sort by

76 publications mentioning hsa-mir-370

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-370. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 422
Induction of miR-370 over -expression attenuated the EGFR expression while inhibition of endogenous miR-370 expression by transfection with miR-370 inhibitor increased the EGFR expression in lung cancer cells. [score:13]
Furthermore, we found that induction of miR-370 over -expression attenuated the EGFR expression and inhibited the proliferation, clonogenicity, and invasion of lung cancer cells while inhibition of endogenous miR-370 by transfection with miR-370 inhibitor significantly enhanced the EGFR expression and the proliferation, clonogenicity, and invasion of lung cancer cells. [score:13]
These data demonstrated that induction of miR-370 expression significantly down-regulated the EGFR expression and inhibited the growth and angiogenesis of xenograft NSCLC tumors in mice. [score:10]
Therefore, induction of miR-370 over -expression inhibited proliferation, clonogenicity, wound healing and invasion while inhibition of endogenous miR-370 by transfection with miR-370 inhibitor enhanced proliferation, clonogenicity, wound healing and invasion of XWLC-05 and H157 cells. [score:9]
MiR-370 over -expression inhibits while inhibition of miR-370 expression enhances the proliferation, colony formation, wound healing and invasion of XWLC-05 and H157 cells. [score:9]
These, together with observation of down-regulated miR-370 expression in most lung cancer cells tested, suggest that miR-370 may inhibit the development and progression of lung cancers. [score:9]
Induction of miR-370 over -expression attenuates the EGFR expression and down-regulates the ERK and AKT signaling in XWLC-05 and H157 cells. [score:8]
We found that miR-370 acted as a tumor suppressor to reduce EGFR expression and inhibited the growth and metastasis of lung cancers by down -regulating the ERK1/2 and AKT signaling. [score:8]
MiR-370 over -expression significantly reduced the EGFR 3′UTR-regulated luciferase activity, suggesting that miR-370 may bind to the 3′UTR of the EGFR to inhibit the EGFR expression in lung cancer cells. [score:8]
In contrast, inhibition of endogenous miR-370 by transfection with miR-370 inhibitor significantly enhanced the proliferation, clonogenicity, wound healing and invasion in XWLC-05 and H157 cells, accompanied by increased levels of EGFR and HIF-1α expression as well as the ERK1/2 and AKT activation. [score:7]
Induction of miR-370 over -expression reduces EGFR and HIF-1α expression and inhibits the ERK and AKT phosphorylation in XWLC-05 and H157 cells. [score:7]
As shown in Figure 3A, induction of miR-370 over -expression dramatically reduced the proliferation rates while induction of miR-370 inhibitor expression enhanced the proliferation rats of XWLC-05 and H157 cells, relative to the control transfected with negative control. [score:7]
More importantly, miR-370 over -expression inhibited the growth, angiogenesis and metastasis of implanted lung tumors in mice, accompanied by attenuating EGFR and Ki67 expression as well as MVD in the tumors. [score:7]
While one study indicates that miR-370 expression is associated with poor prognosis of patients with lung adenocarcinoma [29], another study reveals that induction of miR-370 over -expression inhibits the proliferation and promotes apoptosis of human lung cancer A549 and H358 cells [30]. [score:7]
We found that transfection with miR-370 significantly increased levels of miR-370 expression, but decreased EGFR mRNA transcripts (Figure 2A and 2D) while transfection with miR-370 inhibitor significantly decreased the levels of miR-370 expression, but increased EGFR mRNA transcripts in both XWLC-05 and H157 cells, relative to their controls (Figure 2B and 2E). [score:7]
MiR-370 over -expression inhibits the lung metastasis of xenograft NSCLC tumors in vivoFinally, we examined the effect of miR-370 over -expression on the lung metastasis of xenograft NSCLC tumors in vivo. [score:7]
Our findings extended a previous report that miR-370 inhibits the progression of NSCLC by targeting the TRAF4 [30], but disagreed with a previous report that miR-370 expression is associated with poor prognosis of lung cancers [29]. [score:7]
Previous studies have shown that miR-370 can promote liver cancer cell apoptosis by targeting the AKT signaling and inhibits glioma cell proliferation and bladder cancer metastasis by targeting the β-catenin [38, 41, 42]. [score:7]
The reduced EGFR and Ki67 expression in the implanted tumors further supported that miR-370 over -expression inhibited proliferation of lung cancer cells in vitro. [score:7]
Given that the ERK and AKT signaling are important for the growth, angiogenesis and metastasis of cancers the inhibition of lung cancer growth, metastasis and angiogenesis by miR-370 over -expression may be also mediated by miR-370 attenuating the EGFR expression and down-stream ERK and AKT signaling in vivo. [score:7]
More importantly, miR-370 over -expression inhibited the proliferation, clonogenicity, wound healing and invasion of lung cancer cells in vitro, which were associated with reduced levels of EGFR and HIF-1α expression and the ERK1/2 and AKT activation. [score:7]
Modulation of miR-370 expression alters the neoplastic behaviors of lung cancer XWLC-05 and H157 cells in vitroTo test the function of miR-370 in lung cancer cells, XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor, control miR-NC or control inhibitor and the dynamic proliferation of different groups of cells was determined by MTT assay. [score:6]
MiR-370 can function as a tumor suppressor by targeting the expression of FoxM1 [25, 26] and TRAF4 [27]. [score:6]
Modulation of miR-370 expression affects the EGFR expression and the EGFR 3′UTR-regulated luciferase activity in lung cancer cells. [score:6]
Recent studies have revealed that miR-370 expression is downregulated in several types of cancer tissues, including bladder cancer [23], neuroblastoma [24], acute myeloid leukemia [25] and others. [score:6]
To determine whether miR-370 regulates the EGFR expression, XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor, or their corresponding scrambled control. [score:6]
However, miR-370 expression is up-regulated in breast cancer and gastric carcinoma [28]. [score:6]
To explore the molecular mechanisms underlying the action of miR-370, XWLC-05 and H157 cell were transfected with miR-370 mimics, miR-370 inhibitor control miR-NC or control inhibitor. [score:5]
Furthermore, miR-370 over -expression not only attenuated the EGFR and HIF-1α expression, but also significantly reduced the relative levels of ERK1/2 and AKT activation in XWLC-05 and H157 cells. [score:5]
Induction of miR-370 over -expression inhibits the growth and angiogenesis of NSCLC xenograft tumors in vivo. [score:5]
Therefore, induction of miR-370 over -expression inhibited the lung metastasis of xenograft NSCLC tumors in mice. [score:5]
We are interested in further determining whether miR-370 directly binds to the 3′UTR of the EGFR to understand the precise role and mechanisms in regulating the EGFR expression in lung cancer. [score:5]
XWLC-05 and H157 cells were transfected with miR-NC, miR-370 mimics, miR-370 inhibitor NC or miR-370 inhibitor for 24 h. The relative levels of miR-370 and EGFR mRNA transcripts in different groups of cells were determined by quantitative RT-PCR. [score:5]
The levels of miR-370 expression were determined by quantitative RT-PCR and of EGFR expression were determined by Western-blot. [score:5]
In contrast, transfection with miR-370 inhibitor increased the relative levels of EGFR and HIF-1α expression, increased AKT and ERK1/2 phosphorylation in XWLC-05 and H157 cells. [score:5]
Figure 5Induction of miR-370 over -expression inhibits the growth and angiogenesis of NSCLC xenograft tumors in vivoTo establish a subcutaneous tumor mo del in nude mice, XWLC-05 cells were transfected with pre-miR-370 or miR -negative control (miR-NC). [score:5]
These independent experimental results suggest that miR-370 may bind to the 3′UTR of the EGFR mRNA to inhibit EGFR expression. [score:5]
Figure 2XWLC-05 and H157 cells were transfected with miR-NC, miR-370 mimics, miR-370 inhibitor NC or miR-370 inhibitor for 24 h. The relative levels of miR-370 and EGFR mRNA transcripts in different groups of cells were determined by quantitative RT-PCR. [score:5]
Figure 6MiR-370 over -expression inhibits the lung metastasis of NSCLC xenografts in vivoIndividual BALB/c nude mice were injected intravenously with 1×10 [6] XWLC-05-miR-370 or XWLC-05-miR-NC cells (n=4, per group). [score:5]
In this study, we found that miR-370 over -expression inhibited the proliferation, clonogenicity, wound healing and invasion of XWLC-05 and H157 cells in vitro. [score:5]
To induce miR-370 over -expression, XWLC-05 cells were transfected with pPG/miR-370/EGFP or control pPG/miR-NC/EGFP using Lipofectamin [TM] 2000 reagent for 24 h. The cells were treated with 6 ng/mL of blasticidin S (Sigma) for 30 days to establish stable XWLC-05-miR-370 over -expression and control XWLC-05-miR-NC cells. [score:5]
After being annealed, the DNA fragments were cloned at the SacI/XhoI sites of the pmiRGLO firefly luciferase -expressing vector (Promega, WI, USA) to generate plasmids of pmiRG-EGFR-UTR-wt, pmiRG-EGFR-UTR-mut and pmiRG-miR-370 -inhibitor-PC, respectively, followed by sequencing. [score:5]
MiR-370 over -expression inhibits the lung metastasis of xenograft NSCLC tumors in vivo. [score:4]
To test the function of miR-370 in lung cancer cells, XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor, control miR-NC or control inhibitor and the dynamic proliferation of different groups of cells was determined by MTT assay. [score:4]
Figure 4XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor or corresponding controls for 24 h. The relative levels of EGFR, HIF-1α, ERK, AKT expression, ERK and AKT phosphorylation were determined by assays. [score:4]
MiR-370 over -expression inhibits the lung metastasis of NSCLC xenografts in vivo. [score:4]
MiR-370 over -expression inhibits the growth and angiogenesis of xenograft NSCLC tumors in vivo. [score:4]
XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor or corresponding controls for 24 h. The relative levels of EGFR, HIF-1α, ERK, AKT expression, ERK and AKT phosphorylation were determined by assays. [score:4]
XWLC-05 and H157 cells (1×10 [5]/well) were cultured in 24-well plates overnight and co -transfected in triplicate with 250 ng pmiRG-EGFR-UTRwt, pmiRG-EGFR-UTRmu or pmiRG-miR-370 -inhibitor-PC, together with 20 nM miR-370 mimic or miR-NC, by Lipofectamine 2000 according to the manufacturer's instructions. [score:3]
XWLC-05 cells were transfected with pre-miR-370 or miR -negative control (miR-NC) to establish stable XWLC-05-miR-370 over -expression and control XWLC-05-miR-NC cells. [score:3]
In comparison with the controls transfected with miR-NC, transfection with miR-370 mimics significantly reduced the relative levels of EGFR and HIF-1α expression, reduced AKT and ERK1/2 phosphorylation in XWLC-05 and H157 cells (Figure 4). [score:3]
More importantly, transfection with miR-370 significantly reduced the EGFR 3′UTR-wt-regulated luciferase activity, but did not affect the EGFR 3′UTR-mut-regulated luciferase activity in both XWLC-05 and H157 cells. [score:3]
Modulation of miR-370 expression alters the neoplastic behaviors of lung cancer XWLC-05 and H157 cells in vitro. [score:3]
The cells were treated with 6 ng/mL blasticidin for 30 days to establish stable miR-370 over -expressing XWLC-05-miR-370 and control XWLC-05-miR-NC cells. [score:3]
Transfection with miR-370 mimics, inhibitors. [score:3]
In comparison with the controls transfected individual plasmids with miR-NC, transfection with miR-370 mimics, together with pmiRG-EGFR-UTRwt or pmiRG-miR-370 -inhibitor-PC, but not pmiRG-EGFR-UTRmu significantly reduced the levels of luciferase activity in both XWLC-05 and H157 cells (Figure 2C and 2F). [score:3]
Therefore, miR-370 may be a tumor suppressor and our findings may aid in design of new therapeutic strategies for intervention of lung cancers. [score:3]
XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor, or corresponding scrambled controls for 24 h. The different groups of cells (10 [4] cells/well) were cultured in 96-well plates for 4 days and the cell viability of each group of cells was determined in triplicate using 3-(4, 5-dimethyl-thiazol-2-yl) 2, 5-diphenyltetrazolium bromide (MTT) reagent (Sigma). [score:3]
Next, we examined the relative levels of EGFR to control β-actin expression and miR-370 to U6 transcripts in human lung cancer A549, H460, H157, XWLC-05 cells, and non-tumor bronchial epithelial Beas-2b cells by and quantitative RT-PCR, respectively. [score:3]
In this study, we found that the 3′UTR of the EGFR contained a potential binding site of miR-370 and the levels of EGFR were negatively associated with the levels of miR-370 expression in several human lung cancer cell lines and non-tumor bronchial epithelial cells. [score:3]
We synthesized the EGFR 3′UTR mutant at the potential binding sequence of miR-370 (Figure 2G) and generated pmiRG-EGFR-UTRwt, pmiRG-EGFR-UTRmu and pmiRG-miR-370 -inhibitor-PC plasmids. [score:3]
XWLC-05 and H157 cells were cultured in medium without antibiotics overnight and transfected with 20 nM miR-370 mimics, 40 nM miR-370 -inhibitor, or their corresponding scrambled controls for 24 hours using the Lipofectamine TM 2000 transfection reagent (Invitrogen). [score:3]
EGFR and miR370 expression in lung cancer cells. [score:3]
We found that XWLC-05-miR-370 cells displayed higher levels of miR-370, but lower EGFR expression than control XWLC-05-miR-NC cells (Figure 5A, 5B and 5C). [score:3]
In summary, our data suggest a negative association between the levels of EGFR and miR-370 expression in human lung cancer cell lines and non-tumor bronchial epithelial cells. [score:3]
Modulation of miR-370 alters the EGFR expression in lung cancer cells. [score:3]
The EGFR and miR-370 expression in different lung cancer cells and non-tumor bronchial epithelial cells. [score:3]
These consistent with previous findings and support the notion that miR-370 is a tumor suppressor of cancer [36– 38]. [score:3]
Subsequently, we transfected XWLC-05 and H157 cells with pmiRG-EGFR-UTRwt, pmiRG-EGFR-UTRmu or pmiRG-miR-370 -inhibitor-PC, together with miR-370 mimic or miR-NC for 48 h, respectively. [score:3]
In this study, we examined the levels of miR370 and EGFR expression in several human lung cancer cell lines and non-tumor bronchial epithelial cells, and explored the effect of miR-370 on the proliferation, angiogenesis and migration of lung cancer cells in vitro and the growth and metastasis of lung cancers in vivo. [score:3]
Immunohistochemistric analysis revealed that the percentages of EGFR+ or KI67+ cells and the levels of HIF-1α expression and microvessel density (MVD) in the XWLC-05-miR-370 tumor sections were significantly lower than that in the XWLC-05-miR-NC tumor sections (Figure 5H). [score:3]
MiR-370 over -expression inhibits the growth and angiogenesis of xenograft NSCLC tumors in vivoNext, we evaluated the effects of miR-370 on the growth of NSCLC xenografts in vivo. [score:3]
Hence, the levels of miR-370 expression may be negatively associated with the levels of EGFR in these cells, except for A549 cells. [score:3]
In addition, XWLC-05 and H157 cells were co -transfected in triplicate with pmiRG-EGFR-UTRwt, pmiRG-EGFR-UTRmut or pmiRG-miR-370 -inhibitor-PC, together with 20 nM miR-370 mimics or miR-NC for 48 h and the luciferase activities of individual cell samples were analyzed. [score:3]
Finally, we examined the effect of miR-370 over -expression on the lung metastasis of xenograft NSCLC tumors in vivo. [score:3]
These suggest that miR-370 may bind to the 3′UTR of EGFR mRNA and the miR-370 inhibitor in both lung cancer cells. [score:3]
XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor or their corresponding controls for 24 h. The proliferation, colony formation, wound healing and invasion of individual groups of cells were determined by MTT, colony formation, wound healing and transwell invasion assays, respectively. [score:2]
Figure 3XWLC-05 and H157 cells were transfected with miR-370 mimics, miR-370 inhibitor or their corresponding controls for 24 h. The proliferation, colony formation, wound healing and invasion of individual groups of cells were determined by MTT, colony formation, wound healing and transwell invasion assays, respectively. [score:2]
For luciferase reporter assay, oligonucleotides for the EGFR 3′-UTR wild type (WT), EGFR 3′-UTR mutant and Hsa-miR-370-3P inhibitor (as a positive control) were synthesized by Genepharma (Shanghai, China). [score:2]
The relative levels of miR-370 transcripts and EGFR expression in XWLC-05-miR-370 and control XWLC-05-miR-NC cells were determined by quantitative RT-PCR and assays, respectively. [score:2]
MiR-370 over -expression attenuated the growth, angiogenesis and metastasis of implanted lung tumors in vivo. [score:2]
BALB/c nude mice were injected intravenously with XWLC-05-miR-370 or XWLC-05-miR-NC cells. [score:1]
We found that the volumes of XWLC-05-miR-370 tumors were significantly smaller than XWLC-05-miR-NC tumors at day 11, 14, 17 and 20 post implantation (Figure 5D and 5E). [score:1]
The body weights of the mice bearing XWLC-05-miR-370 tumors were significantly higher than that of those bearing XWLC-05-miR-NC tumors (Figure 6A). [score:1]
Individual female BALB/c nude mice were implanted subcutaneously with 2×10 [6] XWLC-05-miR-370 or XWLC-05-miR-NC cells (n=4, per group). [score:1]
We found that the 3′UTR of the EGFR contained the potential binding site of miR-370 using several online database (http://www. [score:1]
Next, female BALB/c nude mice were implanted subcutaneously with 2×10 [6] XWLC-05-miR-370 or XWLC-05-miR-NC cells/mouse (4 mice per group). [score:1]
At the end of the experiment, the XWLC-05-miR-370 tumor weights were significantly less than XWLC-05-miR-NC tumors (Figure 5F). [score:1]
To establish stable transfected cells, pre-miR-370 or miR -negative control (miR-NC) were cloned into the plasmid pPG/miR/EGFP (Genepharma). [score:1]
These independent lines of data indicated that miR-370 attenuated the EGFR-related ERK1/2 and AKT signaling in lung cancer cells in vitro. [score:1]
