sort by

151 publications mentioning hsa-mir-373 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-373. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 311
The overexpression of Rab22a in EOC tissues was strongly correlated with reduced expression of miR-373, suggesting that the increased expression of Rab22a might result from down-regulation of miR-373 in human EOC. [score:10]
Tanaka [16] and Chen [15] et al. reported that the expression of miR-373 is down-regulated by aberrant methylation in colon cancer and hilar cholangiocarcinoma, and our future studies will examine the possible mechanism(s) regulating miR-373 expression in EOC. [score:9]
The results in two independent experiments showed that 262 transcripts, including 168 downregulated transcripts and 94 upregulated transcripts, were impacted by overexpression of exogenous miR-373 in S KOV3 cells (Supple Table 1). [score:9]
Enforced over -expression of miR-373 down-regulate Rab22a expression in EOC cells, while Rab22a knockdown reduce EOC cells migration and invasion. [score:9]
Transient expression of miR-373 and siRNA -based knockdown of Rab22a showed essentially similar effects in ovarian cancer cells, further confirming that direct targeting of Rab22a by miR-337 plays an important inhibitory role in migration and invasion of ovarian cancer cells. [score:9]
We demonstrate that Rab22a is significantly up-regulated in human EOC tissues and overexpression of Rab22a in EOC cells may result from down-regulation of miR-373. [score:9]
Data suggested that miR-373 acts as a tumor suppressor in EOC, therefore a set of 168 downregulated transcripts, which are potential direct targets of miR-373, was focused on for further experiments. [score:9]
Of the 12 downregulated transcripts and potential targets of miR-373 (ANK2, CD44, CROT, ELAVL2, FN1, GALNT3, GNPDA2, PFN2, Rab22a, RND3, TGFBR1, and TGFBR2), CD44 [17], TGFBR1 [18], and TGFBR2 [19] have been reported as the direct miR-373 targets. [score:9]
Ectopic overexpression of miR-373 suppresses EOC cell metastasis and invasion in vitro and in vivoTo better understand the impact of miR-373 on EOC cells, a lentivirus vector expressing miR-373 (pMSCV-miR-373) was constructed and S KOV3 -transfected cells were established. [score:7]
However, in breast cancer miR-373 appears to have tumor suppressor activity, as re -expression of miR-373 inhibited TGF-β -induced invasion in MDA-MB-231 and MCF10A cells as well as vascular intravasation in ER [−] breast cancer in vivo [19]. [score:7]
Inhibition of miR-373 expression was unable to increase cell invasion and migration in Rab22a -depleted A2780 cells (Fig. 5A-B), and western blot analysis showed that E-cadherin was positively regulated and N-cadherin was negatively regulated in A2780 cells co -transfected with anti-miR-373 and siRab22a (Fig. 5C). [score:7]
To further examine Rab22a as a direct target gene of miR-373, S KOV3 and A2780 cells were transfected with pMSCV-miR-373 and anti-miR-373 inhibitor, respectively. [score:6]
Transient transfection of S KOV3 cells with the above wild-type or mutant vectors and miR-373 or mock control resulted in partial rescue of the inhibition (Fig. 2G), further supporting that Rab22a is a direct target of miR-373. [score:6]
miR-373 is frequently down-regulated in ovarian cancer cell lines and miR-373 inhibits the invasion and metastasis of S KOV3 cells in vitro and in vivo. [score:6]
Down-regulation of miR-373 in EOC cells resulted in increased expression of Rab22a, resulting in enhanced EOC migration and invasion. [score:6]
The down-regulation of Rab22a was strongly correlated with the over -expression of miR-373 in xenograft ovarian carcinoma metastatic mo dels in nude mice by S KOV3 [luc]-pMSCV-miR-373 cells (Fig. 5G). [score:6]
miR-373 suppressed EMT-related migration and invasion via directly targeting Rab22a in ovarian cancer cells. [score:6]
While diverse phenomena were observed, the Rab22a mRNA and protein levels were down-regulated by anti-miR-373 inhibitor in A2780 cells (Fig. 2D). [score:6]
Compared to the IOSE cells, the expression of miR-373 was significantly down-regulated in A2780, CP70, HeyC2, and S KOV3 cell lines. [score:5]
On the other hand, overexpression of Rab22a abrogated (P < 0.05) miR-373 -mediated invasion and migration of S KOV3 cells (Fig. 5D-E), and E-cadherin was negatively regulated and N-cadherin was positively regulated in S KOV3 cells co -transfected with pCMV-miR-373 and pCMV6-Rab22a (Fig. 5F). [score:5]
The expression of miR-373 was down-regulated (P = 0.0104) in PEOC compared to benign tumor (Table 1). [score:5]
MiR-373 directly targets Rab22a to suppress EMT -mediated migration and invasion in EOC. [score:5]
Furthermore, among these EOC cells, the lowest endogenous expression of miR-373 was observed in S KOV3 cells and the highest expression of miR-373 was observed in A2780 cells (Fig. 1A). [score:5]
Ectopic overexpression of miR-373 suppresses EOC cell metastasis and invasion in vitro and in vivo. [score:5]
In summary, the present study is the first to demonstrate a tumor suppressor role for the miR-373 by targeting Rab22A in human EOC. [score:5]
We show for the first time that the miR-373/Rab22a axis contributes to migration and invasion in ovarian cancer and may represent a potential therapeutic target for the disease. [score:5]
Three bioinformatics -based prediction analysis softwares (PicTar, TargetScan, and miRanda) were used to identify the potential miR-373 targets. [score:5]
To explore the expression and significance of miR-373 in ovarian cancer carcinogenesis, the expression of miR-373 was detected in 30 primary epithelial ovarian cancer (PEOC) samples and 15 benign epithelial ovarian tumor tissues using TaqMan quantitative RT-PCR analysis. [score:5]
The expression of miR-373 was remarkably lower (P = 0.0124) in advanced tumor stages (III, IV) in which lymph node or distant metastases were present compared to earlier tumor stages; furthermore, differences (P < 0.05) in miR-373 expression among histological differentiation (G1 vs. [score:4]
Taken together, these results support the hypothesis that miR-373, by targeting Rab22a, regulates EOC migration and invasion. [score:4]
To investigate the potential target gene which miR-373 could regulate in ovarian cancer cells, microarray gene expression profiling of S KOV3-pMSCV-miR-373 cells and S KOV3-pMSCV-NC cells was performed. [score:4]
These results suggested a possible association between down-regulation of miR-373 and metastastic EOC. [score:4]
Previous studies have indicated that miR-373 was frequently down-regulated in colon cancer [15] and hilar cholangiocarcinoma [16]. [score:4]
