed to assess the EGFR was a novel target of miR-302b. [score:2]
In conclusion, the dysregulation of miR-302b is a frequent event in human hepatocarcinoma. [score:2]
The miR-302 family consists of four highly-homologous miRNA members, which are transcribed together as a noncoding RNA cluster containing mir-302b, mir-302c, mir-302a, mir-302d, and mir-367 in a 5′-to-3′ direction [16]. [score:2]
The results showed that miR-302b obviously suppressed the firefly luciferase activity of pmirGLO-EGFR-3′UTR-wt at 24 and 48 h, compared with miR-ctrl (Figure  2B). [score:2]
MiR-302b targets at EGFR. [score:2]
Figure 1 Dysregulated miR-302b/EGFR in hepatocarcinoma tissues and cells. [score:2]
MTT, colony formation, immunofluorescence staining, and cell cycle assays were used to examine the tumor suppressor role of miR302b in cell proliferation. [score:2]
The dual-luciferase reporter assays revealed that EGFR was a novel target of miR-302b. [score:2]
To date, miR-302 s have been proven to post-transcriptionally regulate CCND1 and CDK4, therefore affecting cell cycle progression. [score:2]
Plasmid miR-302b or siEGFR was transfected into SMMC-7721 cells using Lipofectamine 2000 (Invitrogen Co. [score:1]
As shown in Figure  2A, there is a miR-302b -binding site at 4259-4284nt of the EGFR 3′ UTR. [score:1]
PmirGLO-EGFR-3′UTR-wt vector or pmirGLO-EGFR-3′UTR-mut vector were co -transfected with miR-302b or miR-ctrl into SMMC-7721 cells using lipofectamine 2000 (Invitrogen). [score:1]
Whereas in SMMC-7721 cell lines, the correlation between miR-302b and EGFR didn’t show significant difference (Figure  2C), but it exhibited the correlation trend, which were consistent with the results of that in HCC tissues. [score:1]
Figure 2. A- miR-302b -binding site at 4259–4284 nt of the EGFR 3′ UTR is predicted to be evolutionarily conserved across different species. [score:1]
At the transcription level, we tested relationship between miR-302b and EGFR by using Pearson’s correlation coefficient test in 27 paired HCC tissues and found that they have inverse correlation in mRNA level (Figure  2D). [score:1]
Then, the miR-302b was chemically synthesized and cloned into pcDNA™6.2-GW/EmGFP-miR vector between the EcoRI and HindIII sites. [score:1]
To determine the effect of miR-302b/siEGFR on cell proliferation, we also performed immunofluorescence staining using the Ki-67 antibody (Millipore, diluted 1/100). [score:1]
Further bio-information analysis showed that there was a miR-302b -binding site at 4259–4284 nt of the EGFR 3′ UTR. [score:1]
Luciferase activity of reporter gene (EGFR 3′ UTR-wt) displayed a significant decrease by transfecting miR-302b. [score:1]
Later, we have co -transfected miR-302b or miR-ctrl with pmirGLO-EGFR-3′UTR-wt or pmirGLO-EGFR-3′UTR-mut into SMMC-7721 cells. [score:1]
[1 to 20 of 95 sentences]
2
[+] score: 303
Other miRNAs from this paper: hsa-mir-302a, hsa-mir-302c, hsa-mir-302d, hsa-mir-302e, hsa-mir-302f
Overexpression of miR-302 did not lead OCT4 negative hMSCs to express OCT4 and acquire the teratoma formation, which suggested that the regulation of miR-302 on pluripotency and teratoma formation by direct suppression of AKT1 may be dependent on the high endogenous expression of OCT4 in cells. [score:11]
Then miR-302 -overexpressing lentiviral vector (lenti-miR-302s) that expresses a series of connected miR-302a/b/c/d sequences was used to upregulate the expression of miR-302s in hMSCs (Supplementary Figures S3A and B). [score:10]
In addition, the upregulation of miR-302 in AKT1 -overexpressed hNT-2 cells could inhibit AKT1 and rescue the expression of OCT4. [score:10]
[20] We found that miR-302 was gradually downregulated during EB differentiation (Figure 6a), while at the same time, AKT1 was gradually upregulated, OCT4 and SOX2 were downregulated (Figure 6b). [score:10]
21, 22, 23, 33, 34, 35 Consistent with these results, we revealed that the expression levels of CCND1, CDK4, CDK6, CDKN1A and TGF β were increased in miR-302 downregulated-hNT-2 cells and decreased in miR-302 upregulated-hMSCs (Supplementary Figures S4B and C). [score:9]
showed that OCT4 was decreased in AKT1 -overexpressed hNT-2 cells, while its expression was increased in AKT1 suppressed-hNT-2 cells and was accompanied with morphological changes similar to the effect of miR-302 on the expression of AKT1 and OCT4 (Figures 6c and e). [score:9]
displayed that the overexpression of miR-302 significantly suppressed >58% of the reporter luciferase activity of the AKT1-WT reporter plasmid but not that of the AKT1-MUT reporter plasmid, suggesting a direct targeting relationship between miR-302 and the 3'UTR of AKT1 (Figure 5b). [score:8]
Upregulation of miR-302 in AKT1 -overexpressed hPSCs could inhibit AKT1 and rescue the protein level of OCT4. [score:8]
These results strongly confirmed that miR-302 can directly target AKT1 and suppress its expression. [score:8]
Overexpression of miR-302 also significantly decreased AKT1 expression in hMSCs (Supplementary Figure S5A), whereas OCT4 always maintained at undetectable level regardless of the expression changes of miR-302 and AKT1 in hMSCs (Supplementary Figures S6A and B). [score:7]
[51] We found a marked suppression of cell cycle progression in miR-302 -suppressed-hNT-2 cells, while an increase in the number of S phase cells in miR-302 -overexpressed hMSCs. [score:7]
miR-302 can directly target and regulate the expression of AKT1 in pluripotent and adult stem cells. [score:7]
Here, we observed that in addition to directly targeting cell cycle -associated genes, miR-302 also affects the expression of total AKT1 and phospho-AKT mainly at S473 locus. [score:6]
In addition, the expression of OCT4 was markedly reduced in teratoma generated from miR-302 -downregulated hNT-2 cells (Figure 7a). [score:6]
Furthermore, miR-302 upregulation could not significantly change the expression level of OCT4 in siAKT1 -transfected hNT-2 cells (Figures 6c and d), while repression of miR-302 led to the opposite effects. [score:6]
We found that inhibition of miR-302 causes a significant decrease in self-renewal ability and promotes differentiation accompanied by downregulation of OCT4, suggesting that high level of endogenous miR-302 may be responsible for the maintenance of self-renewal and pluripotency in hPSCs. [score:6]
The positive correlation between miR-302 and OCT4, and negative correlation between miR-302 and AKT1 suggested that miR-302 may enhance the expression of pluripotency regulators through suppressing AKT1. [score:6]
TargetScan, PicTar and Miranda suggested that many genes including both positive and negative G1 to S transition -associated regulators are candidate targets of miR-302 (Figure 3f). [score:6]
High expression of endogenous miR-302 in hPSCs is a contributing factor for the pluripotency and teratoma formation through maintaining OCT4 at high level by directly inhibiting AKT1. [score:6]
Downregulation of miR-302 inhibits the teratoma formation of hPSCs. [score:6]
Previous evidence has demonstrated that the cell cycle promoters CCND1 and CDK2, and the inhibitors CDKN1A, RB1, RBL1, RBL2, LATS2 and TGFBR2, are direct targets of miR-302. [score:6]
5, 32 To explore the intrinsic mechanisms underlying the regulation of teratoma formation by miR-302, we analyzed the cell cycle distribution and the expression patterns of key cell cycle regulators associated with the G1 to S transition in hESCs, hNT-2 cells and hMSCs. [score:5]
These results revealed that miR-302 indirectly regulates OCT4 protein level by suppressing AKT1 and subsequently avoiding OCT4's degradation. [score:5]
We confirmed that AKT1 is a direct target of miR-302 in the regulation of pluripotency and differentiation of hPSCs. [score:5]
miR-302 contributes to the pluripotency and teratoma formation of hPSCs by maintaining OCT4 expression via suppressing AKT1. [score:5]
Importantly, in highly differentiated teratoma of patients, which are more common clinically, the expression of miR-302 is very low or even undetectable, and the expression of OCT4 is still undetectable. [score:5]
Therefore, our findings revealed that high expression levels of endogenous miR-302 in hPSCs are beneficial for the pluripotency and tumorigenicity of hPSCs by maintaining OCT4 at high level through suppressing AKT1 (Figure 7d). [score:5]
5, 7, 8, 9, 33, 35 To date, both positive and negative cell cycle -associated factors have been reported as direct targets of miR-302. [score:4]
[52] Thus, our data suggest that the negative cell cycle regulators are dominant targets of miR-302 in ESCs, hNT-2 cells and hMSCs. [score:4]
qRT-PCR and western blot analyses showed that miR-302 can regulate the expression of total AKT1 and phosphorylated AKT1 mainly at S473 locus (Figures 5c and d; Supplementary Figures S4B and C) both in hNT-2 and hMSCs. [score:4]
However, upregulation of miR-302 cannot lead OCT4 negative hMSCs to acquire the teratoma formation. [score:4]
38, 39 We found that miR-302 could regulate the expression of AKT1 (Supplementary Figures S4B and C). [score:4]
miR-302 regulates pluripotency by promoting self-renewal and suppressing differentiation. [score:4]
[18] We found that OCT4 was markedly reduced in teratoma generated from miR-302 -downregulated hNT-2 cells, which is in agreement with our results in vitro. [score:4]
miR-302 dominantly regulates a set of cell cycle inhibitors and promotes the G1 to S transition. [score:4]
Our findings suggested that miR-302 can enhance proliferation through the dominant regulation of a set of cell cycle inhibitors, and result in rapid G1 to S transition. [score:4]
23, 48, 49 We revealed that downregulation of miR-302 significantly decreased the rate of tumor formation and reduced the tumor volume in hPSCs. [score:4]
To further validate whether miR-302 can directly target AKT1, we designed dual luciferase reporter gene vectors containing either wild type (AKT1-WT) or mutated (AKT1-MUT) putative 3′UTR sequences for miR-302 -binding (family ‘seed sequence') and inserted them into the 3′UTR of the luciferase genes. [score:4]
Thus, we speculated that AKT1 might be one of the direct targets of miR-302 that controls the self-renewal and pluripotency of hPSCs. [score:4]
To clarify whether miR-302 mediates pluripotency and differentiation of hPSCs through the regulation of AKT1, we first analyzed the expression of miR-302 during embryoid body (EB) formation. [score:4]
miR-302 can promote the proliferation and self-renewal both in hPSCs and hMSCs through dominantly regulating a set of cell cycle inhibitors and accelerating the G1 to S transition. [score:4]
We presumed that high endogenous expression of miR-302 in hPSCs might be responsible for their teratoma formation. [score:3]
In summary, our findings first uncover that miR-302 indirectly regulates OCT4 by suppressing AKT1, which provides hPSCs two characteristics related to their potential for clinical applications: the benefit of pluripotency and the hindrance of teratoma formation. [score:3]
Our miRNA microarray and TaqMan qRT-PCR data revealed that the endogenous expression levels of miR-302 family were high in hESCs and hNT-2 cells but very low in hMSCs (Figures 1a and b; Supplementary Figures S1E and F and Supplementary Table S1). [score:3]
We speculated that miR-302 might be involved in maintaining the low expression levels of these genes in hESCs. [score:3]
Thus, we next analyzed the impact of miR-302 on the proliferation of hPSCs and found that cell growth was suppressed gradually with an increase in the concentration of miR-302s antagomir (Figure 2a). [score:3]
The ectopic expression of miR-302 is able to reprogram and promote human somatic cells to ESC-like cells. [score:3]
hPSCs have strong teratoma formation ability and high endogenous expression of miR-302. [score:3]
After the cells were infected with the miR-302 overexpressing GFP-labeled lentiviral vector (lenti-miR-302s), GFP -positive cells were sortinged by FACSCalibur (BD). [score:3]
These results strongly demonstrated that miR-302 can maintain the expression of OCT4 at high level, at least in part by repressing AKT1. [score:3]
These results showed that the inhibition of miR-302 negatively impacted self-renewal and pluripotency and promoted the differentiation of hPSCs. [score:3]
shRNA was used to suppress endogenous expression of miR-302s and to investigate the function of miR-302 on pluripotency and differentiation of hPSCs. [score:3]
More recently, miR-302 has been reported to be capable of regulating Brg1 chromatin remo deling complex composition in hESCs, and subsequently regulating pluripotency by positively influencing mesendodermal differentiation. [score:3]
Moreover, the expression of miR-302 is very low or almost undetectable in highly differentiated patient-derived teratoma as compared with hNT-2 cells generated malignant teratoma xenografts (Figure 7b). [score:2]
Whether upregulation of miR-302 can drive hMSCs to acquire a higher differentiation potential is worthy of deep investigation. [score:2]
24, 41, 42, 43, 44 However, there is a big controversy about what role miR-302 has in the regulation of stemness, cell proliferation, tumorigenesis and differentiation. [score:2]
Taking into account the positive feedback regulation involved in the G1 to S transition, self-renewal and pluripotency in hPSCs, 5, 36, 37 we further assessed the role of miR-302 in self-renewal and pluripotency. [score:2]
53, 54 Recently, the role of miR-302 in nerve development has been reported. [score:2]
[40] Here, we demonstrate that miR-302 has an important role in regulating cell proliferation, self-renewal, pluripotency, differentiation and teratoma formation. [score:2]
miR-302 promotes the proliferation of pluripotent and adult stem cells. [score:1]
These results demonstrated that miR-302 can promote cell proliferation both in pluripotent and adult stem cells. [score:1]
miR-302s antagomir (miR-302a, miR-302b, miR-302c and miR-302d in combination) was used to silence the endogenous miR-302s in vitro and in vivo (Supplementary Figure S2A). [score:1]
In all, 5 × 10 [4] 293 T cells per well in 24-well plates were co -transfected with 1  μg pRL-TK vector with or without the synthetic fragment of the AKT1 3′UTR and 0.1  μg pGL-3 control vector with firefly luciferase reporter gene, and 100 nM miR-302 mimics or miR-NC mixed with Lipofectamine 2000 (Invitrogen), respectively, according to the manufacturer's instructions. [score:1]
These results indicated that miR-302 promotes cell growth and proliferation partially through promoting the G1 to S transition. [score:1]
Cells were transfected with 200 nM of miR-302s antagomir (50 nmol each of miR-302a antagomir, miR-302b antagomir, miR-302c antagomir and miR-302d antagomir), 200 nM miR-302s mimics (50 nmol each of miR-302a, miR-302b, miR-302c and miR-302d) or 200 nM negative control NC or 200 nM negative control antagomir as a control (Genepharma, Shanghai, China) (see Supplementary Table S5 in the ). [score:1]
This result coincides with recent report that miR-302 induces proliferation in human adipose tissue-derived MSCs. [score:1]
[57] These findings suggested a complicated relationship between pluripotency and differentiation related to miR-302. [score:1]
Thus, miR-302 is able to promote the teratoma formation of hPSCs in vitro and in vivo. [score:1]
Bioinformatics analysis showed that there is a 7-bp sequence within the 3'UTR of AKT1 that is complementary to the sequence of miR-302 (Figure 5a). [score:1]
[8] Therefore, to further analyze the effects of miR-302 on the modulation of differentiation, hESCs were subjected to EB formation and then placed back into ESC conditions. [score:1]
[1 to 20 of 70 sentences]
3
[+] score: 288
We found that miR-302b overexpression upregulated the expression of 380 genes and downregulated the expression of 150 genes (Fig 1E and S1 Array Data). [score:13]
Target gene prediction by using TargetScan revealed that among 150 downregulated genes, 32 genes are putative direct target genes of miR-302b (Fig 1G and Table 1). [score:11]
NFIA, a transcription factor downregulated in miR-302b -overexpressing cells, was validated as a direct target gene of miR-302b. [score:9]
According to our findings, IGFBP2 levels may be transcriptionally upregulated by NFIA overexpression and indirectly inhibited by miR-302b. [score:9]
The network of overlapping canonical pathways was analyzed using DAVID Bioinformatics Resources 6.7 according to the 150 downregulated and 380 upregulated molecule-related pathways in miR-302b -overexpressing cells. [score:9]
A direct miRNA -targeted mechanism that guided nontargeting miRNA -inhibited signaling was verified to participate in miR-302b -mediated gene networks. [score:8]
Next, we explored the NFIA—directly and transcriptionally regulated genes that co-existed in 118 miR-302b -downregulated genes from array data, and their 3’ UTR regions did not contain miR-302b target sites. [score:8]
The 34 non-direct targets of miR-302b -downregulated genes. [score:7]
Similarly, in the present study, we found that miR-302b induced glioma cell death by targeting and inhibiting NFIA expression. [score:7]
Furthermore, overexpression and knockdown of NFIA significantly influenced miR-302b -inhibited IGFBP2 and IGFBP2-related downstream signaling in U87-MG cells (Fig 6E). [score:6]
This vector was sequenced and named pMIRGLO-NFIA-3-1, -2, and -3. Site-directed mutagenesis of the miR-302b target site in NFIA 3U-3 was performed using the QuikChange [®] Site-Directed Mutagenesis Kit (Stratagene, Hei delberg, Germany), and the vector was named pMIRGLO-NFIA-3′UTR-mutant. [score:5]
As shown in Fig 2H and 2I, overexpression or knockdown of NFIA significantly influenced miR-302b-regulated cell viability, caspase-3 activation, and PARP degradation. [score:5]
Moreover, although IGFBP2, another tumor-promoting factor, was not the miR-302b target gene, its levels were decreased in miR-302b -overexpressing cells. [score:5]
Identification of the NFIA-directly mediated genes in miR-302b -downregulated gene profile. [score:5]
To date, no study has comprehensively analyzed the putative target genes of miR-302b and its functions in carcinogenesis inhibition. [score:5]
The results collectively demonstrate that miR-302b -inhibited NFIA expression results in U87-MG cell apoptosis. [score:5]
The target genes of miR-302b were predicted using TargetScan 6.2 [24]. [score:5]
Target gene prediction by using TargetScan revealed that miR-302b binds to three sites in the NFIA 3′UTR, named 3U-1, -2, and -3 (Fig 2C). [score:5]
Effects of miR-302b overexpression on NFIA mRNA (F) and protein (G) expression. [score:5]
As shown in Fig 2E, the miR-302b mimic did not affect luciferase activity after mutation of the miR-302b -targeted site. [score:4]
To validate whether miR-302b influences NFIA expression levels by binding to the 3′UTR, five nucleotides in the critical binding region of the NFIA 3′UTR were mutated using site-directed mutagenesis (Fig 2C). [score:4]
These results collectively demonstrate that inhibition of NFIA-regulated IGFBP2 signaling is involved in miR-302b -induced glioma cell death. [score:4]
miR-302b inhibited the IGFBP2 -mediated signaling pathway through NFIA regulation. [score:4]
Effects of the miR-302b target gene of NFIA on regulating glioma cell death. [score:4]
We comprehensively analyzed the miR-302b -mediated gene networks by generating a transcriptome microarray and verified that NFIA is a novel direct target gene of miR-302b. [score:4]
miR-302b inhibited IGFBP2 signaling through NFIA regulation. [score:4]
Furthermore, to confirm that NFIA is a direct target gene of miR-302b, three NFIA 3′UTR regions containing a miR-302b -binding site were cloned into the pmiRGlo-reporter plasmids. [score:4]
Our results demonstrated that NFIA is a direct target gene of miR-302b. [score:4]
Overexpression and knockdown of NFIA influenced miR-302b -mediated cell viability (H) and apoptotic markers (I). [score:4]
Thus, in the present study, by examining the transcriptome of miR-302b -overexpressing cells, we investigated the miR-302b -mediated gene networks involved in the inhibition of glioma cell growth. [score:3]
To explore the effects of miR-302b on glioma apoptosis, we generated a transcriptome microarray of cells transfected with 50 nM miR-302b mimic and 50 nM scramble control for 24 h. We selected significantly differentially expressed genes by using a log2 (ratio) of |≥ 1| and a p value of < 0.05 as cutoffs. [score:3]
Because a previous study suggested that NFIA promotes glioblastoma growth [6], we focused on the effects of miR-302b on NFIA gene expression. [score:3]
miR-302b overexpression enhanced cell apoptosis (C), caspase-3 activation, and PARP degradation (D). [score:3]
NFIA-activated IGFBP2 expression also exhibited antagonistic effects on miR-302b -induced glioma cell apoptosis. [score:3]
Overexpression of the miR-302b mimic reduced IGFBP2 mRNA (A) and protein levels (B). [score:3]
Our array data (S2C Fig) revealed that IGFBP2 levels were decreased in miR-302b -overexpressing cells. [score:3]
In our previous study [17], we found that inhibition of E2F3 by miR-302b was involved in all-trans retinoic acid -induced glioma cell apoptosis. [score:3]
The relative expression levels of miR-302b were normalized respectively to U6B by using the equation ΔCt = (CtmiR-302b –CtU6b). [score:3]
The heat map depicts the 530 mRNAs that were differentially expressed between the miR-302b subsets. [score:3]
Several studies have reported the tumor suppressor role of miR-302b [15, 16, 27], and that miR-302b enhances the sensitivity of cancer cells to clinical therapeutic drugs [28– 30]. [score:3]
Moreover, NFIA-regulated IGFBP2 signaling pathways play a critical role in the ability of miR-302b to regulate apoptosis in glioma cells. [score:3]
Moreover, in our miR-302b -mediated gene profiles, the expression levels of hundreds of genes were significantly changed. [score:3]
miR-302b overexpression dose dependently reduced IGFBP2 promoter activity (Fig 6C). [score:3]
In the present study, we found that miR-302b overexpression significantly enhanced glioma cell death through apoptosis. [score:3]
0173890.g006 Fig 6Overexpression of the miR-302b mimic reduced IGFBP2 mRNA (A) and protein levels (B). [score:3]
miR-302b overexpression also affected IGFBP2-related downstream signaling (Fig 6B). [score:3]
As shown in Fig 6A and 6B, the mRNA and protein levels of IGFBP2 dose dependently decreased in miR-302b -overexpressing U87-MG cells. [score:3]
The 32 putative miR-302b target genes. [score:3]
Identification of NFIA as a target gene of miR-302b. [score:3]
According to our results, we conclude that inhibition of NFIA -mediated IGFBP2 signaling plays a crucial role in miR-302b -induced glioma U87-MG cell death. [score:3]
We found that miR-302b expression levels were lower in glioma cells than in primary astrocytes. [score:3]
Another 33 nondirect target genes of miR-302b possessed characteristics similar to those of NFIA. [score:2]
Furthermore, analysis of molecular functions revealed that most miR-302b-affected genes were involved in regulation of glioma cell proliferation and death. [score:2]
Volcano plot (E) and heat map of hierarchical gene clustering (F) demonstrating miR-302b-regulated transcriptome profiles. [score:2]
However, their functions should be studied to construct integrated miR-302b-regulated gene networks. [score:2]
We also tested the effects of miR-302b on NFIA-regulated IGFBP2 promoter activity. [score:2]
In this study, transcriptome profiles revealed that miR-302b -mediated gene networks were involved in regulating glioma cell apoptosis. [score:2]
Our findings identified the novel molecular mechanisms underlying the regulation of gliomagenesis by both miR-302b and NFIA. [score:2]
We also directly tested the effect of miR-302b on NFIA expression and found that transient transfection of U87-MG cells with the miR-302b mimic significantly and dose dependently reduced NFIA mRNA and protein levels, as measured through RT-qPCR (Fig 2F) and immunoblotting (Fig 2G). [score:2]
The miR-302–367 cluster comprises miR-302a, miR-302b, miR-302c, miR-302d, and miR-367. [score:1]
To test the effect of miR-302b, overnight culture cells were cotransfected with different doses of the miR-302b mimic or 50 nM scrambled miRNA mimic (control) and 500 ng of the pmiRGlo-NFIA 3′ UTR or mutant 3′UTR. [score:1]
To determine whether NFIA is involved in miR-302b -mediated cell death, we measured NFIA levels after transfection with NFIA overexpression (NFIA OE) plasmids, NFIA shRNA, or the scramble control (S2D Fig). [score:1]
Three putative sites were predicted and named 3U-1, -2, and -3. (D and E) Effects of miR-302b on NFIA 3′UTR luciferase activity. [score:1]
The miR-302b mimic was purchased from GenePharma (Suzhou, China). [score:1]