Individual BALB/c nude mice were injected intravenously with 1×10 [6] XWLC-05-miR-370 or XWLC-05-miR-NC cells (n=4, per group). [score:1]
Next, we tested whether miR-370 affected the EGFR 3′UTR-regulated luciferase activity by dual-luciferase reporter assay. [score:1]
There were obviously more tumor nodules in the lungs of the mice bearing XWLC-05-miR-NC tumors than those bearing XWLC-05-miR-370 tumors. [score:1]
Therefore, currently, the role of miR-370 in the tumorigenesis and metastasis of lung cancers remains controversial. [score:1]
The impact of miR-370 on the metastasis of implanted tumors was determined. [score:1]
To establish a subcutaneous tumor mo del in nude mice, XWLC-05 cells were transfected with pre-miR-370 or miR -negative control (miR-NC). [score:1]
Individual mice were implanted subcutaneously with 2×10 [6] XWLC-05-miR-370 or XWLC-05-miR-NC cells (4 mice per group). [score:1]
Briefly, individual mice were injected intravenously with 1×10 [6] XWLC-05-miR-370 or XWLC-05-miR-NC cells (4 mice per group). [score:1]
Analysis of the tumor tissues indicated that the relative levels of EGFR mRNA transcripts in the XWLC-05-miR-370 tumors were significantly lower than XWLC-05-miR-NC tumors (Figure 5G). [score:1]
In contrast, high levels of miR-370 transcripts were detected in H460, Beas-2b, A549 and moderate levels of miR-370 in H157 cells while much lower levels of miR-370 in XWLC-05 cells (Figure 1D). [score:1]
A previous study has showed that miR-370 may have a causative role in the disorder of lipid metabolism [22]. [score:1]
The micrometastases were scored according to the reference [32], and quantitative analysis revealed that the scores of lung metastatic tumors in the mice bearing XWLC-05-miR-370 tumors were significantly less than those bearing XWLC-05-miR-NC tumors (Figure 6C). [score:1]
Figure 1 (A) A potential binding site of miR-370 in the 3′UTR of the EGFR was predicted using online tools. [score:1]
[1 to 20 of 103 sentences]
2
[+] score: 403
Other miRNAs from this paper: hsa-mir-21
In addition, it was previously reported that enforcing IL-6 expression in CCA cell lines induces miR-370 downregulation correlating with increased expression of DNA methyltransferase enzyme-1 (DNMT-1) [24]. [score:8]
The inverse correlation between IL-6 and miR-370 in human CCA specimens and matched normal livers, as well as the fact that IL-6 induces miR-370 suppression in vitro while demethylation induces miR-370 overexpression suggests a potential pathway where overexpression of IL-6 in human CCA induces higher levels of DNA methylation which, in turn, induces lower levels of miR-370. [score:7]
We observed the growth suppressive effect of miR-370 overexpression in vitro, and effects of miR-370 are exerted, at least in part, through WNT10B inhibition. [score:7]
We found that enforced overexpression of miR-370 reduced WNT10B and downregulation of miR-370 resulted in increased WNT10B (Figure 7E ). [score:6]
Cells infected with MIEG3-miR-370 expressed miR-370 approximately 7.5 fold more than cells infected with MIEG3-EV (empty virus), which is similar to the miR-370 upregulation in normal cholangiocytes (H69) vs. [score:6]
We further confirmed in vitro that IL-6 downregulates miR-370 and that Azacytidine treatment increases the expression of miR-370. [score:6]
Figure S1 DNA demethylation upregulates miR-370 expression in HCT116 cells. [score:6]
B. Treatment with the demethylating agent 5Aza-dC upregulates miR-370 expression in HuCCT1 cells. [score:6]
miR-370 expression is strongly elevated in mat-UPD embryos and is absent from pat-UPD embryos, showing that miR-370 is a maternally expressed imprinted gene. [score:5]
Next, we plotted all 8 tissues (4 cancer and their matched 4 normal specimens) in terms of percent methylation (Y-axis in Figure 4C ) and miR-370 expression (X-axis in Figure 4C ) and noted a statistically significant correlation between percent methylation and miR-370 expression. [score:5]
As Figure 3A and B demonstrate, the expression of miR-370 in wild type control littermates is, as expected, approximately half the maternal disomy levels, while the expression of miR-370 in paternal disomy tissues is non-existent. [score:5]
NSM – non-specifici mimic; miR-370M – miR-370 mimic; NSI – non specific inhibitor; miR-370In – miR-370 inhibitor. [score:5]
Percent methylation and miR-370 expression are expressed as a log2 of the ratio between the cancer and matched normal specimen. [score:5]
The synthesized miR-370 mimic (miR-370M, Cat# C-300676-05), inhibitor (miR-370In, Cat# I-300166-01), Non-specific mimic (NSM, Cat# CN-001000-01-10) and non-specific -inhibitor (NSI, Cat# IN-001000-01-05) were purchased from Dharmacon (Lafayette, LA, US). [score:5]
Among our specimens, we had 10 pairs of CCA tissues and matched normal liver tissues for which we had expression data for both miR-370 and IL-6. In 8 out of 10 pairs of specimens, IL-6 had higher expression in CCA vs. [score:5]
Previous studies identified MAP3K8 as a target of miR-370 [24], and we now report WNT10B as a biologically relevant target in human CCAs. [score:5]
Although the quick suppression of miR-370 within 1 hour of starting the treatment cannot be explained through increased methylation, miR-370 demonstrates maximal suppression starting at 72 hours post treatment. [score:5]
To identify the pathway by which miR-370 exerts its tumor-suppressive effects, we sought mRNA targets of miR-370. [score:5]
To test if demethylating agents influence the expression of miR-370, we treated HuCCT1 cells with the demethylating agent 5 Aza-deoxycytidine (5 AZA-dC) and noted, at 48 hours post treatment, a sharp and statistically significant rise in expression level of miR-370 vs. [score:5]
We further hypothesized that miR-370, normally expressed only from the maternal allele, is suppressed by IL-6 via hypermethylation -mediated transcriptional repression. [score:5]
The expression level of miR-370 starts decreasing at 1 hour and appears to be maximally suppressed starting with 72 hours post treatment (p-value<0.0001, One-way ANOVA, Figure 2A ), in accord with data in other CCA cell lines [24]. [score:5]
The growth-suppressive effect of miR-370 overexpression was also confirmed in a dicer-defective cancer cell line, HCT116 Dicer(-) (Figure S2). [score:5]
The expression of miR-370 was linked with expression of enhanced green fluorescence protein (eGFP) via internal ribosome entry site 2 (IRES2). [score:5]
Our report now brings evidence that miR-370 is downregulated in human CCA vs. [score:4]
normal tissuesOur previous miR microarray data performed on a small cohort of CCAs suggested that miR-370 is downregulated in cancers vs. [score:4]
B. miR-370 is upregulated approximately 7.5-fold when retrovirus -mediated miR-370 delivery is employed. [score:4]
B. HuCCT1 malignant cholangiocytes display decreased growth upon modest miR-370 upregulation through infection with MIEG3-miR-370. [score:4]
Figure S4 miR-370 is upregulated to physiologic levels through retrovirus -mediated delivery in contrast to transfections. [score:4]
We previously reported, based on microRNA arrays, that micro -RNA-370 (miR-370) appears to be downregulated in human cholangiocarcinomas [23]. [score:4]
Figure S3 Wnt10b is downregulated at mRNA level by miR-370. [score:4]
C. miR-370 is upregulated approximately 9.5 times in normal cholangiocytes (H69 cells) vs. [score:4]
In conclusion, we report miR-370 is downregulated in human CCA specimens. [score:4]
Although the role of IL-6 in downregulating miR-370 in human specimens continues to be elusive, these data suggest that miR-370 might be an important etiologic factor in CCA. [score:4]
These data suggest that WNT10B is a direct target of miR-370. [score:4]
A. miR-370 is downregulated in human CCA vs. [score:4]
In spite of this modest upregulation of miR-370, cells infected with MIEG3-miR-370V behaved similarly to cells transfected with miR-370, displaying a statistically significant decreased growth (Figure 6B ). [score:4]
IL-6 is a major regulator of CCA growth and it inhibits miR-370 in vitro [24]. [score:4]
Our previous miR microarray data performed on a small cohort of CCAs suggested that miR-370 is downregulated in cancers vs. [score:4]
To establish if the prediction of miR-370 imprinting based on the location of its genomic locus is translated to tissues, we assayed the level of miR-370 in embryos with alterations in the parental origin of mouse chromosome 12 (uniparental disomy mice) which would be predicted to express either a double dose (maternal uniparental disomy) or no miR-370 (paternal uniparental disomy) if the gene is imprinted. [score:4]
A. miR-370 is upregulated approximately 24,000 fold through transfections. [score:4]
MSCV -based bicistronic retroviral vectors, MIEG3 (Ghiaur, 2006 #475) were used to express miR-370. [score:3]
A and B. WNT10B is a putative target of miR-370. [score:3]
Of note, in all these cases, the level of miR-370 expression was inversely correlated with the level of IG-DMR-CG6 methylation. [score:3]
0045606.g003 Figure 3 A and B. Maternal, but not paternal, UPD(12) disomy mice express miR-370. [score:3]
org/), miR-370 has a binding site in WNT10B 3′-untranslated region (3′UTR). [score:3]
Ten pairs of CCA and matched normal liver tissues for which we had expression data for both miR-370 and IL-6 were analyzed. [score:3]
IL-6 and promoter methylation modulate expression of miR-370. [score:3]
miR-370 displays cell growth suppressive effects. [score:3]
Indeed, our data suggest that miR-370 is normally imprinted in post-embryonic life and expressed only from the maternal allele. [score:3]
matched normal tissues (black bars towards the positive side of Y axis) and the expression of miR-370 was less in cancer vs. [score:3]
In order to confirm the suppressive effects of miR-370 on CCA cells at a physiological level, we inserted miR-370 into a retrovirus, MSCV-IRES-Enhanced-GFP-3 (MIEG3). [score:3]
Based on these data we sought evidence of an inverse relationship between the expression levels of IL-6 and miR-370 in human specimens. [score:3]
Y-axis – level of wnt10b in HuCCT1-EV cells (control cells) and in HuCCT1-370V cells (cells overexpressing miR-370). [score:3]
To assess if miR-370 has tumor suppressive effects on CCA cells, miR-370 mimic or non-specific mimic (NSM) were transfected into HuCCT1 cells. [score:3]
A. HuCCT1 malignant cholangiocytes display decreased growth upon reinforcement of miR-370 expression. [score:3]
To test this hypothesis and confirm in vitro that IL-6 downregulates miR-370, we treated human intrahepatic CCA cells, HuCCT1, with IL-6 and assayed miR-370. [score:3]
Wingless-type MMTV integration site family, member 10B (WNT10B) was predicted as a target of miR-370 (Figure 7A ). [score:3]
miR-370 induced ∼10% decreased expression of the ORF (P = 0.018, unpaired Student's t-test), an effect that was lost upon mutating the miR-370 binding site (Figure 7D ). [score:3]
Transfection with miR-370 mimic or inhibitor. [score:3]
A negative value (as in the values for miR-370 for all 4 specimens) signifies a lower expression in cancer vs. [score:3]
matched normal tissues (the figure displays the logarithmic (base 2) value of the ratio between expression of miR-370 in cancer vs. [score:3]
We now show that matched human CCA and normal specimens display an inverse relation between IL-6- and miR-370 expression, suggestive of in vivo interaction. [score:3]
matched normal liver, while miR-370 had lower expression in CCA vs. [score:3]
Since the data is displayed in log space, a positive value on the Y-axis for miR-370 or IL-6 represents overexpression of miR-370 or IL-6, respectively, in a CCA specimen vs. [score:3]
Figure S2 HCT116(-) cells display decreased growth upon miR-370 reinforced expression. [score:3]
0045606.g006 Figure 6 A. HuCCT1 malignant cholangiocytes display decreased growth upon reinforcement of miR-370 expression. [score:3]
X-axis- miR-370 expression, Y-axis- overall methylation rate (%). [score:3]
However, to date, the expression level of miR-370 has not been validated in a larger cohort of human CCA specimens. [score:3]
At 96 hours, the expression of miR-370 is almost zero and this finding could be, at least in part, due to increased methylation. [score:3]
IL6 inhibits miR-370 through modulation of DNA methylation levels. [score:3]
A. IL-6 reduces miR-370 expression in HuCCT1 cells. [score:3]
Y-axis –qRT-PCR expression of miR-370 vs. [score:3]
Furthermore, we searched for additional miR-370 binding sites in the 5′-untranslated region (5′UTR) as well as in the open reading frame (ORF) region and found another seven nucleotide putative binding site in the WNT10B ORF. [score:3]
Therefore, we hypothesized that loss of miR-370 in human CCAs can be, at least in part, explained by a two-hit theory, whereby the first “hit” is the result of normal imprinting, while the second hit is the result of an IL-6 induced maternal to paternal epigenotype switch that causes loss of expression from the usually active allele. [score:3]
X-axis - methylation rate, and miR-370 expression, Y-axis - human tissues. [score:3]
Conversely, a negative value on the Y-axis represents underexpression of miR-370 or IL-6, respectively, in the CCA specimen vs. [score:3]
Methylation of IG-DMR-CG6 influences miR-370 expression. [score:3]
0045606.g007 Figure 7 A and B. WNT10B is a putative target of miR-370. [score:3]
Finally, to confirm that miR-370 has a significant effect on the protein level of WNT10B, we performed western-blotting on proteins extracted from HuCCT1 cells treated with NSM, miR-370, NSI or miR-370 inhibitor respectively. [score:3]
B. miR-370 expression is inversely related to methylation at IG-DMR-CG6 in human liver specimens. [score:3]
C. The expression of miR-370 is inversely correlated with level of DNA methylation. [score:3]
The average expression of miR-370 vs. [score:3]
A and B. Maternal, but not paternal, UPD(12) disomy mice express miR-370. [score:3]
Luciferase activity in the cells co -transfected with miR-370 mimic was down-regulated by ∼42% (P = 0.001, unpaired Student's t-test), compared with cells transfected with NSM. [score:3]
miR-370 modulates the expression of WNT10B. [score:3]
It is therefore likely that miR-370 also acts on multiple targets and it would be interesting to fully dissect molecular pathways downstream of this miR, although this was not the primary focus of the current study. [score:3]
We next assessed a potential direct interaction between miR-370 and WNT10B in vitro using HuCCT1 cells that were transfected with luciferase reporter plasmids containing the wild-type WNT10B mRNA 3′UTR as well as miR-370M or NSM. [score:2]
C and D. miR-370 binds directly to WNT10B. [score:2]
For the ORF mutant, the miR-370 binding site was mutated by substituting seven nucleotides of the miR-370 binding sites using the Gene Tailor site directed mutagenesis system. [score:2]
For the 3′UTR mutant, the miR-370 binding site was mutated by substituting the eight nucleotides of the miR-370 binding sites using the Gene Tailor site directed mutagenesis system (Cat# 4500239; Invitrogen, Carlsbad, CA, US). [score:2]
MiR-370 is down regulated and IL-6 is up regulated in human CCA vs. [score:2]
matched normal liver (Figure 1C ), suggestive of an IL-6 regulatory effect on miR-370 in human CCA specimens. [score:2]
Similar experiments were conducted to test the direct interaction between miR-370 and the binding site located in the ORF of WNT10B. [score:2]
Therefore, we assayed the expression of miR-370 in 58 human specimens, including 34 CCAs and 24 normal liver tissues. [score:2]
These data confirmed that miR-370 can bind directly to both the 3′UTR and the ORF of WNT10B in human cholangiocarcinoma cells. [score:2]
The early effects of IL-6 onto miR-370 levels could be a result of transcription regulation, as previously suggested by others {Loffler, 2007 #1212}. [score:2]
Hepatology 24 Meng F, Wehbe-Janek H, Henson R, Smith H, Patel T (2008) Epigenetic regulation of microRNA-370 by interleukin-6 in malignant human cholangiocytes. [score:2]
As Figure 5 shows, in specimens CCA1 and CCA2, the ratio of miR-370 DNA in tumor vs. [score:1]
Of note, miR-370 is located within the DLK1-DIO3 domain, but so far there is no data regarding its imprinting status in human CCA specimens. [score:1]
In addition, we identified another miR-370 putative binding site in the ORF of WNT10B (Figure 7B ). [score:1]
Our study contributes to unraveling miR-370 as an important miR in the pathogenesis of liver cancers. [score:1]
The transfection of miR-370 results in non-physiologically high levels of miR-370 (Figure S4A). [score:1]
E. WNT10B protein changes upon miR-370 manipulation. [score:1]
First, we assessed the change in the mRNA level of WNT10B in response to miR-370 level. [score:1]
matched normal can be solely explained by the observed increased methylation at IG-DMR-CG6, we performed PCR on genomic DNA of the genomic locus of miR-370. [score:1]
Exogenous miR-370 induced a statistically significant decrease in growth (Figure 6A ). [score:1]
The seed of miR-370 displays complementarity to position 668–674 of WNT10B 3′UTR (A) as well as to position 458–464 of WNT10B ORF (B) in bold. [score:1]
MIEG3 empty virus – EV, MIEG3-miR-370 virus - miR-370V. [score:1]
C. miR-370 is located within the DLK-DIO3 domain. [score:1]
In this fashion, we were able to consider LOH at the miR-370 genomic locus. [score:1]
qRT-PCR was used to evaluate the expression of miR-370 and IL-6 mRNA. [score:1]
To establish the imprinting status of miR-370, TaqMan qPCR was carried out on wild-type mice and mice with maternal and paternal uniparental disomy for chromosome 12 (WT, mat-UPD and pat-UPD respectively). [score:1]
To investigate if the lower expression of miR-370 in human CCA vs. [score:1]
matched normal is accompanied by a lower level of miR-370 in cancer vs. [score:1]
IG-DMR and MEG3-DMR are methylated on the paternal chromosome indicated by the encircled letter m. miR-370 is a member of the cluster A of miRs and located within the DLK1-DIO3 domain. [score:1]
Two of the four CCA tissues displayed LOH at miR-370 locus vs. [score:1]
X-axis –HCT116(-) cells counted at day 2, 4, 6 and 8 after transfection of miR-370 mimic. [score:1]
These studies, however, did not test LOH at the miR-370 genomic locus. [score:1]