Previous studies identified miR-373 as an oncogene that is up-regulated in a number of different human tumor types, including medullary thyroid carcinoma [23], hepatocellular carcinoma [24, 25], prostate cancer [26], gastric cancer [27], and testicular germ cell tumors [28]. [score:4]
Chen et al. reported that down-regulation of miR-373 in hilar cholangiocarcinoma is associated with poor cell differentiation, advanced clinical stage, and shorter survival [15]. [score:4]
We identified a direct target of miR-373, Rab22a, which is a member of the Rab family of small GTPases. [score:4]
Our current study identified that Rab22a was a direct target of miR-373 in EOC. [score:4]
Additional examination of these five genes using quantitative RT-PCR analysis showed that only Rab22a was downregulated in S KOV3-miR-373 -transfected cells (Fig. 2B). [score:4]
Among those, miR-373 was frequently down-regulated in OCICs and ovarian cancer cells, although the role of miR-373 in ovarian cancer was not clear. [score:4]
The expression of miR-373 was the lowest in S KOV3 cells. [score:3]
miR-373 directly regulates Rab22a in S KOV3 cells. [score:3]
The miR-373/Rab22a axis provides a novel insight into the pathogenesis of EOC, particularly EOC invasion and metastasis, and represents a new potential therapeutic target for the treatment of this deadly malignancy. [score:3]
In addition to PEOC, miR-373 expression was detected in ovarian immortal cell line IOSE and a panel of ovarian cancer cell lines cells (Fig. 1A). [score:3]
MiR-373 is down-regulated in ovarian cancer tissues and cell lines and associated with tumor invasion and metastasis. [score:3]
Moreover, re -expression of miR-373 in ovarian cancer cells results in decreased cellular migration and invasion in vitro and in vivo. [score:3]
Taken together, these data suggest that miR-373 acts as a tumor suppressor in EOC, which is in agreement with those previous findings on this miR in breast cancer. [score:3]
MiR-373 is located in close proximity to these chromosomal rearrangements and several groups recently have linked the expression of miR-373 with the genomic alteration [30]. [score:3]
However, ectopic expression of miR-373 had no effect on S KOV3 cell proliferation and colony formation in vitro (data not shown). [score:3]
To examine a possible role for Rab22a in miR-373 -mediated suppression of EOC migration and invasion, specific siRNAs against Rab22a were used. [score:3]
Concurrent with the morphological changes, levels of E-cadherin were higher while levels of N-cadherin were lower (P < 0.01) in miR-373 -transfected cells relative to cells transfected with the negative control (Fig. 1D), suggesting that the overexpression of miR-373 was associated with EMT and EOC cell metastasis. [score:3]
Anti-miR-373 inhibitor (anti-miR-373) and negative control (anti-miR-NC) were purchased from Ambion (Life Technologies, Foster City, CA). [score:3]
After stable transfection, miR-373 -expressing S KOV3 cells displayed a change from spindle-shaped mesenchymal-like morphology to more rounded epithelial-like morphology (Fig. 1C). [score:3]
As siRab22a-2 inhibited Rab22a protein more efficiently than siRab22a-1 (Supple Fig. 1), co-transfection experiments using siRab22a-1 or siRab22a-2 and anti–miR-373 were carried out. [score:3]
Both mRNA and protein expression of Rab22a were substantially decreased after ectopic miR-373 transfection in S KOV3 cells (Fig. 2C). [score:3]
To better understand the impact of miR-373 on EOC cells, a lentivirus vector expressing miR-373 (pMSCV-miR-373) was constructed and S KOV3 -transfected cells were established. [score:3]
miR-373 directly regulated Rab22a activity. [score:3]
These findings shed new light on the mo del in which miR-373 may suppress TGF-β signaling through Rab22–Rabex-5–Rab5 cascade. [score:3]
Based on the bioinformatics prediction analysis, three miR-373 -targeting sequences were identified in the 3′-UTR of Rab22a mRNA (Fig. 2F), and mutant vectors of Rab22a 3′-UTR containing four mutated bases on the predicted binding sites were constructed. [score:3]
As shown in Fig. 1B, S KOV3 cells expressed high level of miR-373 after transfection with pMSCV-miR-373 compared to the mock control (P < 0.001). [score:2]
For the wound scratch assay, 5 × 10 [6] S KOV3 cells that stably overexpressed either miR-373 or empty vector were plated and grown until confluent state and then cells were scratched using sterile tips. [score:2]
The invasive and migratory potential of miR-373 -expressing cells showed a strong reduction compared with mock controls. [score:2]
Figure 2 (A) Luciferase reporter assay was used to reveal 3′-UTRs of five candidate miR-373 targets (CROT, ELAVL2, GALNT3, GNPDA2, and Rab22a). [score:2]
Dual luciferase reporter assays confirmed that the luciferase activities of Rab22a 3′-UTR were significantly reduced in S KOV3 cells stably transfected with pMSCV-miR-373 and the luciferase activities increased in A2780 cells transfected with anti-miR-373 inhibitor (Fig. 2E). [score:2]
Taken together, these results suggest that miR-373 is a negative metastatic regulator for EOC. [score:2]
S KOV3 and A2780 cells were transfected with miR-373 (negative control precursor) or Rab22a siRNA (or negative control precursor). [score:1]
Boyden chamber assays without Matrigel further demonstrated that expression of miR-373 reduced (P < 0.01) migration of S KOV3 cells when compared with vector-only cells (Fig. 1F). [score:1]
Figure 5 (A-B) Transwell invasion assays and migration assays for A2780 cells after co -transfected with anti-miR-373 inhibitor and siRab22a. [score:1]
Virus particles were harvested from HEK293T cells 48 h after transfection with pMSCV-miR-373 or pLenti-shRab22a with the packaging plasmids using Lipofectamine 2000. [score:1]
In this study, we investigated the potential tumor suppressor effect of miR-373 in ovarian cancer. [score:1]
The invasive capacity of S KOV3-miR-373 cells was reduced (P < 0.01) compared to vector-only cells (Fig. 1E) and the ability of miR-373 -transfected cells to invade was suppressed (55%) compared with vector-only cells. [score:1]
The human Pre-miR-373 sequence was amplified from normal human genomic DNA and cloned into pMSCV vector to generate pMSCV-miR-373. [score:1]
More rounded epithelial-like morphology was observed in the miR-373 -transfected-S KOV3 cells (bottom), while spindle-shaped mesenchymal-like morphology was observed in the mock control cells (top). [score:1]
However, little is known about the role and underlying molecular mechanism of miR-373 in EOC, therefore the present study represents the first report on miR-373 in a panel of EOC cell lines and patient ovarian cancer tissues. [score:1]