This observation suggests that miR-302b significantly promotes glioma cell apoptosis. [score:1]
Overnight culture U87-MG cells were transfected with different doses of the miR-302b mimic for 24 h. The scrambled miRNA mimic (50 nM) was used as a control (Ctrl). [score:1]
However, few studies have focused on the effects of miR-302b on gliomagenesis. [score:1]
As shown in Fig 2D, the miR-302b mimic significantly reduced the luciferase activity of only 3U-3 in a dose -dependent manner. [score:1]
Our results collectively suggest that miR-302b -mediated gene networks are highly associated with glioma U87-MG cell death. [score:1]
To explore the role of miR-302b in regulating glioma cell death, we compared the endogenous miR-302b levels in normal astrocytes and three glioma cell lines (Fig 1A). [score:1]
For a microarray, total RNA was isolated from U87-MG cells with or without transfection with 50 nM miR-302b mimic for 24 h. Total RNA was extracted from cultured cells by using Trizol [®], according to the manufacturer’s instructions. [score:1]
Transfection with 50 nM miR-302b mimic for 24 h reduced U87-MG cell viability by 41% in comparison with transfection with the scramble control. [score:1]
Among these miRNAs, miR-302b has been reported to be an antioncogenic miRNA for some cancers [14– 16]. [score:1]
miR-302b -mediated transcriptome in glioma cells. [score:1]
To confirm our array result, we measured the IGFBP2 levels after miR-302b overexpression in U87-MG cells. [score:1]
Furthermore, caspase-3 activation and poly(ADP ribose) polymerase (PARP) degradation were detected in miR-302b -transfected U87-MG cells (Fig 1D). [score:1]
To test the cytotoxic effects of miR-302b on U87-MG cells, cells were transfected with different doses of the miR-302b mimic for 24 h (Fig 1B). [score:1]
Briefly, 10 [6] cells with or without transfection with NFIA plasmids and the miR-302b mimic were fixed with 1% formaldehyde, washed with cold PBS, and lysed in buffer. [score:1]
Molecular and cellular functions of miR-302b-influenced genes by ingenuity pathway analysis. [score:1]
In brief, after cells were transfected with the miR-302b mimic for 24 h, whole cells were collected in Hepes buffer containing 10 mM Hepes (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl [2]. [score:1]
miR-302b also attenuated the binding of NFIA to the IGFBP2 promoter (Fig 6D). [score:1]
0173890.g001 Fig 1(A) Detection of endogenous miR-302b levels in normal human astrocytes and the three glioma cell lines of HS683, M059K, and U87-MG. [score:1]
After 70% confluence was achieved, cells were transfected with indicated dose of the miR-302b mimic, scrambled miRNA mimic, scrambled or NFIA shRNAs, empty or NFIA-containing pcDNA3 plasmids, and pGL3 promoter reporter plasmids by using Lipofectamine 3000 (Invitrogen), according to the manufacturer’s instructions. [score:1]
Another seven target genes of miR-302b possessed characteristics similar to those of NFIA. [score:1]
Three individual 500-bp PCR products containing different putative miR-302b binding sites were digested with XhoI and XbaI and cloned downstream of the luciferase gene in the pMIRGLO-REPORT luciferase vector (Promega). [score:1]
After overnight culture U87-MG cells were transfected with 50 nM miR-302b mimic and 50 nM scrambled miRNA mimic (control) for 24 h, total RNA was extracted for the microarray analysis. [score:1]
We found that miR-302b induced U87-MG cell death in a dose -dependent manner. [score:1]
Cells were seeded overnight in a 96-well plate at 8 × 10 [3] cells/well, followed by transfection with various concentrations of the miR-302b mimic for another 24 h. Before the end of treatment, 0.5 mg/mL MTT was added to each well for 4 h. Supernatants were carefully aspirated, and formazan crystals were dissolved using dimethyl sulfoxide. [score:1]
Effects of miR-302b on mediating glioma cell death. [score:1]
miR-302b also enhanced the apoptosis ratio in a dose -dependent manner. [score:1]
miR-302b induced glioma cell death through apoptosis. [score:1]
This procedure reduced or abolished miR-302b binding to NFIA. [score:1]
As shown in Fig 1C, miR-302b promoted U87-MG cell death through apoptosis. [score:1]
[1 to 20 of 93 sentences]
4
[+] score: 218
Despite the upregulation of some hESC-specific genes in tumors, our data revealed a down-regulation of miR-302b in high-grade tumors. [score:7]
For evaluation of miR-302b expression in tumor and non-tumor groups, in each sample the expression level of miR-302b was normalized to that of U6 snRNA, then the level of expression of each sample was calibrated to that of the least expressed sample. [score:7]
Distributing the data in different grades of malignancy revealed that the relative expression of miR-302b mostly declined in tumors that had a high grade of malignancy by a p value of 0.009 (paired ttest), while the observed down-regulation in the low-grade samples was not statistically significant (p=0.10, non-parametric Wilcoxon test; Fig 2B). [score:6]
Note that only the relative expression of miR-302b in tumors with high grad of malignacy is significantly down-regulated (p=0.009). [score:6]
In contrast, while the expression of miR-302b was down-regulated in all grades of malignancies, the most significant decrease was observed in highly malignant tumors. [score:6]
They claimed that miR-302 is a human tumor suppressor capable of attenuating rapid cell growth, causing tumor cell apoptosis, and inhibiting tumor cell invasion and metastasis. [score:5]
The cluster of miR-302 is the most abundantly expressed miRNA in undifferentiated ESCs, and its expression is sharply turned off upon the induction of differentiation (20). [score:5]
As shown in figure 2A, the expression level of miR-302b was down-regulated in tumor samples compared to their non-tumor counterparts obtained from the same patients, by a p value of 0.001 (non-parametric Wilcoxon test). [score:5]
In NT2 and other pluripotent cells, high expression of miR-302 coincides with high expression of OCT4. [score:5]
Note the expression of miR-302b is significantly downregulated in tumor samples compared to their non-tumor counterparts (p=0.001). [score:5]
While we expected an elevated expression of miR-302b in tumor samples compared to their nontumor counterparts, a significant down-regulation of the gene interestingly appeared in tumor samples. [score:5]
The low expression of the miR-302b in AGS cells could be due to the restricted expression of miRNA in a rare subpopulation of the cells, such as CSCs. [score:5]
A comparison of the pattern of miR-302b expression in NT2, AGS, and gastric tumor/non-tumor tissue samples to the pattern of OCT4 expression in the same samples (24) has suggested that miR-302b could be considered a better marker of pluripotency. [score:4]
The later finding raised a hypothesis that tumor progression might require the silencing or down-regulation of miR-302b in its course towards a more malignant behavior. [score:4]
Members of the miR-302 cluster are highly expressed in embryonic stem cells (ESC), where they regulate cell self-renewal and pluripotency. [score:4]
Interestingly, the ESC-specific transcription factors OCT4, SOX2, Nanog and Rex-1 have binding sites on the miR-302 promoter, thus regulating its expression (20, 21). [score:4]
The data further revealed a down-regulation of miR-302b in gastric tumor samples (p=0.001), particularly in high-grade adenocarcinoma (p=0.009). [score:4]
The data suggest a potential tumor-suppressor role for miR-302b in tumorigenesis of gastric tissue. [score:3]
It was determined that a start concentration of 200 ng of total RNA Fig 1 miR-302b and U6 snRNA expression in AGS gastric cancer and NT2 human embryonic cancer cell lines. [score:3]
The expression pattern of miR-302 and ips genes greatly varies among the diffuse versus intestinal, subgroups of tumors (Unpublished data). [score:3]
Fig 3 ROC curve analysis for testing the sensitivity and specificity of miR-302b expression to discriminate between tumor and non-tumor states of the samples. [score:3]
It was determined that a start concentration of 200 ng of total RNA Fig 1 miR-302b and U6 snRNA expression in AGS gastric cancer and NT2 human embryonic cancer cell lines. [score:3]
Despite a significant difference between miR- 302b expression in tumor and non-tumor samples, the data obtained from ROC analysis suggested that miR-302b has a low sensitivity and specificity in discriminating between tumor and non-tumor gastric samples. [score:3]
As shown in Figure 1A, the relative expression of miR-302b (normalized to that of U6 snRNA as an internal control; figure 1C) in NT2 cells was ~500 times higher than that of the AGS cell line. [score:3]
C. The relative expression of miR-302b in individual samples, distributed in high and low grade groups. [score:3]
We also expected to see a higher expression of miR-302b at higher grades of malignancy, where the cells are mostly in a poorly differentiated state. [score:3]
The relative expression of miR-302b in individual samples, distributed in high and low grade groups, is presented in figure 2C. [score:3]
For calculation of miR-302b expression fold change, the expression level of miR-302b in each sample was normalized to that of U6 snRNA, as an internal control. [score:3]
This study aims to find a potential link between the expression level of human/homo sapiens miR-302b (has-miR- 302b) and tumor/grade state of gastric tissues. [score:3]
Interestingly, we also detected miR-302b expression in the AGS cell line, albeit at a level 500 times less than in NT2 cells. [score:3]
The difference between the grades of gastric samples and miR-302b expression fold change was determined by the Mann-Whitney non-parametric test. [score:3]
We also plotted standard curves by using serial dilutions of NT2 cDNA, as a positive control for miR-302b expression, and by using ABI 7500 software (Applied Biosystems, USA). [score:3]
However, this finding was in agreement with a recent report by Lin et al. (38) who have demonstrated tumor suppressive activity for miR-302. [score:3]
Then, miR-302 expression in tumor samples was normalized to the matched non-tumor samples (2 [‸‑ΔΔCT]). [score:3]
However, ROC analysis data demonstrated a low sensitivity and specificity of miR-302b expression to discriminate between the tumor and non-tumor state of the samples (AUC=0.63). [score:3]
This data suggested a potential tumor-suppressor role for miR-302b in tumorigenesis of gastric tissue. [score:3]
Association of miR-302b expression with patients' clinico-pathological data. [score:3]
Next, we determined the relative expression of miR-302b in 34 paired tumor/non-tumor gastric tissue surgical specimens. [score:3]
Therefore, we have employed a real-time reverse transcription–polymerase chain reaction (RT-PCR) approach to compare the expression level of miR-302b in a series of tumor and non-tumor gastric specimens. [score:3]
In contrast, NT2 cells as the positive control, had a high expression of miR-302b with a CT of 16 ± 2 (Fig 1A). [score:3]
A similar low and restricted expression of miR-302b in some glioma cell lines has been reported (37). [score:3]
Before we examined miR-302b expression in gastric tissues, the real-time RT-PCR procedure was optimized on NT2 as a positive control. [score:3]
There is a positive correlation between miR-302 expression and induced pluripotency (ips) genes, including OCT4 variants, in gastric adenocarcinoma. [score:3]
B. Comparative expression of miR-302b in different grades of gastric samples. [score:3]
A. Histograms show the mean values of miR-302b's relative expression in tumor and non-tumor samples, with confidence interval as an error bar. [score:3]
In each sample, the expression level of miR-302b is normalized to that of U6 snRNA, as an internal control. [score:3]
As expected, we detected a high expression level of miR-302b in the NT2 cell line, the positive control in our study. [score:3]
However, more work is needed on the expression and function of miR-302 on different tumor types before we can assign a general role for miR-302 in tumor initiation and progression. [score:3]
Area under curve (AUC=0.63) shows that data from miR-302b expression does not have high ability to correctly identify and distinguish tumor versus non-tumor groups of gastric samples. [score:3]
According to our data, miR-302b expression (normalized to that of the U6 snRNA housekeeping gene) in the pluripotent cell line NT2 was more than 500 times greater than that of the AGS cell line. [score:3]
The fact that the expression level of miR-302b in both tumor and non-tumor gastric samples was low (CT=35.5 ± 2) has suggested that it is not suitable to be used as a reliable tumor marker for detection and classification of gastric cancers. [score:3]
Fig 2 MiR-302b expression in tumor vs. [score:2]
For detection of miR-302b, we used Locked-Nucleotide Acid (LNA) primers, which provided high affinity and excellent discriminative power for the specific amplification of target miRNAs (36). [score:2]
We also used the human AGS cell line to compare the level of miR-302b expression in a gastric cancer cell line compared to that of a pluripotent cell line. [score:2]
MiR-302b expression in gastric tumors and their matched non-tumor tissues. [score:2]
B and D; The corresponding melt curves of miR-302b and U6 miR-302b (B) and U6 snRNA (D) the PCR products confirmed the specificity of the primers to amplify exact targets in both cell lines. [score:2]
Thus, in this study we have evaluated a potential alteration in the expression of miR-302b, the main regulatory miRNA in reprogramming and pluripotency pathways (19, 35) in gastric tumor samples. [score:2]
Note that the expression of miR-302b is significantly higher (~500x) in NT2 cells compared to that of AGS cells. [score:2]
The PCR products in both cell lines produced identical melt curves for both miR-302b and U6 snRNA (Fig 1B,D), which confirmed that the employed LNA primers had high specificity for the detection of miR-302b expression, with no cross-reactivity to other miRNAs. [score:2]
We used ROC analysis to evaluate the suitability of miR-302b expression to discriminate between the tumor and non-tumor state of the samples. [score:1]
and 1µl of the related cDNA generated detectable CT values for miR-302b (35.5 ± 2) and the internal control U6 snRNA (19.5 ± 4). [score:1]
Total area under the curve (AUC) for miR-302b was 63% (p=0.065; Fig 3). [score:1]
Optimizing the amplification of miR-302b in NT2 and AGS cell lines. [score:1]
Thus, our findings have supported Lin's results and provided an important insight into the role of miR-302 in tumorigenesis. [score:1]
The miR-302 promoter has binding sites for the main ESC-specific transcription factors, i. e. OCT4, Nanog, Sox2, and Rex1 (20, 21). [score:1]
The clinicopathological characteristics of the patients are summarized in table 1. The expression level of miR-302b was low in both tumor and non-tumor samples. [score:1]
Receiver operating characteristics (ROC) curve was plotted to determine how well the expression level of miR-302b discriminated between tumor and non-tumor gastric samples. [score:1]
A comparative evaluation of miR-302b expression in tumor and non-tumor gastric samples was performed by either paired t test or Wilcoxon non-parametric test. [score:1]
Members of the miR-302 cluster (miR-302a, miR-302b, miR-302c, miR-302d, and miR-367) are the most abundant miRNAs in human embryonic stem cells (hESCs). [score:1]
A and C; Representative amplification plots of mir-302b (A) and U6 snRNA (internal control, C) for NT2 and AGS cell lines. [score:1]
The sample size was calculated based on the assumption of 1 ΔCT difference for miR-302 expression between tumor and non-tumor gastric samples, with the consideration of a type I error of 0.05 and type II error of 0.20. [score:1]
Thus, it seemed that miR-302b, as a tumor marker, did not have adequate sensitivity and specificity to discriminate between tumor and nontumor gastric samples. [score:1]
[1 to 20 of 72 sentences]
5
[+] score: 166
miR-302 members also can directly inhibit the expression of Cyclin D1/2, CDK2 and ARID4a (AT-rich interacting domain 4a, also known as RBP1), which represses the phosphorylation of pRB, leading to failed expression of cell cycle genes and cellular G1 phase arrest (figure 2 b) [57, 58]. [score:8]
miR-302 members strongly suppress BMI-1 to stimulate CDKN2A (cyclin -dependent kinase inhibitor 2A, or p16) expression, thus giving rise to decrease in the output of CDK4/6 and Cyclin D complex and finally repressing the G1-to-S transition. [score:7]
CDKN1A (cyclin -dependent kinase inhibitor 1, also known as p21), which was referred to as an inhibitor to Cyclin E/CDK2 complex, was the first verified target of the miR-302/367 cluster [55, 56]. [score:7]
Overexpression of the miR-302/367 cluster significantly increased the conversion of reprogrammed iPS cells by repressing MBD2 expression, thereby augmenting Nanog expression [65]. [score:7]
The miR-302/367 cluster is wi dely distributed in vertebrates and plays vital roles in cellular self-renewal, differentiation and reprogramming, mainly through targeting the key genes in cell cycle regulation, cellular signalling regulation and epigenetic regulation. [score:6]
To begin with, the miR-302/367 cluster was found to be involved in regulating cell signalling pathways, including TGF- β/Nodal signalling, PI3K–AKT signalling and BMP signalling, by directly repressing expression of some key components in the pathways [24, 37, 47]. [score:5]
miR-302 members can target different epigenetic factors resulting in global demethylation in target cells [61]. [score:5]
The miR-302/367 cluster, specifically expressed in embryonic stem cells, induced pluripotent stem cells (iPSs) or tumour cells, represses the targets mentioned above, to coordinate proliferation, differentiation, pluripotency maintenance and reprogramming. [score:5]
4.2. miR-302 members can target different epigenetic factors resulting in global demethylation in target cells [61]. [score:5]
Interestingly, the 3′UTRs of upregulated transcripts in Dicer -null ESCs were shown to be enriched for the ‘GCACUUU’ and ‘AGCACUU’ motifs, complementary to the miR-302 family seed sequence, indicating the importance of the miR-302 family in the regulatory network in ESCs [24, 25]. [score:5]
The miR-302/367 cluster regulates the pathways through silencing key components, and the feedback of the regulated pathways can impact the expression of the cluster. [score:5]
Most recent publications on miR-302 members have supported a positive correlation between miR-302/367 upregulation and BMP signalling promotion. [score:4]
The remaining verified targets of miR-302/367 are key mediators of a diverse range of processes, including epigenetic regulation and glucose metabolism. [score:4]
In addition, miR-302 members could negatively regulate the level of Lefty1 and Lefty2 (Nodal inhibitors), and thus became upstream modulators of the TGF- β/Nodal signalling pathway, striking a balance between pluripotency and differentiation [70]. [score:4]
Using similar experimental approaches, Gata6 was identified as a new transcriptional regulator to activate the expression of miR-302/367 cluster in mouse embryos [39, 40]. [score:4]
In addition, miR-302 members can mediate other pathways to regulate the cell cycle via targeting the transcripts of epidermal growth factor receptor (EGFR), C–C chemokine receptor type 5 (CCR5), C–C motif ligand (CCL5) and C–X–C chemokine receptor type 4 (CXCR4) [58– 60]. [score:4]
M112.390898) 43 Brautigam C, Raggioli A, Winter J 2013 The Wnt/beta-catenin pathway regulates the expression of the miR-302 cluster in mouse ESCs and P19 cells. [score:4]
miR-302 members directly repressed the expression of the transforming growth factor beta receptor 2 (TGFBR2), and Ras homologue gene family, member C (RHOC) genes, resulting in facilitation of EMT [68, 69]. [score:4]
miR-302 members directly silenced the expression of CDKN1A and hence augmented the abundance of Cyclin E/CDK complex, promoting the transition of mouse embryonic stem cells from G1 to S phase [56]. [score:4]
M111.308528) 42 Kang H, Louie J, Weisman A, Sheu-Gruttadauria J, Davis-Dusenbery BN, Lagna G, Hata A 2012 Inhibition of microRNA-302 (miR-302) by bone morphogenetic protein 4 (BMP4) facilitates the BMP signaling pathway. [score:3]
However, a subsequent publication revealed that miR-302 members could inhibit human pluripotent stem cell proliferation by enhancing multiple G1 phase arrest pathways [57]. [score:3]
Furthermore, CHIP assays revealed a physical interaction between Sox2 and the binding sites [38], verifying that Sox2 is the upstream regulator of the miR-302/367 expression. [score:3]
Three BMP inhibitors, TOB2, DAZAP2 and SLAIN1, were silenced via binding of mature miR-302 members to the 3′ UTRs of their transcripts, leading to repression of stem cell differentiation and maintenance of stem cell pluripotency [66]. [score:3]
Henceforward, numerous targets of miR-302/367 cluster have been identified. [score:3]
A recent study has also revealed that an anti-allergy drug, tranilast, promoted miR-302 members expression through binding to the two aryl hydrocarbon receptor binding motifs in the promoter [44]. [score:3]
In addition, some regulators could indirectly affect the transcriptional level of the miR-302/367 cluster via a diverse range of signalling pathways. [score:3]
Figure 2. (a) The transcriptional factors and main targets of the miR-302/367 cluster. [score:3]
Increasing evidence has directly demonstrated that the members of the miR-302/367 cluster play a critical role in regulation of the balance of G1-to-S transition. [score:3]
Cyclin D1 and CDK4 were the first miR-302/367 targets identified, by means of reporter assays [38, 46]. [score:2]
Accumulating evidence demonstrates that the miR-302/367 cluster plays significant roles in regulation of cellular proliferation, differentiation and reprogramming. [score:2]
For some well-annotated genomes, mir-302 sequences were directly extracted from the database. [score:2]
The miR-302/367 cluster has been demonstrated to be involved in regulation of various cellular signalling pathways, such as the BMP signalling pathway and TGF- β/Nodal/Smad-2/3 pathway, to coordinate different biological processes. [score:2]
Indeed, miR-302 members repressed lysine-specific histone demethylase 1 and 2 (AOF1 and AOF2) and methyl-CpG binding proteins (MECP1 and MECP2), leading to destabilization of DNA methyltransferase 1 which is involved in genome-wide demethylation and consequently promotes reprogramming and iPS cells development [64]. [score:2]
The RNA sequencing data from H. sapiens and Mus musculus confirmed that the 3′ arm is highly expressed and more conserved compared with the 5′ arm in most miR-302 family members (figure 1 c) [28– 30]. [score:2]
Of the 118 TFs, seven pertained to the miR-302/367 cluster, including the previously known Oct 3/4 and 6 novel TFs (figure 2 a). [score:1]
However, according to multiple sequence alignment, we found that the mir-302 of P. marinus (pma-mir-302) was not contained in the mir-302/367 family. [score:1]
The miR-302/367 cluster gene was found to be located in an intron on the 4q25 region of human chromosome 4, and transcribed by RNA polymerase II (Pol-II) to generate a capped and polyadenylated miRNA precursor that possessed eight miRNAs: miR-367, 302d, 302c-5p, 302c-3p, 302a-5p, 302a-3p, 302b-5p and 302b-3p [23]. [score:1]
The miR-302/367 cluster, composed of several intronic miRNAs, was initially proposed to be transcribed with their host gene LARP7. [score:1]
The starting point of comparative genomic analysis of the mir-302/367 cluster was the retrieval of mir-302 members and mir-367 precursor sequences. [score:1]
Increasing studies in the future will provide us with a clear mechanism by which miR-302 members fulfil the cellular self-renewal, differentiation and reprogramming in a more integrated network. [score:1]
The primary transcript is a 1974 nt long RNA with the 5′ end located 153 nt upstream from the first encoded miRNA (miR-302b-5p), and the 3′ end sited approximately 12 nt downstream from a classical polyadenylation signal (figure 2 a) [23, 37]. [score:1]
The whole genome of the amphibian X. tropicalis codes two miRNAs, miR-302 and miR-367, located in the intron of the LARP7 gene. [score:1]
Red arrows depict miR-302 family members, green arrows depict miR-367, black arrow depicts pma-miR-302 and blue arrow depicts bird-specific miR-1811 sequence. [score:1]
The role of the miR-302/367 cluster is expanding. [score:1]
It was also observed that the seed sequence of Gallus gallus miR-1811, a bird-specific miRNA located in the miR-302/367 cluster gene locus, shows a high similarity to miR-367, indicating that miR-1811 might have been generated by tandem duplication of miR-367. [score:1]