miR-370 is normally imprinted. [score:1]
miR-370 localizes within the imprinted locus DLK1-DIO3 [31]. [score:1]
PGL4 luciferase reporter plasmids containing wild-type WNT10B 3′UTR (C) or open reading frame (ORF) (D) were cotransfected with miR-370 mimic (miR-370M) or non-specific mimic (NSM), respectively. [score:1]
The effects of miR-370 on the ORF of WNT10B may be biologically less important than the effects on the 3′UTR, however, these effects were statistically significant. [score:1]
Therefore, we hypothesized that the paternal allele of miR-370 is repressed by imprinting. [score:1]
Y-axis – cell counts ×10 [4] of HuCCT1 cells transfected with miR-370 mimic (miR-370M, black squares) or NSM (black circles). [score:1]
Y-axis – Mean and standard deviation of qRT-PCR-measured expression of miR-370 normalized to RNU6B. [score:1]
non-specific mimic – NSM, miR-370 mimic - miR-370M. [score:1]
8 micrograms (µg) of plasmid DNA of miR-370 together with 10 µg MLV gag-pol plasmid and 3 µg VSVG envelope plasmid were co -transfected using Lipofectamine 2000 (Cat# 11668-019; Invitrogen, Carlsbad, CA, US). [score:1]
The figure displays the Log2 of the ratio of miR-370 in CCA vs. [score:1]
miR-370 induces growth retardation. [score:1]
Interestingly, the genomic locus of miR-370 is situated within the DLK1-DIO3 imprinted domain. [score:1]
matched normal specimensTo investigate if the lower expression of miR-370 in human CCA vs. [score:1]
To this end, we performed RT-PCR for WNT10B on HuCCT1 cells transduced with an empty vector (HuCCT1-EV) and on HuCCT1 cells transduced with miR-370 (HuCCT1-370V). [score:1]
The figure displays the mean and standard deviation of qRT-PCR-measured expression of miR-370 normalized to RNU6B for human CCA and normal liver tissues. [score:1]
0045606.g005 Figure 5Two of the four CCA tissues displayed LOH at miR-370 locus vs. [score:1]
X-axis – HuCCT1 cells counted at days 2, 4 and 6 after plating of MIEG3-miR-370 (miR-370V) HuCCT1 cells or MIEG3-EV (EV) HuCCT1 cells, respectively. [score:1]
Confirmation of imprinting status of miR-370. [score:1]
A ratio close to 1 (as shown for CCA1 and CCA2) signifies no LOH while a ratio close to 0.5 (as in CCA3 and CCA4) suggests LOH at miR-370 in CCA vs. [score:1]
miR-370 and IL-6 are inversely correlated in human CCA. [score:1]
These data suggest that hypermethylation of IG-DMR-CG6 in human CCA contributes to diminishing levels of miR-370. [score:1]
Thus, genomic locus of miR-370 appears to display LOH in 2 out of the 4 specimens tested. [score:1]
C. miR-370 and IL-6 display an inverse relationship in matched human CCA and normal specimens. [score:1]
We now report, although in a small number of CCA specimens, allelic loss of the specific genomic locus of miR-370 in approximately 50% of CCAs. [score:1]
In addition, we bring evidence suggesting that The data shown here lends support to the hypothesis that miR-370 is an important mediator of cholangiocarcinogenesis, and its loss can be explained through physiological imprinting, allelic loss, as well as IL-6 induced maternal to paternal epigenotype switch. [score:1]
miR-370 locus displays allelic loss in a subset of human CCA vs. [score:1]
normal is 0.83 and 0.96, respectively, which suggests that in these specimens, there is no LOH at miR-370 locus. [score:1]
[1 to 20 of 145 sentences]
3
[+] score: 379
MiR-370 decreases expression of the cell-cycle inhibitors p21 [Cip1] and p27 [Kip1] and increases expression of cell cycle regulator cyclin D1As miR-370 promoted cell proliferation, we explored the effect of miR-370 on expression of the genes which regulate the G1/S transition [4]– [6], including the CDK inhibitors p21 [Cip1] and p27 [Kip1] and the CDK regulator cyclin D1. [score:14]
In this study, overexpression of miR-370 increased cell proliferation and colony formation ability and decreased FOXO1 protein expression, which correlated with reduced expression of the genes regulated by FOXO1, including the cell-cycle inhibitors p21 [Cip1] and p27 [Kip1], and upregulation of the cell-cycle regulator cyclin D1. [score:14]
We demonstrated that miR-370 promoted prostate cancer cell proliferation by directly targeting the 3′-UTR of FOXO1 mRNA, which subsequently reduced expression of the cyclin -dependent kinase (CDK) inhibitors, p27 [Kip1] and p21 [Cip1], and upregulated the cell-cycle regulator cyclin D1. [score:12]
FOXO1 is downregulated in prostate cancer cells (Figure S1A and Figure 1A); which is likely to be linked to upregulation of miR-370 in prostate cancer cells (Figure 1), which would reduce expression of the miR-370 target gene FOXO1. [score:11]
We observed that FOXO1 is downregulated in prostate cancer cells (Figure S1A and Figure 1A); confirming that overexpression of miR-370 downregulates the miR-370 target gene FOXO1 in prostate cancer cells. [score:11]
Ectopic overexpression of FOXO1 (without the 3′UTR) significantly abrogated miR-370 -induced proliferation, whereas transfection of the FOXO1 3′UTR (containing the 3′UTR) only partially reduced miR-370 -induced proliferation, suggesting that miR-370 increases the proliferation of prostate cancer cells by directly targeting the FOXO1 3′-UTR to downregulate FOXO1. [score:9]
MiR-370 upregulated the cell-cycle regulator cyclin D1 by directly targeting the FOXO1 3′-UTR, demonstrating that FOXO1 is regulated by miR-370 in prostate cancer cells. [score:9]
Upregulation of miR-370 promoted the G1/S cell cycle transition in prostate cancer cells, which correlated with downregulation of the cyclin -dependent kinase (CDK) inhibitors p27 [Kip1] and p21 [Cip1]. [score:9]
GFP protein expression was dramatically inhibited by ectopic expression of miR-370 in PC3 and DU145 cells, compared to the control plasmid GFP-γ-tubulin, suggesting that miR-370 specifically targets the FOXO1 3′ UTR. [score:8]
This study suggests that upregulation of miR-370 may provide an alternative mechanism for the reduced expression of the FOXO1 tumor suppressor protein in prostate cancer cells. [score:8]
Transfection of a miR-370 inhibitor restored the luciferase activity of the pGL3-FOXO1-3′UTR reporter plasmid in PC3 and DU145 prostate cancer cells (Figure 5A), and upregulated FOXO1 protein expression (Figure 5B). [score:8]
As miR-370 promoted cell proliferation, we explored the effect of miR-370 on expression of the genes which regulate the G1/S transition [4]– [6], including the CDK inhibitors p21 [Cip1] and p27 [Kip1] and the CDK regulator cyclin D1. [score:7]
A. MiR-370 decreases expression of the cell-cycle inhibitors p21 [Cip1] and p27 [Kip1] and increases expression of cell cycle regulator cyclin D1. [score:7]
As shown in Figure 4B, Figure S2A and Figure 4C, ectopic expression of miR-370 decreased the protein and mRNA expression levels of FOXO1 in PC3 and DU145 cells, indicating that FOXO1 is a potential miR-370 target gene. [score:7]
We identified the tumor suppressor gene FOXO1 as a putative miR-370 target gene using bioinformatic analysis, and confirmed that FOXO1 is a bona fide target of miR-370. [score:7]
Conversely, inhibition of miR-370 reduced prostate cancer cell proliferation, upregulated p27 [Kip1] and p21 [Cip1], and delayed the G1/S transition. [score:6]
Coincident with altered expression of cell-cycle regulators, the phosphorylation level of Rb, a downstream target protein of CDK, was significantly increased in miR-370 -transfected cells (Figure 2C), further confirming that miR-370 can influence the proliferation of prostate cancer cells. [score:6]
In the current study, publicly available algorithms (TargetScan, Pictar, miRANDA) indicated that miR-370 may directly target the 3`-UTR of FOXO1. [score:6]
Using and real-time PCR analysis, we observed that p21 [Cip1] and p27 [Kip1] protein and mRNA were downregulated and cyclin D1 protein and mRNA were upregulated in miR-370 -transfected cells, compared to NC -transfected cells (Figure 2C and 2D). [score:6]
In parallel, our analysis using three publicly available algorithms (TargetScan, Pictar, miRANDA) demonstrated that miR-370 may directly target the 3′-UTR of FOXO1 (Figure 4A). [score:6]
Taken together, these results indicate that inhibition of miR-370 upregulated FOXO1. [score:6]
MiR-370 downregulates FOXO1 by directly targeting the FOXO1 3′UTR. [score:6]
As expected, inhibition of miR-370 increased the transcription of p21 [Cip1] and p27 [Kip1] and reduced the expression of cyclin D1 mRNA (Figure 3A). [score:5]
Further research is still required to examine whether other miRNAs or signaling pathways can regulate FOXO1 in prostate cancer, because we could not exclude that there might be other microRNAs, not found yet, to play an important role in regulating FOXO1 in prostate cancer, and whether miR-370 can target other members of the FOXO family. [score:5]
Moreover, ectopic expression of miR-370 in PC3 and DU145 prostate cancer cells significantly enhanced the anchorage-independent growth ability and lead to increased colony numbers and size in the soft agar colony formation assay (Figure 1F), suggesting that upregulation of miR-370 increased prostate cancer cell tumorigenicity in vitro. [score:5]
C, analysis indicating decreased expression of p21 [Cip1], p27 [Kip1] and increased expression of cyclin D1 and phosphorylated Rb (p-Rb) in PC3 and DU145 cells transfected with miR-370 or NC 48 hours after transfection. [score:5]
Furthermore, ectopic overexpression of miR-370 significantly increased the growth of PC3 and DU145 cells, while suppression of miR-370 slowed proliferation and reduced colony-forming ability. [score:5]
Inhibition of miR-370 suppresses the growth of prostate cancer cells. [score:5]
Real-time PCR analysis revealed that miR-370 expression was markedly increased in all five prostate cancer cell lines tested (Tsu-Pr1, PC3, DU145, 22Rv1 and LNCaP), compared to normal prostate epithelial (PrEC ) cells (Figure 1A), indicating that miR-370 is upregulated in prostate cancer cell lines. [score:5]
To confirm the effect of miR-370 overexpression in prostate cancer cells (Figure 1), we quantified the expression of FOXO1 in prostate cancer cells. [score:5]
These results demonstrated that upregulation of miR-370 promotes the proliferation of prostate cancer cells. [score:4]
MiR-370 directly targets the transcription factor FOXO1 in prostate cancer cellsA previous study revealed that FOXO1 can regulate a series of genes relevant to the cell cycle at a transcriptional level, including p21 [Cip1], p27 [Kip1] and cyclin D1 mRNA. [score:4]
In conclusion, these results suggest that miR-370 -induced prostate cancer cell proliferation is directly mediated by suppression of FOXO1. [score:4]
Taken together, these experiments demonstrated that upregulation of miR-370 promoted the proliferation and transformation of prostate cancer cells. [score:4]
Upregulation of miR-370 promotes the proliferation of prostate cancer cells. [score:4]
This data indicated that miR-370 may modulate the expression of p27 [Kip1], p21 [Cip1] and cyclin D1 by regulating FOXO1. [score:4]
Additionally, the upregulation of miR-370 may correlate with clinical progression in prostate cancer. [score:4]
Collectively, these findings suggest that upregulation of miR-370 may promote the initiation and progression of prostate cancer. [score:4]
D, analysis of GFP reporter gene expression in miR-370 or NC -transfected cells 48 hours after transfection. [score:3]
Understanding the PrECise role played by miR-370 in prostate cancer progression will not only advance our knowledge of prostate cancer biology, but also will help determine if miR-370 has potential as a novel therapeutic target for the treatment of prostate cancer. [score:3]
A. analysis of FOXO1 expression of PC3 and DU145 cells transfected with miR-370 mimic or negative control (NC) on day 10. [score:3]
Collectively, this data suggested that overexpression of miR-370 may enhance the proliferation of prostate cancer cells by promoting the G1/S cell cycle transition. [score:3]
Inhibition of miR-370 activates the FOXO1 pathway. [score:3]
In this study, we demonstrated that miR-370 is upregulated in prostate cancer cell lines, compared to primary normal prostate epithelial cells. [score:3]
In particular, after transfection of a FOXO1 reporter gene and miR-370 into PC3 and DU145 prostate cancer cells, luciferase activity could be restored by overexpression of FOXO1 and partially rescued by transfection of the FOXO1-3′-UTR (Figure 6B). [score:3]
Real-time PCR analysis of p21 [Cip1], p27 [Kip1] and cyclin D1 mRNA in PC3 and DU145 cells transfected with miR-370 inhibitor or negative control (NC) 48 hours after transfection. [score:3]
Furthermore, inhibition of miR-370 consistently and dose -dependently increased the luciferase activity of pGL3-FOXO1-3′UTR in both prostate cancer cell lines (Figure 5C). [score:3]
MiR-370 is upregulated in prostate cancer cell lines. [score:3]
Overexpression of miR-370 increases proliferation and enhances tumorigenicity. [score:3]
These results demonstrated that FOXO1 is a bona fide target of miR-370. [score:3]
Figure S2 Targeting effect of miR-370 on FOXO1 in prostate cancer cells on day 10. [score:3]
0045825.g003 Figure 3Real-time PCR analysis of p21 [Cip1], p27 [Kip1] and cyclin D1 mRNA in PC3 and DU145 cells transfected with miR-370 inhibitor or negative control (NC) 48 hours after transfection. [score:3]
Moreover, using the MTT assay, we discovered that ectopic expression of the hsa-miR-370 inhibitor reduced the growth of PC3 and DU145 prostate cancer cells, compared to NC -transfected cells (Figure 3C). [score:3]
B, analysis of FOXO1 expression in miR-370 or negative control (NC) -transfected PC3 and DU145 cells 48 hours after transfection. [score:3]
Overexpression of miR-370 promotes the G1/S cell cycle transition in prostate cancer cells. [score:3]
In summary, the key finding of the current study is that miR-370 can increase the proliferation of prostate cancer cell lines by targeting FOXO1. [score:3]
Inhibition of miR-370 reduces the proliferation of prostate cancer cells. [score:3]
However, it remained unknown whether inhibiting miR-370 would reduce cell proliferation. [score:3]
B, Flow cytometric analysis of PC3 and DU145 cells transfected with miR-370 inhibitor or NC 48 hours after transfection. [score:3]
The miR-370 mimics, negative control and anti-miR-370 inhibitor were purchased from RiboBio (Guangzhou, Guangdong, China). [score:3]
These observations indicate that activation of FOXO1 by inhibition of miR-370 may be a potential therapeutic strategy for prostate cancer. [score:3]
Furthermore, the growth rate of both PC3 and DU145 prostate cancer cells was inhibited to a significantly greater extent by co-transfection of miR-370 and FOXO1 than co-transfection of FOXO1-3′-UTR and miR-370 (Figure 6C). [score:3]
E, Upregulation of miR-370 promoted prostate cancer cell tumorigenicity; representative micrographs (left) and quantification of colonies containing more than 50 cells (middle) or colonies larger than 0.1 mm (right) in the anchorage-independent growth assay. [score:3]
The miRNA expression levels were defined based on the threshold cycle (C [t]), and the relative expression levels were calculated as 2 [−[(Ct of miR-370) – (Ct of U6)]]. [score:3]
Additionally, inhibition of miR-370 significantly increased the percentage of cells in the G0/G1 phase and decreased the percentage of cells in the S phase (Figure 3B). [score:3]
MiR-370 directly targets the transcription factor FOXO1 in prostate cancer cells. [score:3]
Additionally, as shown in Figure 3D, inhibition of miR-370 decreased the colony number and colony sizes of PC3 and DU145 cells in the colony formation assay, and also markedly reduced the anchorage-independent growth ability of both cell lines. [score:2]
Our results suggest that miR-370 may play an important role in the development and progression of prostate cancer. [score:2]
Furthermore, the repressive effect of miR-370 on the FOXO1 3′-UTR was abrogated by point mutations in the miR-370 -binding seed region of the FOXO1 3′-UTR (Figure 4E). [score:2]
A, Sequence of the FOXO1 3′UTR miR-370 binding seed region and mutation of the FOXO1 3′-UTR seed region to create FOXO1-mu. [score:2]
0045825.g005 Figure 5Relative luciferase activity assay of PC3 and DU145 cells co -transfected with the pGL3-FOXO1-3′UTR plasmid and increasing amounts (20, 50 nM) of miR-370 mimic- or miR-370 inhibitor-oligonucleotides, 48 hours after transfection, respectively. [score:2]
Furthermore, the proportion of Ki-67 positive cells, a known indicator of proliferating cells, was significantly increased in cells ectopically expressing miR-370, compared to NC -transfected cells (Figure 1D). [score:2]
C, Colony formation assay of miR-370 overexpressing cells; representative micrographs (left) and quantification (right) of crystal violet stained cell colonies. [score:2]
We observed that miR-370 was significantly overexpressed in prostate cancer cell lines, compared to PREC. [score:2]
C, MTT assays revealed that inhibition of miR-370 reduced cell growth. [score:2]
C, Luciferase activity assay of PC3 and DU145 cells transfected with the pGL3-FOXO1-3′UTR plasmid and increasing amounts (20, 50 nM) of miR-370 inhibitor-oligonucleotides 48 hours after transfection. [score:2]
Relative luciferase activity assay of PC3 and DU145 cells co -transfected with the pGL3-FOXO1-3′UTR plasmid and increasing amounts (20, 50 nM) of miR-370 mimic- or miR-370 inhibitor-oligonucleotides, 48 hours after transfection, respectively. [score:2]
The expression levels of miR-370 were quantified using a miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). [score:2]
This data indicates that miR-370 plays an essential role in the regulation of prostate cancer cell proliferation and may function as an onco-miRNA. [score:2]
, Flow cytometric analysis of PC3 and DU145 cells transfected with miR-370 mimic or negative control (NC) 48 hours after transfection. [score:1]
Using MTT and colony formation assays, we observed that the growth rate of miR-370 overexpressing cells was dramatically increased, compared to negative control (NC) -transfected prostate cancer cells (Figure 1B and 1C). [score:1]
To investigate whether FOXO1 could repress miR-370 -induced proliferation, FOXO1 (without the 3′-UTR) and FOXO1-3′-UTR (with the 3′-UTR) were transfected into miR-370 -overexpressing prostate cancer cells. [score:1]