Scoring was based on the proportion of positively stained cells: <5% was scored as 0; 5–24% was scored as 1; 25–49% was scored as 2; 50–74% was scored as 3; and >74% was scored as 4. The S KOV3 cells were transfected with pMSCV-NC vector and pMSCV-miR-373 as described above. [score:1]
MiR-373 belongs to miRNAs-371-373 clusters, located at chromosome 19q13.42 and matured from pri-miRNAs-371-373. [score:1]
The S KOV3 [luc]-pMSCV-miR-373 -injected mice showed fewer incidence of metastasis in distant organ sites, whereas S KOV3-pMSCV-NC -injected mice showed metastatic deposits in the peritoneal wall, small intestine, colon, stomach, liver and diaphragm. [score:1]
[1 to 20 of 76 sentences]
2
[+] score: 310
miR-373 orchestrates its functions either by pairing to the 3’ untranslated regions (UTR) of specific mRNAs to post-transcriptionally down-regulate gene expression, or by binding to the promoters of target DNAs to up-regulate gene expression. [score:15]
miR-373 has been documented to suppress target mRNAs translation and/or degrade target mRNAs [7– 28], besides, it can also induce target genes expression [4, 29– 31]. [score:13]
By targeting mTOR and SIRT1 directly, which are negative regulators of MMP9 expression, miR-373 and miR-520c up-regulates the expression level of MMP9, resulting in increased cell migration [18]. [score:12]
In principle, miR-373 was considered to function as an oncogene or a tumor suppressor based on its up-regulated expression or down-regulated expression in tumors compared with non-tumor samples. [score:11]
Arzumanyan et al. [29] underlined the impact of HBx in liver cancer, suggested that miR-373 expression levels were down-regulated by HBx in HepG2X cells and tissue sections from HBV infected patients, and suppressed expression of miR-373 in liver probably represents a more aggressive phenotype. [score:10]
miR-373 expression levels are down-regulated in a variety of cancers, including cholangiocarcinoma [13], colon cancer [16], pancreatic cancer [31], lung cancer [23] and ovarian cancer [24], overexpression of miR-373 could inhibit cell proliferation and tumor growth. [score:10]
The Hepatitis B × antigen (HBx), which is involved in HBV-related hepatocellular carcinoma (HCC), was shown to be able to down-regulate the expression miR-373 which correspondingly reduces E-cadherin expression, suggesting that HCC with low miR-373 expression level might be more invasive [29]. [score:10]
Nevertheless, in prostate cancer [11], of which miR-373 expression levels were down-regulated in both tumor tissues and cancer cell lines, exogenous miR-373 did not arrest the growth of tumor but accelerate migration and invasion by impeding CD44 translation, suggesting miR-373 might act as an oncogene unexpectedly. [score:8]
miR-373 exerts its functions by suppressing or promoting multiple target genes expression, and is involved in regulation of cell proliferation and growth, cell migration, invasion and metastasis, and DNA damage repair Cellular senescence is a state of irreversible cell cycle arrest, which limits the proliferative capacity of cells exposed to stress signals. [score:8]
While oncogenic stress leads to activation of P53 and induction of P21, which results in cell cycle arrest and senescence, the introduction of miR-372 or miR-373 prevents the inhibition of CDK by targeting tumor suppressor LATS2 directly, thereby permitting proliferation and tumorigenesis of transformed cells [7]. [score:8]
Up-regulation of miR-373, leading to LATS2 suppression, dampens the p53 pathway which is intact in most TGCTs, and allows oncogenic mutations to accumulate, playing an essential role in tumorigenesis of TGCTs. [score:7]
miR-373, either down-regulated or up-regulated, has been implicated in tumorigenesis of various types of tumors (Table  2). [score:7]
Activation of oncogenes, such as Myc [33], β-catenin [19], can also up-regulate miR-373 expression. [score:6]
In addition to E-cadherin, TGFBR2 [22], RAB22A [24], MMP14 [25], IRAK2 and LAMP1 [23] were also identified as direct targets of miR-373 that contributing to its metastasis-inhibiting function. [score:6]
In addition to chromosomal rearrangements of 19q13.4 that result in overexpression of miR-373 [32], many upstream factors have been demonstrated to regulate the expression of miR-373. [score:6]
In addition to LATS2 [10, 12, 21], many other tumor suppressors such as PPP6C [14], DKK1 [19], TNFAIP1 [20] and TP53INP1 [21] are also verified as direct targets of miR-373, implying that miR-373 promotes cell proliferation and tumor growth under certain conditions. [score:6]
CD44 was determined as a functional target of miR-373 and miR-520c, down-regulation of CD44 by miR-373 was responsible for the migration phenotype. [score:6]
In contrast, in human breast cancer cell line MDA-MB-435, which expresses endogenous miR-373, down-regulation of miR-373 significantly weakened cancer cell migration and invasion [8]. [score:6]
E-cadherin, a well-known regulator of migration and invasion [44], can be up-regulated by miR-373 [4, 30, 31]. [score:5]
Another study detected the miRNA expression profiles of seminoma from formalin-fixed and paraffin-embedded (FFPE) surgical samples, presenting that miR-373 was up-regulated about 1530 fold in seminoma compared to normal testicular tissue [51]. [score:5]
Overexpression of miR-373 in A549 cells increased the expression level of E-cadherin, resulting in decreased migration [30]. [score:5]
Meanwhile, infection of Helicobacter pylori (Hp) or Hepatitis B virus (HBV) can also inhibit miR-373 expression [12, 29]. [score:5]
They evidenced that more than 30 proteins involved in cancer invasion and metastasis were found to be regulated by miR-373, among which TXNIP and RABEP1 were demonstrated to be the direct targets. [score:5]
While evidences from cancer cell lines suggested its oncogenic or tumor-suppressive functions, analysis of clinical tumor samples further confirmed that deregulation of miR-373 plays a critical role in tumorigenesis. [score:4]
Deregulation of miR-373 has been demonstrated in a number of cancers, while indisputable evidence has demonstrated that miR-373 is an oncogene [7, 8, 10, 11, 14, 15, 18– 21, 32, 33], solid documents suggested its tumor suppressor character [13, 16, 22– 24, 27, 30, 31, 34, 35]. [score:4]
In cervical cancer cell line HeLa and breast cancer cell line MCF-7, miR-373 was up-regulated under hypoxia [9]. [score:4]
However, no significant up-regulation of miR-373 was detected in hypoxic prostate cancer cell lines [49]. [score:4]
Mechanism analysis revealed many putative oncogenes as the direct target of miR-373, including MBD2 [13], RAB22A [16], RelA and PIK3CA [27] (Table  1). [score:4]