pma-mir-302 only shared the seed sequence of the 3′ mature miRNAs with the 3′ mature sequence of the mir-302/367 family (figure 1 b). [score:1]
mir-302 precursor sequences: miRBase accessions MI0000738, MI0000772, MI0000773, MI0000774, MI0001211, MI0003700, MI0003701, MI0003702, MI0004878, MI0017123, MI0006903, MI0006904; Ensemble Genome Browser accessions ENSDNOG00000038602, ENSDNOG00000043944, ENSDNOG00000027052, ENSDNOG00000026812, ENSDNOG00000017050, ENSDNOG00000016990. [score:1]
After identification of the gene structure of the miR-302/367 cluster by means of 5′ RACE assay, 3′ RACE assay and sequence alignment, several transcriptional factors (TFs), Oct3/4, Cdx2, Sox2, Rex1 and Nanog, were predicted to be capable of targeting the promoter of the cluster using bioinformatic methods [23]. [score:1]
The miR-302/367 cluster is highly conserved and vertebrate-specific. [score:1]
Whereas most mature miRNAs from the miR-302 family generally originate from the 3′ arm of the hairpin precursor, a small quantity of mature miR-302 members are derived from the opposite arm. [score:1]
More specifically, miR-302 members can fine-tune stem cell self-renewal through promotion of BMP signalling. [score:1]
A combined searching strategy was undertaken to identify mir-302/367 family members in multiple genomes from Ensemble Genome Database (http://www. [score:1]
Another study found that the miR-302/TGF- β/Nodal/Smad-2/3 pathway was also involved in epithelial–mesenchymal transition (EMT). [score:1]
It was experimentally demonstrated that Oct3/4, Nanog, Rex1 and Sox2 act as transcriptional activators of the miR-302/367 cluster [37, 38]. [score:1]
Biological functions of the miR-302/367 cluster. [score:1]
Higher vertebrates such as mammals, birds and reptiles commonly possess ‘classical’ structure, including four miR-302 members and one miR-367, in the cluster locus. [score:1]
The results revealed that the miR-302/367 cluster is conserved among vertebrates, but the copy number and genomic location of the cluster gene vary. [score:1]
The expansion or shrinking of the miR-302 family by tandem duplication or deletion generated miR-302/367 clusters of different lengths in different species. [score:1]
TFs in the right upper corner were newly identified by the ENCODE project and the relationship of most of them to the miR-302/367 cluster is putative. [score:1]
No member of the miR-302/367 cluster has been discovered in bony fish such as D. rerio, most probably owing to the loss of this cluster during the evolutionary process. [score:1]
The fact that no homologue can be found in jawless fish and bony fish suggested the emergence of mir-302/367 at the branch leading to the tetrapoda. [score:1]
Interestingly in primates, besides the four members of miR-302, there also exist another two miR-302 members, namely miR-302e and miR-302f, which are both intergenic miRNAs and located in chromosome 11 and 18, respectively. [score:1]
As shown in figure 1 a, the ancient vertebrate P. marinus contains only one copy of miR-302 members. [score:1]
Figure 1. (a) Phylogenetic tree of vertebrate species and genomic organization of miR-302 and miR-367 sequences. [score:1]
[1 to 20 of 64 sentences]
6
[+] score: 156
In addition to the inhibition of Nodal antagonists, miR-302 could promote BMP signaling by targeting the inhibitors DAZAP2, SLAIN1, and TOB2 [61]. [score:7]
For instance, methyl-DNA binding domain protein 2 (MBD2), an epigenetic suppressor of Nanog, is a direct target of miR-302 [140]. [score:6]
c-Myc downregulates TGFβ1 and TGFβ receptor 2 (TGFBR2), which is also a target of the miR-302 and miR-93 families [119, 121, 123, 133]. [score:6]
Similarly, during reprogramming, miR-302 may also indirectly promote the activation of endogenous core pluripotency genes by targeting their inhibitors. [score:6]
By inhibiting inhibitors of both branches, miR-302 plays a central role in negatively regulating neural induction in pluripotent stem cells (Figure 2). [score:6]
Conversely, Myc-activated genes and c-Myc itself are enriched among transcript that are upregulated in presence of miR-302 family members, suggesting that the pro-pluripotency activity of these miRNAs may be mediated, at least in part, by the indirect increase of Myc [110]. [score:5]
In a feedback loop, miR-302 targets the type II BMP receptor (BMPRII) in PASMCs, thus inhibiting BMP signaling. [score:5]
Upon transfection of let-7 family miRNAs, expression of Oct4, Sox2 and Nanog is inhibited, suggesting an anti-pluripotency activity for let-7. However, if miR-302 family miRNAs are co -transfected, they impair this activity and restore the levels of pluripotency markers [110]. [score:5]
We have previously demonstrated that miR-302 targets NR2F2, which in turn is a transcriptional inhibitor of Oct4 [94]. [score:5]
The specific expression of miR-302 family miRNAs is ensured by their regulation, at the transcriptional level, by the core ESC transcriptional regulatory circuitry [8, 9, 62, 63]. [score:5]
Other pluripotency factors that are directly inhibited by let-7, and indirectly activated by miR-302 family, are Lin28 and Sall4, suggesting that these miRNAs exert their function via multiple pathways [110]. [score:5]
According to the miRNA expression atlas [59], miR-302 family members are specifically expressed in embryonic cells in both mouse and human. [score:5]
We have shown that, by directly inhibiting Lefty, miR-302 is necessary for proper mesoderm and endoderm specification [87]. [score:4]
Another gene involved in EMT, RHOC, is a direct target of miR-302 [123]. [score:4]
The regulation of Nodal signaling by miR-302 seems evolutionary conserved, as the Xenopus and Zebrafish hortologues target Lefty during early embryogenesis [87, 88]. [score:4]
It has recently been shown that BMP signaling down-regulates the miR-302/367 cluster in human primary pulmonary artery smooth muscle cells (PASMCs), mouse mesenchymal cells and embryonic carcinoma p19 cells [91]. [score:4]
Downregulation of MDB2 by miR-302 is necessary to achieve a fully reprogrammed iPSC state. [score:4]
Recently, it has been shown that NR2F2 knockdown enhances reprogramming efficiency, thus mimicking miR-302 overexpression [141]. [score:4]
For instance, it has been proposed that during reprogramming miR-302 regulates multiple genes involved in cell cycle regulation, epigenetic regulation, vesicular transport, cell signaling and mesenchymal-to-epithelial transition [123]. [score:4]
We have shown that both Oct4 (at the transcriptional level) and miR-302 (post-transcriptionally) repress a common target, NR2F2 (also known as COUP-TFII) [94]. [score:3]
Therefore, miR-302 and the two transcription factors, NR2F2 and Oct4, form a feedback regulatory circuitry that regulates hESC exit from pluripotency and neural fate specification (Figure 2). [score:3]
mESCs express high levels of miR-290-295 that decline after conversion to EpiSCs and are replaced by an increase of miR-302/367. [score:3]
Similarly, undifferentiated human ESCs are dominated by the mir-302 cluster, which accounts for more than 60% of all expressed miRNAs [61]. [score:3]
miR-302 overexpression sustains pluripotency markers in differentiating hESCs [87, 139]. [score:3]
The miR-302 family targets p21 and promotes G1/S transition [79, 80]. [score:3]
As mentioned before, introduction of miR-302 family members in DGCR8 −/− mESCs increases expression of endogenous c-Myc and N-Myc downstream genes [110]. [score:3]
Further studies are necessary to address whether this reciprocal inhibition between BMP signaling and miR-302 also exist in ESCs. [score:3]
ESCs and iPSCs express a similar signature group of miRNAs, including the miR-302 family, with small differences between the two cell types [114– 116]. [score:3]
The miR-302 family miRNAs are abundantly expressed in undifferentiated ESCs and decline upon differentiation [54– 58]. [score:3]
miR-302 is deeply integrated in the core transcriptional regulatory circuitry of ESCs. [score:2]
In human ESCs, which correspond to a primed state of pluripotency, the levels of miR-302/367 are much higher than the levels of miR-371-373 and the switch to an earlier developmental state led to an increase of the levels of miR-371-373 [65– 67]. [score:2]
The promoter of the miR-290-295 cluster is directly bound and activated by c-Myc and N-Myc [7], and the miR-302 cluster is also induced by Myc [112], establishing positive feedback loops. [score:2]
Therefore, according to the mo del depicted in Figure 5, the miR-302 and let-7 miRNA families play opposite, crucial roles in regulating ESC pluripotency and differentiation. [score:2]
The miR-302 family has been involved in the TGF-β/BMP signaling pathway, which regulates embryonic stem cells pluripotency and differentiation. [score:2]
In contrast to the finding that combinations of multiple miRNA families are necessary for reprogramming [123, 127, 128], Lin et al. have reported that miR-302 alone could convert skin cancer and hair follicle cells into iPSCs in the absence of other miRNAs or RFs [129, 130]. [score:1]
Moreover, miR-302 family members are required for efficient reprogramming of somatic cells and, in combination with other miRNAs, are sufficient for iPSC generation in the absence of canonical reprogramming factors. [score:1]
This defect could be partially rescued by miR-302 family members and the unrelated miR-195. [score:1]
For simplicity, in this review we will refer to miRNAs containing the AAGUGC seed as miR-302 family. [score:1]
For both let-7 and the miR-302 families feedback loops with Myc are in play. [score:1]
Both were required for reprogramming, as miR-302 alone is not able to give rise to iPSCs in the absence of miR-367. [score:1]
Moreover, at least other two components of the cell cycle machinery, Cyclins D1 and D2, are under the control of miR-302 family members in hESCs [63, 82]. [score:1]
As mentioned above, the miR-302 host gene is under the control of Oct4, Nanog and Sox2, which ensure high miRNA levels in undifferentiated ESCs [9, 62, 63]. [score:1]
Accordingly, miR-302 family members could rescue the proliferation defects of DGCR8 mutant mESCs [73]. [score:1]
For instance, it has been shown that the combination of miR-302, miR-200c and miR-369 can reprogram both human and mouse somatic cells [128]. [score:1]
The promoters of the miR-302 and the miR-290-295 clusters are bound by Oct4, Nanog, Sox2 and Tcf3, that also promote transcription of other unrelated miRNAs. [score:1]
However, it is unlikely that the pro-reprogramming activity of the miR-302 is merely mediated by downstream activation of c-Myc. [score:1]
For instance, miR-93 and 106b (that belong to the same family and share 5/6 of the miR-302 seed) and the unrelated miR-138 enhance iPSC generation [118, 122]. [score:1]
Moreover, miR-367, but not miR-302, can be substituted by other miRNAs in alternative reprogramming cocktails. [score:1]
Interestingly, when used in combination with reprogramming factors to enhance reprogramming, miR-302 alone was almost as effective as the intact miR-302-367 cluster, whereas miR-367 alone had no effect [121]. [score:1]
The conserved miR-302/367 cluster comprises four AAGUGC seed-containing miRNAs (miR-302a, miR-302b, miR-302c and miR-302d) and the unrelated miR-367. [score:1]
Similar to the mouse system, reprogramming of human fibroblasts was also enhanced when miR-302 family members are provided along with the reprogramming factors [123]. [score:1]
This sequence is complementary to the AAGUGC seed of miR-302 family miRNAs, thus confirming their prominent role in pluripotent stem cells. [score:1]
Interestingly, in presence of the three factors plus c-Myc the reprogramming enhancement by the miR-302 family members was strongly reduced [120, 121]. [score:1]
The miR-302-367 cluster contains four miR-302 members, with the AAGUGC seed, and the unrelated miR-367. [score:1]
Much work concerned the miRNAs belonging to the miR-302 family. [score:1]
Interestingly, the conversion from a naïve to a primed state in mESCs correlates with a switch between the miR-290-295 and the miR-302/367 clusters in terms of miRNA abundance [64] (Figure 1b). [score:1]
[1 to 20 of 56 sentences]
7
[+] score: 150
HDAC4 is Directly Targeted by hsa-miR-302b in IGROV-1Because the effects of miRNAs might lead to expression changes in their predicted target genes, we searched for expression patterns deregulated following CpG-ODN treatment by integrating the miRNA and mRNA expression profiles. [score:13]
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
To reduce expression of hsa-miR-424 and hsa-miR-340 (down-modulated in our miRNA expression profile), IGROV-1 cells were transiently transfected for 72 h with the respective LNA inhibitors or with a LNA negative control, whereas cells were transfected with hsa-miR-302b precursor molecule (or a scrambledoligonucleotide) to increase expression of hsa-miR-302b. [score:9]
The observation that overexpression of miR-302b increased the sensitivity of ovarian tumor cells to cisplatin, together with the reported tissue specificity of miRNAs [38], raises the possibility of using this miRNA to modulate DNA-damaging drug sensitivity and avoiding HDAC inhibitor toxicity. [score:5]
Quantitation of p21 protein levels reportedly regulated post-transcriptionally by miRNAs of the hsa-miR-302 family [23] revealed the expected down-regulation of this protein in IGROV-1 cells transfected with hsa-miR-302b precursor (data not shown), suggesting that hsa-miR-302b exerts biological effects in IGROV-1 cells similar to those observed in other cellular mo dels. [score:5]
0058849.g006 Figure 6 Kaplan-Meier survival curves of patients stratified according to hsa-miR-302b expression (A) and has-miR-340 expression (B) on GSE25204 and referred to TTR. [score:5]
Increased Expression of hsa-miR-302b in IGROV-1 Significantly Improved Cisplatin ActivityWe previously showed that TLR9 -expressing cells in the tumor microenvironment can sensitize cancer cells to DNA-damaging cisplatin treatment by down-modulating genes involved in DNA repair [3]. [score:5]
Briefly, the target site of hsa-miR-302b was identified within the HDAC4 3′UTR according to the Target Scan database (Fig. 5C), and the region including this site was cloned downstream of the luciferase gene into the reporter plasmid pGL3 control. [score:5]
Median TTR was 11 and 25 months for low and high expression of hsa-miR-302b (Fig. 6A), and 26 and 12 months for low and high expression of hsa-miR-340, respectively (Fig. 6B). [score:5]
In Bagnoli’s dataset [22], Kaplan-Meier analysis showed that patients with low expression of hsa-miR-302b or with high expression of hsa-miR-340 had a shorter TTR (log-rank, P = 0.037; HR = 1.75, 95% CI: 1.03–2.95 and P = 0.047; HR = 1.7, 95% CI: 1.01–2.86, respectively) (Fig. 6A and 6B). [score:5]
Kaplan-Meier survival curves of patients stratified according to hsa-miR-302b expression (A) and has-miR-340 expression (B) on GSE25204 and referred to TTR. [score:5]
Concerning genes involved in DNA repair, miRNA-mRNA interaction analysis identified HDAC4 as a gene potentially targeted by hsa-miR-302b, as then validated by the decreased HDAC4 mRNA and protein levels upon enforced hsa-miR-302b expression in IGROV-1 cells. [score:5]
Moreover, a very recent study reports direct regulation of p21 protein by members of the miR-302 family activated following DNA damage in human embryonic stem cells [20], further suggesting that miR-302 can impact the response to DNA-damaging agents by modulating different target molecules. [score:5]
Comparison of hsa-miR-18a, hsa-miR-18b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-556-3p, hsa-miR-424, hsa-miR-136, hsa-miR-340, hsa-miR-302b expression obtained by miRNA expression profile and qRT-PCR on tumors collected from human IGROV-1 ovarian tumor-bearing mice treated daily i. p. with CpG-ODN or saline (control group). [score:5]
In Shih’s dataset [21], only the expression of hsa-miR-302b was significantly associated to OS (log-rank, P = 0.034; HR = 2.02, 95%CI: 1.05–3.88), with a median OS of 33.7 and 101.2 months for low and high expression, respectively (Fig. 6C). [score:5]
Reduced expression of hsa-miR-424 or hsa-miR-340 did not significantly improve cisplatin cytotoxicity (data not shown), whereas increased expression of hsa-miR-302b significantly enhanced cisplatin cytotoxicity, with an increase of cell death ranging from 26.5 to 43.9% in 6 independent experiments as compared to negative scrambled -transfected cells (p<0.0001; Fig. 3A). [score:4]
HDAC4 is Directly Targeted by hsa-miR-302b in IGROV-1 Cells. [score:4]
These data indicate the direct effect of hsa-miR-302b on HDAC4 gene expression. [score:4]
Our analysis of 3 miRNAs (hsa-miR-424, hsa-miR-340 and hsa-miR-302b) for their relevance to chemotherapy response showed that the enforced expression of hsa-miR-302b on IGROV-1 cells significantly enhanced cisplatin cytotoxicity. [score:3]
For luciferase reporter experiments, a 1017-bp region of the HDAC4 3′ untranslated region including the binding site for hsa-miR-302b was amplified from IGROV-1 cells. [score:3]
Targeting of HDAC4 in IGROV-1 cells by hsa-miR-302b. [score:3]
Mutations into the hsa-miR-302b binding site of the HDAC4-3′UTR were introduced using Quik-Change II Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA). [score:3]
Consistent with in vitro data, hsa-miR-302b expression was significantly associated to TTR or OS in two datasets of ovarian cancer patients treated with platinum -based therapy. [score:3]
To determine whether the down-modulation of HDAC4 after hsa-miR-302b overexpression was due to a direct interaction between the miRNA and the mRNA of HDAC4, a luciferase reporter assay was performed. [score:3]
Increased Expression of hsa-miR-302b in IGROV-1 Cells Significantly Improved Cisplatin Activity. [score:3]
IGROV-1 cells seeded in 6-well plates at 2×10 [5] cells/well were transfected with miRCURY LNA inhibitors of hsa-miR-424 or hsa-miR-340 or negative control A (Exiqon; final concentration, 100 nmol/L) using SiPort Neo-FX (Ambion) according to the manufacturer’s instructions, or with hsa-miR-302b precursor or negative control #1 pre-miR (Ambion; final concentration, 50 nmol/l). [score:3]
Forced expression of hsa-miR-302b increased cisplatin sensitivity in IGROV-1 cells without affecting cell proliferation. [score:3]
To determine whether miRNAs modulated by CpG-ODN treatment are able to modify the sensitivity to DNA-damaging agents, the 3 most significantly differentially expressed miRNAs in tumor samples obtained from the replica of the in vivo experiment (hsa-miR-424, hsa-miR-340 and hsa-miR-302b) were examined applying a gain- or loss-of-function phenotype in order to mimic the up- or down-modulation observed in miRNA profiling (see Fig. 1). [score:3]
Focusing on the 19 genes potentially targeted by hsa-miR-302b as identified using MAGIA (q value <0.1, Table S1), we evaluated HDAC4, one of the top anti-correlated mRNAs, as a potential molecular target of hsa-miR-302b associated with response to chemotherapy. [score:3]
Forced hsa-miR-302b expression in IGROV-1 cells decreased HDAC4 mRNA and protein levels (Fig. 5A and B), supporting the interaction analysis data. [score:3]
Analysis of IGROV-1 cells co -transfected with hsa-miR-302b precursor or a scrambled oligonucleotide and the reporter vector, containing HDAC4 3′UTR, revealed a significant decrease in luciferase activity in hsa-miR-302b transfected cells as compared to scrambled transfected cells (∼50% reduction, p = 0.0088, Fig. 5D), whereas mutated HDAC4-3′UTR escaped this inhibition (Fig. 5E). [score:2]
In silico evaluation of ovarian cancer patients’ clinical course according to hsa-miR-302b and hsa-miR-340 expression levels. [score:1]
No significant differences in cell growth were observed between IGROV-1 cells transiently transfected with hsa-miR-302b precursor molecule and control cells (Fig. 3B), ruling out the possibility that hsa-miR-302b sensitized cancer cells to cisplatin by stimulating cell proliferation. [score:1]
pGL3 reporter vector (200 ng) containing the hsa-miR-302b binding site, 40 ng of the phRL-SV40 control vector (Promega), and 50 nmol/l miRNA precursors or scrambled sequence miRNA control (Ambion Inc, Austin, TX. [score:1]
IGROV-1 cells were transfected with 50 nmol/l pre-hsa-miR-302b or scrambled oligonucleotide using SiPort Neo-FX transfection reagent according to the manufacturer’s protocol (Ambion) and seeded in a 96-well plate at a density of 10 [3], 1.5×10 [3], and 2×10 [3] cells/well. [score:1]
IGROV-1 cells were transfected with 50 nmol/l hsa-miR-302b precursor molecule or scrambled control, and 72 h later, exposed to cisplatin (50 µM) for 1 h. Cell viability was assessed 24 h after cisplatin treatment by propidium iodide staining and flow cytometry. [score:1]
0058849.g003 Figure 3(A) Percent cell death of hsa-miR-302b- and scrambled -transfected cells after cisplatin treatment. [score:1]
These findings indicate that hsa-miR-302b acts as a “chemosensitizer” in human ovarian carcinoma cells and may represent a biomarker able to predict response to cisplatin treatment, leading to a more accurate selection of patients potentially responsive to a specific therapy. [score:1]
Of the 9 miRNAs, hsa-miR-18a and hsa-miR-18b were selected based on their reported role in the pathogenesis of ovarian cancer [25]; [26], and hsa-miR-101 and hsa-miR-302b for their described involvement in DNA repair processes and sensitivity to chemotherapy [20]; the remaining 5 miRNAs were randomly selected. [score:1]
[1 to 20 of 39 sentences]
8
[+] score: 146
The western blots showed that ectopic overexpression of miR-302b in HepG2 cells can down-regulate the Mcl-1 and DPYD protein levels (Figure 3C,F), but mRNA levels of these two genes did not change (data not shown), which suggested that the miR-302b suppress Mcl-1 and DPYD genes expression at translational level, but not transcriptional level. [score:12]
Western blot analysis showed that transfection of miR-302b (Figure 2F) or Mcl-1-siRNA or DPYD-siRNA (Figure 4I) down-regulated the expression of caspase-3 and up-regulated the expression of cleaved PARP. [score:11]
This very low expression level of miR-302b in liver cancer cell lines also caused little change of miR-302b expression after transfection of miR-302b inhibitor into SMMC-7721 cells. [score:7]
The target genes sequences and their mutated ones were respectively cloned into the pmirGLO Dual-Luciferase miRNA Target Expression vector; (B, E) Analysis of luciferase activity; (C, F) Western blot measured the expression level of Mcl-1 (C) and DPYD (F) 48 h post transfection of miR-302b. [score:7]
In our study, we observed the miR-302b’s function of suppressing proliferation in human hepatoma cell lines and found that ectopic overexpression of miR-302b could enhance the sensitivity of HCC to 5-FU by negatively regulating DPYD and anti-apoptosis protein Mcl-1, which suggests that miR-302b might serve as a therapeutic reagent for HCC. [score:6]
These results indicated that overexpression of miR-302b enhanced the sensitivity of HCC cells to 5-FU -induced apoptosis by down-regulation of Mcl-1 and DPYD. [score:6]
The result of real-time PCR showed that a huge increase of miR-302b expression level occurred 48 h later in HepG2/SMMC-7721 cells infected with pre-miR-302b plasmid (Figure 1A), partly due to comparing with the very low expression level of miR-302b in HepG2/SMMC-7721 cells transfected with control plasmid. [score:5]
To search for the miR-302b target genes involved in 5-FU sensitivity, we applied the programs RegRNA2.0 [28] and/or TargetScan [29] to get Mcl-1 and DPYD genes, both of which were shown to harbor good binding sites of hsa-miR-302b-3p respectively in the 3′ UTR of Mcl-1 gene at 2225–2231 nt and the coding domain sequence (CDS) of DPYD gene at 925–949 nt (Figure 3A,D). [score:5]
Lin S. L. Chang D. C. Ying S. Y. Leu D. Wu D. T. MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathways Cancer Res. [score:5]
Lin S. L. Chang D. C. Lin C. H. Ying S. Y. Leu D. Wu D. T. Regulation of somatic cell reprogramming through inducible miR-302 expression Nucleic Acids Res. [score:4]
Because of its low level of expression in HCC cells, miR-302b will be a potential candidate molecular to improve the efficiency of chemotherapy in the treatment of advanced HCC patients after development of better gene delivery systems. [score:4]
Wang L. Yao J. Zhang X. Guo B. Le X. Cubberly M. Li Z. Nan K. Song T. Huang C. MiRNA-302b suppresses human hepatocellular carcinoma by targeting AKT2 Mol. [score:4]
The results from apoptosis assay showed that only overexpression of miR-302b in SMMC-7721 cells hardly increase cells’ apoptosis rate (Figure 2E), but enhanced expression of miR-302b in SMMC-7721 cells led to an obvious increase in apoptosis after 5-FU (20 μM) treatment for 72 h (Figure 2E). [score:4]