As described above, miR-370 plays a critical role in the proliferation of prostate cancer cells. [score:1]
Transfection of miR-370 consistently and dose -dependently reduced the luciferase activity of the FOXO1 3′-UTR luciferase reporter plasmid in PC3 and DU145 prostate cancer cells (Figure 4E). [score:1]
To confirm the function of the putative miR-370 binding site in the FOXO1 3′-UTR, we cloned the FOXO1 3′-UTR into the reporter plasmids pEGFP-C3 and pGL3. [score:1]
A, Real-time PCR analysis of miR-370 expression in normal prostate epithelial cells (PrECs; shown as N1 and N2) and prostate cancer cell lines including PC3, DU145, 22Rv1 and LNCaP cells B, MTT assays indicating that the proliferation of miR-370 -transfected cells increased, compared to negative control (NC) -transfected cells. [score:1]
0045825.g001 Figure 1 A, Real-time PCR analysis of miR-370 expression in normal prostate epithelial cells (PrECs; shown as N1 and N2) and prostate cancer cell lines including PC3, DU145, 22Rv1 and LNCaP cells B, MTT assays indicating that the proliferation of miR-370 -transfected cells increased, compared to negative control (NC) -transfected cells. [score:1]
0045825.g002 Figure 2, Flow cytometric analysis of PC3 and DU145 cells transfected with miR-370 mimic or negative control (NC) 48 hours after transfection. [score:1]
D, Real time PCR analysis of p21 [Cip1], p27 [Kip1] and cyclin D1 mRNA in PC3 and DU145 cells transfected with miR-370 or NC 48 hours after transfection. [score:1]
C, Relative FOXO1 reporter activities in miR-370 or NC -transfected cells 48 hours after transfection. [score:1]
MiR-370 -overexpressing PC3 and DU145 cells had a significantly lower percentage of cells in the G1/G0 phase and increased percentage of cells in the S phase, compared to NC -transfected cells (Figure 2A). [score:1]
E, Relative luciferase activity of PC3 or DU145 prostate cancer cells co -transfected with increasing amounts of miR-370 mimic oligonucleotides (20, 50 nM), and the pGL3 control reporter, pGL3-FOXO1-3′UTR reporter, or pGL3-FOXO1-3′UTR-mu reporter, 48 hours after transfection, respectively. [score:1]
D, Quantification of Ki-67 positive cells in PC3 and DU145 cells transfected with miR-370 mimic or negative control (NC) 48 hours after transfection. [score:1]
[1 to 20 of 93 sentences]
4
[+] score: 328
To determine whether miR-370 conferred to the tumor-suppressive effect of KCNQ1OT1’s inhibition, we transfected over -expression of miR-370 or miR-370 inhibitors into the stable sh-KCNQ1OT1 cells prior to the assessment of cell proliferation, apoptosis, migration and invasion. [score:9]
The nude mice were divided into four groups: control group (only U87 or U251), sh-KCNQ1OT1 group (sh-KCNQ1OT1 stable expression U87 or U251 cells), miR-370 group (miR-370 stable over -expression U87 or U251 cells) and sh-KCNQ1OT1 + miR-370 group (KCNQ1OT1 inhibition and miR-370 over -expression stable U87 and U251 cells). [score:9]
KCNQ1OT1 Inhibition Combined with miR-370 Over-Expression Significantly Reduced Tumor Growth In VivoAs shown in Figures 8A,B, knockdown of KCNQ1OT1 or over -expression of miR-370 reduced tumor growth. [score:8]
Figure 4F showed that CCNE2 protein expression was robustly decreased in sh-KCNQ1OT1 + pre-miR-370 group, while anti-miR-370 rescued sh-KCNQ1OT1 induced down-regulation of CCNE2 protein expression (P < 0.05). [score:8]
Overexpression of miR-370 and downregulation of its novel target TGFbeta-RII contribute to the progression of gastric carcinoma. [score:8]
Furthermore, KCNQ1OT1 inhibition combined with miR-370 over -expression significantly decreased CCNE2 and increased p-YAP expression. [score:7]
In addition, the KCNQ1OT1 knockdown up-regulated miR-370, which was lowly expressed in glioma tissues and cells. [score:7]
Therefore, phosphorylated YAP expression were detected in cells treated with KCNQ1OT1 inhibition, miR-370 restoration and co -transfected KCNQ1OT1 inhibition and miR-370 restoration glioma cells. [score:7]
Figure 3 MiR-370 targeted KCNQ1OT1 and its expression was negatively correlative with KCNQ1OT1, miR-370 was involved in KCNQ1OT1 -mediated regulation of human glioma cells. [score:6]
We have demonstrated that KCNQ1OT1 regulated CCNE2 expression via decreasing miR-370 expression. [score:6]
MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells. [score:5]
We first examined the expression of miR-370 in KCNQ1OT1 inhibition glioma cells. [score:5]
As shown in Figure 7D, p-YAP expression was up-regulated in sh-KCNQ1OT1 group and pre-miR-370 group compared with control group (P < 0.05). [score:5]
In conclusion, our study demonstrated that knockdown of KCNQ1OT1 inhibited glioma cells malignancy by up -regulating miR-370. [score:5]
Further, as shown in Figure 3A, we found KCNQ1OT1 expression was negatively correlated with miR-370 expression in glioma cells (P < 0.01). [score:5]
MicroRNA-370–3p inhibits human glioma cell proliferation and induces cell cycle arrest by directly targeting beta-catenin. [score:5]
As expected, phosphorylated YAP expression was predominantly increased in cells co -transfected with KCNQ1OT1 inhibition and miR-370 restoration. [score:5]
CCNE2 protein levels were also examined in overexpressed or inhibited miR-370 cells. [score:5]
In most cases, miR-370 is lowly expressed and exerts tumor-suppressive role in tumor cells (Lo et al., 2012; Chen et al., 2014). [score:5]
Having confirmed CCNE2 was up-regulated in glioma cells and participated in KCNQ1OT1/miR-370 regulating glioma cells’ malignancy, we examined the effect of CCNE2 on glioma cells’ biological behaviors. [score:5]
Moreover, miR-370 suppressed glioma cells’ malignant biological behaviors by targeting CCNE2, and further activated Hippo pathway. [score:5]
Short-hairpin KCNQ1OT1 (sh-KCNQ1OT1) plasmid and its respective non -targeting sequence (negative control, sh-NC), miR-370 agomir (pre-miR-370), miR-370 antagomir (anti-miR-370) and their respective non -targeting sequence (negative control, NC; pre-NC or anti-NC) were synthesized as previously described (GenePharma, Shanghai, China; Zhou et al., 2009; Wang and Li, 2010; Wang et al., 2012). [score:5]
CCNE2 was a target of miR-370, both KCNQ1OT1 and miR-370 could modulate CCNE2 expression. [score:5]
In addition, it has been confirmed that miR-370 inhibits glioma cells’ proliferation via targeting cyclin D1 and c-myc. [score:5]
KCNQ1OT1 Inhibition Combined with miR-370 Over-Expression Significantly Reduced Tumor Growth In Vivo. [score:5]
Further, KCNQ1OT1 negatively regulated miR-370, and miR-370 inversely modulated KCNQ1OT1 expression. [score:4]
A latest study shows that miR-370 is down-regulated in human glioma tissues cells (Peng et al., 2016). [score:4]
As shown in Figures 8A,B, knockdown of KCNQ1OT1 or over -expression of miR-370 reduced tumor growth. [score:4]
More importantly, miR-370 has been confirmed to be down-regulated in glioma and reduces glioma cells growth (Peng et al., 2016). [score:4]
MiR-370 Mediated the Tumor-Suppressive Effect of KCNQ1OT1’s Inhibition on Glioma Cells. [score:4]
An earlier study has shown miR-370 was down-regulated in glioma tissues and cells (Peng et al., 2016). [score:4]
CCNE2 is a direct target of miR-370. [score:4]
We further discovered that miR-370 played a tumor-suppressive role by down -regulating CCNE2 in glioma cells. [score:4]
Figure 7 MiR-370 inhibited human glioma cells malignant progression via targeting to CCNE2 3′-UTR. [score:4]
KCNQ1OT1 and miR-370 negatively regulated their respective expression. [score:4]
As shown in Figure 3E, sh-KCNQ1OT1 cells co -transfected with over -expression of miR-370 had the strongest inhibitory effect on cell proliferation compared with sh-NC + pre-NC group at different times (P < 0.05). [score:4]
MiR-370 targeted CCNE2 3′-UTR and impaired its expression. [score:4]
Similarly, the survival analysis demonstrated both KCNQ1OT1 inhibition and miR-370 restoration prolonged survival period compared with control group, and as expected, KCNQ1OT1 inhibition combined with miR-370 reintroduction contributed to the longest survival period (Figure 8C). [score:4]
As expected, CCNE2 protein level was attenuated in pre-miR-370 group, while it was up-regulated in anti-miR-370 group (Figure 4E; P < 0.05). [score:4]
The in vivo study demonstrated knockdown of KCNQ1OT1 combined with miR-370 over -expression produced the smallest tumor and the longest survival period in nude mice. [score:4]
We hypothesized KCNQ1OT1/miR-370/CCNE2 might exert crucial function in glioma cells progression and might be a novel therapeutic target. [score:3]
After infection, the stable expressing cells of miR-370 and sh-KCNQ1OT1 were obtained. [score:3]
Over-Expression of miR-370 Impaired Cell Proliferation, Migration and Invasion, While Promoted Apoptosis of Glioma Cells. [score:3]
Further, we examined the expression of CCNE2 protein in cells treated with KCNQ1OT1 or miR-370. [score:3]
As expected, our results showed that overexpression of miR-370 restrained glioma cells’ malignant progression, including cell proliferation, migration and invasion, while promoting apoptosis. [score:3]
Thus, therapy targeting KCNQ1OT1/miR-370/CCNE2 axis may be a promising option for the treatment of human gliomas. [score:3]
High Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA, USA) and Taqman Universal Master Mix II (Life Technologies Corporation, Carlsbad, CA, USA) were used to examine the expression levels of miR-370 and U6 (Applied Biosystems, Foster City, CA, USA) levels. [score:3]
CCNE2 was identified as one of the downstream genes of miR-370 by Bioinformatics database (Targetscan, miRanda and Starbase). [score:3]
Reintroduction of miR-370 Impaired CCNE2-Induced Promotion Effects on Glioma U87 and U251 Cells by Targeting CCNE2 3′-UTR. [score:3]
In most cases, miR-370 serves as a tumor-suppressive gene in tumors such as liver cancer and osteosarcoma (Duan et al., 2015; Sun G. et al., 2016). [score:3]
To discover whether CCNE2 reversed miR-370 -mediated blocking of glioma U87 and U251 cells’ malignant evolution in a sequence-specific manner, we analyzed proliferation, migration, invasion and apoptosis of U87 and U251 which stably expressed miR-370 + CCNE2 (non-3′UTR). [score:3]
The miR-370 and short-hairpin RNA targeting human KCNQ1OT1 were ligated into the pLenti6.3/V5eDEST vector and LV3-CMV-GFP-Puro vector (GenePharma, Shanghai, China), respectively, and then pLenti6.3/V5eDEST-miR-370 and LV3-CMV-GFPPuro-sh-KCNQ1OT1 vectors were generated. [score:3]
Also, CCNE2 inversed miR-370 -induced suppression on glioma cells malignant behavior. [score:3]
In our study, three kinds of bioinformatics softwares indicated CCNE2 was a target of miR-370. [score:3]
Besides, p-YAP expression was robustly increased in sh-KCNQ1OT1 + pre-miR-370 group. [score:3]
Therefore, we detected p-YAP and YES -associated protein (YAP) expression in cells treated with KCNQ1OT1 and miR-370. [score:3]
We used a bioinformatics database (Starbase) to infer the potential targets of miR-370. [score:3]
Further, knockdown of KCNQ1OT1 combined with over -expression of miR-370 exhibited the smallest tumor compared with each group in the experiment (P < 0.05). [score:3]
Taken together, the KCNQ1OT1/miR-370/CCNE2 axis might exert an important role in human glioma tumorigenesis and malignant progression, which provided a novel promising therapeutic target. [score:3]
MicroRNA-370 suppresses proliferation and promotes endometrioid ovarian cancer chemosensitivity to cDDP by negatively regulating ENG. [score:3]
KCNQ1OT1 was identified as a potential target and harbored one putative binding site of miR-370. [score:3]
Aberrant expression of miR-370 has been reported in various cancers. [score:3]
These results supported our assumption that KCNQ1OT1 promoted glioma cells progression via decreasing miR-370 expression. [score:3]
Therefore miR-370 might act as a tumor suppressor in glioma cells. [score:3]
The mechanism underlying tumorgenesis of human glioma cell lines by KCNQ1OT1 is schematically presented in Figure 9. Figure 9 The schematic cartoon of the mechanism of KCNQ1OT1 negatively regulated miR-370/CCNE2 axis in glioma. [score:2]
MiR-370 is first identified as a tumor-suppressor in human cholangiocytes, and is found to be methylated by Interleukin-6 (Meng et al., 2008). [score:2]
This may partially declare the underlying mechanism of KCNQ1OT1/miR-370 regulation on glioma cells. [score:2]
As shown in Figure 3A, miR-370 expression was increased in sh-KCNQ1OT1 group compared with sh-NC group (P < 0.01). [score:2]
These results demonstrated an insight into the mechanism of KCNQ1OT1 negatively regulating miR-370. [score:2]
Similarly, knockdown of KCNQ1OT1 combined with restoration of miR-370 robustly decreased migrating and invading glioma cells (Figure 3G; P < 0.05). [score:2]
Knockdown of KCNQ1OT1 combined with miR-370 significantly restrained malignant behaviors of glioma cells in vitro and reduced tumor growth in vivo. [score:2]
Epigenetic regulation of microRNA-370 by interleukin-6 in malignant human cholangiocytes. [score:2]
Meanwhile, over -expression of miR-370 led to an increased ratio in apoptosis compared with pre-NC group (Figure 2B; P < 0.05). [score:2]
Whole cell lysates from the control groups and miR-370 groups were incubated with RIP immunoprecipitation buffer containing magnetic beads conjugated with human anti-Argonaute 2 antibody (Millipore, Billerica, MA, USA) and the negative control (normal mouse IgG; Millipore, Billerica, MA, USA). [score:1]
In addition, the restoration of miR-370 reduced glioma cells proliferation. [score:1]
Our results showed KCNQ1OT1 exerted oncogenic role while miR-370 exerted the opposite function in glioma cells. [score:1]
There was a specific binding site between KCNQ1OT1 and miR-370. [score:1]
The cells were divided in five groups respectively: control group, KCNQ1OT1-Wt + miR-370-NC (transfected with KCNQ1OT1-Wt and pre-NC), KCNQ1OT1-Wt + miR-370 group (transfected with KCNQ1OT1-Wt and pre-miR-370), KCNQ1OT1-Mut + miR-370-NC group (transfected with KCNQ1OT1-Mut and pre-NC), KCNQ1OT1-Mut + miR-370 group (transfected with KCNQ1OT1-Mut and pre-miR-370); Control group, CCNE2-Wt + miR-370-NC (transfected with CCNE2-Wt and pre-NC), CCNE2-Wt + miR-370 group (transfected with CCNE2-Wt and pre-miR-370), CCNE2-Mut + miR-370-NC group (transfected with CCNE2-Mut and pre-NC), CCNE2-Mut + miR-370 group (transfected with CCNE2-Mut and pre-miR-370). [score:1]
Control group); P < 0.01 (pre-miR-370 + sh-KCNQ1OT1 group vs. [score:1]
CCNE2-Wt + miR-370-NC group. [score:1]
We further explored miR-370’s detailed function in glioma cells. [score:1]
HEK-293T cells were seeded in 96-well plates and the cells were co -transfected with KCNQ1OT1-Wt (or KCNQ1OT1-Mut) or CCNE2-Wt (or CCNE2-Mut) and miR-370 or miR-370-NC plasmids when they reached 50%–70% confluence. [score:1]
As shown in Figure 3D, KCNQ1OT1 and miR-370 were both detected in anti-Ago2 group (P < 0.01). [score:1]
However, the underlying mechanism between miR-370 and CCNE2 remained unclear. [score:1]
The lentiviruses of miR-370 were transduced in sh-KCNQ1OT1 stably transfected cells to generate miR-370 + sh-KCNQ1OT1 cells. [score:1]
In the present study, we investigated the expression and function of KCNQ1OT1, miR-370 and CCNE2 in glioma tissues and cells. [score:1]
miR-370 + CCNE2 group. [score:1]
Bioinformatics software (Starbase) indicated KCNQ1OT1 might harbor a binding site of miR-370. [score:1]
Sh-KCNQ1OT1 group and pre-miR-370 group. [score:1]
KCNQ1OT1 and miR-370 expression levels were measured using qRT-PCR (Data represent mean ± SD (n = 5, each group). [score:1]
Briefly, to explore whether KCNQ1OT1 and miR-370 were associated with the RISC, we performed RNA immunoprecipitation. [score:1]
CCNE2 was Involved in KCNQ1OT1/miR-370-Mediated Glioma Cells Malignant Progression. [score:1]
But the detailed function of miR-370 still needs to be explored. [score:1]
pre-miR370 group; [▲] P < 0.05 vs. [score:1]
Further, luciferase reporter results confirmed the binding site between miR-370 and CCNE2. [score:1]
Lentivirus encoding miR-370 was generated using pLenti6.3/V5eDEST Gateway Vector Kit (Life Technologies Corporation, Carlsbad, CA, USA). [score:1]
Figure 2 Effect of miR-370 on proliferation, migration, invasion and apoptosis of human glioma cells. [score:1]
Consistent with previously reported, CCK-8 assay indicated over -expression of miR-370 restrained the proliferation of U87 and U251 cells compared with pre-NC group at different times (Figure 2A; P < 0.05). [score:1]
KCNQ1OT1-WT + miR-370-NC group. [score:1]
We further performed RNA -binding protein immunoprecipitation (RIP) experiment to ascertain whether KCNQ1OT1 and miR-370 were in a RNA -induced silencing complex (RISC). [score:1]
P < 0.05 (pre-miR-370 or sh-KCNQ1OT1 group vs. [score:1]
[1 to 20 of 101 sentences]
5
[+] score: 243
Taken together, miR-370 may function as a tumor suppressor by targeting FoxM1, and the epigenetic silence of miR-370 thus leads to derepression of FoxM1 expression and consequently contributes to AML development and progression. [score:8]
Moreover, when HL60 and K562 cells were treated with 5-aza-2 [′]-deoxycytidine, a DNA methylation inhibitor, miR-370 expression was up-regulated, which indicates epigenetic silencing of miR-370 in leukemic cells. [score:8]
Figure 2 Suppression of AML cell proliferation and induction of cell senescence by overexpression of miR-370 in vitro while anti-miR-370 expression increases cellular ability of proliferation. [score:7]
On the other hand, transfection with the miR-370 inhibitor suppressed mature miR-370 expression to 31% ± 0.04 (p < 0.05) and 58% ± 0.05 (p < 0.05) lower in HL60 and K562 cells, respectively (Figure 2B). [score:7]
We found that the down-regulation of miR-370 expression was a frequent event in both leukemia cell lines and primary leukemic cells from patients with de novo AML. [score:6]
Up-regulation of miR-370 expression mediated by 5-Aza-CdR. [score:6]
Down-regulation of miR-370 expression in BM blasts from de novo AML patients. [score:6]
All these results suggest that downregulation of miR-370 may be another mechanism involved in the pathology of AML and therefore, could be used as a diagnostic marker and therapeutic target in AML. [score:6]
The decline in miR-370 expression was coupled with enhanced cell proliferation (Figure 2C) (pSuper vs pSuper-miR -inhibitor: HL60: 56 ± 7 vs 72 ± 6, p < 0.05; K562: 66 ± 12 vs 93 ± 7, p < 0.05). [score:5]