Among the identified HRMs, only miR-210, the master HRM, shows consistent up-regulation under hypoxia in all cell types, other HRMs, including miR-373, response to hypoxia in a cell-specific way [48]. [score:4]
miR-373, up-regulated under hypoxic conditions in certain cancer cells, has been demonstrated to play a role in hypoxic response. [score:4]
First, the upstream molecular regulators of miR-373, which are responsible for the altered expression of miR-373, such as HIF-1 [9], MYC [33] and MBD2 [34], need to be explored. [score:4]
As for down-regulation of miR-373, epigenetic silencing is the major reason [16, 23, 27, 35]. [score:4]
Green boxes display upstream regulators of miR-373, black boxes contain representive functional targets of miR-373, and blue boxes imply the correspondingly involved cellular processes. [score:4]
Hypoxia can induce the expression of miR-373 by activating transcription factors hypoxia inducible factor 1 (HIF-1) [9]. [score:3]
Paradoxically, miR-373 has been demonstrated to function also as a suppressor of cell migration and invasion. [score:3]
To identify miRNAs which cooperate with oncogenic RAS to overcome oncogene induced senescence, Voorhoeve et al. [7] developed a library of vectors expressing the majority of cloned human miRNAs, and identified miR-372 as well as miR-373 as an oncogene for the first time. [score:3]
From that time forth, the functions of miR-373 in tumors as well as the potential targets of miR-373 have been an interested research field. [score:3]
Numerous target mRNAs and DNAs have been verified [4, 7– 31], contributing to the potential roles of miR-373 in cellular processes (Table  1). [score:3]
Serum miR-373 expression levels of HER2 -negative breast cancer were higher than that of HER2 -positive patients, showing us the probability that serum miR-373 might be utilized to estimate the HER2 status of the primary tumor [60]. [score:3]
Upstream factors lead to altered expression of miR-373. [score:3]
Based on results from in vitro and in vivo experiments, miR-373 can both promote and inhibit metastasis of breast cancer cells, functioning in a cell-specific way. [score:3]
Up-regulated miR-373 cooperating with other deregulated miRNAs, which confers stem cell-like characteristics to cancer cells, is a biomarker for poor prognosis. [score:3]
In HER2 -positive patients, however, serum expression levels of miR-373 did not correlate with prognosis [61]. [score:3]
They both demonstrated the up-regulation of miR-373 in tumor tissues compared with non-tumor tissues. [score:3]
By reducing the expression of RAD52, which is an important factor in homology -dependent repair, and RAD23B, which is involved in nucleotide excision repair, miR-373 impairs the DNA damage repair, thereby resulting in genetic instability [9]. [score:3]
Second, additional targets of miR-373 urge to be verified, which may reveal more crosslinks between miR-373 and classical tumor-related signaling pathways such as NF-κB, TGF-β [22], Wnt/β-catenin [19] and JAK/STAT [28]. [score:3]
Notwithstanding the foregoing mentioned tumor promoting function of miR-373, a number of studies also presented the tumor suppressive potential of miR-373. [score:3]
miR-373 regulates cell growth. [score:2]
By down -regulating PPP6C, miR-373 facilitates the proliferation of HCC cell lines HepG2 and QGY-7703. [score:2]
So far, miR-373 has been elucidated to participate in the regulation of cell proliferation [10, 14, 16, 19– 21, 23, 33], apoptosis [26, 27], senescence [7], mesendoderm differentiation [36], migration and invasion [8, 11, 18, 19, 23– 25, 30, 31], it was also involved in hypoxia response as a hypoxia -induced miRNA, taking part in DNA damage repair [9] (Fig.   1). [score:2]
Using a forward genetic screen, Huang et al. [8] transduced MCF-7 cells with a miRNA -expression library and performed transwell cell migration assay to assess their migration ability, identified miR-373 and miR-520c as metastasis-promoting miRNAs. [score:2]
The expression levels of plasma miR-373 were found to be significantly higher in breast cancer patients with lymph node metastasis compared with those without lymph node metastasis, suggesting that plasma miR-373 has an ability to discriminate lymph node status of breast cancer [59]. [score:2]
Based on the metastasis-promoting function of miR-373 in MCF-7 cells, Yan et al. [15] implemented a quantitative proteomics to globally identify the genes regulated by miR-373. [score:2]
It belongs to miR-371-3 gene cluster that is transcribed into polycistronic primary transcript pri-miR-371-3. The pri-miR-371-3 is then processed into 3 pre-miRNAs (pre-miR371, pre-miR-372 and pre-miR-373), giving rise to four mature miRNAs (miR-371, miR-372, miR-373 and miR-373*) [6, 7]. [score:1]
Nevertheless, there are visibly limited studies to speculate the potential role of miR-373 as a biomarker. [score:1]
Initially identified as an ESC-specific miRNA, miR-373 is one of the interested fields in recent years. [score:1]
A four-miR signature representative of these clusters, comprising miR-100, let-7a, miR-371, miR-373, was identified, which could be used to discriminate not only aggressive HBs but also invasive HCCs. [score:1]
miR-373 was first identified as a metastasis-promoting miRNA in breast cancer. [score:1]
miR-373 takes part in hypoxic response. [score:1]
Taken together, miR-373 functions paradoxically, it promotes cell growth, cell migration and invasion on one side, but on the other it yields the opposite effect. [score:1]
Considering the heterogeneity of tumor, it is not hard to comprehend the unpredictable functions of miR-373. [score:1]
The oncogenic potential of miR-373 was first explored in TGCTs [7]. [score:1]
miR-373 is one member of miR520/373 family, which consists of three different miRNA clusters possessing identical seed region, miR-302/367, miR-371/372/373 and miR-520 [8, 18, 22]. [score:1]
Since miR-373 was identified as an ESC-specific microRNA, its implication in cancer can be easily connected to embryonic carcinomas. [score:1]
In human fibrosaroma HT1080 cells, miR-373 and miR-520c can also promote migration. [score:1]
On one side, miR-373 was demonstrated to be positively correlated with higher metastatic phenotype [8], on the other, miR-520c/373 was shown to be negatively correlated with lymph node metastasis [22]. [score:1]
Adi Harel S, Bossel Ben-Moshe N, Aylon Y, Bublik DR, Moskovits N, Toperoff G, et al. Reactivation of epigenetically silenced miR-512 and miR-373 sensitizes lung cancer cells to cisplatin and restricts tumor growth. [score:1]
Wu et al. [14] evidenced that miR-373 functions as an oncogene. [score:1]
To date, functions of miR-373 in breast cancer remain controversial. [score:1]