Further studies indicated that the sensitivity to 5-FU could be enhanced in miR-302b -overexpressing HepG2/SMMC-7721 cells, but not in miR-ctrl -overexpressing ones (Figure 2A,B), after treatment with low concentration of 5-FU at about 3.2 μM for 72 h. It was further validated by the colony formation assay (Figure 2D). [score:4]
After overexpression of miR-302b in HepG2/SMMC-7721, we observed an obvious suppression of cell proliferation by the MTT (Figure 1B) and colony formation assays (Figure 2D). [score:4]
Subramanyam D. Lamouille S. Judson R. L. Liu J. Y. Bucay N. Derynck R. Blelloch R. Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells Nat. [score:3]
It suggested that miR-302b might enhance 5-FU sensitivity via its two target genes: Mcl-1 and DPYD (Figure 4H). [score:3]
These results suggested that overexpression of miR-302b in HepG2/SMMC-7721 cells could enhance the cells’ sensitivity to 5-FU when the concentration of 5-FU at least over 1.6 μM. [score:3]
In our studies, we observed miR-302b’s effects of suppressing the proliferation of liver cancer cell lines by blocking cell cycle at G0/G1 phase (Figure 1), which was in consistence with previous reports [26, 27]. [score:3]
Overexpression of miR-302b in HepG2/SMMC-7721 caused an increase of cells in G0/G1-phase population and a decrease of cells in S-phase population, which indicated that miR-302b blocked the transition from G0/G1 to S phase in HCC cells (Figure 1C). [score:3]
In order to get a general idea of the function of miR-302b in liver cancer cell lines, miR-302b expression plasmid and the control plasmid were respectively transfected into the HepG2/SMMC-7721 cells. [score:3]
Recently, some people began to divert attention from miR-302b’s function of maintaining pluripotency [21, 22] to suppressing oncogenesis [25, 26, 27]. [score:3]
Overexpression of miR-302b Enhances the Sensitivity to 5-FU in HepG2 and SMMC-7721 Cells. [score:3]
Luciferase reporter assay confirmed that miR-302b directly targeted the 3′ UTR of the Mcl-1 (Figure 3B). [score:3]
The oligonucleotides mentioned are shown in Table 1. The miR-302b expressing plasmid, Mcl-1 siRNA and DPYD siRNA were respectively transiently transfected into the HepG2/SMMC-7721 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), 24 h after seeding. [score:3]
The results showed that overexpression of miR-302b sensitizes the HCC cell lines to apoptosis induced by 5-FU (Figure 2E). [score:3]
Mutations in the seed region of miR-302b were respectively generated in the 3′ UTR of Mcl-1 and in the CDS of DPYD, as indicated by underline. [score:2]
MiR-302b Targets Mcl-1 and DPYD. [score:2]
To verify the directly repressive effect of miR-302b on Mcl-1 and DPYD genes, these two gene sequences corresponding to miR-302b -binding sites were inserted downstream of the luciferase reporter gene. [score:2]
Mcl-1 siRNA or DPYD siRNA transfection also significantly reduced the cell proliferation of HepG2/SMMC-7721 cells treated with 5-FU over 3.2 μM (Figure 4G), which is consistent with the results of miR-302b transfection. [score:1]
The HepG2 /SMMC-7721 cells were transfected with miR-302b and miR-ctrl vector in 12-well plates. [score:1]
In addition, we also found that the reporters carrying mutant Mcl-1 gene or mutant DPYD gene were not responsive to the miR-302b (Figure 3B,E). [score:1]
We also mutated these two miR-302b -binding sites and cloned them into the luciferase reporter plasmid, respectively. [score:1]
Bio-information analysis showed that 5-FU resistance -associated genes Mcl-1 and DPYD both have the miR-302b -binding sites in their mRNAs. [score:1]
We further explored the role played by miR-302b in cell apoptosis, and found that the miR-302b transfected cells showed no significant difference in apoptosis (Figure 1D). [score:1]
Koga C. Kobayashi S. Nagano H. Tomimaru Y. Hama N. Wada H. Kawamoto K. Eguchi H. Konno M. Ishii H. Reprogramming using microRNA-302 improves drug sensitivity in hepatocellular carcinoma cells Ann. [score:1]
Name Sequence 5′–3′ Pre-miR-302b-F AATTCGCTCCCTTCAACTTTAACATGGAAGTGCTTTCTGTGACTTTAAAAGTAAGTGCTTCCATGTTTTAGTAGGAGTA Pre-miR-302b-R AGCTTACTCCTACTAAAACATGGAAGCACTTACTTTTAAAGTCACAGAAAGCACTTCCATGTTAAAGTTGAAGGGAGCG Mcl-1-UTR-F TCGAGGTATCTCTAAGGACCTAAAAGCACTTTATGG Mcl-1-UTR-R TCGACCATAAAGTGCTTTTAGGTCCTTAGAGATACC Mcl-1-UTR-MF TCGAGGTATCTCTAAGGACCTAAAAGCTGTTATGG Mcl-1-UTR-MR TCGACCATAACAGCTTTTAGGTCCTTAGAGATACC DPYD-CDS-F TCGAGTGAATGAAATGACTCTTAGCACTTTG DPYD-CDS-R TCGACAAAGTGCTAAGAGTCATTTCATTCAC DPYD-CDS-MF TCGAGTGAATGAAATGACTCTTAGCCGCCTG DPYD-CDS-MR TCGACAGGCGGCTAAGAGTCATTTCATTCAC miR-302b-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTACTA miR-302b-F TGCTTAAGTGCTTCCATGTT miR-302b-R ATCCAGTGCGTGTCGTG β-actin-F CCAACCGCGAGAAGATGA β-actin-R CCAGAGGCGTACAGGGATAG Mcl-1L-F GGAGGAGGAGGACGAGTTGTA Mcl-1L-R TGATGTCCAGTTTCCGAAGCA Mcl-1S-F GAGACGGCCTTCCAAGGAT Mcl-1S-R AGGTTGCTAGGGTGCAACTCT DPYD-F GAACTTGCCAAGAAGTCTGAGG DPYD-R ATGCCATGTGGACATGATAAAT U6-RT AACGCTTCACGAATTTGCGT U6-F CTCGCTTCGGCAGCACA U6-R AACGCTTCACGAATTTGCGT si-Mcl-1-F GGACUUUUAGAUUUAGUGAUU si-Mcl-1-R UCACUAAAUCUAAAAGUCCUU si-DPYD-F UAUUGUAACUGCACAUAAUGCUAGCUU si-DPYD-R GCUAGCAUUAUGUGCAGUUACAAUAUU SMMC-7721/HepG2 cells were seeded into 96-well plates at a density of 4 × 10 [3] cells/well for 24 h before transfection. [score:1]
The sequence of miR-302b plasmid has been shown above, and siRNA sequences are shown in Table 1. About 60 transfected HepG2/SMMC-7721 cells were seeded per well onto 6-well plates. [score:1]
After bioinformatics analysis, we chemically synthesized the sequences of Mcl-1 and DPYD genes’ counterparts of miR-302b -binding sites and these two genes’ mutant DNA fragments. [score:1]
Transfection of miR-302b Sensitizes the HCC Cell Lines to Apoptosis Induced by 5-FU. [score:1]
They were then transfected with miR-ctrl plasmid, miR-302b plasmid, Mcl-1 or DPYD siRNA and treated in 5-FU at a gradient concentration of 0, 0.2, 0.4, 0.8, 1.6, 3.2 μM and the other gradient concentration of 0, 0.2.5, 5, 10, 20, 40 μM. [score:1]
The sequences of pre-miR-302b were synthesized from the Sangon Biotech (Shanghai, China). [score:1]
The Pre-miR-302b was chemically synthesized and cloned into pcDNA™6.2-GW/EmGFP-miR Vector harboring EGFP gene and pcDNA™6.2-GW/miR Vector without EGFP gene between the EcoRI and HindIII sites. [score:1]
The above results maybe suggested that DPYD gene could play a somehow more important role in 5-FU resistance and, together with Mcl-1 gene, partly clarified the mechanism of miR-302b enhancing the sensitivity of HepG2/SMMC-7721 cells to 5-FU. [score:1]
The miR-302b lies in the miR-302-367 cluster, where else includes miR-302c, miR-302a, miR-302d and miR-367 [19]. [score:1]
PmirGLO, PmirGLO-Mcl-1-3′UTR-wt, pmirGLO-Mcl-1-3′UTR-mut, PmirGLO-DPYD-3′UTR-wt and PmirGLO-DPYD-3′UTR-mut vectors were respectively co -transfected with miR-302b vector into 293 cells in a 96-well plate using lipofectamine 2000 (Invitrogen). [score:1]
In conclusion, we have shown that miR-302b can enhance 5-FU chemotherapy sensitivity in liver cancer cells. [score:1]
To determine whether miR-302b -induced cell growth suppression was associated with cell-cycle block, we performed the FACS to measure the cell-cycle phase distribution. [score:1]
[1 to 20 of 48 sentences]
9
[+] score: 146
Reprogramming via miR-302/367 might involve different pathways such as targeting several epigenetic factors that result in global demethylation of the genome, inhibition of Oct4 suppressor factors, and enhancement of pluripotency markers [28, 30– 33]. [score:7]
0127878.g001 Fig 1 Transduction and continuous expression of vectors were confirmed by injecting a GFP expressing empty lentiviral vector and lentiviral particle that included the miR-302/367+GFP cluster. [score:5]
Transduction and continuous expression of vectors were confirmed by injecting a GFP expressing empty lentiviral vector and lentiviral particle that included the miR-302/367+GFP cluster. [score:5]
miR-302/367 expressing lentiviral particles were injected into the mice striata to induce transdifferentiation of targeted cells into neuroblasts. [score:5]
The same pattern of GFP expression was detected when miR-302/367-GFP expressing lentiviral vectors were used. [score:5]
Regulation of somatic cell reprogramming through inducible mir-302 expression. [score:4]
The miR-302/367 cluster is involved in early embryonic development and expressed in NSCs. [score:4]
A regulatory circuitry comprised of miR-302 and the transcription factors OCT4 and NR2F2 regulates human embryonic stem cell differentiation. [score:3]
A few GFP [+]/NeuN [+] cells were detected within the brains of mice that received control vector+VPA (average cell count: day 7, 0.5; day 14, 8) or miR-302/367 expressing vector (average cell count: day7, 5; day 14, 6) (Fig 4A). [score:3]
The pluripotency genes, Oct4, Sox2 and Nanog increase the expression of miR-302/367 via binding to its promoter. [score:3]
In vitro reprogramming of human astrocytes into neuroblasts was determined by transfection of astrocytes with viral particles that expressed miR-302/367. [score:3]
0127878.g005 Fig 5 (A) Expressions of Oct4 and Nanog genes as pluripotent markers were not detected following miR-302/367+ valproic acid (VPA) treatment. [score:3]
Groups 5 and 6 received focal injections of viral particles that expressed the miR-302/367+GFP cluster and VPA injections as mentioned for groups 1 and 2. For astrocyte transplantation, 300,000 human astrocytes were concentrated in 3 μl of DMEM and transplanted into the mouse striatum two days after transfection. [score:3]
In order to prove in vivo conversion of astrocytes to neuronal cells, we transfected human cultured astrocytes with miR-302/367-GFP expressing viral particles which were subsequently transplanted into the striatum (Fig 6A). [score:3]
Human astrocytes were transduced with the miR-302/367+GFP expressing vector in vitro and then transplanted into mice striata. [score:3]
However, the combination of miR-302/367 and VPA resulted co -expression of DCX [+]/GFP [+] cells at both 7 and 14 dpi (Fig 3) which implied conversion of astrocytes into neuroblasts. [score:3]
0127878.g004 Fig 4 (A) received miR-302/367+GFP expressing vectors. [score:3]
Following in vitro neuronal induction of astrocytes by using the miR-302/367 cluster, some neuroblasts and neurons were detected that did not express GFP. [score:3]
which received both VPA and miR-302/367 expressing vector had higher numbers of GFP [+]/NeuN [+] cells especially at day 14 (average cell number: 39.33) (Fig 4). [score:3]
Morrisey et al. showed that the miR-302/367 cluster alone was enough to reprogram human fibroblasts to iPSCs, while the presence of valproic acid (VPA) as a histone deacetylase inhibitor was necessary for conversion of mouse fibroblasts to iPSCs by the miR-302/367 cluster. [score:3]
Interestingly, in a positive feedback loop miRNA-302/367 enhances the expression of the above mentioned reprogramming factors. [score:3]
Groups 5 and 6 received focal injections of viral particles that expressed the miR-302/367+GFP cluster and VPA injections as mentioned for groups 1 and 2. For astrocyte transplantation, 300,000 human astrocytes were concentrated in 3 μl of DMEM and transplanted into the mouse striatum two days after transfection. [score:3]
At six weeks after transfection of astrocytes with the miR-302/367 cluster, we checked for the expressions of markers of differentiated neurons. [score:3]
We used hematoxylin and eosin staining to assess the possibility of teratoma formation following local injection of the miR-302/367 cluster expressing lentiviral particles. [score:3]
At 24 hours after seeding, astrocytes were infected with GFP or miR-302/367-GFP expressing lentiviral particles and allowed to incubate overnight. [score:3]
The number of GFP [+] cells which expressed NeuN significantly increased in animals treated with the miR-302/367 cluster and VPA, especially at day 14. [score:3]
More than 80% of astrocytes became transduced with miR-302/367 and expressed GFP (Fig 6B). [score:3]
0127878.g007 Fig 7 (A) Human induced neurons expressed neuroblast marker [doublecortin (DCX)] and neuronal markers (TUJ1 and NeuN) at 8 and 10 days post in vitro (DPI) when they received the miR-302/367 cluster. [score:3]
We prepared the miR-302/367 cluster as lentiviral particles which included a GFP expressing sequence (System Biosciences, San Francisco, CA) by transfecting along with a Virapower Lentiviral Packaging Mix (Invitrogen) into 293T cells by the Lipofectamine 2000 Transfection Reagent (Invitrogen). [score:3]
Groups 3 and 4 received focal injection of viral particles that expressed the miR-302/367+GFP cluster. [score:3]
Administration of GFP and miR-302/367 expressing lentiviral particles into the striatum and the distribution of transduced cells. [score:3]
Following in vivo application of miR-302 we checked for the expression of pluripotency markers Oct4 and Nanog and did not detect positive cells. [score:3]
The administration of empty vector (GFP expressing vector) and/or miR-302/367 cluster vector did not cause the conversion of transfected (green) cells into neuroblasts during 2 weeks (Fig 3). [score:3]
The miR-302/367 cluster has been frequently reported as one of the highly expressed microRNAs in pluripotent stem cells [25– 29]. [score:3]
These induced neuroblasts could potentially generate neuronal cells; thus miR-302/367 might be considered a new tool for conversion of glial scar astrocytes to endogenous neuroblasts in repairing lesions for different neurological diseases. [score:2]
miR-302/376 induced neurons might be the result of pluripotent reprogramming of glial cells towards iPSCs and their subsequent differentiation to neuronal cells, or the result of direct conversion of astrocytes into neuroblasts. [score:2]
These results show that neuroblasts can be generated directly from adult human and mouse astrocytes by miR-302/367 -driven induction. [score:2]
Here we have shown that adult human astrocytes could be reprogrammed to neuroblasts by miR-302/367, both in vivo and in vitro. [score:1]
In vivo conversion of engrafted human astrocytes to neuroblasts by miR-302/367. [score:1]
Doublecortin (DCX [+]) cells were detected at 7 and 14 days post-injection (dpi) in animals pre -treated with VPA that afterwards received miR-302/367. [score:1]
Considering the previous reports on the effectiveness of Oct4, Sox2 and Nanog in inducing astrocytes into neurons, this positive loop may explain a possible mechanism for miRNA-302/367 induced neuronal fate from astrocytes [27, 28, 35]. [score:1]
Human astrocytes were converted into neurons by the miR-302/367 cluster in vitro, without pre-treatment with valproic acid (VPA). [score:1]
Here, we have shown high conversion of astrocytes to neuroblasts by miR-302/367 administered in conjunction with VPA. [score:1]
These data showed the neuronal differentiation of cells induced by miR302/367+VPA. [score:1]
Nine days after transduction of astrocytes with miR-302/376, immunofluorescence staining was performed to determine the fate of the engrafted cells. [score:1]
both miR302/367 and empty vector+VPA groups at day 14). [score:1]
Scale bar: 50 μm We showed that application of the miR-302/367 resulted in reprograming of adult mouse human astrocytes into neuroblasts both in vivo and in vitro. [score:1]
This data showed the conversion of induced human astrocytes to neuronal cells by miR302/367 alone. [score:1]
According to Fig 5A, we could not detected any Oct4 and Nanog positive cells in the sections obtained from mice treated with both the miR-302/367 cluster and VPA. [score:1]
0127878.g003 Fig 3Doublecortin (DCX [+]) cells were detected at 7 and 14 days post-injection (dpi) in animals pre -treated with VPA that afterwards received miR-302/367. [score:1]
Following focal administration of the miR-302/367 cluster into the striatum, we studied the fate of transfected cells by specific staining against doublecortin (DCX) as a neuroblast marker. [score:1]
Two months after miR-302/367 injections, the animals were perfused with PBS and paraformaldehyde, respectively and the sections were counterstained with hematoxylin and eosin. [score:1]
Although the astrocytes were the major transfected cells after in vivo injection of viral particles, other cell types might also receive miR-302/367 and undergo reprogramming. [score:1]
In vitro conversion of astrocytes to neuron-like cells by miR-302/367. [score:1]
In addition, we showed that human astrocytes could reprogram into neurons by the miR-302/367 cluster alone in neuronal differentiation medium. [score:1]
A number of cells transduced with the miR-302/367+GFP cluster following valproic acid (VPA) pre-treatment showed neuronal fate as determined by immunostaining against NeuN. [score:1]
Cells were prepared for electrophysiological recording at six weeks after transfection with the miR-302/367 cluster. [score:1]
We observed DCX, TUJ1 and NeuN positive cells in the miR-302/367+GFP treated cultures which implied conversion of astrocytes into neuroblasts and neuronal cells. [score:1]
miR-302/367 and valproic acid (VPA) converted the transducted cells into neuroblasts. [score:1]
Human astrocytes transduced with miR-302/367 produced neuroblasts in vitro as well as in vivo when engrafted into the adult mouse brain. [score:1]
Two months after injection of viral particles that expressed miR-302/367 and VPA, the striata areas were investigated for teratoma formation. [score:1]
[1 to 20 of 61 sentences]
10
[+] score: 74
Taken together, miR-302/367 expression induces global demethylation and suppresses NR2F2, two events that indirectly activate Oct4 expression, which in turn elevates miR-302/367 levels. [score:8]
The use of a miRNA expression vector, such as the intronic miRNA expression system, provides a simple and safe way to generate iPSCs due to the fact that no oncogene is required for successful reprogramming and, in the case of miR-302/367, only a single transcript is transfected rather than the simultaneous transfection of multiple genes, whose expression would be difficult to consistently maintain in iPSCs. [score:7]
Among the highly expressed ESC-specific miRNAs, miR-302/367 is highly expressed in early embryonic development and then rapidly declines after differentiation [12, 13]. [score:6]
This, in combination with the observation of high miR-302/367 expression in the early embryo followed by a rapid decrease upon differentiation, strongly suggests that miR-302/367 serves as upstream pluripotency regulator to modulate the expression of Oct4, Sox2, Nanog, and other embryonic transcription factors. [score:6]
A recent study has reported that a combination of miR-302b and miR-372 downregulates TGFBR2 and RHOC gene expression [19]. [score:6]
Given that miRNA can target several to hundreds of genes, the inhibition of multiple factors and pathways likely initiates miR-302/367 reprogramming. [score:5]
In hESCs, NR2F2 expression begins with differentiation and conversely correlates with the expression of Oct4 and miR-302/367. [score:5]
miR-302/367 also directly targets NR2F2, a member of the nuclear orphan receptor family of transcriptional factors and a negative regulator of Oct4 [25]. [score:5]
Studies from Lin and colleagues showed that overexpression of mir-302/367 (approximately 1.1- to 1.3-fold as compared with normal hESCs) leads to global demethylation and coexpression of Oct4, Sox-2, and Nanog in human iPSCs [20, 27]. [score:4]
Also, miR-302/367 targets several cell cycle regulators. [score:4]
Studies have also shown that Oct4, Nanog, and Sox2 bind to the promoter regions of miR-302/367 and increase its expression level [26]. [score:3]
miR-302/367 targets multiple epigenetic factors, leading to global demethylation. [score:3]
A similar study using RUES2 cells confirmed that transfection with miR-302 elevates Oct4 and Nanog expression [14]. [score:3]
We found that the miR-302 may also target TGFBR2 and RHOC, supporting the possibility that miR-302/367 has the same effect on MET as miR-302b/327. [score:3]
This reciprocal cycle increases cellular levels of miR-302/367 and Oct4, which leads to the co-activation of other transcription regulators, such as Sox2 and Nanog. [score:2]
Based on evidence of the successful establishment of iPSC lines using a miRNA -mediated strategy, it seems that ESC-specific miRNA, especially the miRNA-302/367 family, can induce reprogramming events similar to those of Yamanaka factors. [score:1]
Moreover, instead of the miR-302 family alone, it has been argued that successful reprogramming by mature miRNAs always requires the combination of miR-302 s, miR-200c, and miR-369, while several miRNA -mediated iPSC lines have been generated with only miR-302 or miR-302/367 [20, 22]. [score:1]
Numerous miRNA -mediated iPSC lines have been subsequently developed with either miR-302/367 or a combination of miR-302 and other miRNAs from mouse fibroblast, human dermal fibroblast, and human skin cancer cells [21, 22]. [score:1]
2. Proposed Mechanism of miR-302/367-Mediated Reprogramming. [score:1]
[1 to 20 of 19 sentences]
11
[+] score: 72
Lin et al. (2011) reported that miR-302 targeted cosuppression of four “epigenetic” regulators, lysine demethylase KDM1 (also known as LSD1/AOF2), AOF1, p66/MECP1, and MECP2 [57]. [score:6]
Lin et al. reported that maintaining slowly proliferating adhesive stem cells will require inhibition of cell cycle by miR-302/367 that targets cyclin D1 and cyclin -dependent kinases 2/4/6 (Cdk2, Cdk4 and Cdk6) [55]. [score:5]
Lipchina et al. reported that miR-302/367 cluster promotes BMP signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1 [59] (Figure 1). [score:5]
Liao et al. reported that the miR-302/367 cluster enhanced somatic cell reprogramming (SCR) by accelerating an MET through targeting TGF β type II receptor (TGFbR2) and increased E-cadherin expression [58]. [score:5]
The first report of targets of miR-302 in ES and iPS cells was regarding cell cycle regulators. [score:4]
This group confirmed that the presence of a signature group of miRNAs that is upregulated in both iPS and hES cells, such as the miR-302/367 and miR-17/92 clusters. [score:4]
This group showed that defined hES cells-enriched miRNA groups (miR-302, miR-17, miR-515 families, and the miR-371-373 cluster) were downregulated “rapidly” in response to differentiation. [score:4]
Card et al. showed that Oct4/Sox2-regulated miR-302 targeted mRNA encoding cyclin D1 in hES cells [54] (Figure 1). [score:4]
Li et al. reported that not only miR-302 but also miR-93 targets mRNA encoding TGFbR2 to enhance generation of iPS cells [60]. [score:3]
The miR-302 -transfected cells expressed key ES cell markers such as Oct3/4, SSEA-3/4, Sox2, and Nanog but also had a highly demethylated genome similar to a reprogrammed zygotic genome. [score:3]
Targeting TGF β signaling by miR-302 may reprogram cells toward generation of iPS and mirPS cells through induction of mesenchymal-epithelial transition (MET), the acquisition of intercellular adhesion. [score:3]
This group firstly reported that the miR-302 family members (miR-302s) were expressed most abundantly in slowly growing human ES cells and “quickly” decreased after cell differentiation and proliferation. [score:3]
Later miRNA profiling studies reproduced that miR-302 was essentially expressed specifically in ES and iPS cells and lost upon differentiation and proliferation. [score:3]
One arising question was what factors were targeted by miR-302. [score:3]
Thereafter, Barroso- del Jesus et al. (2009) released perspectives regarding the miR-302/367 cluster as a potential stemness regulator in ES cells [51]. [score:2]
This work showed an extremely higher efficiency of ES cell-like colony formation with ES cell-like morphology and expression of markers using miR-302/367 cluster compared to OSKM-iPS. [score:2]
MicroRNA-302/367 Cluster Targets Multiple Factors Involving Epithelial-Mesenchymal and G1-S Transitions. [score:2]
This work explained how the miR-302 overcame the G1-S arrest at the G1-S transition. [score:1]
Lin et al. reported that miR-302 reprogrammed human skin cancer cells into a pluripotent ESC-like state [50]. [score:1]
These works using miR-302/367 showed that blocking mesenchymal TGF β signaling and maintenance of BMP signaling were required for generation and maintenance of iPS cells. [score:1]
Thus, CCN2/CTGF may be useful as a growth factor supporting cellular reprogramming through induction of miR-302. [score:1]
Poleganov et al. reported that human fibroblasts and “blood-derived endothelial progenitor” cells were efficiently reprogrammed by transduction of nonmodified miR-302/367 cluster in a single vector leading to immune evasion [62]. [score:1]