Finally, we assessed the effect of miR-370 expression on FoxM1 expression. [score:5]
Cells were transfected with precursors to miR-370 and miR-370 inhibitor to enhance and decrease mature miR-370 expression, respectively. [score:5]
We demonstrate that miR-370 is a tumor suppressive factor by targeting multiple critical oncogenic pathways. [score:5]
We have also analyzed the correlation between miR-370 expression and FoxM1 mRNA expression in 48 de novo AML samples. [score:5]
Treatment with 5 μM 5-aza-CdR, a DNA methylation inhibitor, for 72 hours, substantially (>2.0-fold) and significantly (P < 0.05) increased the expression of miR-370 in both HL60 and K562 cells (Figure 3A) and decreased cell proliferation (Figure 3D) (control vs CdR: HL60: 24 ± 4 vs 7 ± 2, p < 0.01; K562: 152 ± 5 vs 78 ± 5, p < 0.001). [score:5]
Moreover, we identified FoxM1 as a target for miR-370 and restored expression of miR-370 reduced the level of FoxM1. [score:5]
There was a >2-fold increase in expression of FoxM1 in HL60 and K562 cells after transfection of miR370 inhibitor plasimids (Figure 4E). [score:5]
K562 cells were plated in 24-well plates, and then transfected with 0.05 μg of a Renilla luciferase expression construct pRL-TK and 0.5 μg of the pGL3-FoxM1-wt-luc or pGL3-FoxM1-mut-luc firefly luciferase expression construct, along with either miR-370 precursor or control precursor. [score:5]
We further wanted to define the mechanism behind miR-370 overexpression -mediated proliferation inhibition. [score:5]
miR-370 has been noted to be down-regulated in papillary thyroid carcinoma, colorectal cancer [17] and malignant cholangiocytes [18], but evidence of a biological role for this miRNA in AML has not been reported. [score:4]
Our findings show a down-regulation of miR-370 in blasts from patients with de novo AML. [score:4]
In the present study, we haven’t got the conclusion that the expression level of miR-370 is with AML subtype-specificity, which may be due to the limited number of primary AML patients enrolled in our study. [score:3]
Efficient miR-370 overexpression was verified in Figure 2 (A). [score:3]
The comparison of the leukemia samples with healthy controls highlighted the differential expression of miR-370. [score:3]
Figure 4 Identification of FoxM1 as a target of miR-370. [score:3]
The comparison of foci numbers, β-Gal -positive cells, luciferase activity and miR-370, FoxM1, c-myc, hTERT, p27, skp2 mRNA expression after different treatments was made using a Student’s t-test. [score:3]
Figure 3 Expression of miR-370 in AML cells (HL60 and K562) and the effect of 5-aza-2’deoxycytidine (5-Aza-CdR). [score:3]
with miR-370 precursor decreased reporter activity in K562 cells (Figure 4B), which strongly indicates that FoxM1 is a target for miR-370. [score:3]
In the present study, we explored the expression and role of miR-370 in AML. [score:3]
Our results indeed demonstrated that senescence occurred in most of AML cells treated with miR-370 overexpressing plasmid, which was concomitant with their diminished clonogenic capacity. [score:3]
Consistent with the cell line data, FoxM1 was enriched in the primary blasts mRNAs that inversely correlated to miR-370 expression levels. [score:3]
The cells were first treated as above and the efficiently changed miR-370 expression was verified in (A) and (B). [score:3]
In contrast, depletion of miR-370 expression using RNA interference enhanced the proliferation of those leukemic cells. [score:3]
Overexpression of miR-370 decreased cell proliferation (Figure 2C and Additional file 1) (pSilencer vs pSilencer-miR: HL60: 88 ± 15 vs 11 ± 4, p < 0.01; K562: 49 ± 5 vs 18 ± 5, p < 0.01). [score:3]
The expression levels of miR-370 and FoxM1 were assessed in 48 newly diagnosed AML patients, 40 AML patients in 1 [st] complete remission (CR) and 21 healthy controls. [score:3]
Taken together, FoxM1 is a target of miR-370. [score:3]
We analyzed miR-370 expression in BM samples from 48 de novo AML patients at diagnosis time using qRT-PCR. [score:3]
Figure 1 Downexpression of miR-370 in de novo AML patients. [score:3]
These changes were similar to those observed with miR-370 overexpression. [score:3]
As we have verified that FoxM1 is a target for miR-370, we then sought to probe its role in AML. [score:3]
Identification of FoxM1 as a target for miR-370. [score:3]
In six patients, BM samples were available both at diagnosis time prior to treatment and after a complete remission and we found a lower miR-370 level at diagnosis while at least 2.1-fold increase in miR-370 expression after CR (Figure 1B). [score:3]
of HL60 and K562 cells with miR-370 precursor resulted in lower expression of FoxM1 after 48 hours (Figure 4C-D). [score:3]
Proliferation curve of HL60 cell line (A) and K562 cell line (B) after transfection with miR-370 -expressing plasmid or the control pSilencer vector. [score:3]
Mechanistically, miR-370 targets the transcription factor FoxM1, a well established oncogenic factor promoting cell cycle progression. [score:3]
miR-370 inhibitor sequences were synthesized as DNA oligonucleotides; after annealing, were sticking ended and subcloned into a pSuper vector. [score:3]
Ectopic expression of miR-370 in HL60 and K562 cells led to cell growth arrest and senescence. [score:3]
The difference in miR-370 and FoxM1 mRNA expression among different patient groups as detected using qRT-PCR was analyzed using One-Way ANOVA. [score:3]
We hypothesize that miR-370 also acts as a tumor suppressor in AML, as in papillary thyroid carcinoma, colorectal cancer and malignant cholangiocytes. [score:3]
Changes in proliferation and cellular senescence of leukemic cells mediated by altered miR-370 expression. [score:3]
with the miR-370 precursor increased mature miR-370 expression 114.5 ± 5.70: 1 ± 0.12 (p < 0.05) and 59.8 ± 6.90: 1 ± 0.24 (p < 0.05) (pSilencer-miR vs pSilencer) times higher in HL60 and K562 cells, respectively (Figure 2A). [score:3]
Restoring miR-370 expression downmodulates FoxM1, induces senescence, and dampens cell growth in AML cells, thereby suggesting miRNA -based therapy as a novel approach to increase response in AML. [score:3]
The expression of mature miR-370 was assessed using real-time PCR. [score:3]
A decrease in relative firefly luciferase activity in the presence of miR-370 indicates the presence of a miR-370 modulated target sequence in the 3’-UTR of FoxM1. [score:3]
Quantitative real-time PCR, western blots, colony formation assay, and β-Galactosidase (SA -β-Gal) staining were used to characterize the changes induced by overexpression or inhibition of miR-370 or FoxM1. [score:2]
Lower levels of miR-370 expression were found in 37 of 48 leukemic samples from AML patients compared to those in bone marrow cells derived from healthy adult individuals. [score:2]
As shown in Figure 1A, the miR-370 level in patients’ samples was significantly reduced (P < 0.01, t test) compared to that from healthy controls, while following acquisition of CR in the induction chemotherapy, miR-370 expression level restored to 0.82 fold of controls. [score:2]
Next, the studies were repeated with random mutations in the recognition sequence (Figure 4A), which resulted in abolition of the reporter activation by miR-370 precursor (Figure 4B). [score:2]
Interestingly, the chromosomal location of miR-370 on chromosome 14q32.31 has been shown to be regulated by DNA methylation, or deleted by loss of heterozygosity [14, 21] or by hypermethylation of an CpG island 200 bp upstream in the mother allele [22]. [score:2]
Firefly luciferase reporter vectors with the intact putative miR-370 recognition sequence from the 3 [′]-UTR of FoxM1 (pGL3-FoxM1-wt-3 [′]-UTR) or with random mutations (pGL3-FoxM1-mut-3 [′]-UTR) cloned downstream of the firefly luciferase gene were constructed. [score:2]
Efficient miR-370 depletion was verified in Figure 2 (B)First, we made the luciferase reporter constructs containing the miR-370 recognition sequence from the 3 [′]-UTR of FoxM1 inserted downstream of the luciferase gene. [score:1]
Among those AML patients, six were analyzed for miR-370 and FoxM1 levels in their bone marrow samples at both diagnosis and complete remission. [score:1]
β-Gal staining was performed and % of positive cells was calculated The above result suggests that miR-370 suppresses proliferation of HL60 and K562 cells. [score:1]
The set includes miR-127, miR-154, miR-154*, miR-299, miR-323, miR-368, and miR-370. [score:1]
qRT-PCR was applied to detect mature miR-370 level. [score:1]
Efficient miR-370 depletion was verified in Figure 2 (B) First, we made the luciferase reporter constructs containing the miR-370 recognition sequence from the 3 [′]-UTR of FoxM1 inserted downstream of the luciferase gene. [score:1]
A positive β-Gal staining was observed in the two cell lines transfected with miR-370 precursors (Figure 2D) [pSilencer vs pSilencer-miR (% of β-Gal -positive cells): HL60: 3 ± 1 vs 28 ± 3, p < 0.01; K562: 8 ± 3 vs 40 ± 1, p < 0.01;]. [score:1]
In the present study, we sought to define the role of miR-370 in AML by investigating its expression and biological function in leukemic cell lines and blast cells from patients with de novo AML. [score:1]
β-Gal staining was performed and % of positive cells was calculatedThe above result suggests that miR-370 suppresses proliferation of HL60 and K562 cells. [score:1]
The cells were transfected with either miR-370 precursors or with control precursor and harvested after 48 hours. [score:1]
The precursor to miR-370 was synthesized and cloned in pSilencer. [score:1]
The results are shown as miRNA expression after normalization with U6 and -ΔCt calculations We then explored the biological function of miR-370 in leukemic cells. [score:1]
The FoxM1 gene has a 249-bp 3 [′]UTR region that presents a 7-mer binding site for miR-370 (Figure 4A). [score:1]
Briefly, the cells grown in 6-well plates were transfected with pSilencer or pSilencer-miR-370. [score:1]
Hypermethylation of DMR causes silence of this miRNA cluster, including miR-370. [score:1]
We suspected that miR-370 might trigger cellular senescence program. [score:1]
There was no association between the presence of mature miR-370 and age, gender, blast percentage or FAB subtypes (data not shown). [score:1]
All patients and healthy controls were tested for miR-370 and FoxM1 mRNA levels in their BM cells. [score:1]
Following the treatment with 5-aza-2 [′]-deoxycytidine, there is a significant enrichment for miR-370 in AML cell lines, which indicated that hypermethylation may contribute to reduction of miR-370. [score:1]
miR-370 and many other miRNAs are organised in clusters together on chromosome 14q32 [34]. [score:1]
[1 to 20 of 79 sentences]
6
[+] score: 183
Other miRNAs from this paper: hsa-mir-214, mmu-mir-214, mmu-mir-370
We assessed the level of expression of miR-370 and SLD5 by qRT-PCR using tumor tissue on day 20 after treatment, and confirmed overexpression of miR-370 and downregulation of SLD5 in tumors from the miR-370 -injected group. [score:8]
A miRNA-370 mimic inhibits tumor growth in vivo In vitro experiments had clearly demonstrated that overexpression of miR-370 suppresses proliferation of cancer cells. [score:7]
The results suggested that miR-370 inhibits mRNA expression in T24 cells, resulting in a reduction of SLD5 protein expression. [score:7]
After 24 hours of treatment with 5-aza, miR-370 expression was more strongly induced in cancer cells than in control cells (Fig. 6A), suggesting that its expression is suppressed in cancer cells by DNA methylation. [score:7]
We found that attenuated miR-370 expression in cancer cells is partly mediated by methylation of the miR-370 promoter, because treatment with 5-aza-2-deoxycytidine (5-aza), a specific inhibitor of DNA methylation 34, induced the expression of this miRNA. [score:7]
Consistent with this, knocking down IL-6 using siRNA resulted in reduced DNMT1 expression (Fig. 6E,F) and concurrent upregulation of miR-370 (Fig. 6G) and reduction of SLD5 (Fig. 6H). [score:7]
miR-370 downregulation results in SLD5 upregulation in human bladder cancer cells. [score:7]
In contrast, in bladder cancer cells, miR-370 is downregulated, and SLD5 expression levels are increased to induce proliferation of cancer cells. [score:6]
We analyzed whether miR-370 expression is regulated by DNA methylation by using 5-azacytidine (5-aza), an inhibitor of DNA methylation. [score:6]
These results suggest that hypermethylation caused by IL-6 induces suppression of many genes including miR-370, contributing to the upregulation of SLD5. [score:6]
As observed in the siRNA experiments (Fig. 2), miR-370 overexpression also inhibited the proliferation of bladder cancer cells (Fig. 4F). [score:5]
Because endothelial cells, blood cells (data not shown) and fibroblastic cells 33 express GINS complex gene, reduced SLD5 expression by the injection of miR-370 caused attenuation of cellular activity of those cells and cancer cell proliferation and survival could not be supported by such stromal cells. [score:5]
In vitro experiments had clearly demonstrated that overexpression of miR-370 suppresses proliferation of cancer cells. [score:5]
The results suggested that inhibition of miR-370 led to increased SLD5 mRNA and protein expression in normal cells. [score:5]
In normal cells, SLD5 expression is blocked by miR-370 expression. [score:5]
However, in cancer cells, IL-6 induces DNMT1 to inhibit miR-370 expression. [score:5]
Because miR-370 suppresses SLD5, in cancer cells SLD5 expression is restored and cells can proliferate. [score:5]
We confirmed that miR-370 expression was indeed suppressed in T24 and KMBC2 cells (Fig. 4A,B). [score:5]
Based on our results, we hypothesize that miR-370 acts as a negative regulator of SLD5 expression in normal states. [score:4]
We knocked down miR-370 in normal cell lines (HUVEC) using miR-370 inhibitor transfection methods and assessed SLD5 mRNA and SLD5 protein levels using qRT-PCR and, respectively (Supplementary Fig. 3). [score:4]
Furthermore, we identified miR-370 as a negative regulator of SLD5 gene expression. [score:4]
SLD5 mRNA expression is regulated by miR-370. [score:4]
It has also been suggested that miR-370 is normally imprinted and activated only on the maternal allele 35, so it may be predicted that miR-370 is downregulated even when CpG islands are only slightly methylated. [score:4]
Regulation of miR-370 expression in tumors. [score:4]
How to cite this article: Yamane, K. et al. Regulation of SLD5 gene expression by miR-370 during acute growth of cancer cells. [score:4]
Among several candidates, we found that a miR-370 target sequence is located at the 3′-UTR of the SLD5 gene. [score:3]
After injection of miR-370, tumor growth was clearly suppressed (Fig. 5A,B). [score:3]
A miRNA-370 mimic inhibits tumor growth in vivo. [score:3]
In Fig. 4, overexpression of miR-370 might affect not only cancer cells but other cells consisting cancer microenvironment. [score:3]
T24 cancer cells were transfected with pMIR luciferase vector with an inserted 3′-UTR region of SLD5 containing the miR-370 target sequence. [score:3]
Moreover, we confirmed that SLD5 protein was also suppressed in tumor tissue of miR-370 -injected relative to control tumors (Fig. 5C,D). [score:3]
Although we focused on miR-370, it is possible that there are multiple additional miRNAs that are relevant for SLD5 expression in vivo. [score:3]
In terms of the cell cycle, similar to the results from the SLD5 knockdown study, miR-370 mimic transfection reduced the fraction of cells in S phase relative to control miR transfection (Fig. 4I). [score:2]
Regulation of miR-370 in human bladder cancer cells. [score:2]
The 3′ UTR region of SLD5, containing miR-370 target sites, was amplified using a standard PCR protocol with the following linker primers: 5′-ATT ACT ACT AGT GCA TAA ACA GCC AGG CAT GGT GAC-3′ (forward), 5′-AAC CAT AAG CTT TAG TAG AGA TGG GTT TAG TAG AG-3′ (reverse). [score:2]
Therefore, we conclude that miR-370 directly binds to the 3′-UTR of the SLD5 gene. [score:2]
Addition of a miR-370 mimic led to reduction of the luciferase activity of the SLD5 3′-UTR, whereas miR-214 as a negative control had no affect (Fig. 4C). [score:1]
The present study revealed a relationship between SLD5 and miR-370 in human bladder cancer. [score:1]
After 24 h, miRNA was isolated and cDNA synthesized for qRT-PCR analysis of miR-370. [score:1]
Next, we investigated how miR-370 affects SLD5 expression. [score:1]
The Pre-hsa-miR-370 mimic (GeneDesign, Osaka, Japan) was transfected into T24 bladder cancer cells following the manufacturer’s instructions. [score:1]
Two weeks after transplantation, the developed tumors were treated with control scrambled RNA, SLD5 siRNA, or miR-370 mimic suspended in atelocollagen (Atelogene, KOKEN, Tokyo, Japan) to facilitate siRNA introduction into tumors, according to the manufacturer’s instructions Twenty days after atelocollagen injection, xenograft tumor volumes and weights were measured, RNA was isolated from tumors for the analysis of SLD5 or miR-370 expression by qRT-PCR, and tumor tissues were fixed in 4% paraformaldehyde for immunohistochemistry analysis. [score:1]
T24 bladder cancer cells were plated in 96-well plates and transfected with or without miR-370 mimic and luciferase vector. [score:1]
miR-370 mimics or control miR were injected on day10 post-inoculation. [score:1]
To assess this, T24 cells were inoculated into nude mice and control miR or miR-370 mixed with atelocollagen was injected into the tumors once they had reached approximately 50 mm [3] in diameter. [score:1]
Tumor growth is affected by miR-370. [score:1]
Moreover, we analyzed cell kinetics and how the cell cycle was affected by miR-370. [score:1]
To document direct binding of miR-370 to the 3′-UTR of the SLD5 gene, we performed luciferase reporter assays. [score:1]
Cells were analyzed after transfection with control or miR-370 mimic. [score:1]
Therefore, bladder cancer cells may have intrinsic signaling pathways for methylating the miR-370 promoter region. [score:1]
T24 cells were transfected with pMIR luciferase reporter containing 3′-UTR sequences of SLD5 and miR-370. [score:1]
Next, we investigated whether miR-370 can effectively inhibit tumor growth in vivo. [score:1]
Next, we investigated whether miR-370 silencing affects SLD5 expression in normal cells. [score:1]