miR-373 is located in the chromosomal band 19q13.4. [score:1]
miRNA-373 (miR-373) was first identified as one of the human embryonic stem cell (ESC)-specific miRNAs [6]. [score:1]
Although a single miR-373 could be used as diagnostic and prognostic biomarker with considerable sensitivity and specificity, considering the innate heterogeneity of breast cancer, combination of a panel of relevant miRNAs is more reasonable and advisable. [score:1]
The focus of this review is to highlight the diverse functions of miR-373 and its implication in cancer. [score:1]
miR-373 and other tumors. [score:1]
miR-373 and breast cancer. [score:1]
However, mechanism analysis from different perspectives showed us distinct functions of miR-373. [score:1]
microRNAs miR-373 Cancer Proliferation Invasion Oncogene MicroRNAs (miRNAs) are small noncoding RNAs approximately 22 nucleotides (nt) in length that are engaged in virtually all cellular processes [1, 2]. [score:1]
Therefore, when we discuss the functions of miR-373 here, we should bear in mind that other members of miR-520/373 family may possess the same functions. [score:1]
Further study suggested that serum exosomal miR-373 is the predominant source of circulating miR-373, the level of serum exosomal miR-373 was associated with negative ER and PR status [28]. [score:1]
miR-373 modulates cell migration and invasion. [score:1]
At last, with regard to utilize miR-373 as a biomarker either in diagnosis or prognosis of cancer, studies with large cohorts of patients are needed, and the combination of a variety of miRNAs including miR-373 may be more effective. [score:1]
Here, we dissect the functions of miR-373 from the perspective of specific cancer, highlighting its differential role in distinct cancer. [score:1]
miR-373 and testicular germ cell tumors (TGCTs). [score:1]
Functions of miR-373. [score:1]
miR-373 and liver cancer. [score:1]
In human breast cancer cell line MCF-7, which is characterized by non-migratory and non-metastatic phenotype, overexpression of miR-373 promoted cell migration and invasion. [score:1]
In addition, serum miR-373 was found to be significantly higher in patients of breast cancer than healthy women, which indicated that miR-373 is a promising diagnostic biomarker. [score:1]
Large scales of patient cohorts are needed to specialize the paradoxical functions of miR-373 in each subtype with different genetic context. [score:1]
miR-373 and cancers: evidence from both cultured cancer cell lines and clinical samples. [score:1]
[1 to 20 of 89 sentences]
3
[+] score: 259
Using stable transfection with miRNA precursors or inhibitors, we generated (see ) miR-205 -expressing and miR-373 -expressing Caco-2 [WT] clones (Caco-2 [WT]/miR-205; Caco-2 [WT]/miR-373) as well as miR-205-inhibiting and miR-373-inhibiting Caco-2 [D299G] clones (Caco-2 [D299G]/α-miR-205; Caco-2 [D299G]/α-miR-373). [score:11]
We chose stable transfection to overexpress the precursors or inhibitors of miR-205/miR-373 in Caco-2 [WT] or Caco-2 [D299G], because only this approach allowed long-term study of miRNA -mediated induction or inhibition of individual phenotypic effects and permanent gene target modulation. [score:9]
Reversely, high expression levels of phosphorylated STAT3 and N-CADHERIN in Caco-2 [D299G]/α-miR-c were downregulated by stable inhibition of miR-373 (Caco-2 [D299G]/α-miR-373). [score:8]
Overexpression of miR-373 induced loss of epithelial polarity, cytoskeletal reorganization, disruption of intercellular junctions and mitotic spindle aberrations, which were associated with upregulation of N-CADHERIN and TGFβ1 expression levels, suggesting cancer-related EMT [52]. [score:8]
Finally, miR-205 and miR-373 may target (directly or indirectly) many more genes and affect expression of numerous other proteins than identified in this study. [score:7]
Clones of eGFP-tagged miExpress [™] precursor miRNAs of miR-205 (cat# HmiR0026-MR04) and miR-373 (cat# HmiR0347-MR04) and corresponding precursor miRNA scrambled control clone (miR-c) for vector pEZX-MR04 (cat# CmiR0001-MR04) as well as clones of mCherry-tagged miArrest [™] miRNA inhibitors of miR-205 (α-miR-205; cat# HmiR-AN1314-AM02), miR-373 (α-miR-373; cat# HmiR-AN0461-AM02) and corresponding miRNA inhibitor scrambled control clone (α-miR-c) for vector pEZX-AM02 (cat# CmiR-AN0001-AM02) were obtained from GeneCopoeia (Rockville, USA). [score:7]
Overexpression of the miR-205- and miR-373- inhibitors led to decreased expression of mature miR-205 and miR-373 in Caco-2 [D299G]. [score:7]
Using realtime qPCR, we found (Fig 1C) that Caco-2 [WT] showed low levels of miR-205 and miR-373 expression, while both miRNAs were significantly upregulated in Caco-2 [D299G]. [score:6]
Expression of miR-205 and miR-373 is upregulated in colon carcinoma cells in-vitro. [score:6]
Here, we show that expression levels of miR-205 and miR-373 are specifically upregulated only in mucinous CRC. [score:6]
Expression of miR-205 and miR-373 is upregulated in colon carcinoma cells in-vitroNext, we aimed to determine the effects of miR-205 and miR-373 on cellular biology and function in normal and neoplastic intestinal epithelium in-vitro. [score:6]
However, overexpression of miR-373 in Caco-2 [WT] led to significant growth induction in-vivo, while blockade of miR-373 in Caco-2 [D299G] resulted in inhibition of tumor growth. [score:5]
However, overexpression of miR-373 in Caco-2 [WT] induced branching formations suggestive of invasion, whereas inhibition of miR-373 in Caco-2 [D299G] markedly reduced the extent of invasion. [score:5]
As shown in Fig 6C, overexpression of miR-373 in Caco-2 [WT] increased and inhibition of miR-373 in Caco-2 [D299G] decreased cell proliferation rates, respectively. [score:5]
The overexpressed pre-miR-205 and pre-miR-373 were successfully processed to increase expression of mature miR-205 and miR-373 in Caco-2 [WT], respectively, as confirmed by qPCR analysis (Fig 1D). [score:5]
Indeed, stable overexpression of miR-373 in Caco-2 [WT] slightly induced phosphorylation of STAT3 and expression of EMT -associated N-CADHERIN (Fig 5A). [score:5]
Overexpression of miR-205 induces increased mucin production, while overexpression of miR-373 causes dedifferentiation. [score:5]
Second, to gain insight into the functional effects of miR-205/miR-373 signaling, as a proof-of-principle, we used a colon cancer cell-culture mo del based on the IEC line Caco-2 which reflected the endogenous miR-205/miR-373 expression pattern in correlation with human disease in patients with MAC. [score:5]
Expression levels of (A) miR-205 and (B) miR-373 are significantly upregulated in human mucinous (n = 20) and chronic UC (n = 13) CRC tumor areas compared to matched R [0] margins, as determined by qPCR. [score:5]