This group used a combination of miR-200c plus miR-302 s and miR-369 s family of miRNAs without using OSKM factors. [score:1]
Sequencing of RNA transcripts revealed that a pre-miRNA cluster encoded five miRNAs including miR-302a, -302b, -302c, -302d (miR-302s), and miR-367, termed miR-302/367 cluster. [score:1]
So far, established markers of ES and iPS cells are SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, Oct-4 (Pou5f1), Nanog, Sox2, Klf4, MycN, Lin28, Cripto, Fbx15, Dnmt3b, Fgf4, Gdf3, Rex1, miR-200c, miR-302 family, miR-369-3p, and miR-369-5p. [score:1]
Anokye-Danso et al. reported miRNA-302/367 -mediated reprogramming of mouse and human somatic cells to pluripotency [61]. [score:1]
Combination of miR-200c Plus miR-302 s and miR-369 s Family. [score:1]
In this study, the number of colonies with ES cell-like morphology per 100,000 cells was 10396 cells using miR-302/367 and only 3 with OSKM in this work. [score:1]
[1 to 20 of 28 sentences]
12
[+] score: 71
To infer the function of these miRNAs, we predicted 2,436 targets for the miR-302 cluster and 4,691 targets for the miR-520 cluster by querying the public database miRNAMap 2.0, and 2,284 target genes were shared by both clusters suggesting functional similarity. [score:7]
miRNAs expressed at high levels in hES cells and downregulated during differentiation or in adult cells included the well-known miR-302 family, miR-200 family, and miR-372. [score:6]
Among the hES signature miRNAs, the miR-520 cluster shared a similar expression pattern and seed sequence as the well known miR-302 family and targeted the same genes as the miR-302 family. [score:5]
The upregulation of miR-302 cluster and miR-520 cluster in hES cells suggests their ability to modulate local chromatin states which is necessary for stem cell pluripotency [58, 59]. [score:4]
Among the miRNAs upregulated in hES cells, we observed 7 miRNAs were located in the miR-302 cluster and 21 miRNAs were located in miR-520 cluster. [score:4]
In addition, we identified 12 other hES upregulated miRNAs in this cluster: miR-302a, miR-302b, miR-302c, miR-302d, miR-519b, miR-519c, miR-520a, miR-520b, miR-520c, miR-520d, miR-520e which share a consensus seed sequence: AAGUGC [24]. [score:4]
In addition, we identified 21 hES upregulated miRNAs that were co-localized in a cluster on chromosome 19, the miR-520 cluster, many of which shared consensus seed sequence with miR-302 family and which can be used as candidate biomarkers for pluripotency (Additional file 1). [score:4]
Expression of levels of miR-200c, miR-302b, miR-302c, miR-367, miR-519b, and miR-520b were the greatest in hES cells (panel A). [score:3]
The 20 miRNAs most highly expressed in hES cells, EB, and adult cells respectively were shown in additional file 1. MiR-302a, miR-302b, miR-302c, miR-302d, miR-367, and miR-200c were increased in hES and have previously been reported to be hES-specific [16, 17]. [score:3]
Especially, members of the miR-302 cluster on chromosome 4 and miR-520 cluster on chromosome 19 were highly expressed in undifferentiated hES cells. [score:3]
The difference in the expression of miR-200c, miR-302b, and miR-367 between hES cells and EB, and between hES cells and adult cells was significant (P < 0.05). [score:3]
To visualize the functions of these miRNA targeted genes, a binary (red indicate participate in the functional category and green indicate not) heatmap was used to indicate functional commonality among all miRNAs in miR-302 and miR-520 clusters. [score:3]
Gene Ontology (GO) enrichment analysis confirmed that the inferred functions of miRNAs within the miR-302 and miR-520 clusters were overlapping based on their involvement in cell growth, negative regulation of cellular metabolic process, negative regulation of transcription, and small GTPase mediated signal transduction. [score:3]
Along with the reports of miR-302 family on chromosome 4 [16, 17, 19, 25, 26], several groups have reported the expression of members of miR-520 cluster on chromosome 19 in hES cells [24, 26, 29]. [score:3]
The miR-302 cluster and miR-520 cluster target large groups of genes which share overlapping functions based on Gene Ontology (GO) analysis. [score:3]
From our data, the expression of miR-302a, miR-302b, miR-302c, miR-302d and miR-367, which are co-located in a cluster on chromosome 4 were highly correlated (R [2 ]= 0.78–0.98). [score:3]
Using qRT-PCR we found that the expression levels of miR-302b, miR-302c, miR-367, miR-200c, miR-519b, and miR-520b were much higher in hES cells than in either EB or adult cells (Figure 6, panel A). [score:3]
Signature miRNAs, such as the miR-302 family, the miR-200 family have been reported in human [16, 17] and mouse embryonic stem cells [18- 20]. [score:1]
Figure 8 Sequence and GO analysis of the miR-302 cluster and miR-520 cluster. [score:1]
The members of the miR-302 and miR-520 clusters had similar sequences; they shared a consensus seed sequence: AAGUGC (panel A, seed sequence is highlighted by the purple rectangle). [score:1]
MiR-520b, miR-302b, miR-302c, miR-302d, miR-519c, miR-520a and miR-302a were clustered closely base on the 48 GO terms analyzed. [score:1]
In particular, miR-302a, miR-302b, miR-302c, miR-302d, miR-519b, miR-519c, miR-520a, miR-520b, miR-520c, miR-520d, and miR-520e had a consensus seed sequence: AAGUGC (Figure 8, panel A). [score:1]
At the Gene Ontology level, miR-520b, miR-302b, miR-302c, miR-302d, miR-519c, miR-520a, and miR-302a formed a cluster (significant GO terms shown as red), and they shared GO terms related to chromatin structure modifications (Panel B). [score:1]
Functional comparison of miR-302 cluster and miR-520 cluster. [score:1]
[1 to 20 of 24 sentences]
13
[+] score: 67
As both the miR-371–373 and miR-302/367 microRNA clusters are ESC-specific pluripotency markers (Suh et al., 2004; Thomson et al., 2006; Lakshmipathy et al., 2007; Barroso- del Jesus et al., 2008; Laurent, 2008), the co-ordinate expression of microRNAs from these clusters in malignant GCTs either represents the persistence of an embryonic pattern of microRNA expression that is not present in normal, somatically differentiated tissues, or acquired re -expression, regulated by an as yet undetermined mechanism(s) (Palmer et al., 2010). [score:8]
This analysis showed that the identical seed region shared by microRNAs from the over-expressed miR-371–373 and miR-302/367 clusters resulted in a global down-regulation of target mRNAs in malignant GCTs and was therefore of functional significance (Palmer et al., 2010). [score:8]
As for miR-371–373 and miR-302/367 over -expression, let-7 under -expression in malignant GCTs was universal, occurring regardless of patient age, histological subtype or site of disease, thereby extending published reports describing predominantly or exclusively tumours from adult patients (Cao et al., 2011a, b; Gillis et al., 2011; Xue et al., 2011). [score:7]
In summary, miR-371–373 and miR-302/267 cluster over -expression occurs in all malignant GCTs, regardless of patient age, histological subtype and anatomical site of disease (Palmer et al., 2010). [score:5]
In particular, further over -expression of the miR-302/367 cluster was observed in YSTs compared with seminomas, which resulted in the down-regulation of cancer -associated protein-coding genes (Murray et al., 2010). [score:5]
Furthermore, in another study the relative miR-302/367 over -expression in YSTs was associated with increased bone morphogenetic protein (BMP) signalling activity in YSTs (compared with seminomas), presumably via multiple predicted mRNA targets in the transforming growth factor –beta/BMP pathway (Fustino et al., 2011). [score:4]
Figure 2Differential expression of the miR-371–373 and miR-302/367 clusters in malignant germ cell tumours (GCTs) [adapted from (Palmer et al., 2010)]. [score:3]
In contrast, all malignant GCTs over-express the miR-371–373 and miR-302/367 clusters regardless of patient age, histological subtype or anatomical tumour site. [score:3]
control samples were identified, in addition to the key over-expressed miR-371–373 and miR-302/367 clusters (Palmer et al., 2010). [score:3]
However, the most significant finding was that the miR-371–373 and miR-302/367 clusters were over-expressed in all malignant GCTs, independent of patient age (paediatric or adult), tumour histological subtype (YST, seminoma or EC) or anatomical site (gonadal or extragonadal) (Palmer et al., 2010). [score:3]
In addition to the universal miR-371–373 and miR-302/367 over -expression findings, each subtype of malignant GCT was additionally characterized by specific abnormalities of microRNA expression (Palmer et al., 2010). [score:3]
As miR-302/367 expression is lost in cells and tissues showing somatic differentiation (Suh et al., 2004; Barroso- del Jesus et al., 2008), it is likely that levels peak during early extraembryonic differentiation. [score:3]
Importantly for potential clinical use as highly sensitive and specific universal biomarkers of malignant GCTs, the expression levels of the eight main microRNA members from the miR-371–373 and miR-302/367 clusters accurately segregated malignant GCTs from the non-malignant group, comprising fetal and gonadal control samples and benign teratomas (Fig. 2) (Palmer et al., 2010). [score:3]
The first report of serum microRNA expression in malignant GCTs contained a detailed multiplexed qRT-PCR methodology and demonstrated elevated serum levels of all eight main members of the miR-371–373 and miR-302/367 clusters in the serum of a paediatric patient compared with pooled normal serum (Murray et al., 2011). [score:2]
If so, dynamic changes in miR-302/367 levels in normal embryonic development (Stadler et al., 2010) would be mirrored in GCTs showing equivalent differentiation states (Murray et al., 2010). [score:2]
Figure 3MicroRNAs from the miR-371–373 and miR-302/367 clusters as novel serum biomarkers of malignant germ cell tumours (GCTs) [adapted from (Murray & Coleman, 2012)]. [score:1]
Thus, microRNAs of the miR-371–373 and miR-302/367 clusters are emerging as promising bodyfluid biomarkers to improve clinical management of malignant GCTs. [score:1]
Of note, the miR-371–373 cluster is involved in maintaining the pluripotent state in ESCs and germline stem cells, whereas miR-302/367 members are induced during the first stages of differentiation (Zovoilis et al., 2008). [score:1]
Levels of miR-372 from the miR-371–373 cluster (left) and miR-367 from the miR-302/367 cluster (right) in the serum at the time of diagnosis in eight malignant GCTs of different patient age, anatomical site and histological subtype. [score:1]
Hierarchical clustering analysis based on the eight main microRNAs from the miR-371–373 and miR-302/367 clusters (rows) segregates (A) paediatric and (B) adult malignant GCT samples from non-malignant controls (comprising benign teratomas and normal gonadal controls) (columns). [score:1]
[1 to 20 of 20 sentences]
14
[+] score: 59
Because the expression levels of the miR-302 cluster must be precisely regulated, we used different promoters to exogenously express the miR-302 cluster and screened for optimal expression (Additional file 1: Figure S1a, S1b). [score:8]
Therefore, miR-302 s have a positive impact on somatic cell reprogramming, but in some pathways these family members can inhibit reprogramming by indirectly activating targets that inhibit reprogramming. [score:8]
Furthermore, miR-302 family members target the oncogene Bmi1 and suppress tumorigenesis, which can inhibit somatic cell reprogramming [15, 16, 25]. [score:7]
Furthermore, the miR-302 family activates Ink4a and Arf to suppress the tumorigenesis of human pluripotency stem cells by targeting the oncogene Bmi1 [25], and Arf/ p53 pathway activation suppresses somatic cell reprogramming [15, 16]. [score:7]
Therefore, miR-302 s are typically important factors that promote somatic cell reprogramming, but targeted factors that inhibit reprogramming exist in some signal pathways. [score:5]
Lin SL Chang DC Ying SY Leu D Wu DT MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathwaysCancer Res. [score:5]
Lin SL Chang DC Lin CH Ying SY Leu D Wu DT Regulation of somatic cell reprogramming through inducible mir-302 expressionNucleic Acids Res. [score:4]
In the present study, we constructed a low-risk 6F/BM1-4C reprogramming system, in which we eliminated the tumorigenic factors used in traditional episomal reprogramming systems, such as c-Myc, SV40-LT, and p53 inhibitor, and included Oct4, Glis1, Klf4, Sox2, L-Myc, the miR-302 cluster and four compounds, and then treated cells for no longer than 48 h to efficiently generate iPSCs from hUCs. [score:3]
The miR-302 family, which is specifically expressed in embryonic stem cells (ESCs), can partially or completely replace reprogramming factors and increase reprogramming efficiency [14, 23, 24]. [score:3]
As revealed by AP staining, the combination termed 6F, which includes Oct4, Glis1, Klf4, Sox2, L-Myc, and the miR-302 cluster initially expressed from the CMV promoter (Fig.   1c, d), showed the highest reprogramming efficiency at 19 days post nucleofection. [score:3]
This system includes six low-risk factors (6F), Oct4, Glis1, Klf4, Sox2, L-Myc, and the miR-302 cluster. [score:1]
To induce reprogramming in this study, we employed low-risk factors, including L-Myc, Glis1, lincRNA-ROR, and the miR-302 cluster, and randomly combined them with Oct4, Sox2, and Klf4 in the Epstein–Barr virus-encoded nuclear antigen-1 (EBNA)-oriP episomal vector (Additional file 1: Figure S1a, S1b, S1c). [score:1]
The miR-302 family can increase reprogramming efficiency by replacing reprogramming factors [14, 23, 24]. [score:1]
In this study, we applied hUCs as donor cells to induce iPSCs using low-risk factors, and then we screened a combination of low-risk reprogramming factors, including Oct4, Glis1, Klf4, Sox2, L-Myc, and the miR-302 cluster. [score:1]
The sequence of the miR-302 cluster was cloned from genomic DNA. [score:1]
Three groups of cells harboring the reprogramming factors Oct4, Glis1, Klf4, Sox2, L-Myc, lincRNA-ROR, and the miR-302 cluster with high AP -positive scores were selected for further analysis (Additional file 5: Figure S2c, S2d). [score:1]
[1 to 20 of 16 sentences]
15
[+] score: 59
miR-302b is downregulated in hepatocellular carcinoma cancer specimens and overexpression of miR-302b suppresses invasion and metastasis by directly targeting AKT2 followed by regulation of NF-κB and MMP-2 in human hepatocellular carcinoma cells [33]. [score:12]
By comprehensively analyzing the experimentally validated and all potential target genes of these 6 miRNAs, our study suggested miR-34a-5p, miR-34c-5p and miR-302b-3p seemed to be particularly important in inhibition of lung cancer metastasis by curcumin because their target genes (e. g. CCND1, WNT1, MYC and LEF1) were significantly enriched in metastasis related pathways (Wnt signaling pathway and Focal adhesion). [score:7]
Transfection of miR-302b exerts anti-proliferation and anti-migration effects on 95D cells, which was accompanied with significantly down-regulated expression of TGFβRII, phosphorylated ERK1/2 and MMP9 induced by TGF-β1 [34]. [score:6]
Further, 6 miRNAs (miR-302b-3p, miR-335-5p, miR-338-3p, miR-34c-5p, miR-29c-3p and miR-34a-35p) with more verified target genes and TFs than others in lung cancer review literatures were screened, suggesting these 6 miRNAs might play critical roles in the suppression of lung cancer metastasis by curcumin. [score:5]
miR-34a-5p, miR-34c-5p and miR-302b can regulate the target gene CCND1, Wnt family member 1 (WNT1) and MYC via the LEF1 transcription factor (Fig 3). [score:4]
Although growing evidence has indicated that upregulation of miR-302b may be an important mechanism during cancer treatments [36], whether the expression of miR-302b can be changed after curcumin seems not to be investigated. [score:4]
We first demonstrated miR-302b was significantly upregulated (FC = 3.34) when treatment with 10 μM curcumin, which also needs a further experiment confirmation. [score:4]
However, the inhibitory mechanism of miR-302b on cancer remains unclear and its regulation on transcription factor is rarely reported [35]. [score:4]
Therefore, we believe miR-34a-5p/miR-34c-5p/miR-302b-3p —LEF1—CCND1/WNT1/MYC axis may be a crucial mechanism in inhibition of lung cancer metastasis by curcumin. [score:3]
Similarly, miR-302b was found to be significantly lowly expressed in high-metastatic lung cancer cell line 95D than that in low metastatic cell line 95C. [score:3]
In this study, we first found miR-302b might be involved in lung cancer metastasis by regulating LEF1 followed by Wnt signaling related genes, which need a further experiment confirmation. [score:2]
Nevertheless, it is essential to further explore how miR-34c, miR-34a and miR-302b collectively to regulate LEF1 followed by Wnt signaling related genes in lung cancer [38]. [score:2]
However, other strategies [(such combination of curcumin and its target miRNAs (miR-34a and miR-302b) mimics)] to enhance the therapeutic effects are needed to be further investigated. [score:1]
miR-302b also seems to be a potential molecular marker for cancer invasion and metastasis [32]. [score:1]
Our present study provides some novel, underlying mechanisms of curcumin (miR-34a-5p/miR-34c-5p/miR-302b-3p— LEF1—CCND1/WNT1/MYC axis) on lung cancer metastasis. [score:1]
[1 to 20 of 15 sentences]
16
[+] score: 57
As shown in Figure 4I, expression of miR-302a, miR-302b, miR-302d and miR-367 was identified in p100−/− cells, and such ectopic expression led to a dramatically inhibition of cyclin d1 3′-UTR activity in p100−/− cells (Figure 4J). [score:7]
The previous studies show that miR-302 inhibits the proliferation of endometrial cells with inhibiting CDK1 and Cyclin D1 expression in MCF7 and HepG2 [42, 43]. [score:7]
Transfectants of miR-302/367 cluster construct in UMUC3(shp100) cells also expressed a high level of miR-302d (Figure 4K) and inhibited Cyclin D1 expression in both UNUC3 (shp100) and p100−/− cells (Figure 4L and 4M). [score:7]
To provide evidence demonstrating whether miR-302d, rather than miR-302a/miR-302b, direct binds to cyclin d1 mRNA 3′-UTR and inhibits Cyclin D1 protein translation, putative miR-302d binding site in cyclin d1 3′-UTR reporter was point mutated as indicated in Figure 4O. [score:6]
Our finding is supported by previous report that miR-302 expression suppresses Cyclin D1-CDK4/6 pathways [42]. [score:5]
The expression of these miRNAs were therefore determined in both p100+/+ and p100−/− cells, and the expression of miR-302a, miR-302b and miR-302d was found to be significantly decreased in p100−/− cells, whereas there was no observable difference on miR-17, miR-19a, miR-20a and miR-106b between p100+/+ and p100−/− cells (Figure 4E). [score:5]
The results also showed that ectopic p100 expression in p100−/− cells only restored miR-302d expression (Figure 4F), demonstrating that miR-302d, not miR-302a or miR-302b, was activated by p100. [score:5]
These results demonstrate that miR-302 inhibits cyclin d1 3′-UTR luciferase activity, Cyclin D1 protein expression and cell cycle progression. [score:5]
To determine potential role of miR-302d in the Cyclin D1 expression, a miR-302/367 cluster construct was transfected into p100−/− cells and UMUC3 (shp100) cells, respectively. [score:3]
Construct expressing miR-302/367 was obtained from Addgene (Cambridge, MA). [score:3]
The p100-stimulation of CREB phosphorylation in its activation of LARP7/miR-302 transcription was convincingly demonstrated by using CREB knockdown in p100−/−(p100) cells. [score:2]
Constitutive expression of miR302 in UMUC3(shp100) cells induced G [0]/G [1] growth arrest as compared with UMUC3 (shp100/Vector) cells (Figure 4N). [score:2]
[1 to 20 of 12 sentences]
17
[+] score: 54
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
Similarly, eight miR-302-like C19MC miRNAs were previously shown to promote cell proliferation and cell-cycle progression by targeting p21, an inhibitor of the G1/S transition, as for the miR-302 and -372 families [5, 6]. [score:5]
Echoing these findings, the miR-302-like C19MC are also predominantly 3p-biased, possibly targeting genes which are biologically significant in regulating the stemness of stem cells and the tumor phenotype in cancers. [score:4]
Hence, despite the presence of the AAGUGC seed sequence, it is more likely that the nts 2-7 canonical subgroup of the C19MC-AAGUGC-miRNAs may target genes that share similar functions as the miR-302/-372 miRNAs. [score:3]
MiR-302 -driven cellular reprogramming coordinates stem cell division by regulating targets in the cell cycle, particularly at the G1/S restriction point [5]. [score:3]
Consistent with the bioinformatics prediction, a literature review showed that a number of validated targets have indeed been reported to be shared between the miR-302/372 and the group I C19MC-AAGCGU-miRNA families (Table  3). [score:3]
Many of the expressed miRNAs share the “AAGUGC” seed sequence of the known reprogramming miR-302 miRNA family; these miRNAs are called the C19MC-AAGUGC-miRNAs in this work (see Fig.   2a and depiction below). [score:3]
However, the miR-520 and miR-302/372 families share a significant number of target genes (Fig.   3a) suggesting common biological functions. [score:3]
a Venn diagrams of predicted target genes of the miR-302/372 families and group I of the C19MC-AAGUGC-miRNAs. [score:3]
The group I miR-519 subfamily also shares 262 putative target genes with the miR-302/-372 families, far fewer than the miR-520 subfamily (Fig.   3a, red box). [score:3]
In particular, C19MC-AAGUGC-miRNAs with the nucleotides 2-7 canonical seed position as in miR-302/-372 miRNAs, may play similar roles as miR-302/-372 in induced pluripotency. [score:1]
The results showed that 1185 putative shared genes were obtained between the miR-520 and -302/372 families (Fig.   3a, blue box and Additional file 1: Table S1), suggesting that the miR-520 subfamily might share similar biological functions with the miR-302/372 family. [score:1]
Bioinformatics analysis showed that sixteen of the C19MC miRNAs share the same “AAGUGC” seed sequence with members of the miR-302/-372 family, which are known cellular reprogramming factors. [score:1]
Moreover, the identification of sixteen miR-302-like C19MC miRNAs predicts functions in promoting “stemness” as the miR-302 and miR-372 families. [score:1]
More specifically, a subgroup of sixteen C19MC miRNAs has been identified that shares the same AAGUGC seed sequence as the reprogramming miR-302/372 family, predicting contribution of the C19MC-AAGUGC-miRNAs to the reprograming process. [score:1]
Further elucidation of the biological functions of C19MC miRNAs, particular the miRNA-302-like subclass, may lead to potential applications in more efficient cellular reprogramming and in cancer therapy. [score:1]
On sequence alignment, sixteen C19MC miRNAs were found to share the same seed sequence, 5’-AAGUGC-3’, with the reported reprogramming-able miR-302 and miR-372 miRNA families [8, 9] (Fig.   2a). [score:1]
Possible biological functions of a subset of miR-302-like C19MC miRNAs, were further investigated by bioinformatics analysis, which predicted targeting at the apoptosis pathway in the tumorigenesis of cancer cells and induced pluripotency in stem cells. [score:1]
Furthermore, it is noted that the AAGUGC seed position at 5’ end is variable among the C19MC-AAGUGC-miRNAs: subgroup I miRNAs, which includes eight miR-519 and -520 subfamilies, have the seed sequence located at the canonical and optimal 5’-nucleotide positions (nts) 2-7, as in the miR-302/-372 families; the seed sequence of the four subgroup IIa miRNAs is at location nts 1-6, and that of the remaining subgroup IIb miRNAs is at nts 3-8 and 4-9 (Fig.   2a). [score:1]
a The sixteen C19MC miRNAs that share the AAGUGC hexameric seed sequence (in bold letters and boxed in red) with the miR-302 (in blue letters) and miR-372 (in green letters) families are shown. [score:1]
[1 to 20 of 21 sentences]
18
[+] score: 51
In this study, the members of the endogenous miR-302/372/373/520 family were found to suppress ZEB1 transcription factor in PC-3 cells and finally activate the expression of E-cadherin through a similar regulatory pathway induced by dsEcad640. [score:6]
However, when dsEcad215, dsEcad302, dsEcad640, or members of miR-302/372/373/520 family act on ZEB1 mRNA and suppress the expression of ZEB1, the transcriptional repression of E-cadherin is alleviated (lower panel). [score:5]
Thus, the members of the miR-302/372/373/520 miRNA family were revealed to be able to reduce the expression of ZEB1 by targeting its CDS. [score:5]
Increase of E-cadherin expression via suppression of the ZEB1 transcription factor by miR-302/372/373/520 family miRNAs. [score:5]