The level of miR-370 (left) and SLD5 (right) after transfection of each miR was confirmed by qRT-PCR. [score:1]
[1 to 20 of 54 sentences]
7
[+] score: 128
This dysregulates cell survival by targeting the newly discovered targets, SHMT-2 and MECP-2, respectively; apoptosis was induced by the inhibition of miR-370 or miR-373, and also by the overexpression of SHMT-2 or MECP-2. These results suggest that the decreased functions of miR-370 and miR-373 in OA chondrocytes lead to the disinhibition of SHMT-2 and MECP-2, respectively, thereby promoting apoptotic cell death. [score:12]
Co-induction of miR-370 significantly inhibited SHMT-2 -induced MMP-13 expression and SHMT-2 -upregulated apoptosis-related gene cell death in normal chondrocytes (Fig. 4D). [score:8]
The previously identified targets for miR-370 and miR-373 were largely associated with cancer pathogenesis (e. g., oncogenes and tumor suppressors), suggesting that the utilized target genes may contribute to the tissue- and cell-type-specific performances of these miRNAs (Akhtar et al., 2010). [score:7]
miRNA inhibitor -mediated knockdown and pre-miR-370/373 -mediated upregulation of miR-370 and miR-373. [score:7]
To further test whether MECP-2 is a target of miR-370 or miR-373, we cloned the entire 3′UTR of MECP-2 into a luciferase reporter vector, electroporated the vector into chondrocytes along with the precursor of miR-370 or miR-373 or a cognate nontargeting negative control, and assayed cell lysates for luciferase expression. [score:6]
Fig 4miR-370 regulates OA pathogenesis by targeting SHMT-2. (A) Luciferase reporter activity was driven by the 3′UTR of SHMT-2 or mutated 3′UTR of SHMT-2 (3′UTR mt) with or without forced expression of miR-370 (left panel). [score:6]
Normal and OA chondrocytes were treated with a miR-370 precursor (miR-370) or an inhibitor of miR-370 (anti-miR-370), and the protein expression levels of MMP-2 and MMP-13 were analyzed by immunoblotting. [score:5]
To see whether these two OA-specific miRNAs are involved in the regulation of SHMT-2, we cloned the entire 3′UTR of SHMT-2 into a luciferase reporter vector, electroporated the vector into cells along with the precursor of miR-370 or a cognate nontargeting negative control, and assayed cell lysates for luciferase expression. [score:5]
For example, miR-370 targets FOXO1 in gastric mucosal cancer and has been associated with disease progression (Voorhoeve et al., 2007). [score:5]
On the other hand, inhibition of miR-370 in OA chondrocytes increased the expression levels of these proteins. [score:5]
In sum, we herein show for the first time that miR-370 and miR-373 directly target and negatively regulate SHMT-2 and MECP-2, respectively, in human articular chondrocytes, where they contribute to the pathogenesis of OA. [score:5]
Overexpression of miR-370 suppressed the RNA levels of apoptosis-related and autophagy-related genes (Fig. 4C). [score:5]
Here, we present the first evidence suggesting that miR-370 and miR-373 may potently regulate one-carbon metabolism by directly targeting SHMT-2 and MECP-2, respectively. [score:5]
However, the induction of miR-370 in OA chondrocytes significantly reduced this apoptotic cell death to 4.56%, whereas inhibition of miR-370 increased cell death among OA chondrocytes. [score:3]
We identify serine hydroxymethyltransferase (SHMT)-2 and methyl-CpG -binding protein (MECP)-2 as targets of miR-370 and miR-373, respectively, and hypothesize that these interactions contribute to the pathogenesis of OA. [score:3]
The precursors or inhibitors of miR-370 and miR-373 (Ambion, Austin, TX, USA) were electroporated into cells using a square-wave generator (BTX-830; Gentronics, San Diego, CA, USA) with 20 ms, 200 square pulses. [score:3]
We found that chondrocytes transfected with the SHMT-2 3′UTR -driven vector plus pre-miR-370 exhibited significantly less luciferase activity but mutated SHMT-2 3′UTR -driven vector plus pre-miR-370 did not alter luciferase activity (Fig. 4A, left panel) compared to cells that received the reporter plus the nontargeting negative control, suggesting that miR-370 may be involved in the SHMT-2-regulated pathogenesis of OA. [score:3]
Furthermore, decreased levels of miR-370 and miR-373 were observed in OA chondrocytes from majority of patients, as confirmed by analysis of MMP-13 expression (Fig. 3B). [score:3]
In in vivo study using DMM mice, the most severe cartilage destruction (as visualized by safranin O staining) was observed among mice infected with anti-miR-370- and SHMT-2-encoding lentiviruses, whereas infection of DMM mice with miR-370 -expressing lentiviruses significantly ameliorated DMM -induced cartilage destruction (Fig. 4F). [score:3]
OA chondrocytes were treated with miR-370 precursor (miR-370) and miR-370 inhibitor (anti-miR-370), and SHMT-2 level was analyzed by real-time PCR (right panel). [score:3]
Finally, we propose that miR-370 and miR-373 could be potent therapeutic targets for OA. [score:3]
For miRNA target validation, cells were electroporated as described above with 25–50 ng of each firefly luciferase reporter construct, 150–175 ng of empty pcDNA3 vector (Clontech, Mountain View, CA, USA), 200 ng pcDNA3 harboring the Renilla luciferase gene (transfection control), and 30 pmol of pre-miR-370, pre-miR-373, or pre-miR-neg (Ambion). [score:3]
Here, we found that miR-370 and miR-373 were significantly downregulated in OA chondrocytes compared to normal chondrocytes. [score:3]
To investigate whether modulation of miR-370 induced the same effects as modulation of SHMT-2, we altered the expression level of miR-370 using its specific inhibitor or precursors (Fig. 4B). [score:3]
Annexin V staining revealed that the induction of miR-373 in OA chondrocytes significantly reduced this apoptotic cell death to 2.26%, whereas inhibition of miR-370 increased cell death up to 10% in normal chondrocytes. [score:3]
These results provide novel insights into OA and may facilitate the development of therapeutic approaches based on the modulation of miR-370 and/or miR-373. [score:2]
In addition, induction of miR-370 decreased SHMT-2 RNA level, whereas knockdown of miR-370 increased SHMT-2 RNA level in OA chondrocytes (Fig. 4A, right panel). [score:2]
Here, we report the first study showing that the levels of miR-370 and miR-373 are significantly lower in OA chondrocytes. [score:1]
of miR-370 as confirmed by real-time PCR into OA chondrocytes reduced the protein levels of MMP-2 and MMP-13 that are typically increased in OA chondrocytes. [score:1]
Among we analyzed, miR-370 and miR-373 seem highly OA specific (Fig. 3A). [score:1]
In this prospective study, we examined the potential functional role of miR-370 and miR-373 in OA pathogenesis. [score:1]
In addition, folate treatment reduced miR-370 levels and apoptosis of OA chondrocytes (Fig. 4E), suggesting that miR-370 may be involved in one-carbon metabolism. [score:1]
Human 293FT cells were transfected with lentiviral vectors encoding miR-370, miR-373, SHMT-2, or MECP-2 or the negative control lentivirus (Applied Biological Materials, Canada) using the third-generation packaging mix (Applied Biological Materials, Canada) and Lentifectin (Applied Biological Materials, Canada). [score:1]
DMM surgery was performed in male mice, and lentiviruses were injected intra-articularly with 1 × 10 [9] plaque-forming units (PFU) of lentiviral vectors encoding miR-370, miR-373, SHMT-2, or MECP-2 every week for 8 weeks. [score:1]
[1 to 20 of 34 sentences]
8
[+] score: 80
miRNA profiling expression experiments utilizing ovarian cancer cells and ovarian cancer clinical samples demonstrated that a number of miRNAs were aberrantly expressed, including miR-370-3p, which was down-regulated in these studies (Iorio et al., 2007[76]; Lee et al., 2012[91]). [score:8]
Taken together, these results indicate that miR-370-3p can mediate luciferase mRNA translational repression and/or destabilization by directly interacting with the predicted miR-370-3p MRE target site. [score:6]
Given that endoglin is known to be over-expressed in some cancers (Rosen et al., 2014[139]), Chen et al. (2014[30]) analyzed the human endoglin mRNA for the presence of miR-370-3p MRE(s) sequences by the TargetScan algorithm (Table 8 (Tab. [score:5]
Chen et al. (2014[30]) demonstrated that miR-370-3p gain- and loss-of-function experiments inversely regulated endoglin protein expression. [score:4]
Taken together these investigators hypothesized that, in endometrioid ovarian cancer cells, hypermethylation reduces miR-370 levels which in turn results in the elevated expression of its direct target endoglin. [score:4]
Thus, the decision by these investigators to test the hypothesis that miR-370-3p can regulate endoglin expression was based on the published observations that this miRNA target might be biologically relevant even though the context score for miR-370-3p was not that striking (Table 2 (Tab. [score:4]
These experiments demonstrated that miR-370 mimicry suppressed endometrioid ovarian cancer cell malignant phenotypes via the negative regulation of endoglin (Chen et al., 2014[30]). [score:4]
It is important to note that of the 249 miRNA MRE sites predicted by TargetScan in the human S-endoglin mRNA isoform, miR-370-3p had only the 40th highest total context score (-0.21). [score:3]
In contrast, human endoglin protein levels were augmented in IGROV1 and TOV112D cells transfected with miR-370-3p inhibitors. [score:3]
Since the two human endometrioid ovarian cancer cell lines (IGROV1 and TOV112D), expressed both miR-370-3p and endoglin at easily detectable levels, they were able to perform gain- and loss-of-function experiments in each cell line (Chen et al., 2014[30]). [score:3]
Notably, these transfection experiments demonstrated that luciferase reporter activity was increased in cells transfected with the wild-type chimeric luciferase/endoglin reporter construct and the miR-370-3p inhibitor (Chen et al., 2014[30]). [score:3]
After identifying this MRE, Chen et al. (2014[30]) subsequently demonstrated that human endoglin was negatively regulated by miR-370-3p directly interacting with this sequence (Table 8 (Tab. [score:3]
Taken together, these data indicated that miR-370-3p and endoglin were co-expressed in ovarian tissues and cells. [score:3]
8)), recent reports suggest that miR-370 is a tumor suppressor (An et al., 2012[6]; Iorio et al., 2007[76]; Lee et al., 2012[91]; Zhang et al., 2012[179]). [score:3]
Since the transfected ovarian cancer cells endogenously express miR-370-3p, these investigators also performed identical luciferase reporter transfection experiments utilizing a miR-370-3p inhibitor. [score:3]
Northern blot and qPCR experiments demonstrated that, compared with normal ovarian tissues and control ovarian epithelial cells, miR-370-3p expression levels were attenuated in endometrial ovarian cancer tissues and in two endometrioid ovarian cancer cell lines (IGROV1 and TOV112D) (Chen et al., 2014[30]). [score:2]
Importantly, Chen et al. (2014[30]) initiated their study by investigating whether or not human ovarian cancer tissues and endometrioid ovarian cancer cell lines expressed endoglin and miR-370-3p. [score:1]
Chen et al., (2014[30]) demonstrated that miR-370-3p could repress the activity of a chimeric luciferase/endoglin reporter gene. [score:1]
These investigators subsequently performed gain- and loss-of-function experiments to determine whether manipulation of endogenous miR-370-3p activity corresponded to predictable changes in endoglin protein expression. [score:1]
Among the number of putative miRNA/human endoglin mRNA interactions documented above, the remainder of this review article will focus on miR-370 (Table 8 (Tab. [score:1]
They subsequently performed additional gain- and loss-of-function experiments to determine whether or not the experimental manipulation of endogenous miR-370-3p activity corresponded to observable changes in specific biological responses. [score:1]
In contrast, the luciferase activity was unchanged in cells transfected with the mutant chimeric luciferase/endoglin reporter construct and miR-370-3p mimics. [score:1]
However, this algorithm identified one additional miR-370-3p 3′-UTR MRE (5′ CCCCAGCAAGC 3′, 8mer “seed” + mismatch region, underlined) and the potential functionality of this site has not been tested. [score:1]
In miR-370-3p mimic transfected cells human endoglin protein levels were repressed. [score:1]
A miR-370-3p 3′-UTR MRE (5′ CCAGCAGG 3′, 8mer “seed” region, -0.21 total context score) was predicted 256 nts downstream from the stop codon of the human S-endoglin mRNA isoform (Chen et al., 2014[30]). [score:1]
8); References in Table 8: miR-5739: Yoo et al., 2011[173]; miR-6087: Yoo et al., 2012[174]; miR-208a-5p: Shyu et al., 2013[147]; miR-208a-5p: Wang et al., 2014[165]; miR-15 family: Tijsen et al., 2014[155]; miR-370-3p: Chen et al., 2014[30]). [score:1]
“Pull-down” experiments were not performed that may have proven useful since the Diana-microT-CDS algorithm predicted that human S-endoglin mRNA harbors an additional miR-370-3p 3′-UTR MRE whose function is unknown. [score:1]
Taken together, these results suggest that the miR-370-3p can bind to the predicted miR-370-3p MRE sequence harbored in the 3′-UTR of human endoglin mRNA and imply that this interaction is physiologically relevant. [score:1]
Given that angiogenesis is required for the survival and growth of solid cancers (reviewed in Carmeliet, 2003[29]) and since endoglin is essential for angiogenesis (Dallas et al., 2008[34]), Chen et al. (2014[30]) investigated whether human endoglin mRNAs harbored putative miR-370 MREs by utilizing the TargetScan algorithm. [score:1]
A miR-370-3p 3′-UTR MRE (5′ CCAGCAGG 3′, 8mer “seed” region) was predicted 256 nts downstream from the stop codon in the human S-endoglin mRNA isoform (Chen et al., 2014[30]). [score:1]
Finally, several human endoglin mRNA algorithm computed interacting miRNAs that might be interesting to investigate include miR-26a/b-5p, miR-93-5p, miR-150-5p, miR-326, miR-370 given that these miRNAs have been shown to have tumor suppressor/promoter and cardiovascular roles (Chen et al., 2014[30]; Fang et al., 2011[50]; Icli et al., 2014[74]; Ito et al., 2014[77]; Kim et al., 2014[84]; Lo et al., 2012[100]; Lyu et al., 2014[104]; Zeitels et al., 2014[178]). [score:1]
We also surveyed the 259 Diana-microT-CDS predicted human S-endoglin MRE sequences and found that this algorithm also predicted the same miR-370-3p 3′-UTR MRE (0.519 miTG score) interaction site. [score:1]
Given the increasing number of examples of “arm switching”, where two distinct functional mature miRNAs (guide strands) can be processed from opposite arms of the same pre-miRNA, these products are now denoted with the suffix-5p (from the 5′ arm) (e. g. miR-370-5p) or-3p (from the 3′ arm) (e. g. miR-370-3p) following their name. [score:1]
The wild-type chimeric construct harbored a small portion of the human endoglin 3′-UTR (29 nts) including the miR-370-3p MRE and an identical chimeric construct in which the miR-370-3p MRE seed sequence was mutated. [score:1]
Cells transfected with the wild-type chimeric luciferase/endoglin reporter construct and miR-370-3p mimic exhibited the lowest luciferase activity (Chen et al., 2014[30]). [score:1]
[1 to 20 of 35 sentences]
9
[+] score: 63
Other miRNAs from this paper: hsa-mir-31, hsa-mir-29b-1, hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
The expression levels of miR-200a and miR-31 was significantly down-regulated in PCa tissues compared with matched normal glands (Fig. 3B and 3D), while there was no significant difference in the expression levels of miR-29b-1 or miR-370 (Fig. 3A and 3C). [score:7]
MiR-29b-1, miR-200a, miR-370, and miR-31were selected for further validation of microarray results using real-time qPCR because they were not only the most down/up-regulated but also closely potentially target to the Dicer 3′ UTR. [score:6]
Correlation studies between Dicer and miR-29b-1, miR-200a, miR-370, and miR-31 expression in PCas showed that the expression of Dicer mRNA was moderately and negatively correlated with that of miR-200a and miR-31 (ρ [s] = -0.489, p < 0.0001; ρ [s] = -0.314, p < 0.0001, respectively). [score:5]
In vitro assays indicated that exogenous miR-370 expression enhanced the oncogenic potential of gastric carcinoma cells, targeted predicted sites in the transforming growth factor-b receptor II gene 3′UTR, and increased abdominal disseminated metastasis in nude mice [28]. [score:4]
Higher expression of miR-370 in gastric cancer tissues was also associated with more advanced nodal metastasis and a higher clinical stage compared with controls, while patients with more advanced or invasive tumors demonstrated higher serum miR-370 expression levels. [score:4]
Data analysis showed that miR-29b-1, miR-200a, miR-370, and miR-31 were down-regulated in prostate cancer samples compared with matched normal tissues. [score:3]
In the present study, we examined the expression levels of miR-29b-1, miR-200a, miR-370, and miR-31 in matched PCa tissues from 185 patients. [score:3]
Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in prostate adenocarcinoma and matched normal glands, after normalization to U6. [score:3]
Expression of miR-29b-1(A), miR-200a(B), miR-370(C) and miR-31(D) in androgen dependent and castration resistant PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
0120159.g003 Fig 3 Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in prostate adenocarcinoma and matched normal glands, after normalization to U6. [score:3]
0120159.g005 Fig 5 Expression of miR-29b-1(A), miR-200a(B), miR-370(C) and miR-31(D) in androgen dependent and castration resistant PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in localized and metastatic PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
We showed that miR-200a, miR-31, and miR-370 expression levels were increased in metastatic PCa rather than in localized cancers. [score:3]
The ectopic expression of miR-370 promoted cell proliferation and increased the anchorage-independent growth and colony formation ability of DU145 and LNCaP PCa cells [27]. [score:3]
0120159.g004 Fig 4 Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in localized and metastatic PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