0156871.g001 Fig 1Expression levels of (A) miR-205 and (B) miR-373 are significantly upregulated in human mucinous (n = 20) and chronic UC (n = 13) CRC tumor areas compared to matched R [0] margins, as determined by qPCR. [score:5]
As shown in Fig 6A, Caco-2 [WT]/miR-373 showed loose patches of fibroblast-like, spindle-shaped mesenchymal cells after brief trypsinization, comparable to Caco-2 [D299G]/α-miR-c. In contrast, Caco-2 [D299G]/α-miR-373 maintained adhesive cobblestone-like epithelial morphology after treatment with trypsin, comparable to Caco-2 [WT]/miR-c. No changes in cell adhesion were evident by overexpression or inhibition of miR-205 in Caco-2 [WT] or Caco-2 [D299G], when compared to control clones. [score:4]
Further studies will need to identify the mechanisms that directly control expression of miR-205 and miR-373 during mucinous carcinogenesis in the colon. [score:4]
Future studies must determine whether such mutations may influence activity and outcome of miR-205/miR-373 signaling and whether aberrant TLR4 signaling may be directly involved in MAC pathogenesis. [score:3]
Expression of miR-205 and miR-373 differentially (A) alters actin cytoskeletal architecture, influences (B) ZO-1 and (C) phospho-β-CATENIN -associated barrier integrity, and (D) induces formation of multinucleated cells with multipolar spindles. [score:3]
In contrast, no significant differences in miR-205 and miR-373 expression are observed between paired conventional CRC (n = 18) tumor tissue and corresponding normal mucosa. [score:3]
Furthermore, enlarged nuclei of Caco-2 [WT]/miR-373 revealed gross perturbations of the mitotic spindle, comparable to Caco-2 [D299G]/α-miR-c. In contrast, inhibition of miR-373 in Caco-2 [D299G] promoted epithelial tightening by apical polarization of actin filaments and re-establishment of ZO-1- and phospho-β-CATENIN- associated barrier integrity, thus reducing the mesenchymal phenotype of poorly differentiated Caco-2 [D299G]. [score:3]
We demonstrate that enforced expression of miR-373 into normal-like Caco-2 [WT] was sufficient to drive progression to inflammation -associated, aggressive carcinoma. [score:3]
Stable inhibition of miR-373 in Caco-2 [D299G] led to organization of polarized epithelial cells, which resembled differentiated Caco-2 [WT]/miR-c (Fig 2A–2D). [score:3]
Remarkably, Caco-2 [D299G] /α-miR-373 showed normal mitotic metaphases, comparable to Caco-2 [WT]/miR-c. However, inhibition of miR-205 in Caco-2 [D299G] did not change the fibroblast-like appearance with actin cytoskeletal disorganization, cytoplasmic redistribution of ZO-1 and aberrant mitotic figures. [score:3]
Overexpression of miR-373 induces signaling mediators of inflammation -associated progression and invasion. [score:3]
Of note, conditioned media from Caco-2 [D299G] stimulated enhanced expression of miR-373, but not miR-205, in Caco-2 [WT] (Fig 5D). [score:3]
Among the 2–7 remaining candidates per plasmid, individual subclones were chosen based on best expression levels of mature miR-205 and miR-373 using qPCR analysis. [score:3]
Inhibition of miR-373 allowed mesenchymal Caco-2 [D299G] to regain epithelial properties, which correlated functionally with absence of tumor progression. [score:3]
Expression levels of miR-205 and miR-373 were specifically increased in the two subgroups of colonic adenocarcinoma associated with mucin production (mucinous and chronic UC-related colorectal cancers) relative to adjacent normal colonic mucosa (Fig 1A and 1B). [score:3]
However, we did not identify any correlations between miR-205 and miR-373 expression levels and cancer stages (including histological grade) in any subtype. [score:3]
0156871.g003 Fig 3Expression of miR-205 and miR-373 differentially (A) alters actin cytoskeletal architecture, influences (B) ZO-1 and (C) phospho-β-CATENIN -associated barrier integrity, and (D) induces formation of multinucleated cells with multipolar spindles. [score:3]
analysis of the supernatants (Fig 5C) confirmed high baseline secretion of protein amounts of CHI3L1 and TFPI mediated by miR-373, which were decreased when expression of miR-373 was low (Caco-2 [WT]/miR-c) or blocked (Caco-2 [D299G]/α-miR-373). [score:3]
S4 FigExpression levels of (A) miR-205, (B) miR-373, (C) miR-1, (D) miR-10a and (E) miR-133a in different human colonic adenocarcinoma cell lines (LS 174T, HT-29, HCT 116 and SW480), in comparison to naïve (untransfected) Caco-2, Caco-2 [WT] and Caco-2 [D299G] cells, as determined by qPCR (n ≥ 2 samples/cell line). [score:3]
Overexpression of miR-205 and miR-373 differentially alter morphological features of intestinal epithelial barrier integrity. [score:3]
We show in patients that elevated expression levels of miR-205 and miR-373 are associated with mucinous colon cancers and mucin-producing UC-colon cancers, but not with sporadic colonic AC that lack mucinous components. [score:3]
In contrast, miR-205/miR-373 expression levels were not elevated in sporadic AC, implying the presence of this specific miRNA signature only in mucin -associated subentities of CRC. [score:3]
No significant differences in miR-205 and miR-373 expression were identified in paired colonic tumor tissue and corresponding normal mucosa from patients with conventional colonic adenocarcinoma (non-mucinous). [score:3]
Expression levels of miR-205 and miR-373 in human CRC patient samples and Caco-2 subclones. [score:3]
In contrast, Caco-2 [WT] overexpressing miR-373 displayed irregular, highly cellular structures, which resembled undifferentiated human AC (S5 Fig). [score:3]
miR-373, first identified as an embryonic stem cell-specific miRNA [28], may directly regulate the activity of the Wnt/β-catenin pathway [29]. [score:3]
In contrast, overexpression of miR-373 in Caco-2 [WT] induced features of poorly differentiated, heterogeneous cells growing in flat sheets, which resembled neoplastic Caco-2 [D299G]/α-miR-c (Fig 2A–2D). [score:3]
First, we showed that the expression patterns of miR-205 and miR-373 differed between human mucinous vs. [score:3]
Reversely, the conditioned media from Caco-2 [D299G] induced expression of miR-373, but not miR-205, in Caco-2 [WT], suggesting that secretory products from the tumor cells may have the capacity to promote miR-373 signaling in a paracrine/autocrine manner, which may contribute to malignant transformation. [score:3]
Expression levels of miR-205 and miR-373 are increased in mucin-producing human colon cancers. [score:3]