Our result might account for a pathway to gain pluripotency by linking the mirPS induction pathway by miR-302 and that to induce pluripotent state of FAB-SCs by E-cadherin upregulation. [score:4]
Microarray profiles of gene expression by the transfection of miR-302/372/373/520 family members and dsEcad640. [score:3]
Microarray analyses of gene expression profiles by the transfection of dsEcad640 and members of miR-302/372/373/520 family miRNAs. [score:3]
A noncoding RNA cluster containing mir-302b, mir-302c, mir-302a, and mir-367 are known to be expressed most abundantly in human ES cells, and quickly decrease after cell differentiation and proliferation [49]. [score:3]
The seed complementary sites in the ZEB1 CDS were found to be target sites of seed -dependent silencing by dsEcad215, dsEcad640, and miR-302/372/373/520 family members (Figure 4A). [score:3]
The mean expression levels of the transcripts that have common seed-complementary sequences, AGCACUU, to dsEcad640 and miR-302/372/373/520 miRNA family members in their 3′UTR were apparently reduced by the transfection with dsEcad640, miR-302a, miR-372, miR-373, and miR-520c duplexes (Figure S1). [score:3]
To assess the parallel genome-wide regulation by dsEcad640 and the members of miR-302/372/373/520 family, microarray analyses were performed using PC-3 cells transfected with each of the miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes, as well as with dsEcad640 at 24 hour. [score:2]
These results indicate that miR-302/372/373/520 family members and dsEcad640 show analogous genome-wide gene regulation due to the common seed sequence. [score:2]
The miR-302a duplex is composed of miR-302a and miR-302*; the miR-373 duplex, miR-373 and miR-373*; and the miR-520c duplex, miR-520c-5p and miR-520c-3p. [score:1]
Microarray profiles of transcripts containing common seed-complementary sequences of dsEcad640 and members of miR-302/372/373/520 family by the transfection of (A) dsEcad640, (B) miR-302a duplex, (C) miR-372 duplex, (D) miR-373 duplex, (E) miR-520c duplex, and (F) miR-520f duplex. [score:1]
These results suggest that members of the miR-302/372/373/520 miRNA family activate E-cadherin transcription via repression of ZEB1 transcriptional factor in an analogous fashion to dsEcad640. [score:1]
The transfection of the mir-302 cluster into human Colo and PC-3 cells has been shown to generate ES-like cells, known as miRNA -induced pluripotent stem (mirPS) cells [50]. [score:1]
Table S2 List of the increased and decreased genes that have common seed-complementary sequences to dsEcad640 and miR-302/372/373/520 miRNA family members. [score:1]
The seed sequence of dsEcad640 antisense strand (AAGUGCU) is same as those of the miR-302/372/373/520 miRNA family members, miR-302a, miR-372, miR-373, miR-520a-3p, and miR-520f, although the seed sequence of miR-520f is shifted by 1 nt to 1–7 nt from 2–8 nt (Figure 1B). [score:1]
The seed sequences of dsEcad640 sense strand, miR-302*, the opposite strand of miR-372, miR-373*, miR-520c-5p, and the opposite strand of miR-520f, are different (Figure 1B). [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 40
For example, mir-302 family was highly expressed in PSC but maintained an upregulated expression at the mesoderm stage, with a significant decrease thereafter. [score:8]
This latter observation suggests that despite the overlapping of gene targets, each microRNA from miR-302 cluster interacts with different affinities to their target RNAs. [score:5]
Additionally, we studied the correlation between the target affinity scores of the miR-302 cluster/family for their common targets (see above). [score:5]
mir-302 family members are highly expressed microRNAs in PSC. [score:3]
We chose the miR-302 family, miR-17/92 family and a group of microRNAs highly expressed in CM population. [score:3]
Moreover, the score correlation of predicted targets of the family miR-302 illustrates the synergistic effect that these microRNAs have. [score:3]
The most expressed microRNA family in PSC and MPC was miR-302, which also corresponds to a cluster we named Chr4.1 (first one found in Chormosome 4). [score:3]
For both miR-302 and mir-17-92a families many GO terms were related to developmental processes (see complete lists in Supplemental Files  11 and 12). [score:2]
It is necessary to include all family members (as in the case of mir-302) in order to reach significance in the developmental pathways. [score:2]
Many other clusters are composed by a single family (red lines), as for example the mir-302 family/cluster (cluster 4.1). [score:1]
The well-characterized miR-302 family (mainly represented by miR-302a, miR-302b, miR302c, miR302d) is overwhelmingly expressed in both PSC and MPC. [score:1]
The cluster word clouds complemented the family word clouds; hence, Chr4.1 (where mir-302 family is located) was highly represented in PSC and MPC. [score:1]
In the case of MPC, the most distinctive family apart from the miR-302, is the miR-25 (miR-25, miR-92a and miR-92b). [score:1]
As it can be observed,-3p microRNAs had the highest correlation between them than-5p microRNAs, except for miR-302b-5p and miR-302d-5p. [score:1]
In Fig.   5C the upper part of the matrix shows the correlation scores between pairwise comparisons of miR-302 members. [score:1]
[1 to 20 of 15 sentences]
20
[+] score: 35
[d] As annotated by miRBase Table 2 Top 10 differentially expressed piRNA clusters (A), tRNA-derived small RNAs (B) and miRNAs (C) A Top 10 differentially expressed small RNA clusters Genomic location Log2 Fold Change P-value (adjusted) 1 chr15:21,925,462-21,930,432 −6.18 2.62e-29 2 chr15:20,841,664-20,850,393 −6.18 1.31e-27 3 chr15:23,510,099-23,514,854 −6.25 1.46e-26 4 chr18:55,837,529-55,838,674 inf 1.46e-26 5 chr1:2,237,998-2,241,778 −6.55 1.88e-26 6 chr15:23,386,898-23,404,357 −6.06 1.88e-26 7 chr15:28,583,287-28,593,483 −5.93 1.88e-26 8 chr4:190,801,280-190,804,618 −6.21 1.88e-26 9 chr15:20,723,798-20,737,584 −5.94 3.27e-26 10 chr18:14,460,205-14,464,963 −6.30 3.27e-26 B Differentially expressed tRNA-derived small RNAs tRNA Log2 Fold Change P-value (adjusted) 1 Glu-GAG (chr13, 45492060) −2.51 2.50e-09 2 Glu-GAG (chr15, 26327380) −2.63 2.50e-09 3 Asp-GAY (chrX, 18996334) −3.49 3.40e-06 C Top 10 differentially expressed miRNAs miRNA Log2 Fold Change p-value (adjusted) 1 hsa-miR-302d-3p 11.25 1.95e-13 2 hsa-miR-302a-3p 11.65 1.23e-12 3 hsa-mir-302b 11.38 1.23e-12 4 hsa-mir-302a 11. [score:9]
A study using a genetic screen of primary human cells supported this observation and found that both miR-372-373 and miR-302 may act as TGCT oncogenes through inhibition of target genes such as Large Tumor Suppressor homolog 2 (LATS2) [12]. [score:7]
Expression analysis of miRNAs shows upregulation of the miR-302 and miR-371-373 clusters. [score:6]
The most significantly differentially expressed miRNAs were from the miRNA clusters miR-302/367 and miR-371-373, seen in the upper right corner of the plot. [score:3]
We have confirmed the association between TGCT and high expression of the miR-371-373 and miR-302/367 clusters. [score:3]
Moreover, the miRNAs miR-371-373, miR-302 and miR-146 have previously been shown to display a TGCT-specific expression pattern [12– 14], indicating a potential role for miRNAs in TGCT pathogenesis. [score:3]
Our results confirm previous findings indicating that miRNAs have a relevant role during testicular carcinogenesis, since overexpression of the miR-371-373, miR-302 and miR-367-3p clusters was noted in malignant TGCT tissue [12, 57, 58]. [score:3]
Several of the miR-371-373 and miR-302/367 cluster members have shown a sufficiently strong association with TGCT [12, 57, 58] to serve as biomarkers of TGCT. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 33
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
In our study, the putative porcine miR-302 cluster was highly expressed in both types of piPSCs, but hpiPSCs had a much higher expression level that was similar to that in EpiSCs. [score:5]
Regulation of somatic cell reprogramming through inducible mir-302 expression. [score:4]
This study demonstrated that overexpression of the whole porcine miR-106a-363 cluster and miR-302 cluster combined with OSKM improved the efficiency of piPSCs induction. [score:3]
Of note, the piPSCs highly expressing the miR-106a-363 cluster and putative porcine miR-302 cluster had enhanced reprogramming efficiency. [score:3]
This indicated that hpiPSCs dominantly expressed the miR-302 cluster. [score:3]
The miR-302 cluster regulates the PI3K-Akt signaling pathway, MAPK signaling pathway, TGF-β signaling pathway, lysine degradation and other processes (Fig 7B). [score:2]
It was previously reported that the miR-106a-363 cluster and miR-302 cluster promote reprogramming in mice by negatively regulating the TGF-β signaling pathway [35, 36]. [score:2]
The miR-106a-363 cluster and miR-302 cluster were both highly expressed in piPSCs compared with pEFs. [score:2]
Of note, we found three novel miRNAs, ssc_38501, ssc_38503 and ssc_38508, which were very similar to has-miR-302a and has-miR-302b in terms of their sequences (Fig 6C). [score:1]
Transfection of has-miR-302a and has-miR-302b miRNA mimics effectively enhanced the porcine reprogramming efficiency and reduced the induction time for piPSCs in the OSKM and OSK induction systems in a previous study [58]. [score:1]
Genomic location of the putative porcine miR-302 cluster. [score:1]
A putative porcine miR-302 cluster was predicted by miRdeep2. [score:1]
We observed that the number of AP -positive colonies was highest in the cells transfected with the putative miR-302 cluster group, then in those with the miR-106a-363 cluster group then in the control group (Fig 7E and Fig 7F). [score:1]
These findings indicate that the miR-106a-363 cluster and putative miR-302 cluster exhibited an improved reprogramming efficiency, which was consistent with the results observed in mouse cells. [score:1]
The miR-106a-363 cluster and putative miR-302 cluster therefore appear to have conserved functions in promoting the reprogramming efficiency in porcine cells. [score:1]
An approximately 1.5 kb range harboring the whole miRNA-106a-363 cluster and a 2 kb range containing the putative porcine miR-302 cluster were amplified. [score:1]
The pMXs system separately carrying the porcine miR-106a-363 cluster and putative porcine miR-302 cluster were used to reprogram the pEFs in combination with pMXs-Oct4, pMXs-Sox2, pMXs-Klf4 and pMXs-Myc (OSKM, laboratory stored). [score:1]
[1 to 20 of 17 sentences]
22
[+] score: 33
The expression of gene NR2F2 is increased during differentiation when the expression of OCT4 gene and miR-302 declines (Rosa and Brivanlou, 2011). [score:5]
Several miRNA, especially miR-302 and miR-372 have been directly involved in enhancing of HFF reprogramming (Subramanyam et al., 2011) revealing the possibility to directly target these miRNAs to reprogram the HFF without Yamanaka factors. [score:5]
Type of cells Processes involved Non-coding RNA Reference hESC Pluripotency, self-renewal, cell cycle and fate specification miR-302 Suh et al. (2004), Bar et al. (2008), Lipchina et al. (2011) hESC Inhibition of pluripotency miR-145 Xu et al. (2009) iPSC Pluripotency miR-17, miR-106b, and miR-106a Li et al. (2011) Fibroblasts to iPSC Reprogramming miR-302, miR-372 Anokye-Danso et al. (2011), 2012, Subramanyam et al. (2011) Fibroblasts to iPSC Reprogramming Combination of miR-302, miR-200c, and miR-369 Miyoshi et al. (2011) iPSC Reprogramming LincRNAs Loewer et al. (2010) hESC Neural differentiation LincRNAs Ng et al. (2012) iPS-derived neural progenitors Neural differentiation LincRNAs Lin et al. (2011) hESC Differentiation to neuroectoderm miR-200, miR-96 Du et al. (2013) hESC-derived neural stem cells Suppression of selfrenewal, neural differentiation miR-124, miR-125b and miR-9/9 Roese-Koerner et al. (2013) hESC Neural differentiation miR7 Liu et al. (2012) hESC Neural differentiation miR125 Boissart et al. (2012) hESC, human embryonic stem cells; iPSC, induced pluripotent stem cells. [score:5]
Rosa and Brivanlou (2011) have shown that Oct4 and miR-302 inhibit NR2F2, which in turn inhibits Oct4. [score:5]
A regulatory circuitry comprised of miR-302 and the transcription factors OCT4 and NR2F2 regulates human embryonic stem cell differentiation. [score:3]
Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. [score:3]
Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. [score:3]
This study showed important biological function of mir-302 and NR2F2 in human early development and cell fate determination. [score:2]
Another study confirmed that fully pluripotent stem cells can be obtained by introducing other miRNA such as combination of miR-302, miR-200c, and miR-369 (Miyoshi et al., 2011). [score:1]
The most abundant miRNA transcript in hESCs is mir-302 which encodes for miR-302a/b/c/d and mir-367 (Suh et al., 2004) and is under the control of Oct4, Sox2, and Nanog. [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 31
miRNA-302/367 promotes proliferation and accelerates G1 to S transition of the cell cycle by the targeting the Rb family and CDK1NA [13], whereas the miR-17/92 cluster enhances reprogramming efficiency by downregulating PTEN, a renowned tumor suppressor [11]. [score:8]
Similarly, miR-302/367 and miR-200 play a crucial role in iPSC generation by targeting EMT-related genes TGFβR2 and ZEB1/ZEB2, respectively [12, 14], echoing our finding of miR-524-5p regulation of ZEB2. [score:4]
Lin SL Chang DC Lin CH Ying SY Leu D Regulation of somatic cell reprogramming through inducible mir-302 expressionNucleic Acids Res. [score:4]
The miR-302/367 cluster enhances reprogramming efficiency by increasing cell division rate [13] and suppressing apoptosis [39], as well as promoting epigenetic reactivation of pluripotency genes [40], as shown here for miR-524-5p. [score:3]
Subramanyam D Lamouille S Judson RL Liu JY Bucay N Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cellsNat Biotechnol. [score:3]
Alternatively, when co-expressed with the OSKM factors, members of the miR-302/367, miR-17/92, and miR-200 clusters are able to enhance reprogramming efficiency [10– 12]. [score:3]
Moreover, both miR-302/367 and miR-200 clusters increase the kinetics of MET during reprogramming through blocking the epithelial-to-mesenchymal transition (EMT)-related genes TGFβR2 and ZEB1/ZEB2 [12, 14]. [score:1]
Other C19MC miRNAs, particularly those that share the same seed sequence with the known reprogramming miR-302/-372 families [7], may also be shown to contribute to cellular reprogramming in future studies. [score:1]
The miR-302/367 cluster miRNAs are able to generate iPSCs [8, 9]. [score:1]
These include the miR-302/367, miR-17/92, and miR-200 clusters, and the chromosome 19 miRNA cluster (C19MC). [score:1]
Others have reported that introduction of multiple members of the miR-302/367 family was able to rapidly and efficiently reprogram fibroblasts into iPSCs with or without other reprogramming factors [9, 10]. [score:1]
Zhang Z Hong Y Xiang D Zhu P Wu E MicroRNA-302/367 cluster governs hESC self-renewal by dually regulating cell cycle and apoptosis pathwaysStem Cell Rep. [score:1]
[1 to 20 of 12 sentences]
24
[+] score: 28
Transfection of miR302 into cancer cell lines suppresses the expression of genes important in development and differentiation and appears to re-program differentiated cancer cells into a pluripotent ES-like state [45]. [score:6]
The miR302 family targets numerous genes important in early human embryogenesis [45, 46], and is co-expressed with other ES cell genes such as Oct3/4, Sox2 and Nanog. [score:5]
Via inhibition of cyclin D1/D2, CDK2, and BMI-1 expression, miR302 blocks G1-S cell cycle transition, leading to a low proliferation rate [47]. [score:5]
Lin S. L. Chang D. C. Ying S. Y. Leu D. Wu D. T. MicroRNA miR302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathwaysCancer Res. [score:5]
Decreased levels of Oct4 and miR302 permit NR2F2 expression. [score:3]
miR302 expression is induced by Oct4; together, Oct4 and miR302 silence the transcription factor NR2F2. [score:3]
Fareh M. Turchi L. Virolle V. Debruyne D. Almairac F. de-la-Forest Divonne S. Paquis P. Preynat-Seauve O. Krause K. H. Chneiweiss H. The miR302–367 cluster drastically affects self-renewal and infiltration properties of glioma-initiating cells through CXCR4 repression and consequent disruption of the SHH-GLI-NANOG networkCell Death Differ. [score:1]
[1 to 20 of 7 sentences]
25
[+] score: 28
Several mRNAs targeted by neuronal miRNAs (i. e., miR-124, miR-9 and miR-96) were downregulated upon increased miRNA expression, consistent with expectations of the role of miRNAs in repressing downstream targets, whereas for the decreasing miR-302 cluster and miR-103, similar proportions of the targets were up- and downregulated. [score:15]
This cluster is transcriptionally regulated by NANOG, POU5F1 and SOX2 (Barroso- del Jesus et al, 2009), and since these pluripotency factors were downregulated, the decrease in the miR-302/367 cluster levels was expected. [score:5]
To further test the impact of miRNAs in iNGN cell differentiation, we knocked down the expression of the miR-302/367 cluster and miR-124 in iNGN cells by miRNA sponges (Ebert et al, 2007). [score:4]
At day 0, the uninduced iNGN samples had miRNA signatures of stem cells; the miR-302/367 cluster dominated their profile (50.3% of the total amount of miRNAs) (Fig 4A; Supplementary Fig S5) consistent with previous studies that demonstrated its role in regulating self-renewal and preserving pluripotency (Lipchina et al, 2012; Wang et al, 2013). [score:2]
Thus, miRNA profiles rapidly changed in the course of iNGN differentiation, consistent with the loss of pluripotency (miR-302 cluster) and the establishment of neuronal miRNA signatures (miR-124, miR-96 and miR-9). [score:1]
The miRNA sponge sequences for hsa-miR-124 and the hsa-miR-302/367 cluster were in silico designed as previously described by Krol et al (2010), synthesized (Genewiz), PCR-amplified and placed downstream of a GFP-T2A-puromycin cassette driven by the EF1α promoter within a lentiviral vector (Addgene Plasmid 12252: pRRLSIN. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 28
The expression of pluripotence -associated hsa-miR-302 family was silenced and the expression of Hox miRNA hsa-miR-10 family that regulates gene expression predominantly in neuroectoderm was induced to high levels in these hESC-derived neuronal progenitors hESC-I hNuPs [6, 34]. [score:8]
The drastic expression increase of hsa-miR-10 upon exposure of hESCs to RA suggested that RA might induce the expression of Hox genes and co -expression of Hox miRNA hsa-miR-10 to silence pluripotence -associated genes and miRNA hsa-miR-302 to drive a neuroectoderm fate switch of pluripotent hESCs [6, 34]. [score:7]
Genome-scale profiling of miRNA differential expression patterns during hESC neuronal lineage-specific progression further identified novel sets of stage-specific human embryonic neurogenic miRNAs, including silencing of the prominent pluripotence -associated hsa-miR-302 family and drastic expression increases of Hox hsa-miR-10 and the let-7 miRNAs [6, 34]. [score:5]
Nuclear translocation of NAD (nicotinamide adenine dinucleotide) -dependent histone deacetylase SIRT1 and global chromatin silencing lead to hESC cardiac fate determination, while silencing of pluripotence -associated hsa-miR-302 family and drastic up-regulation of neuroectodermal Hox miRNA hsa-miR-10 family lead to hESC neural fate determination [6]. [score:4]
Nuclear translocation of NAD -dependent histone deacetylase SIRT1 and global chromatin silencing lead to hESC cardiac fate determination, while silencing of pluripotence -associated hsa-miR-302 family and drastic up-regulation of neuroectodermal Hox miRNA hsa-miR-10 family lead to hESC neural fate determination. [score:4]
[1 to 20 of 5 sentences]
27
[+] score: 27
Other miRNAs from this paper: hsa-mir-302a, hsa-mir-302c, hsa-mir-302d, hsa-mir-302e, hsa-mir-302f
To confirm the direct targeting of the 3′ UTR region of ALDH5A1 mRNA by miR-302, we employed TG1-miR and TG1 cells expressing a Renilla luciferase expression construct containing the ALDH5A1-3′UTR. [score:8]
The miR-302 can be another relevant epigenetic regulator, since it targets ALDH5A1 mRNA, is upregulated in GBM stem-like cells by extra-cellular pro-differentiation cues [15], and is enriched in non-proliferative/differentiated GBM territories (F. Burel-Vandenbos, T. Virolle, unpublished results). [score:7]
Deletion of miR-302 putative target sequence in the 3′UTR of ALDH5A1 mRNA (ALDH5A1-3′UTR-DEL) prevented the binding of the miR, and rescued luciferase activity (Fig.   1e). [score:3]
The cells were chocked twice (at day 0 and day 3) and collected at day 6. Cells were transfected with Renilla Luciferase mRNA and Firefly luciferase mRNA containing either the wild-type form of ALDH5A1-3′UTR or a mutant form of ALDH5A1-3′UTR with a deletion of the miR-302 putative target sequence (ALDH5A1-3′UTR-DEL). [score:3]
Deletion of miR-302 putative target sequence in the 3′UTR of ALDH5A1 mRNA (ALDH5A1-3′UTR-DEL) prevents the binding of the miR, and rescues luciferase activity. [score:3]
e Targeting of the ALDH5A1 transcript by miR-302. [score:3]
[1 to 20 of 6 sentences]
28
[+] score: 27
The miR-299a-3p, miR-302b-5p, miR-499 and miR-200c-3p were all up-regulated in EPO-MVs; the up-regulation of miR-499 and miR-200c-3p was significant (p < 0.001, n = 3). [score:7]
Faherty N Curran SP O’Donovan H Martin F Godson C Brazil DP CCN2/CTGF increases expression of miR-302 microRNAs, which target the TGFβ type II receptor with implications for nephropathic cell phenotypesJ Cell Sci. [score:5]
Our findings also demonstrate that miR-299, miR-499, miR-302, and miRNA-200 were upregulated in EPO-MVs (Fig.   8c). [score:4]
The miRNA profiles of the MVs revealed that EPO-MVs changed 212 miRNAs (fold-change ≥ 1.5), including miR-299, miR-499, miR-302, and miRNA-200, and that 70.28 % of these changes involved upregulation. [score:4]
d The bar plot shows the top ten enrichment score value of the significant enrichment pathway of the predicted possible target genes of miR-299a-3p, miR-302b-5p, miR-499 and miR-200c-3p. [score:3]
e The plot shows top ten biologic functions from the predicted possible target genes of miR-299a-3p, miR-302b-5p, miR-499 and miR-200c-3p, P-value cutoff (p < 0.05). [score:3]
miR-302 decreases TGF-β1 -induced EMT in renal HKC8 epithelial cells and attenuates the TGF-β1 -induced mesangial production of fibronectin and thrombospondin [44]. [score:1]
[1 to 20 of 7 sentences]
29
[+] score: 26
When miR-302 cluster (without miR367) was overexpressed, significant increase in conversion of partial to fully reprogrammed iPS cells by suppressing MBD2 expression, thereby increasing Nanog expression was observed (19). [score:9]
Somatic cells reprogram to an embryonic stem cell (ESC) comparable induced pluripotent stem (iPS) cell state upon forced expression of exogenously delivered transcription factors, however, expression of exogenous miR-302 cluster (without miR-367) is efficient in attaining a fully reprogrammed iPS state. [score:5]
JMJD1C knockdown reduces miR-302 expression (36). [score:4]
It is thought that overexpressed miRNAs from the miR302/367 cluster in stem cells primarily repress development. [score:4]
The expression of the miR302/367 cluster rapidly and efficiently reprograms mouse and human somatic cells to an iPSC state without a requirement for exogenous transcription factors (10, 11). [score:3]
Eight miRNA loci (miR-302b, miR-302b [*], miR-302c, miR-302c [*], hsc-3, miR-302a [*], miR-302d, and miR-367) are located within an ~700-bp region on chromosome 4. Cell biology data indicated that the miR302-367 promoter activity depends on the ontogeny and hierarchical cellular stage. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 25
On the other hand, miR-302 can enhance reprogramming by accelerating mesenchymal-to-epithelial translation (MET) [30] and suppressing some epigenetic regulators [23]. [score:6]
Nanog, Oct3/4, Sox2 and Rex1 are upstream regulators of the miR-302 cluster promoter [26], miR-302a regulate ESCs cell cycle by repressing cyclin D1 [27], and miR-302 impair early differentiation by repress NR2F2 [28] and Lefty [29] at the post-transcriptional level. [score:3]
We also analyzed miRNA cluster expression patterns and the results revealed that miRNAs from miR-302 cluster, miR-182/miR-183/miR-96 cluster and miR-143/miR-145 cluster were the most rpESCs enriched miRNAs. [score:3]
For miRNAs which had a very high expression level(>10000 reads TPM) in both parthenogenetic and IVF rhesus monkey ESCs, members of mir-302 cluster, miR-106b-25 cluster have important roles in maintaining of pluripotency. [score:3]