Following the log2-transformation of miRNA fold changes in prostatic adenocarcinoma versus matched normal glands, the relative expression levels of miR-200a, miR-370, and miR-31 was higher in metastatic PCa compared with localized PCa (Fig. 4). [score:2]
For the comparison between miRNA array data and Real-Time qPCR results, miR-29b-1, miR-200a, miR-370 and miR-31determined to be differentially expressed in prostate adenocarcinoma compared to matched histologically normal glands in four patients by miRNA array were validated using Real-Time qPCR. [score:2]
0120159.g001 Fig 1 For the comparison between miRNA array data and Real-Time qPCR results, miR-29b-1, miR-200a, miR-370 and miR-31determined to be differentially expressed in prostate adenocarcinoma compared to matched histologically normal glands in four patients by miRNA array were validated using Real-Time qPCR. [score:2]
Similarly, a role for miR-370 in the proliferation of human PCa cells has previously been demonstrated. [score:1]
[1 to 20 of 19 sentences]
10
[+] score: 63
We found higher levels of miR-370 in human breast cancer cell lines (MCF-7, MDA-MB-231, MDA-MB-468, SKBR-3 and SUM159) compared with the normal breast cell line (Hs-578Bst) (Figure 8C), and western blot analyses showed that protein levels of GPD1 were dramatically upregulated in MCF-7 and MDA-MB-231 cells when miR-370 expression was inhibited (Figure 8D-E). [score:7]
Taken together, the results suggest that miR-370 directly suppress GPD1 expression in human breast cancer. [score:6]
miR-370 was reported to be upregulated and to function as an oncogene by targeting FoxO1 in human prostate and gastric cancers [32, 33]. [score:6]
Here, we found that the expression of GPD1 was inhibited by miR-370. [score:5]
miR-370 expression was normalized to U6 snRNA expression in each sample. [score:5]
From the results of multiple prediction algorithms by Targetscan, PicTar and miRanda, we queried the possibility that GPD1 was a direct target of miR-370, and then, a luciferase reporter assay was performed (Figure 8A). [score:5]
The results demonstrated that miR-370 significantly repressed the activity of reporter vectors harbouring the wild-type 3′-UTR of GPD1 (GPD1 WT), whereas mutations of putative miR-370 binding sites in the 3′-UTR (GPD1 MT) abrogated the inhibitory effects of miR-370 in MCF-7 cells (Figure 8B). [score:4]
In addition, miR-370 was recently discovered to be upregulated in human breast cancer cells and was shown to be significantly correlated with breast cancer progression [19]. [score:4]
Deregulation of miR-370 has been reported in various cancers, in which it can act as either an oncogene [29] or a tumour-suppressor gene [30, 31]. [score:4]
GPD1 is a direct target of miR-370. [score:4]
Commercially synthesized 2’ -O-methyl -modified antisense oligonucleotide of miR-370 was used as a miR-370 inhibitor (anti-miR-370). [score:3]
We also found that miR-370 was significantly upregulated in the majority of paired human breast cancer tissues compared with the adjacent normal tissues (Figure 8F, p < 0.001), and the miR-370 levels were inversely correlated with GPD1 levels (r = −0.716, p < 0.001, Figure 8G). [score:3]
However, the expression of miR-370 in breast cancer was reported to be increased, which was the same as our results in the 63 paired human breast cancer tissues. [score:3]
The sequence of anti-miR-370 was 5′ - GTAACTGCAGAGACGTGACCTG -3′. [score:1]
Figure 8(A) Diagrammatic representation of miR-370 and its putative binding sequence in the 3′-UTR of GPD1 and the luciferase reporter plasmids with WT and MT GPD1 3′-UTRs. [score:1]
We also identified the relationship between GPD1 and miR-370. [score:1]
To further investigate the relationship between GPD1 and miR-370, we analysed the expression of miR-370 in breast cell lines and 63 paired breast cancer tissues. [score:1]
[1 to 20 of 17 sentences]
11
[+] score: 39
In another study, Zhou et al showd that downregulation of miR-370 expression is a frequent event in primary leukemic cells obtained from acute myeloid leukemia (AML) patients and upregulation of miR-370 inhibits proliferation and enhances chemosensitivity to Homoharringtonine of AML cells by by directly targeting the 3’-UTR of FOXM1 [54]. [score:14]
In their study, overexpression of miR-370 increased cell proliferation by decreasing FOXO1 protein expression, accompanied with downregulation of the FOXO1 target genes (p21Cip1 and p27Kip1) and upregulation of cyclin D1. [score:13]
Likewise, FOXM1 is found to be directly downregulated by miR-370 in laryngeal squamous cell carcinoma [55]. [score:5]
It was reported that FOXM1 is overexpressed in Helicobacter pylori -induced gastric carcinogenesis and is negatively regulated by miR-370 [56]. [score:4]
Followingly, Zhang and his colleagues showed that miR-370 represses FOXO1 expression via “seedless” 3’-UTR miRNA recognition elements in replantation tissues [91]. [score:3]
[1 to 20 of 5 sentences]
12
[+] score: 38
According to previous studies, miR-370 is a lipid metabolism-related miRNA [56] and the increased miR-370 expression in hyperlipidemia patients has been positively correlated with the severity of coronary artery disease [57]. [score:5]
However, only miR-370 and miR-134 show enhanced expression levels in dmECFCs. [score:3]
Overexpression of miR-134, but not of miR-370, in dfECFCs results in decreased cell migration and poorer tube formation ability (Fig 3A). [score:3]
After overexpression of these two miRNAs in dfECFCs, miR-370 and miR-134 were 11-fold and 3.6-fold increased respectively (S4A Fig). [score:3]
MicroRNA-370 controls the expression of microRNA-122 and Cpt1alpha and affects lipid metabolism. [score:3]
Cell motility and microvasculature formation were then determined and it was found that miR-134 reduced cell migration by 34% and tube formation ability by 51%, while overexpression of miR-370 in dfECFCs resulted in no significant change (Fig 3A). [score:3]
Several genes, including sterol-regulatory element binding protein 1c (SREBP-1c), enzymes diacylglycerol acyltransferase-2 (DGAT2), fatty acid synthase (FAS) and acyl-CoA carboxylase 1 (ACC1), that are all involved in regulation of fatty acid and triglyceride biosynthesis, are increased by miR-370 in HepG2 cells. [score:3]
The effect of miR-370 and miR-134 overexpression on dfECFCs or HUVECs. [score:3]
miR-370 also targets carnitine palmitoyltransferase 1α (Cpt1α), which is a mitochondria enzyme and is involved in transportation of long-chain fatty acid for energy production, resulting in a decreased rate of beta oxidation [58]. [score:3]
Although dmECFCs show higher level of miR-370 than dfECFCs, it seems that miR-370 may also regulate other cellular mechanisms in DM. [score:2]
We validated these miRNA expression levels using four DF subjects’ ECFCs incubated under NG and HG condition and found that miR-370, miR-183-5p and miR-134 were increased under the HG condition compared to the NG treatment condition (Fig 2C), whereas the other seven miRNAs showed no statistically significant change (S3 Fig). [score:2]
S4 Fig (A) dfECFCs were infected with lenti-miR-370 and lenti-miR-134. [score:1]
We also measured the effect of miR-370 and miR-134 overexpression on cell motility and microvasculature formation of HUVECs (S4D Fig). [score:1]
0147067.g003 Fig 3. (A) Representative images (left) and quantitative data (right) from the Transwell migration assays (upper) and tube formation assays (lower) of dfECFCs with miR-370 and miR-134 overexpression. [score:1]
We have also identified that HG increases three miRNAs in ECFCs, namely miR-370, miR-183-5p and miR-134. [score:1]
Both miR-370 and miR-134 had no effect on cell proliferation or on cell cycle arrest (S4B and S4C Fig). [score:1]
[1 to 20 of 16 sentences]
13
[+] score: 37
SOF media +BSA Control SOF media +BSA SOF media −BSA Control SOF media −BSA miR-25 B/D – B/D – miR-302c – – – – miR-196a2 D + – – miR-181a B/D + N/A + miR-370 B/D + B/D + B, blastocyst media; D, degenerate media; –, not expressed; +, expressed. [score:5]
The expression of miR-370 in blastocyst, degenerate, and control media was not statistically different though there was a tendency for higher expression in degenerate media as the fold change was 4.2 (range 1.78–10.04; P = 0.110). [score:5]
miR-370 is stage-specifically expressed during mouse embryonic development and regulates Dnmt3a. [score:5]
Another candidate of interest is miR-370 which has a role in regulating the expression of the DNA methyltransferase 3a (Dnmt3a) gene (Liu et al., 2013). [score:4]
As both miR-181a and miR-370 reveal expression in the control media it may be inferred that another source of miRNAs is present in the media. [score:3]
In contrast, miR-370 was expressed in blastocyst and degenerate media when BSA was not supplemented. [score:3]
In BSA supplemented media, the expression of both miR-181 and miR-370 was detected though not statistically significantly different between embryos of varying quality or above the baseline control. [score:3]
MiR-181 and miR-370 were found to be expressed in the control media regardless of BSA supplementation (Table 3). [score:3]
In contrast, miR-370 was not differentially expressed between degenerate and blastocyst embryos (P < 0.239). [score:3]
MiR-181a and miR-370 were expressed in both the control media supplemented with and lacking BSA. [score:3]
[1 to 20 of 10 sentences]
14
[+] score: 35
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
This upregulation leads to an increased expression of lipogenic genes, including sterol regulatory element -binding proteins (SREBP1c) and diacylglycerol acyltransferase-2 (DGAT2), which suggests that miR-370 provides a further point of regulation of this pathway [86]. [score:8]
Particularly, the human hepatic cell line HepG2 transfection with miR-370 upregulates the expression of miR-122. [score:6]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) Cancer metabolic plasticity allows tumor cells to survive in the face of adverse environmental conditions. [score:3]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) MicroRNAs are transcribed by RNA polymerases II and III in pri-miRNAs, generating precursors that undergo a series of cleavage events to form mature microRNA. [score:3]
Iliopoulos D Drosatos K Hiyama Y Goldberg IJ Zannis VI MicroRNA-370 controls the expression of microRNA-122 and Cpt1alpha and affects lipid metabolismJ. [score:3]
MiR-370 targets CPT1A reducing FAO. [score:2]
Recently, Iliopoulos et al. identified a new miRNA, miR-370, that has effects on lipid metabolism similar to miR-122. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 31
org) we identified nine miRNAs that regulate these three genes: miR-368 targeting MINT31, miR-181d, miR-30a-3p, miR-30c, miR-30d, miR-30e-3p, miR-370, miR-493-5p and miR-532-5p targeting CDH13, and miR-181d targeting RASSF1. [score:8]
Expression of four miRNAs (miR-30c, 30d, 30e-3p, and 370) was significantly different between benign neoplasms and ovarian carcinoma: expression of miR-30c (P = 0.02), miR-30d (P = 0.001) and miR-30e-3p (P <0.0001) was higher while expression of miR-370 (P = 0.05) was lower in ovarian carcinomas. [score:7]
All miRNAs except for three (miR-368, miR-370, and miR-493-5p) had hazard ratios less than one for every one unit increase in log [10] miRNA expression for both overall and disease-free survival. [score:5]
Expression of miR-30a-3p was higher in well-differentiated compared to poorly differentiated tumors (P = 0.02), and expression of miR-370 was higher in stage I/II compared to stage III/IV samples (P = 0.03). [score:3]
Expression of four miRNAs (miR-30c, miR-30d, miR-30e-3p, miR-370) was significantly different between carcinomas and benign ovarian tissues as well as between carcinoma and borderline tissues. [score:3]
Expression of miR-181d, miR-368, and miR-370 was significantly different between cell lines and normal ovaries as well as between cell lines and benign tumors. [score:3]
In addition, expression of miR-370 was significantly higher in stage I/II carcinomas compared to stage III/IV (P = 0.03) carcinomas. [score:2]
[1 to 20 of 7 sentences]
16
[+] score: 29
Other miRNAs from this paper: hsa-let-7b, hsa-mir-21, hsa-mir-27a, hsa-mir-148a, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-141, hsa-mir-126, hsa-mir-146a, hsa-mir-1-1, hsa-mir-155, hsa-mir-34b, hsa-mir-34c, hsa-mir-296, hsa-mir-373, hsa-mir-342, hsa-mir-526a-1, hsa-mir-526a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-542, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1246, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
More recently, Chang and her colleagues found that miR-146a is upregulated, while miR-370 is downregulated in EV71 infection [55]. [score:7]
Further functional studies indicated that the silencing of miR-146a restores SOS1 expression and partially attenuates EV71 -induced apoptosis, while the ectopic expression of miR-370 decreases EV71 -induced GADD45β expression and diminishes apoptosis. [score:7]
Moreover, the co -expression of antagomiR-146a and miR-370 showed an additive effect on attenuating EV71 -induced apoptosis [55]. [score:3]
Son Of Sevenless Homolog 1 (SOS1) and Growth arrest and DNA-damage-inducible β (GADD45β) are the targets of miR-146a and miR-370, respectively. [score:3]
The suppression of SOS1 by miR-146a and the relief of GADD45β by miR-370 induce the apoptosis of EV71-infected host cells. [score:3]
The other two altered miRNAs that were identified in EV71 infection, miR-146a and miR-370, target SOS1 and GADD45β, respectively. [score:3]
Chang Y. L. Ho B. C. Sher S. Yu S. L. Yang P. C. miR-146a and miR-370 coordinate enterovirus 71 -induced cell apoptosis through targeting SOS1 and GADD45β Cell Microbiol. [score:3]
[1 to 20 of 7 sentences]
17
[+] score: 27
Other miRNAs from this paper: hsa-mir-1296
Thus, downregulation of IL-6 by siRNA could suppress Sld5 expression in T24 bladder cancer cell line and injection of miR-370 could inhibit tumor growth in the mouse xenograft experiment. [score:10]
Overexpression of IL-6 (Interleukin 6) was also observed and enhanced expression of DNA-methyltransferase1 (DNMT1), leading to suppression of miR370, which in turn resulted in overexpression of Sld5. [score:9]
The candidate miRNA turned out to be miRNA-370 and was downregulated in the bladder cancer cells. [score:4]
Regulation of SLD5 gene expression by miR-370 during acute growth of cancer cells. [score:4]
[1 to 20 of 4 sentences]
18
[+] score: 21
Sixteen of 359 miRNAs detected were differentially expressed between tumor and matched benign tissue (adjusted p < 0.05): 9 were upregulated (hsa-miR-19a; hsa-miR-512-3p; hsa-miR-27b; hsa-miR-20a; hsa-miR-28-3p; hsa-miR-200c; hsa-miR-151-3p; hsa-miR-223; hsa-miR-20b), and 7 downregulated (hsa-miR-22; hsa-miR-516-3p; hsa-miR-370; hsa-miR-139-5p; hsa-let-7e; hsa-miR-145-3p; hsa-miR-30c) in tumor tissue in comparison to matched benign tissue (Table 2). [score:9]
Of the seven tumor-tissue miRNAs downregulated, four (hsa-miR-370; hsa-miR-139-5p; hsa-miR-let-7e; hsa-miR30c) were expressed in both tumor and plasma (both free and within exosomes); hsa-miR-516-3p was present in tumor only, and hsa-miR-22 and hsa-miR-145-3p were present in tumor and exosome only. [score:6]
miRNA Expression Cancer association (Y/N) Upregulated (Y/N) hsa-miR-19a Common YY (10) hsa-miR-512-3p T and E only YN (11) hsa-miR-27b Common YY (12) and N (13) hsa-miR-20a Common YY (14) hsa-miR-28-3p Common YY (15) hsa-miR-200c Common YY (16) and N (17) hsa-miR-151-3p Common YY (18) hsa-miR-223 Common YY (19) and N (15) hsa-miR-20b Common YY (20) hsa-miR-22 T and E only YY (19, 21) and N (22) hsa-miR-516-3p T only N N/A hsa-miR-370 Common YY (23) hsa-miR-139-5p Common YN (24) hsa-let-7e Common YN (25) hsa-miR-145-3p T and E only YN (26) hsa-miR-30c Common YN (27) T, tumor; E, exosome. [score:6]
[1 to 20 of 3 sentences]
19
[+] score: 20
In the present study, we examined the levels of a group of miRNAs, which had been reported to regulate the expression of pluripotent genes such as miR-489, miR-370 and miR-433 30, or were predicted to target stem cell pluripotency genes such as miR-7 and miR-21. [score:6]
showed that miR-489, miR-370 and miR-433 were highly expressed in spheroid hMSCs compared to monolayer hMSCs, especially miR-370 with a fivefold increase, while let-7f, miR-7, miR-145, miR-21 and miR-24 were down-regulated in spheroid hMSCs (Fig. 5A). [score:5]
Our results showed that miR-489, miR-370 and miR-433 were highly expressed in spheroid hMSCs, while miR-7, miR-145, let-7f, miR-21 and miR-24 were down-regulated in spheroid hMSCs, compared to hMSCs that had been cultured in monolayer. [score:5]
To understand whether miRNAs were involved with the phenotypical changes of hMSCs in spheroids, real-time PCR analysis was performed to examine the expression of miR-489, miR-370, miR-433, let-7f, miR-7, miR-145, miR-21 and miR-24. [score:3]
MiR-489, miR-370 and miR-433 have recently been found to play an important role in maintaining the quiescent state of adult stem cells 30. [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 14
It is also known that mir-223 regulates cell proliferation through targeting and downregulating FOXO1 [23], and upregulation of miR-370 promotes proliferation of prostate cancer cells by suppressing the expression FOXO1 [24]. [score:14]
[1 to 20 of 1 sentences]
21
[+] score: 13
For example, restoration of miR-370 expression led to downregulation of FOXM1 in acute myeloid leukemia, promoting cell growth arrest and senescence [35]. [score:6]
The analysis of randomly-chosen miRNAs from clusters 1 and 2 (miR-654-3p, mir-369-3p, miR-495, miR-370-5p, miR-127-5p and miR-376c-3p) in tumor cell lines confirmed their downregulation (Figure 1d). [score:4]
Cahill and colleagues have shown that human derived BRAFT1799A- and RET/PTC-bearing thyroid tumor cells, KAT10 and TPC-1 respectively, express lower levels of 14q32-encoded miRNAs miR-323-3p, miR-370-5p, miR-127-3p, miR-299 and miR-154 [22, 23]. [score:3]
[1 to 20 of 3 sentences]
22
[+] score: 9
Exogenous miR-370 expression can decrease TGFβ-RII expression and the phosphorylation of Smad3 elicited by TGFβ1. [score:5]
Therefore, miR-370 expression can increase gastric cancer migration by disrupting the TGFβ signalling (Ref. [score:3]