Overexpression of miR-373 in Caco-2 [WT] caused disruption and irregular redistribution of actin filaments, tight junctional ZO-1 and phosphorylated β-CATENIN to the cytoplasm, implying compromised intestinal epithelial barrier and fence function. [score:3]
0156871.g002 Fig 2(A-D) Caco-2 [WT] overexpressing miR-205 or miR-373 display significant morphologic changes when compared to control Caco-2 [WT]/miR-c. In contrast, suppression of miR-373 reverses some of the neoplastic characteristics of Caco-2 [D299G]. [score:2]
Our results suggest that STAT3, a central checkpoint at the intersection between inflammation and tumor development [53], is involved in miR-373 signaling in cancerous IEC. [score:2]
Functionally, miR-205 directs the intestinal epithelial cell fate decision toward a mucin-producing goblet cell-like lineage and miR-373 drives inflammation -associated tumor progression by decreasing cell-cell adhesion and increasing invasion. [score:2]
In contrast, activation or inactivation of miR-373 did not regulate chemoresistance, as proliferation rates in response to MTX were comparable between Caco-2 [WT]/miR-373 or Caco-2 [D299G]/α-miR-373 and their control clones. [score:2]
Recently, independent reports have variably reported miR-205 and miR-373 to be associated with CRC [21– 23], but individual cases were not classified into histological subtypes. [score:1]
We tested the single miRNAs individually, and not the combined miR-205/miR-373 phenotype. [score:1]
miR-373 induces enhanced tumor growth which is attenuated by blockade of miR-373, as determined (A,B) in the CD-1 nu/nu xenograft mo del. [score:1]
Functional analysis of miR-205 and miR-373 in colon cancerogenesis. [score:1]
We investigated the role of miR-205 and miR-373 in the pathophysiology of different histological subtypes of colorectal cancer by assessing their expression, together with that of other miRNAs, in specimens of conventional, mucinous and UC -associated human colonic adenocarcinoma. [score:1]
In conclusion, to the best of our knowledge, this study provides first evidence that miR-205 and miR-373 may correlate with mucinous CRC in humans and functionally induce different features of mucinous -associated neoplastic progression in Caco-2 subclones. [score:1]
miR-373 activates molecules related to inflammation and invasion, as assessed by (A) western blot, (B, D) qRT-PCR, (C) and (E) IPA analysis. [score:1]
miR-373 induces enhanced production of mediators related to inflammation and invasion. [score:1]
Using xenografts in mice demonstrated miR-373 -mediated acceleration of malignant intestinal tumor growth and angiogenesis in-vivo. [score:1]
Next, we aimed to determine the effects of miR-205 and miR-373 on cellular biology and function in normal and neoplastic intestinal epithelium in-vitro. [score:1]
miR-205 induces increased mucin production, while miR-373 causes dedifferentiation. [score:1]
We cannot exclude that aberrant epigenetic events during inflammation and/or tumorigenesis, caused e. g. by hypoxia [56], may have modulated miR-373 signaling. [score:1]
miR-373 promotes invasive intestinal xenograft tumor growth in-vivo. [score:1]
We assessed whether miR-373 may be involved in modulating STAT3 -associated signaling pathways. [score:1]
In addition, expression levels of cell cycle (CDK2, CDC2, CCND2) and inflammation markers linked to cancer (NOS2, TGFβ1, CHI3L1 and TFPI) were significantly increased in Caco-2 [WT]/miR-373 compared with Caco-2 [WT]/miR-c, but decreased in Caco-2 [D299G]/α-miR-373 compared with Caco-2 [D299G]/α-miR-c (Fig 5B). [score:1]
miR-373 belongs to the miR-520/-373 family, which consists of three different miRNA clusters (miR-302/-367, miR-371/-372/-373, and miR-520) [27]. [score:1]
Constitutive secretion of pro-tumorigenic and pro-inflammatory mediators (CHI3L1 [54], TFPI [55]) into the supernatant was excessively induced by miR-373. [score:1]
Lower panel: representative isotype IgG-control (left); exemplary vessel (black arrow) in tumor xenograft of Caco-2 [WT]/miR-373 (right). [score:1]
Signaling via miR-205 and miR-373 can favor epithelial-to-mesenchymal transition (EMT) and cancer cell migration in certain tumor entities [24, 31– 33]. [score:1]
miR-205 and miR-373 drive different functions of colon cancer progression. [score:1]
Caco-2 [WT]/miR-373 on day 23 (bar, 50 μm). [score:1]
Both miR-205 and miR-373 seem to exert pleiotropic effects on tumorigenesis, depending on the cell or tissue of origin. [score:1]
EMT in Caco-2 [WT]/miR-373 or Caco-2 [D299G]/α-miR-c correlated with the low mRNA level of the IEC differentiation marker SI in these clones (Fig 5B). [score:1]
Suppression of miR-373 reversed some of the neoplastic characteristics of Caco-2 [D299G]. [score:1]
Thus, we provide first evidence that distinct signaling effects of miR-205 and miR-373 may differentially contribute to the unique phenotype of MAC in CRC. [score:1]
0156871.g006 Fig 6. Functional analysis of miR-205 and miR-373 in colon cancerogenesis. [score:1]
To further understand the morphologic changes induced by miR-205 and miR-373, we performed a series of immunofluorescence staining experiments to assess the effects on structural organization of the actin cytoskeleton (Fig 3A), distribution of barrier -associated tight junctional ZO-1 (Fig 3B) and phospho-β-CATENIN (Fig 3C) and formation of the mitotic spindle (Fig 3D). [score:1]
However, the possible roles of miR-205 and miR-373 in CRC pathogenesis remain so far unknown. [score:1]
The IPA knowledge base suggested that the identified miR-373 -associated molecules interconnected with STAT3 to a common signaling pathway, combining the overlapping functions “inflammation” and “invasion” in “cancer” (Fig 5E). [score:1]
Our results indicate that miR-205 and miR-373 may differentially contribute to the aggressive behavior of mucinous malignancy in CRC. [score:1]
miR-205 and miR-373 disturb intestinal epithelial barrier integrity. [score:1]
Our findings imply that miR-373 plays a unique role in EMT -associated colon cancer progression, because the sole inactivation of miR-373 in cancerous IEC elicited dramatic changes by reversing the phenotype to a MET state. [score:1]
Newly formed blood vessels were found within the tumor xenografts from Caco-2 [WT]/miR-373, but not in Caco-2 [WT]/miR-c (Fig 7B). [score:1]
[1 to 20 of 87 sentences]
4
[+] score: 257
Other miRNAs from this paper: hsa-mir-370, mmu-mir-370, hsa-mir-1180, hsa-mir-1236
MiR-373 act as a tumor suppressor role during BCa progression by recovering E-cadherin expression which leads to down-regulation of Cyclin D1, C-myc and MMP2, therefore inhibits cells proliferation, migratory and invasive capacity. [score:9]
In the present study, we found that the miR-373 activated E-cadherin expression via directly targeting the promoter to study its inhibition on the cell proliferation, invasion and migration in BCa. [score:8]