This phenomenon recently observed also in mouse and human parthenogenetic ESCs [1], [21], [22], due to homologous crossing-over and recombination during meiosis I. In our two rpESCs, mir-302 cluster had a very high expression level, consisting with previous studies that mir-302 cluster was high-riched in human ESCs [12]– [18]. [score:3]
Especially, all of miR-302b, miR-182, miR-183, miR-93 and miR-99b, which were from rpESCs enriched miRNAs cluster (Fig. 3D), were also highly expressed in IVF3.2 and IVF3.3 (counts TPM>10000). [score:3]
Recently, the roles of mir-302 cluster in regulation of ESCs pluripotency have been clarified on some extent. [score:2]
Our previous research suggested that rhesus monkey ESCs from in vitro fertilization (IVF) blastocysts also share a unique miRNAs set, miR-302 cluster, which were reported to be highly enriched in human ESCs, were the most rhesus monkey ESCs enriched miRNAs [19]. [score:1]
Intriguingly, mir-302 cluster can reprogram cancer or somatic cells into iPS [23]– [25] revealed that mir-302 cluster had important roles in maintaining pluripotency of pluripotent cells. [score:1]
[1 to 20 of 9 sentences]
31
[+] score: 25
We constructed a bidirectional vector whereby the reporter gene mCherry is conjugated with perfectly complementary miRNA target sites for miR-223, miR-155, miR-142-3p and EGFP expressed in the anti-sense direction conjugated with miR-302a and miR-302d (miR-302 a/d). [score:7]
For ectopic expression of miRNAs, we purchased miRNA expressing lentiviral vectors for miR-302a, miR-302b, miR-302c, and miR302-d (PMIRH302abcdPA-2) and miR-155 (PMIRH155PA-1) from System biosciences (Mountain View, CA). [score:5]
Ectopic expression of the miRNAs by co-transduction, either miR-302a, miR-302b, miR-302c, and miR-302d or miR-155 results in ablation of EGFP or mCherry expression, respectively, demonstrating sensitivity of the vector to specific miRNAs (Fig. 1B, miR-302a-d and miR-155, respectively). [score:5]
Since the fibroblasts do not express miR-302 [19], [20], [21], the cells were positive for EGFP (Fig. 3A, EGFP miR-T and EGFP miR-T/mCherry miR-T). [score:3]
The miR-302 gene encodes a cluster of eight miRNAs on chromosome 4 (miR-302b*-b-c*-c-a*-a-d-367) that are preferentially expressed in embryonal carcinoma cells, hESCs and hiPSCs [19], [20], [21]. [score:3]
Future more selective choice of miRNAs in combination with miR-302 a/d may be utilized to fractionate hiPSC from partially reprogrammed cells based upon their expression profile of fluorescence and to further investigate reprogramming mechanisms. [score:1]
293T cells infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T were super-infected by a lentiviral vector encoding either miR-302a, miR-302b, miR-302c, and miR-302d (miR-302 a-d) or miR-155 2 days post-infection. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 24
According to the online database for miRNA target prediction and functional annotations, miRDB [61, 62] the number of predicted targets for miRNAs in the miR-371–373 and miR-302 families range from 469 to 529; interestingly, LATS2 is one of the highest ranking targets on the list for all miR-302 family members as well as miR-372 and miR-373 (Target Score > 98) [62]. [score:9]
These studies have reported higher expression of miRNAs in the miR-371–73 and the miR-302 clusters and lower expression of let-7 in Type I and Type II GCTs compared to normal samples [29– 37]. [score:4]
Specifically, the miR-302 cluster regulates the Nodal inhibitors LEFTY1 and LEFTY2 [64]. [score:4]
Using the MIC, we identified correlations across the data features, including six major hubs with higher expression in YST (LEFTY1, LEFTY2, miR302b, miR302a, miR 126, and miR 122) compared with other GCT. [score:2]
Our findings are consistent with previous studies of Type I and Type II GCTs that have identified an overexpression of the miR-371–73 and miR-302 clusters in GCTs compared with normal samples [29– 35]. [score:2]
The miRNA-302 and miRNA-371–373 clusters are highly plausible candidate miRNAs in GCTs given their roles as regulators of embryonic stem cell pluripotency markers [59, 60] which has been discussed extensively in previous studies of GCTs [33, 35]. [score:2]
Alterations in the serum levels of the miR371–3 and miR-302/367 MiRNAs also show promise as a diagnostic and follow-up tool for TGCT patients [38], highlighting the potential translational impact of molecular evaluation. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 24
Our results (Fig 4B) show that ES cell extracts (1 and 3 µg) contained active miR-302b RISC and cleaved the perfectly matched target mRNA, whereas no target cleavage activity was seen in extracts of HeLa cells, which do not express miR-302b. [score:7]
RISC -mediated target RNA cleavage activity was determined by in vitro cleavage of a [32]P-target mRNA that perfectly matched the miR-302b or let-7 sequence. [score:5]
0002820.g004 Figure 4(A) Northern blot analysis of miR-302b and miR let-7a expression in hES and HeLa cells, respectively. [score:3]
Conservation of miRNAs was analyzed as described in Fig 1. (A) Northern blot analysis of miR-302b and miR let-7a expression in hES and HeLa cells, respectively. [score:3]
Fig 4A demonstrates the specific expression of miR-302b and let-7 in hES and HeLa cells, respectively. [score:3]
RISC activity of miR-302b, a representative miRNA expressed in hES cells and not in HeLa cells, and let-7a was analyzed by incubating cell extracts with a [32]P-cap-labeled substrate mRNA that was perfectly complementary to miR-302b or let-7a. [score:3]
[1 to 20 of 6 sentences]
34
[+] score: 22
miR-302/miR-367 target several endogenous inhibitors of BMP and activin pathways including Lefty, TOB2, DAZAP2, and SLAIN1. [score:5]
More recently, miR-302 was shown to directly target NR2F2, a transcription factor involved in the very early triggering of the neural genetic program, suggesting that miR-302 may more specifically avoid a spontaneous commitment of PSCs into the neural lineage (Rosa and Brivanlou, 2011). [score:4]
miR-125, miR-302, and miR-371 both target proteins involved directly in signaling mediated by receptors of the TGF-beta family and modulate finely the strength of the signal transduction. [score:4]
Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. [score:3]
A regulatory circuitry comprised of miR-302 and the transcription factors OCT4 and NR2F2 regulates human embryonic stem cell differentiation. [score:3]
Next to miR-302 family members, the miR-371/miR-372/miR-373 cluster is also considered as a potent inhibitor of the neural lineage commitment (Kim et al., 2011a). [score:2]
miRNAs of the miR-302/miR-367 family are particularly enriched in PSC. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 22
Additionally, three minor products of the polycistronic cluster (miR-302a*, miR-302b* and miR-302c*) were also down-regulated, but were expressed below threshold in NT2-undiff (Fig. 3B). [score:6]
For example, the polycistronic miR-302 cluster was found to be strongly down-regulated during the RA time-course (Fig. 3A). [score:4]
In another study, Hohjoh and Fukushima [27] examine the profiles of 180 mouse and 127 human miRNAs in human (NTera2/D1) and rodent (P19D and Neuro2a) cell lines, and report that the ES cell specific miR-302 cluster [29], [30] and miR-124a [10] show the opposite patterns of expression in response to the RA treatment and may mark the onset of neural differentiation. [score:3]
The expression levels of the same miR-302 (A; bottom left panel) and miR-181 (B; bottom right panel) genomic clusters in NT2-undiff and NT2-28D plotted as yellow and blue bars, respectively. [score:3]
0011109.g003 Figure 3The expression levels of the members of the miR-302 (A) and the miR-181 (B) genomic clusters during neural differentiation plotted as heatmaps (top panels). [score:3]
The expression levels of the members of the miR-302 (A) and the miR-181 (B) genomic clusters during neural differentiation plotted as heatmaps (top panels). [score:3]
[1 to 20 of 6 sentences]
36
[+] score: 22
Mir-129, miR-499 and miR-302b were expressed at similar levels in immature mTECs of mutant and control littermates, but were significantly downregulated in mature mTECs of Aire null mutants (Fig. 2B). [score:6]
In the context of a putative role of miRNA in pGE, it is noteworthy that several mRNAs, upregulated upon mTEC maturation, showed tissue-specific expression patterns, i. e. being restricted to brain (miR-124 and miR-129), heart (miR-499), testis (miR-202), skin (miR-203) or embryo (miR-467 and miR-302). [score:6]
We found that all analysed miRNAs were downregulated in Aire [pos] mTEC [high] compared with Aire [neg]mTEC [high] (Fig. 2A), with the exception of miR-302b, which showed no significant difference in expression levels. [score:5]
miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were stably expressed at two- to tenfold higher level in the mTEC [high] subset independent of the maturation marker used for sorting the cells (Fig. 1C). [score:3]
Interestingly, miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were differentially regulated in immature and mature Aire [neg] versus mature Aire [pos] mTEC subsets. [score:2]
[1 to 20 of 5 sentences]
37
[+] score: 21
Moreover, it has been recently reported that the NODAL inhibitor, LEFTY2, is down-regulated by miR-302, a microRNA that is highly enriched in hESC, thus revealing that modulating LEFTY2 at the translational level might be important to promote the undifferentiated stage [59]. [score:8]
miR-302 inhibits the translation of mRNAs inducing differentiation, including NR2F2 (an antagonist of OCT4), ZEB1 (Inhibitor of E-CADHERIN)and BMPR2 (inducing SMAD1/5/8 signalling) [22]– [24]. [score:7]
In human, OCT4, SOX2 and NANOG promote the expression of stem-cell enriched miRNAs, for example, the polycistronic miR-302/367 cluster [21]. [score:3]
BMP4 is a negative regulator of miR-302/367 [23]. [score:2]
Not surprisingly, a higher reprogramming efficiency has been achieved using a combination of OCT4, SOX2, KLF4 and MYC together with miR-302/367 [25]. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 21
Oct4 can bind directly to miR-302 and upregulate its expression [171], while canonical Wnt signaling regulates mir-302 expression involving 3 TCF/LEF binding sites. [score:10]
In the latter, knocking down β-catenin leads to decreased expression of mir-302, whereas knocking down Tcf3 produces the opposite effect [174], which promotes the expression of pluripotency genes in F9 and P19 cells [154, 175]. [score:7]
In one case this regulation involves the mir-302 gene, which encodes a cluster of 5 microRNAs (miRNAs) that are highly expressed in undifferentiated NTERA-2 cells and P19 cells [172, 173]. [score:4]
[1 to 20 of 3 sentences]
39
[+] score: 21
Of these, 271 miRNAs were overexpressed in hESCs and 73 were overexpressed in HFF-1. The fifteen most significant miRNAs derived from eleven different hairpin precursors, all overexpressed in the hESC libraries, are shown in Table 2. Ten of these miRNAs belong to known hESC-specific miR-302/367 and miR-371/372/373 clusters. [score:7]
Seven of the significantly differentially expressed moRNAs were derived from the hESC-specific miR-302/367 cluster. [score:3]
Overexpression of miR-302 family members is able to reprogram human and mouse somatic cells to pluripotency [19, 20]. [score:3]
Most miRNAs deriving from the well-known pluripotency related miR-302/367, miR-371/372/373 and C19MC clusters were significantly overexpressed in our hESC data, a finding that is well in line with the earlier observations. [score:3]
miRNAs found in hESCs belong mostly to the miR-302 and miR-290 families expressed from miR-302/367 and miR-371–373 clusters, respectively [13, 14]. [score:3]
Among them are seven of the ten moRNAs that derive from the pluripotency related miR-302/367 cluster. [score:1]
One of those fluctuating TFs is NANOG [73], which is also involved in activation of ES cell miRNAs miR-290 and miR-302 [74]. [score:1]
[1 to 20 of 7 sentences]
40
[+] score: 20
Other miRNAs from this paper: hsa-mir-302a, hsa-mir-302c, hsa-mir-302d, hsa-mir-302e, hsa-mir-302f
MiR-302 indeed belongs to a class of miRNAs that functions as cytoplasmic gene silencers: this is in suppressing translation of targeted messenger RNAs (mRNA). [score:7]
A majority of miR-302 -targeted genes are transcripts involved in development-related signals and oncogenes [131]. [score:4]
In using a vector which expresses a cDNA encoding for miR-302 and further selecting cells for its stable integration with antibiotics, Lin and co-workers [30] were able to achieve full reprogramming of cells from human hair follicles; however that cells are slow to propagate because of a restricted cell cycle rate [134]. [score:3]
In human, miR-302 is predominantly expressed in hES and iPS cells, but not in differentiated cells [132, 133]. [score:3]
Finally, recent studies have evidenced that both Oct4 and Sox2 play a pivotal role in miR-302 expression in human embryonic stem cells (hES) [129, 130]. [score:3]
[1 to 20 of 5 sentences]
41
[+] score: 19
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For example, the cluster of miR-512-3p, miR-205, and the miR-302 family illustrated on the heat map demonstrates high expression in undifferentiated ES and early neural progenitor stages, downregulation during the glial restricted and early OP transitions, but then additional high expression during mid to late OP development. [score:9]
From the top ten downregulated miRNAs at this transition, six miRNAs (miR-367, miR-302a, miR-302c, miR-372, miR-302b, and miR-302d) have been shown to encourage proliferation and are highly expressed in undifferentiated cells and cancer stem cells [43], [44], [45], [46], [47], [48]. [score:6]
Oncogene 45 Lee NS Kim JS Cho WJ Lee MR Steiner R 2008 miR-302b maintains “stemness” of human embryonal carcinoma cells by post-transcriptional regulation of Cyclin D2 expression. [score:4]
[1 to 20 of 3 sentences]
42
[+] score: 17
The relative expression of miRNAs in DCM samples and healthy control samples is shown in Figure 9. We found a 2.6-fold increase in hsa-miR-340 expression (P < 0.001), a 2.4-fold increase in hsa-mir-19b expression (P < 0.01) and a twofold increase in hsa-miR-302 expression (P < 0.05) in DCM samples. [score:9]
The hsa-miR-19b and hsa-miR-302 were down-regulated in the profile analysis, but up-regulated in the quantitative RT-PCR assay. [score:6]
The miRNA-302 family plays a role in regulating growth factor signalling pathways, with implications for nephropathic cell fate transitions [37]. [score:2]
[1 to 20 of 3 sentences]
43
[+] score: 17
MiR-302b was frequently down-regulated, whereas EGFR was up-regulated in human hepatocellular carcinoma (HCC) [30]. [score:6]
Re -expression of miR-302b resulted in the inhibition of proliferation in HCC SMMC-7721 cells. [score:5]
The silencing of EGFR by miR-302b or siRNA led to down-regulation of proliferation-related proteins, such as AKT2, CCND1, and CDK2. [score:4]
The dual luciferase reporter assay revealed that EGFR was a target of miR-302b. [score:2]
[1 to 20 of 4 sentences]
44
[+] score: 17
Recently, we reported that the expression of hES cell-specific miRNAs miR-302 d, miR-372 and miR-367 and miR-200c, as well as miR-199a, were strongly up-regulated by activin A [6]. [score:6]
The undifferentiated state of T3/HDF and T3/CMHDF, as well as T3/MEF and T3/CMMEF, cells was evidenced by the very high expression levels of "stemness" genes, as well as hES cell-specific miR-302/367 and miR-371/372/373 clusters, and low expression levels of differentiation markers of ectoderm, mesoderm and endoderm in addition to the strong staining of OCT4 and NANOG. [score:5]
The extremely abundant expression of hES cell-specific miR-302/367 and miR-371/372/373 clusters also indicated the very high proportion of undifferentiated hES cells present in these four cell populations. [score:3]
As demonstrated previously [24- 27], the miR-302/367 cluster on chromosome 4 and miR-371/372/373 cluster on chromosome 19 were extremely abundantly expressed in undifferentiated hES-T3 cells grown on T3HDF feeder (T3/HDF) and feeder-free Matrigel in T3HDF-conditioned medium (T3/CMHDF), as well as MEF feeder (T3/MEF) and feeder-free Matrigel in MEF-conditioned medium (T3/CMMEF). [score:3]
[1 to 20 of 4 sentences]
45
[+] score: 16
0114627.g002 Figure 2. TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
Nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 7 days. [score:3]
nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were further quantitated by TaqMan miRNA assays (Applied Biosystems). [score:2]
Furthermore, we found that let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b were significantly increased in individual exosomal samples from human BMSCs. [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 16
In fact, miR-302 and miR-372 have been shown to promote reprogramming, and miR-302 and miR-372 inhibit the TGF-ß -induced epithelial–mesenchymal transition, as does mouse miR-294 [37]. [score:3]
Eigenvectors with absolute values greater than 2 are shown in Table 2. Most of the listed miRNAs are members of the miR-302 cluster and two human-specific C19MC clusters (the miR-371/372/373 and miR-512∼ clusters), and these miRNAs were previously reported to be expressed in ES and iPS cells [10], [12]– [16], [30], [31]. [score:3]
In addition, other miRNAs—such as miR-17, -20a, -93, -106b, -106a, and -20b, and miR-302 members—which share the same sequence as the miR290 cluster, the miR-371 cluster, and C19MC, and were detected at high levels in both human and mouse ES/iPS cells, were shown to mediate reprogramming by targeting Tgfßr2 and p21 during the mesenchymal-to-epithelial transition during the initiation stage of reprogramming [6]. [score:3]
The miRNAs, reported in numerous studies and expressed abundantly in human and mouse pluripotent cells, are members of the miR-302 cluster [12], [13], [15], [16]. [score:3]
Seed sequence examination indicated no similarities to the known seed sequences of pluripotency-specific miRNAs such as AAGUGC in miR-302b-3p, miR-373, miR-520e, miR-519c-3p, miR-520a-3p, and miR-520b; AGUGCC in miR-515-3p and miR-519e; and AAGUG in miR-519d. [score:1]
The seed sequence of miR-302 is identical to those of miR-372, miR-373 [39], [40], and some C19MC members. [score:1]
Members of the miR-302 cluster were ranked 11 [th], 17 [th], 34 [th], and 59 [th] in the mouse list, and 1 [st], 30 [th], and 33 [rd] in the human list. [score:1]
In addition, miR-367, which is a distantly related member of the miR-302 cluster [36], was 37 [th] in the mouse list and 17 [th] in the human list. [score:1]
[1 to 20 of 8 sentences]
47
[+] score: 16
The small RNA sequencing data showed the upregulation of the miR-302b/367 and miR-106a/363 clusters, and downregulation of let-7 family members and the miR-17/92 cluster. [score:7]
The expression of the miR302/367 cluster especially allows the rapid and efficient reprograming of mouse and human somatic cells to an iPSC state without forced expression of exogenous transcription factors [64]. [score:5]
In mammalian primed pluripotent stem cells, some miRNAs including miR-20, miR-92, and miR-302 regulate the apoptotic threshold and survival through targeting the pro-apoptotic protein BIM [63]. [score:4]
[1 to 20 of 3 sentences]
48
[+] score: 15
Pluripotency-related miRNA (i. e., miR-290 and miR-302 clusters) also regulate reprogramming through suppression of differentiation-related miRNA (i. e., let-7 family, miR-21) [93], with Oct4 and Nanog directly regulating their expression [93]. [score:8]
Indeed, MEFs nearing senescence (late passage) are poorly reprogrammed, and the microRNA families miR-290 and miR-302, which inhibit senescence by inhibiting the expression of G1/S checkpoints, improve their reprogramming [20, 21]. [score:7]
[1 to 20 of 2 sentences]
49
[+] score: 14
MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathways. [score:5]
Regulation of somatic cell reprogramming through inducible mir-302 expression. [score:4]
S2 Fig A, Fluorescent TUNEL staining was performed to detect apoptotic HT29 cells transfected with miR302, miR302 plus miR-369s, or negative control (NC) miR. [score:1]
C, of the apoptosis-related proteins Bak, Bid, Bcl-xl, Bcl2, Mcl1, Caspase-8, and Caspase-3 in HT29 and DLD-1 cells transfected with miR302, miR-369s, miR302 plus miR-369s, or NC miR. [score:1]
miR302 -transfected DLD-1 colorectal cancer cells were analyzed for DNA methylation. [score:1]
B, Propidium iodide and Annexin V-FITC staining was performed in DLD-1 cells 60 h post-transfection with miR302, miR-369s, miR302 plus miR-369s, or NC miR. [score:1]
To prepare a CA transfection mixture in vitro, 2 μg of each miR-302 (-a,-b,-c,-d), miR-369 (-3p,-5p) or NC miR was mixed with 4 μL of 1 M CaCl [2] in 1 mL of serum-free bicarbonate (44 mM)-buffered DMEM medium (pH 7.5) incubated at 37°C for 30 min, and used for transfection [15– 17]. [score:1]
[1 to 20 of 7 sentences]
50
[+] score: 14
Treatment of AGS cells with DZNep and SAHA suppressed CDK2 and BMI-1, which were recently identified as the targets of miR-302, and induced cell cycle (G1/S) arrest. [score:5]
Cyclin -dependent kinase 2 (CDK2) and BMI-1 polycomb ring finger oncogene (BMI-1), both of which are known to be cell cycle regulators, have been identified as targets of miR-302. [score:4]
Recent studies have shown that miR-302 is the major miRNA found in human embryonic stem cells and iPS cells, and that induction of miR-302 expression reprograms somatic cells into a pluripotent stem cell-like state. [score:3]
14, 15 MiR-302 has been reported to inhibit the tumorigenicity of human pluripotent stem cells and the proliferation of cervical carcinoma cells. [score:2]
[1 to 20 of 4 sentences]
51
[+] score: 13
Epigenetic modification Cell lines or biological samples (location) Assessment/modification Identified gene targets Dose (range) DNA methylationBlood (San Francisco, USA, n = 58) Targeted/hypermethylation GSTM1 Blood Hg: 2.9 μg/LHanna et al., 2012 DNA methylationBuccal mucosa samples (Michigan, USA, n = 131) Targeted/hypomethylation SEPP1 Hair Hg: 0.31–0.44 (μg/g)Goodrich et al., 2013 Urine Hg: 0.60–0.83 (μg/L) mi -RNA NT2 (carcinoma pluripotent stem cells) Genome-wide/ – 400 nM MeHgCl for 2–36 dPallocca et al., 2013 ↑ miR-302b ↑ miR-367 ↑ miR-372 miR-196b miR-141↑, increased; ↓, decreased; [*], functionally validated at the expression level; –, not functionally validated at the expression level; Global refers to global methylation patterns; Genome-wide refers to high throughput gene-specific assays; DMGs, differentially methylated genes. [score:10]
In carcinoma pluripotent stem cells, exposure to methyl mercury chloride (MeHgCl) was associated with increased expression of miR-302b, miR-367, miR-372, miR-196b, and miR-141 (Pallocca et al., 2013). [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 12
Intriguingly, the maintenance of precursor expression in neuronal cultures for the pluripotency -associated miR-371 and miR-520, as well as for miR-302 might indicate that these miRNAs have further functional roles beyond the switch from self-renewal to differentiation. [score:3]
In contrast, miR-302b was found in Group 2 and showed expression both in hES cells and in lt-NES cells, but not in differentiated neuronal cultures (Figure 2B). [score:3]
Conversely, mature miR-371, miR-520 and miR-302b (Figure 2B, C) appeared to be expressed in the stem cell populations only (hES and lt-NES), while their corresponding precursors were present both in stem cells and neuronal differentiating cultures. [score:3]
This evidence is consistent with previous data showing that miR-302 is expressed in neural stem cells (e. g. [32]). [score:3]
[1 to 20 of 4 sentences]
53
[+] score: 11
mirVana miRNA Mimic, Negative Control #1, mirVana miRNA Inhibitor Negative Control, hsa-miR-302-5p mimic (Pre-miR/Anit-miR ID:MC12557), and 302a-5p inhibitor (Pre-miR/Anti-miR ID:MH12557) were purchased from Applied Biosystems and used at the stated picomole amount. [score:5]
The miR-302/367 cluster expression is necessary for maintaining the self-renewal of pluripotent cells and also an upstream regulator for many classical stem cell markers such as TRA-1-60, placental-like alkaline phosphatase and the intracellular transcription factors OCT3/4 and NANOG, which can only be measured in fixed or lysed cells 25 26. [score:2]
Generation of live-cell reporters to detect pluripotency-specific miR-302/367 activity. [score:1]
Thus, we can easily exclude both untransfected cells and miR-302 -positive/undifferentiated cells. [score:1]
To show that we could effectively remove the spiked hiPSC cells, we transplanted the sorted miR-302-neg cells into the testes of SCID mice for allogeneic engraftment. [score:1]