Several miRNAs circulating in blood of gastric cancer patients can be applied as diagnosis biomarkers, including let-7a, miR-1, miR-17-5p, miR-21, miR-20a, miR-27a, miR-34, miR-106a/b, miR-196a, miR-199a-3p, miR-218, miR-221, miR-223, miR-370, miR-376c, miR-378, miR-421, miR-423-5p, miR-451 and miR-486 (Refs 64, 76, 111, 112, 113, 114, 115, 116, 117). [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 9
We observed that the expression of miR-370 in NHEM③, which expressed low protein levels of FOXM1, was higher than that in the other NHEMs and in all of the melanoma cell lines (Fig 1C). [score:5]
It has been reported that FOXM1 is a direct target of hsa-miR-370, and it was shown that the mRNA level of miR-370 was decreased in gastric cancer samples compared to normal tissue [26]. [score:3]
Therefore, one possible mechanism underlying the discrepancy between the mRNA and protein levels of FOXM1 in NHEM3 could be due do the high level of miR-370 in these cells. [score:1]
[1 to 20 of 3 sentences]
24
[+] score: 9
The constructed networks from significantly up-regulated miRNAs and significantly down-regulated target genes involved 13 miRNAs from JIA (Fig. 4a) and 29 miRNAs from CF (Fig. 4b), 4 (miR-494, miR-370, miR-326, and miR-505) of them were common (p = 1.2E-03, Table S4 in Supplementary information). [score:9]
[1 to 20 of 1 sentences]
25
[+] score: 8
Other miRNAs from this paper: hsa-mir-134
The tumor suppressive role of miRNA-370 by targeting FoxM1 in acute myeloid leukemia. [score:5]
Moreover, FoxM1 is also repressed by miR-370, a tumor suppressor miRNA frequently silenced in acute myeloid leukemia (Zhang et al., 2012b). [score:3]
[1 to 20 of 2 sentences]
26
[+] score: 7
Employing a similar microarray -based approach, Triboulet et al. [181] showed that, while 11 cellular miRNAs (including miR-122, miR-297, miR-370, and miR-373) were upregulated, just two cellular miRNAs, miR-17-5p and miR-20a were downregulated upon HIV-1 infection in the Jurkat cells. [score:7]
[1 to 20 of 1 sentences]
27
[+] score: 7
Milenkovic et al. [72] found that in vivo supplementation with nine different polyphenols modulated the expression of some combination of miRNAs, including miR-10b, miR-30, miR-144, miR-197, and miR-370, all of which are regulators of cholesterol metabolism [5, 27, 42, 63, 73]. [score:4]
Iliopoulos D. Drosatos K. Hiyama Y. Goldberg I. J. Zannis V. I. MicroRNA-370 controls the expression of microRNA-122 and Cpt1α and affects lipid metabolism J. Lipid Res. [score:3]
[1 to 20 of 2 sentences]
28
[+] score: 7
[43] miR-223 and miR-370 can directly target FOXO1 and regulate endogenous FOXO1 protein expression and are also responsible for cancer cell proliferation. [score:7]
[1 to 20 of 1 sentences]
29
[+] score: 7
At that time, 2 miRNA were upregulated (hsa-miR-668 and hsa-miR-374b-3p), and one downregulated (hsa-miR-370). [score:7]
[1 to 20 of 1 sentences]
30
[+] score: 7
On the other hand, HDAC inhibition also determined coherent up- or down-modulation of several miRNAs directly involved in positive (e. g. mir-129-3p, mir-193b, mir-370) or negative (e. g. mir-196b, mir-335, mir-370) control of cell cycle [44], [45], [46], [47], [48], [49], thus suggesting the existence of an epigenetically regulated negative loop protecting CD34 [+] cells from unrepressed cellular growth, and reinforcing the anti proliferative effect exerted by small cyclin/CDK inhibitors such as p14 [ARF], p16 [INK4] and p21 [Cip1/Waf1] gene products (Figure 2E). [score:7]
[1 to 20 of 1 sentences]
31
[+] score: 7
MiR-370 was up-regulated in acute myeloid leukemia and functional analyses showed that miR-370 directly targeted NF1 mRNA [118]. [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 6
In [47] a predominant upregulation has been shown for miR-370, miR-299 and miR-125b which putatively affects the expression of BAX/AKT, β-catenin, IGF R type I, respectively. [score:6]
[1 to 20 of 1 sentences]
33
[+] score: 6
MicroRNA-370 suppresses proliferation and promotes endometrioid ovarian cancer chemosensitivity to cDDP by negatively regulating ENG. [score:3]
miR-370 24.2Suppresses tumor proliferation [45, 46]. [score:3]
[1 to 20 of 2 sentences]
34
[+] score: 6
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
According to another study, miR-31, miR-148a, and miR-27b were among the downregulated, and miR-617, miR-370, and miR-654 were among the upregulated miRNAs in 23 MCL cases as compared to 11 reactive lymphoid tissues [57]. [score:6]
[1 to 20 of 1 sentences]
35
[+] score: 6
Other miRNAs from this paper: hsa-mir-101-1, hsa-mir-101-2
U87MG cells (D. R. 0.90); induces apoptosis in CCRF-CEM cells, mediated by loss of MMP and increase ROS production (Kuete et al., 2016c); induces apoptotic cell death in H2108 and H1299 cells, mediated by caspase 3/7 activation (Namkoong et al., 2011); induces apoptosis in esophageal squamous cell carcinoma by modulating miR-370/PIM1 signaling (Han et al., 2016); increases the expression of microRNA precursor, miR-101 by suppressing Protein Kinase B (Akt) signaling in renal cell carcinoma (Wang et al., 2017)Amentoflavone (flavonoid; 13) Dorstenia barteri Bureau (Moraceae) (Mbaveng et al., 2008; Kuete et al., 2010)Cytotoxicity toward CCRF-CEM cells, CEM/ADR5000 cells, MDA-MB-231- pcDNA cells, MDA-MB-231- BCRP cells, HCT116 (p53 [+/+]) cells (Kuete et al., 2016c); MCF-7 cells (Chen et al., 2015), B16F-10 cells (Guruvayoorappan and Kuttan, 2008) and SW480 cells (Yang et al., 2014)Hypersensitivity: CEM/ADR5000 cells vs. [score:5]
Alpinumisoflavone induces apoptosis in esophageal squamous cell carcinoma by modulating miR-370/PIM1 signaling. [score:1]
[1 to 20 of 2 sentences]
36
[+] score: 6
Smoking was associated with the down-regulation of 27 plasma miRNAs (Fig.   7), including several previously identified as performing tumour suppressor-like functions; let-7i-5p [2], miR-148a-5p [22], miR-218-5p [17], miR-29-3p [20], miR-133a [4], miR-296-5p [10] and miR-370 [21]. [score:6]
[1 to 20 of 1 sentences]
37
[+] score: 5
Our previous study showed that eight miRNAs (miR-132, miR-181c, miR-15a, miR-370, miR-143-3p, miR-21-5p, miR-200a-3p, and miR-646) were expressed abnormally in different perioperative periods of the same cervical squamous cell carcinoma patients including pre-operative, one week post-operative and one month post-operative, suggesting that the levels of specific circulating miRNAs could be useful for post-therapeutic monitoring of the progression of this disease [22]. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 5
In particular, miR-208a repressed endoglin expression in the heart, whereas miR-370 was negatively correlated with endoglin expression in endometrioid ovarian cancer cells. [score:5]
[1 to 20 of 1 sentences]
39
[+] score: 5
Of the 32 microRNAs exclusively expressed in CD4 [TGF/atRA], 30 were found in the TargetScan7 database (except miR-370 and miR-548f). [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
This finding is particularly important given that a common Adeno-Associated Virus (AAV) insertion site in mice has recently been identified that maps between miR-341 and miR-370 in Meg8 that causes hepatocellular carcinomas, suggesting that perturbed expression of microRNAs may be responsible. [score:3]
Of note, miR-370 is also conserved in humans. [score:1]
Moreover, only Meg8 transcripts have the intron-encoded microRNAs miR-341, miR-1188, and miR-370 that lie upstream of Irm (see Figure 2 and Table 2). [score:1]
[1 to 20 of 3 sentences]
41
[+] score: 5
Haller et al. revealed the deregulation of miRNA-329, miR-370, miR-376c and miR409 expression based on the location of the tumor in gastrointestinal stromal tumors (GISTs); higher expression occurred in intestinal compared to gastric tumors [46]. [score:5]
[1 to 20 of 1 sentences]
42
[+] score: 5
Since possible target genes have been identified for only a few imprinted microRNAs, e. g. miR-134, miR-376a, miR-370, and the microRNAs embedded in the antisense transcript of the Retrotransposon-like 1 (Rtl1) gene [19, 22, 29- 32], we established a pipeline that combines different algorithms to predict microRNA target genes computationally. [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 5
Other miRNAs from this paper: hsa-mir-373, mmu-mir-370, hsa-mir-1180, hsa-mir-1236
And we also proved that miR-1236, miR-1180 and miR-370 could activate the expression of suppressor gene p21 [34– 36]. [score:5]
[1 to 20 of 1 sentences]
44
[+] score: 5
Global microRNA expression analysis demonstrated that the expression of seven microRNAs, including miR-378, miR-689 miR-21, miR-574-5P, miR-696 miR-370 miR-21, that were significantly altered during liver regeneration [16] were not altered during the hepatic differentiation of hUC-MSCs in our study. [score:5]
[1 to 20 of 1 sentences]
45
[+] score: 5
MicroRNA-370 suppresses proliferation and promotes endometrioid ovarian cancer chemosensitivity to cDDP by negatively regulating ENG. [score:3]
For Carboplatin alone, miR-370 has shown to promote chemo-sensitivity in endometrioid OC [36]. [score:1]
This is in line with our findings, where miR-370 showed to be positively correlated to Carboplatin sensitivity. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 4
Some miRNAs have been identified to regulate the expression of FoxM1, including miR-149, miR-134, miR-370, miR-494, miR-194, and miR-24-1 [37– 43]. [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 4
In this context, we observed a preferential down-regulation in region 14q32.31 including miRNA miR-127, miR-370, miR-299, miR-154, miR-154*, miR-323, miR-134, miR-368 and miR-337. [score:4]
[1 to 20 of 1 sentences]
48
[+] score: 4
A large number of overexpressed IR-responsive miRNAs that we identified in our work were found to be deregulated in human cancers, such as hsa-mir-513 [55], hsa-mir-744 [56], hsa-mir-92a [57], [58], hsa-mir-1228* [59], hsa-mir-671-5p [60], hsa-mir-638 [38], hsa-mir-370 [61], and hsa-mir-675 [62]. [score:4]
[1 to 20 of 1 sentences]
49
[+] score: 4
Our miRNA profile (84) Chromosomal localization Fold change Reference DOWNREGULATED hsa-miR-206 6p12.2 −7.53(29) hsa-miR-219-2-3p 9q33.3 −6.64(52) hsa-miR-383 8p22 −6.56(12, 55, 56) hsa-miR-138 16q13.3/3p21.32 −5.16(12, 14) hsa-miR-323-3p 14q32.2 −4.96(12, 52) hsa-miR-122 18q21.31 −4.82 hsa-miR-105 Xq28 −4.66 hsa-miR-129-5p 11p11.2/7q32.1 −4.56(23) hsa-miR-935 19q13.43 −4.53(52) hsa-miR-329 14q32.2 −4.48 hsa-miR-129-3p 11p11.2/7q32.1 −4.43 hsa-miR-650 22q11.21 −4.19 hsa-miR-184 15q24.3 −4.14 hsa-miR-370 14q32.2 −3.99(12) hsa-miR-433 14q32.2 −3.96(29) hsa-miR-138-2* 16q13. [score:4]
[1 to 20 of 1 sentences]
50
[+] score: 4
Previous studies have provided evidence for the important roles of deregulated expression of miRNAs in the pathogenesis of CC, including miR-29, miR-122, miR-124, miR-145, miR-146a, miR-200c, miR-370, miR-373, miR-376c and miR-494 [30– 36]. [score:4]
[1 to 20 of 1 sentences]
51
[+] score: 4
Differential expression analysis between this new group and healthy controls confirmed that three of the four original miRNAs (miR-370-3p, miR-409-3p, miR-432-5p) were significantly dysregulated. [score:4]
[1 to 20 of 1 sentences]
52
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Fukushima et al. (2007) have demonstrated that rat exposed to acetaminophen or carbon tetrachloride showed down-regulation of miR-298 and miR-370 in the liver that was accompanied by hepatocyte necrosis and inflammation. [score:4]
[1 to 20 of 1 sentences]
53
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Additionally, the mitochondrial enzyme carnitine palmitoyl transferase, involved in the transport of long-chain fatty acids across the membrane, is targeted by miR-370 that concurrently affects lipid metabolism [130]. [score:3]
Other miRNAs, such as miR-27b, miR-33, miR-34, miR-103, miR-104, 223, and miR-370, also control the fatty acid metabolism and cholesterol biosynthesis in the liver. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 3
J Transl Med 8 48; 10.1186/1479-5876-8-48 20487562 Gao W He HW Wang ZM Zhao H Lian XQ Wang YS 2012 Plasma levels of lipometabolism-related miR-122 and miR-370 are increased in patients with hyperlipidemia and associated with coronary artery disease. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 3
Within the high homology regions, we found perfectly conserved seed matches for miRNAs that have been predicted (miR-103, miR-142-3p, miR-370, and miR-432) or already demonstrated (miR-15 [31], miR-16 [31], miR-26a [32], miR-214 [33], miR-548c-3p [34] and miR-761 [33]) to target the HMGA1 gene (Figure 1B and 1C). [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 3
Although notable copy number aberrations were not detected at 14q32.31 by our aCGH analyses using a panel of pancreatic cancer [28], ESCC [29] and OSCC [30], [31] cell lines, the expression of miR-134 and miR-370 located at this locus was described to be significantly lower in gastrointestinal stromal tumors (GISTs) with 14q loss and also in GISTs with tumour progression [43]. [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
Other miRNAs from this paper: mmu-mir-370, ssc-mir-370
When cells reach to 80% confluence, 4 μg each of pCDH- METTL3-copGFP-Puro and pCDH-miR370-copGFP-Puro vectors were transfected into HEK-293T cells together with 4 μg pCL-Eco and 2 μg pCMV-VSV-G at a ratio of 2:2:1 using Lipofectamine 2000 (Invitrogen). [score:1]
To screening the stable pluripotent stem cell lines, lentiviral vectors pCDH- METTL3-copGFP-Puro and pCDH-miR370-copGFP-Puro were constructed for packing virus. [score:1]
The puromycin-resistant cell lines include J1 mES cells with miR370 transfection (J1/miR370), and porcine iPS cells with METTL3 transfection (piPS/METTL3) and with miR370 (piPS/miRNA370) (Fig.   5B). [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 3
Notably, microRNAs hsa-miR-127-5p, hsa-miR-370 and hsa-miR-376 had been shown to be highly and specifically expressed in islets of developing and adult human pancreas [53, 54]. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 2
The authors analyzed miRNA landscape in uninfected and HIV-1 infected cells and found that several miRNAs (miR-122, miR-370, miR-373 and miR-297) are up regulated during HIV replication. [score:2]
[1 to 20 of 1 sentences]
60
[+] score: 2
With the same binding energy cutoff, we found two human miRNAs hsa-miR-370 and hsa-miR-661 having MREs within NS1 genes of all types of dengue virus. [score:1]
The start binding position 771 of hsa-miR-370 was highly conserved among gene population of types 1-3 while hsa-miR-661 had a highly conserved start binding position 789 among gene population of all types. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
The known lipid regulatory microRNAs are few and include amongst others miR-335, miR-33, miR-122, miR-370, miR-378-3p, and miR-125a-5p [157]. [score:2]
[1 to 20 of 1 sentences]
62
[+] score: 2
For CCC development our database contained all associations also listed by other databases with two exceptions, MRP2/ABCC2 which was published only recently and the miRNA370 which was missed by our search strategy [26]. [score:2]
[1 to 20 of 1 sentences]
63
[+] score: 2
Other microRNAs such as miR-370, miR-378/378*, miR-143, miR-27, miR-29a, miR-302a, and miR-335 have also been shown to regulate lipid homeostasis [15– 21]. [score:2]
[1 to 20 of 1 sentences]
64
[+] score: 1
KCNQ1OT1 promotes cell malignancy in the KCNQ1OT1-miR-370-CCNE2 axis pathway in glioma [25]. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
MiRNA-370 [17], miRNA-93 [18], and miRNA-100 [19] are related to the chemosensitivity of ovarian cancer. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
It has been demonstrated that miR-370 induces the accumulation of hepatic triglycerides through interacting with miR-122 and Cpt 1α [23]. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
Several miRNAs, as cardiomyocyte-enriched (miR-133, miR-208a) [41], endothelial cell-enriched (miR-126, miR-17-92a cluster), vascular smooth cell (miR-143/145) and inflammatory cell-enriched (miR-155), and platelet-enriched (miR-199a) miRNAs, were associated with CAD, while lipometabolism-related miR-122 and miR-370 increased as the severity of CAD quantified by the Gensini score increased [42]. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Comparing the operated knee with contralateral control showed two miRNAs increased by DMM surgery >1.5-fold at day 1 (miR-144-3p and miR-29b-3p) and two miRNAs at day 3 (miR-370-5p and miR-21-5p). [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Other miRNAs from this paper: hsa-mir-335, mmu-mir-335, mmu-mir-370, mmu-mir-433, hsa-mir-433
One, rs47500792, is in a putative binding site for mmu-miR335-3p, and the other two, rs47154027 and rs46439487, are adjacent SNPs that are in a putative binding site for mmu-miR370. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
The set includes miR-127, miR-154, miR-154*, miR-299, miR-323, miR-368, and miR-370. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
However, in sheep, the analyzed miRNA sites that are located in the 505 bp 3′ UTR of the ovine s-SCF (+) form belongs to the miRNA families of miR-27a/b, miR-194, miR-128, miR-370, and two sites for miR-132/212, miR-320/320abcd (Figure 9(a)) where as miR-669f/a/o-3p, miR-466b and miR828b are detected on the shorter 3′ UTR segment (144 bp) of ovine m-SCF (−) form (Figure 9(b)). [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
Recently, miRNAs linked to lymph node metastasis of GC, such as miR-218, miR-146a, miR-429, and miR-370, have been identified [41– 44]. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
Within the Dlk1–Dio3 cluster, Meg3/Gtl2 contains in its last intron the evolutionarily conserved microRNA miR-770 whereas Meg8 transcripts have the intron-encoded miR-341, miR-1188, and miR-370. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Other miRNAs from this paper: hsa-mir-122, hsa-mir-675
We have previously demonstrated that lipometabolism-related microRNA-122 and microRNA-370 were associated with the risk and severity of CAD [18]. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
We also choose to include seven miRNAs (mir-370, mir-337-5p, mir-376c, mir-377, mir-1247, mir-758 and mir-300) that are located on the q arm of chromosome 14, which has been found to be aberrant and implicated in many types of cancer [24]. [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
-27.5 BCL-2 2382 hsa-miR-370 ((((. [score:1]
[1 to 20 of 1 sentences]