It is also noteworthy that our miR-302 switch system eliminates undesired cells based on positive selection of fluorescent-reporter mRNAs (i. e., we can isolate fluorescent-reporter -positive (miR302 -negative) cells). [score:1]
[1 to 20 of 6 sentences]
54
[+] score: 10
Functionally, the miR-302 cluster has been associated with cellular reprogramming where iPS cells overexpressing miR-302 exhibited suppressed MBD2 expression which in turn increased expression of NANOG (Lee et al., 2013). [score:9]
Epigenetic Regulation of Nanog by MiR-302 Cluster-MBD2 Completes Induced Pluripotent Stem Cell Reprogramming. [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 10
In addition, miR-302 and miR-467a are expressed in mouse ES cells and supplement silencing of the miR-290–295 targets via the 2–7 U seed [16], [27]. [score:5]
The miR-302 cluster is the most abundant miRNA family in human ES cells, and appears to be mostly responsible for 2–7 U seed functions instead of miR-371–373, which is expressed at much lower levels [12]. [score:3]
This seed is shared with miRNAs that are otherwise unrelated such as the miR-430, miR-302 and miR-467a families (http://www. [score:1]
miR-430 and miR-302 appear in the zebrafish and chick genomes and have therefore been acquired before the split of the mammalian lineage. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 10
Genome-scale profiling of microRNA (miRNA) differential expression showed that the expression of pluripotence -associated hsa-miR-302 family was silenced and the expression of Hox miRNA hsa-miR-10 family that regulates gene expression predominantly in neuroectoderm was induced to high levels in those hESC-derived neuronal progenitors [16, 19]. [score:10]
[1 to 20 of 1 sentences]
57
[+] score: 10
All combinations involve miR302, which has been shown to stimulate the expression of Oct4/ Sox2 and Nanog as well as inhibiting several factors that stimulate DNA methylation [73] and stimulating tumour suppressor related pathways [74]. [score:7]
MicroRNA’s have the advantage of specifically targeting multiple pathways and as seen for miR302 may therefore reduce the amount of factors to be introduced to induce pluripotency. [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 10
In the present study, we also identified several microRNAs (e. g. miR-21-5p, miR-135b, miR-34a-5p, miR-212-3p, miR-302b-3p and miR-302c-3p) which proved by previous studies of heart disease with consistently aberrant expression in ARVC patients. [score:5]
Christienet al. showed that the miR-302 promoter was regulated by the Wnt/β-catenin signaling pathway through Tcf3, the only Tcf/Lef factor that bound to the miR-302 promoter 52. [score:2]
The miR-302 cluster are essential in early embryonic development and somatic cell reprogramming 50 51. [score:2]
By contrast, 10 of 11 significantly decreased microRNAs got optimal AUC, the AUC of these microRNAs were 0.936, 0.758, 0.946, 0.991, 0.992, 0.970, 0.837, 0.922, 0.838, 0.966 for miR-135b, miR-138-5p, miR-193b-3p, miR-302b-3p, miR-302c-3p, miR-338-3p, miR-491-3P, miR-575, miR-4254 and miR-4643 respectively (Fig. 6). [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 10
Interestingly, CDKN1A was found to be a target for other down-regulated miRNA species we identified in our present study, namely, hsa-mir-302a, hsa-mir-302b, and hsa-mir-302d [70]. [score:6]
Further bioinformatics analyses revealed that only seven miRNA genes were differentially expressed in H1 at the “early” (2 hr) time point post-IR (p<0.05) (Figure 1); among them, only four miRNA species showed more than 1.5 – fold induction compared to sham-irradiated cells (hsa-miR-15b, hsa-miR-1274b, hsa-miR-302b and hsa-miR-1973) (Table 1). [score:2]
Hsa-mir-302b was shown to be highly expressed in hESC [46] and is directly responsible for “stemness” characteristics in human cells being part of stem cell-enriched mir-302-367 cluster [47], [48]. [score:2]
[1 to 20 of 3 sentences]
60
[+] score: 10
These data indicated that hiPSCs highly expressed miR-302 and miR-17, whereas NHDFs highly expressed let-7 accompanied by modest levels of miR-17 expression. [score:7]
Subsequent incorporation of four copies of the target sequence for miR-302a, let-7a, or miR-17 into the 3′ UTR of KR or EGFP created two different sensor vectors, SeVdp-302aT/let-7aT and SeVdp-302aT/17T (Fig.   4a), with SeVdp-302aT/let-7aT capable of being used to simultaneously evaluate miR-302 and let-7 expression, and SeVdp-302aT/17T capable of being used to simultaneously evaluate miR-302 and miR-17 expression. [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 9
For the acute stage, 9 mature miRNA sequences were identified as consistently differentially expressed: 8 were up-regulated (miR-132-3p, miR-21-5p, miR-21-3p, miR-212-3p, 2137, miR-711, miR-882 and miR-142-5p) and one was down-regulated (miR-302b-5p) (Table  2). [score:9]
[1 to 20 of 1 sentences]
62
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Increased miR-302b was suggested to target cyclin D2 and induced mitochondria-independent apoptosis of neurons during alcohol exposure [129]. [score:3]
Both miR-302b and -497 can target BCL2; increased levels of miR-497 were shown to be critical for mitochondria -dependent neuronal apoptosis [129]. [score:3]
Yadav S. Pandey A. Shukla A. Talwelkar S. S. Kumar A. Pant A. B. Parmar D. MiR-497 and miR-302B regulate ethanol -induced neuronal cell death through BCL2 protein and cyclin D2 J. Biol. [score:2]
In a human neuroblastoma cell line, in vitro long term ethanol exposure (72 h) results in a dramatic increase in miR-302b and miR-497. [score:1]
[1 to 20 of 4 sentences]
63
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
It has been shown that all malignant germ cell tumors overexpress the miR-371–373 and miR-302/367 clusters with increased serum levels, regardless of patient age, histological subtype, or anatomical site of tumor [26, 27]. [score:3]
The miR-302/367 cluster represents the most abundant cluster of eight miRNAs that are specifically expressed in hESCs [81]. [score:3]
Functional studies identified important roles of miR-302/367 in regulation of pluripotency and differentiation of hESCs in vitro. [score:2]
Beside its role in TGF- β signaling, miR-302/367 also promotes the bone morphogenetic protein (BMP) signaling. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 9
Members of miR-302 family, enriched in hESCs, such as miR-302a, miR-302b, miR-302c, and miR-302d, have been shown to be directly involved in regulation of p21 expression in hESCs, demonstrating a novel function for miR-302 s in hESCs [67]. [score:5]
Tens of miRNA species were upregulated after UV-exposures, including hESC-specific miRNAs such as those of the miR-302 cluster and miR-371-372 family. [score:4]
[1 to 20 of 2 sentences]
65
[+] score: 9
It was found that many miRNA species are expressed predominantly in hESCs [128, 129] and genotoxic stresses, such as UV-exposures, result in differential expression of many miRNA species (e. g., miR-302 cluster, miR-371-372 family genes) [130]. [score:5]
More recently, additional miRNAs, such as miR-302 family genes, were implicated in direct regulation of the levels of p21 protein in hESCs, thus affecting the cell cycle machinery through the G1/S checkpoint that is often described as being non-operational in hESC [19]. [score:3]
Recently, it was suggested that Ascl2 could exert its effect through miRNA-302b related pathways [138]. [score:1]
[1 to 20 of 3 sentences]
66
[+] score: 9
Curcumin was shown to significantly downregulate the H [2]O [2] -induced expression of miR-302 cluster in ARPE-19 cells. [score:6]
MiR-302 has been reported to inhibit several epigenetic regulators, including AOF1/2, methyl-CpG binding proteins 1 and 2, and DNA (cytosine-5-)-methyltransferase 1, that induce global DNA demethylation and subsequently activate transcription factors Oct4, Sox2, and Nanog [26]. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 9
2008.06.008 18774719 6. Subramanyam D Lamouille S Judson RL Liu JY Bucay N Derynck R Blelloch R Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cellsNat Biotechnol. [score:3]
Lipchina I Elkabetz Y Hafner M Sheridan R Mihailovic A Tuschl T Sander C Studer L Betel D Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP responseGenes Dev. [score:3]
For example, the miR-302/367 cluster (Fig.   3d and Additional file 5: Figure S3D, panel 3) is known to be abundant in hESCs in maintaining pluripotency [14]. [score:1]
miRNAs for further validation and in miR-302/367 cluster are highlighted with a black border. [score:1]
Some miRNAs known to be highly enriched in hPSCs, e. g., miR-302/367 [14], or endothelial cells, e. g., miR-126 [20], were clearly identified with. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 9
The miRNAs that exhibited at least a 2-fold change in expression in the hADSCs before and after the induction of chondrogenic differentiation are listed in Table I, and these include 12 upregulated miRNAs (miR-196a, miR-143, miR-383, miR-193b, let-7i, miR-26a, miR-539, miR-199a-3p, miR-337-5p, miR-146a-5p, miR-646, and miR-381) and 8 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b, miR-96-3p, miR-302-3p, miR-23a-3p, miR-590, and miR-510). [score:9]
[1 to 20 of 1 sentences]
69
[+] score: 9
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
[1 to 20 of 1 sentences]
70
[+] score: 9
The expression of the miR-371 cluster is downregulated before that of the miR-302/367 cluster, suggesting a temporal hierarchy in the duration of specific miRNA activity (Stadler et al., 2010; Kim et al., 2011). [score:6]
This sequence is complementary to the AAGUGC seed sequence of the miR-290-295 cluster (miR-290, miR-291a, miR-292, miR-291b, miR-294, and miR-295) and the miR-302/367 cluster (miR-302a, miR-302b, miR-302c, miR-302d, and miR-367) in mouse ESCs. [score:1]
These miRNAs include two clusters: miR-302/367 and the miR-371 cluster (miR-372 and miR-373). [score:1]
Members of the miR-302 family rescue the proliferation defects of DGCR8-mutant mouse ESCs (Wang et al., 2008) and reprogram human skin cancer cells into a pluripotent ESC-like state (Lin et al., 2008). [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 9
The miRNAs overexpressed in undifferentiated hESCs like miRNA-302, 200 and 520 cluster miRNAs, were closely involved in the development of cancer. [score:4]
The miR-302 cluster miRNAs (miR-302a, miR-302a*, miR-302b, miR-302b*, miR-302c, miR-302c*, miR-302d) have been shown to regulate important cellular functions in hESCs, including cell proliferation and chromatin structure, and have been consistently reported to be overexpressed in hESCs [156]. [score:4]
Some literatures have reported the relatedness between miRNA-302 family and tumorigenecity [157- 160]. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 9
miR-302 family has been demonstrated to directly regulate p21. [score:3]
In human mammary epithelial cells, overexpression of miR-302b could modulate the activity of p21 and consequently alter the oncogenic phenotypes. [score:3]
miR-302b, which was significantly up-regulated in CA breast cancer patients compared to CA healthy controls, belongs to a panel of 12 miRNAs which are associated with inflammatory breast cancer [38]. [score:3]
[1 to 20 of 3 sentences]
73
[+] score: 9
In addition, miR-302b suppresses HCC cell proliferation by targeting EGFR [17]. [score:5]
MiR-302b suppresses HCC hyperplasia due to associating with proliferation-related proteins, such as AKT2, CCND1, and CDK2, targeting the EGFR/AKT2/CCND1 pathway [16]. [score:4]
[1 to 20 of 2 sentences]
74
[+] score: 9
Other miRNAs from this paper: hsa-mir-21, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-146b
Another study reported that exosome-derived miR-302b significantly suppressed lung cancer cell proliferation and migration via the TGFβRII/ERK pathways, pointing to a potential target for lung cancer therapy [45]. [score:5]
Li J Exosomes-derived MiR-302b suppresses lung cancer cell proliferation and migration via TGFβRII inhibitionCell Physiol. [score:4]
[1 to 20 of 2 sentences]
75
[+] score: 8
We chose these miRNAs because they are among the most abundant miRNAs expressed in hESCs (miR-302 and 367) or NSCs (miR-9–1) and because their isomiRs are co-expressed at levels that are comparable to most of the canonical miRNAs in our libraries (Supplementary Table S2). [score:5]
is expressed as a canonical miRNA by mmu-miR-302c but as an isomiR by hsa-miR-302c and all of the remaining members of the miR-302 family of man and mouse. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 8
In one example, mir-302 is induced by Oct4 (POU5F1) and Sox2 in hESC, in turn suppressing cyclin D1 and thereby (along with other target mRNAs), increasing the fraction of cells in S phase and stimulating cell cycle [7]. [score:5]
Two clusters (2 and 6) included microRNAs primarily expressed in pluripotent cultures and these clusters included mir-302 family members as expected. [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 8
Several miRNAs, namely miR-148a, miR-302b, miR-10a, miR-196a and miR-132 were up-regulated in CINI samples. [score:4]
Five miRNAs displayed relative increased expression in the transition from normal cervix to atypical dysplasia to cancer, these were miR-148a, miR-302b, miR-10a, miR-196a and miR-132 (Figure 4 D). [score:3]
Finally, miR-196a is located in the rare folate sensitive fragile site FRA12A, the other two miRNAs that belong to this group are miR-148a and miR-302b. [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 8
Other miRNAs from this paper: hsa-mir-198, hsa-mir-302c, hsa-mir-527
As expected, we found several coding and non-coding members of the Pluripotency Core Regulatory Network among genes transcribed from ESC-specific and down-regulated promoters (S4 and S5 Figs and S3 Table), such as the master regulators NANOG and OCT4 (POU5F1), and the miRNAs MIR302B and MIR302C, reported to play a key role in pluripotency and cell reprogramming [50– 52]. [score:6]
In some cases, we were able to discriminate the promoters engaged exclusively in miRNA transcription from those of host genes, since mapping on opposite strands (i. e., MIR198, located in the 3’ UTR of the FLST1 gene) or into intergenic regions (MIR302B, MIR302C and MIR527). [score:1]
Although CAGE-seq should in principle allow the identification of miRNA-specific TSSs, we were unable to map transcripts associated to the previously reported ESC- and NESC-specific miRNAs, with the exception of MIR302B and MIR302C, very abundant in human ESCs. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 7
Other miRNAs from this paper: hsa-mir-200c, hsa-mir-367
B. qPCR for miR-302b expression of cells transfected with plasmid pCEP4-has-miR-302-367 cluster. [score:3]
We further confirmed this by showing that UCs expressed higher level of markers or accelerators of MET, such as E-CADHERIN, CLAUDIN, OCCLUDIN and miR-200c, miR-302b, but lower level of repressors for MET, like TWIST (Fig. S2C). [score:3]
In each electroporation, 3.5 µg pEP4EO2SET2K (contains OCT4, SOX2, SV40LT and KLF4) and 2.5 µg pCEP4-M2L (contains c-MYC and LIN28) or pCEP4-miR-302-367 cluster (contains miR-302b, c, a, d and miR-367) were used. [score:1]
[1 to 20 of 3 sentences]
80
[+] score: 7
Cell viability assay upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 miR-302 in MDAMB-231 cells. [score:2]
S6 Fig cell proliferation assay upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-302 in MDAMB-231 cells. [score:2]
S7 Fig Trypan Blue assay shows cell viability upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-302 in MDAMB-231 cells. [score:2]
miR-200a, miR-200b, miR-15a, miR-429 and miR-302 reduced cell proliferation in MDAMB-231 cells. [score:1]
[1 to 20 of 4 sentences]
81
[+] score: 7
The down-regulated miRNAs were highly enriched for LCL specific miRNAs (miR-155, let-7a-i, miR-21, miR-142, miR103, miR-320, miR-146a-b) and the up-regulated miRNAs were highly enriched for iPSC specific miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, miR-18a). [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
Scatter plots showing the number of miRNAs targeting an mRNA (Y axis) versus the correlation between miRNAs and mRNA expression (Y axis) for selected miRNA families within the integrated data set for neuroblastoma (a) the let-7 family and (b) and mir-302 family, and human immune cells (c) the let-7 family and (d) the mir-320 family. [score:5]
Interestingly, although the mir-302 family showed cooperativity in the data set, it did not show any significant cooperativity in the Human Immune Cells data set. [score:1]
In some cases, there is limited evidence of a greater effect, such as in the plots of the mir-302 family in the neuroblastoma data set (Figure 5b) and the mir-320 family in the human immune cells data set (Figure 5d). [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 7
In HCC, aberrant expression of miRNAs, including miR-195, miR-214, and miR-302b suppresses tumor cell proliferation, apoptosis, and invasion by targeting downstream proteins [9– 11]. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
42 members of the miR-515 family (miR-515–527) and eight members of the miR-302–367 cluster (miR-302a, miR-302a*, miR-302b, miR-302b* miR-302c, miR-302d, miR-302d* and miR-367) were only up-regulated in TGCT and not in the other two cancers, and three members of the miR-105-767 cluster (miR-105, miR-105* and miR-767-5p) were ranked as the top ten up-regulated miRNAs in TGCT. [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 6
Lipchina I. Elkabetz Y. Hafner M. Sheridan R. Mihailovic A. Tuschl T. Sander C. Studer L. Betel D. Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP responseGenes Dev. [score:3]
Neural induction is repressed through action on the BMP/TGFβ signalling pathway, blocking the transition of stem cells towards the neural lineage, via targeting by miR-302/367, increasing BMP signalling [220]. [score:3]
[1 to 20 of 2 sentences]
86
[+] score: 6
Very low but specific expression of the members of the mir-302 family and miR-367 and miR-499 (group V, r = 0.995) was detected in different parts of the heart. [score:3]
However, a region closer to miR-302b showed a significant spike in binding-site frequency despite the very low "Hits" (Figure 6E). [score:1]
Two screen shots of the "regulogram" map from GenomeTraFac showed two regions of genomic sequences (red circles) close tothe hsa-miR-302b (E) and hsa-miR-34b (F) loci from which the binding sites for Nkx2-5 and FOXF2, respectively, were identified. [score:1]
In the case of group V, the upstream sequence of the miR-302b locus had a peak of "Hits" but no binding site for heart-specific factors could be found from that region. [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 6
We also found that miR-302∼367 cluster were up-regulated both in 4F and 3F groups, but not in the cMyc only group, indicating that miR-302∼367 were not regulated by cMyc directly. [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
Ascl2 knockdown results in tumor growth arrest by miRNA-302b-related inhibition of colon cancer progenitor cells. [score:4]
Dicer (Iliou et al., 2014) and multiple miRNAs [including, miR-34a (Bu et al., 2013, 2016), miR-106b (Zheng et al., 2015a), miR-140 (Zhai et al., 2015), miR-146a (Hwang et al., 2014), miR-183 (Wellner et al., 2009), miR-200 (Wellner et al., 2009), miR-203 (Wellner et al., 2009), miR-215 (Jones et al., 2015), miR-302b (Zhu et al., 2012), miR-328 (Xu et al., 2012b), miR-363 (Tsuji et al., 2014), miR-371 (Li et al., 2015c) and miR-451 (Bitarte et al., 2011)] reportedly regulate CRC TICs. [score:2]
[1 to 20 of 2 sentences]
89
[+] score: 6
Other miRNAs from this paper: hsa-mir-302a, hsa-mir-302c, hsa-mir-302d, hsa-mir-302e, hsa-mir-302f
For example, Rosa et al., showed that miR-302 family members are involved in the differentiation of human embryonic stem cells [32]; miR-302c could directly target the estrogen receptor in human breast cancer [33]. [score:4]
Dysregulation of miR-302 is seen in biliary tract cancer and thyroid cancer [34]. [score:2]
[1 to 20 of 2 sentences]
90
[+] score: 6
Analysis of miRSystem revealed among the eight miRNAs, four miRNAs (miR-291a-3p, miR-295-3p, miR-302b-3p and miR-302d-3p) have apoptosis -associated target genes (PI3K, NIK and Cn) or a DNA-damage repair -associated target gene (RAD23B). [score:5]
173 (miR-186-5p, miR-208a-5p, miR-291a-3p, miR-294-3p, miR-295-3p, miR-302a-3p, miR-302b-3p, miR-302c-3p and miR-302d-3p). [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 6
Other miRNAs from this paper: hsa-mir-302a, hsa-mir-302c, hsa-mir-302d, hsa-mir-302e, hsa-mir-302f
To try to overcome this difficulty, some researchers are testing other possibilities to generate cancer-derived hiPSCs by the application of other factors in addition to the Yamanaka factors, such as exogenous expression of miRNA302 and chemical compounds, as azacitidine (DNA methyltransferase inhibitor) and knockdown of p53, p21, and Ink4/Arf [19, 62]. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
Indeed, it has recently been demonstrated that overexpression of the miR-302 cluster can facilitate reprogramming of somatic cells to pluripotency [16]. [score:3]
Pluripotent human embryonic stem cells (hESCs) are reported to express a unique panel of miRNAs, including the miR-302 cluster and miR-371/372/373 cluster [12, 13]. [score:3]
[1 to 20 of 2 sentences]
93
[+] score: 6
Moreover, alignment of miRs that could regulate the Wnt reporter made intra- and inter -family related functional consensus sequences apparent (i. e. the seed of miR-1 and miR-613 or within the miR-302 and -515 families (Fig. S8)). [score:2]
Alignment to identify a functional consensus in the miR-515 family and its overlap with modulators the miR-302 family in regarding their ability to modulate the Wnt pathway. [score:1]
Moreover, this consensus sequence is also highly shared by the miR-activators of the miR-302 family. [score:1]
Of these, miR-302a and miR-302d are members of the miR-302 family and miR-519e, -519b, and -517a belong to the miR-515 family. [score:1]
Figure S8 Extraction of a consensus sequence of identified miRs within the miR-515 and miR-302 family. [score:1]
[1 to 20 of 5 sentences]
94
[+] score: 6
Instead, the miR-302 cluster was the highest expressed in human and rhesus macaque [14, 30, 31], indicating the functional divergence of stemness miRNA clusters in primate lineages. [score:3]
MiR-290-295 and miR-302 clusters are transcriptionally regulated by Oct-4/Sox2 [29]. [score:2]
The miR-290-295 cluster contains multiple mature miRNAs with seed sequences similar or identical to those in the miR-302 cluster [6]. [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 6
Card D. A. Hebbar P. B. Li L. Trotter K. W. Komatsu Y. Mishina Y. Archer T. K. Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells Mol. [score:4]
Liu H. Deng S. Zhao Z. Zhang H. Xiao J. Song W. Gao F. Guan Y. Oct4 regulates the miR-302 cluster in P19 mouse embryonic carcinoma cells Mol. [score:2]
[1 to 20 of 2 sentences]
96
[+] score: 6
Couple to this a number of publications have characterised the range of miRNAs expressed by hESC under standard culture conditions and in agreement with those we noted that three of the top ten upregulated miRNAs in hESCs (miR-4271,-4306, and miR-148b-3p), and members of the miR-512/519a and miR-302b/367 cluster are highly expressed in undifferentiated hESCs [32, 33]. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 6
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 1 sentences]
98
[+] score: 6
Recently, it was discovered that ectopic expression of the miR302/367 cluster, combined with Hdac2 suppression, can directly and efficiently reprogram both mouse and human fibroblasts without supplementation with any of the Yamanaka factors (39). [score:6]
[1 to 20 of 1 sentences]
99
[+] score: 6
This is in agreement with the fact that high expression levels of miR-302 cluster are typical of mouse epiblast stem cells [48]. [score:3]
However, expression levels of miR-302a and miR-302b were low in rat PSCs compared to the ESC specific miR-290-295 cluster. [score:2]
This list includes homologues of human miR-302a and miR-302b. [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 6
Subramanyam D. Lamouille S. Judson R. L. Liu J. Y. Bucay N. Derynck R. Blelloch R. Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells Nat. [score:3]
Finally, mir-302d-3p is a member of the mir-302/367 cluster that has a role in the regulation of cell signaling pathways involved in the cell cycle and inducing pluripotent stem cells [29, 30]. [score:2]
Gao Z. Zhu X. Dou Y. The miR-302/367 cluster: A comprehensive update on its evolution and functions Open Biol. [score:1]
[1 to 20 of 3 sentences]