We found that miR-373 could robustly enhance E-cadherin expression in BCa cells by targeting its promoter, and inhibit cells growth and metastasis. [score:7]
According to the levels of miR-373 and E-cadherin expression, Kaplan-Meier curves suggested that BCa patients with high levels miR-373 or E-cadherin expression survived longer than those with low levels of miR-373 and E-cadherin expression did (Figure 1H; HR = 6.74, 95% CI: 2.98–42.77; P = 0.0046). [score:7]
After co -transfected with siCDH1, miR-373 failed to up-regulate E-cadherin or down-regulated Cyclin D1, C-myc and MMP2 mRNA levels (*P<0.05, **P<0.01 ***P<0.001). [score:7]
On the whole, our research provides direct evidence that miR-373 has the ability to activate the expression of E-cadherin through targeting specific complementary motifs of the promoter region in human BCa cells. [score:6]
In order to elucidate the inhibitory effect of miR-373 on BCa cells, we enforced miR-373 expression in EJ and 5637 cells via miRNA mimics. [score:5]
What’s more, miR-373 significantly suppresses the proliferation and metastasis capacity of BCa cells mainly by stimulating E-cadherin expression. [score:5]
Furthermore, we analyzed the relationships between miR-373, E-cadherin expression and the clinicopathologic factors of BCa, as shown in Table 1, miR-373 and E-cadherin expressions (T/N) were related to tumor stage, grade, and lymph node metastasis (P < 0.05). [score:5]
Moreover, miR-373 was demonstrated to be low expressed in a variety of cancers and restoration of it could significantly inhibit tumor progression [18– 21]. [score:5]
Low level of E-cadherin expression or decreased expression level of both miR-373 and E-cadherin is correlated with poor overall survival (OS) in patients with BCa. [score:5]
Overexpression of miR-373 inhibited cell proliferation in both EJ and 537 cells. [score:5]
In the current study, we mainly focus on exploring whether miR-373 possessed the ability to activate E-cadherin expression and then suppress cells proliferation, migration and invasion in human BCa cells. [score:5]
Result showed that the expression level of miR-373 was positively correlated with the level of E-cadherin expression in BCa and adjacent normal tissues (Figure 1E; r = 0.63, P<0.0001 and Figure 1F; r = 0.56, P<0.0001). [score:5]
Most importantly, after co-transfection with siCDH1, the anti-tumor effects of miR-373 were markedly weakened, which indicated that miR-373 inhibited BCa cells proliferation and metastasis in vitro and in vivo mainly by activating E-cadherin expression. [score:5]
It was manifested that a putative miR-373 could induce E-cadherin expression by targeting specific promoter sequences in prostate cancer PC-3 cells [13]. [score:5]
MiR-373 inhibits downstream genes’ expression of E-cadherin. [score:4]
MiR-373 inhibits E-cadherin’s downstream genes Cyclin D1, C-myc and MMP2 expression. [score:4]
To further confirm the changes of cell proliferation induced by miR-373, an EdU assay was conducted and the outcomes showed over -expression of miR-373 suppressed cells proliferation in two BCa cell lines (Figure 5A and 5C). [score:4]
Although the clinicopathological role of miR-373 has not been estimated in BCa, down-regulation of miR-373 has been discovered in several different types of cancers [18– 21, 26]. [score:4]
MiR-373 expression is positively associated with E-cadherin expression. [score:4]
Both (C) E-cadherin and (D) miR-373 expressions were reduced in human BCa tissues compared with the expressions in adjacent normal tissues. [score:4]
These outcomes suggest that miR-373 induces gene expression by directly interacting with the E-cadherin promoter. [score:4]
MiR-373 inhibits BCa cells proliferation mainly through activating E-cadherin expression. [score:4]
Moreover, we co -transfected siCDH1 (silencing E-cadherin expression) and miR-373 mimic into BCa cells and found that E-cadherin expression was dramatically abrogated compared with miR-373 group (Figure 2C, 2E). [score:4]
Bioluminescence imaging showed that fluorescence signal in Lenti-miR-373 group was remarkably weaker than Lenti-dsControl group, which means that less metastasis was occurred in lung tissue after miR-373 up-regulation (Figure 7G). [score:4]
MiR-373 increased E-cadherin and suppressed CyclinD1, C-myc and MMP2 mRNAs expression. [score:4]
Briefly, E-cadherin plays an important role in the miR-373 suppressed EMT signaling pathway [29]. [score:3]
The examples of differential induction of target genes were detected in HCT-116, LNCaP and PC-3 cells, in which CSDC2 and E-cadherin were differentially susceptible to gene induction by miR-373 [13]. [score:3]
high miR-373 or E-cadherin 6.74(2.98-42.77) 0.0046 5.29(2.02-33.96) 0.014 To observe the effects of miR-373 on E-cadherin in BCa cells, we transfected miR-373 mimic into BCa cells and detected E-cadherin expression 48-72 h later. [score:3]
Based on the median-fold change in miR-373 and E-cadherin expression, BCa patients were divided into two subgroups (high miR-373 or E-cadherin group, low miR-373 and E-cadherin group). [score:3]
no) 6.63(1.17-37.05) 0.011 5.37(1.08-21.10) 0.041 miR-373 expression (low vs. [score:3]
The expression of E-cadherin mRNA was significantly increased after miR-373 mimic transfection (Figure 2B). [score:3]
Combined low expression levels of miR-373 and E-cadherin were associated with poor overall survival in patients with BCa. [score:3]
Both miR-373 and E-cadherin were verified to be relate to BCa progression, the Pearson correlation coefficient analysis was applied to detect the relationship between miR-373 and E-cadherin expression levels. [score:3]
To identify whether a putative miR-373 activating E-cadherin in BCa cells by targeting specific site in the promoter, we conducted by using biotinylated miR-373 which was transfected into EJ and 5637 cells. [score:3]
Besides, miR-373 could also dramatically inhibit the growth of BCa xenografts and metastasis in nude mice. [score:3]
Our research fully demonstrates that miR-373 possesses a potential therapeutic application for BCa by targeting activation of E-cadherin. [score:3]
Lenti-miR-373 was used to enforce miR-373 expression following infection into EJ cells according to the manufacturer’s protocols. [score:3]
We further detected the influences of miR-373 on the expression of genes associated with cell proliferation and migration in two BCa cell lines. [score:3]
These suggest that miR-373 and E-cadherin may act as tumor suppressors in BCa. [score:3]
And knockout of E-cadherin evidently weakened the anti-proliferative effect regulated by miR-373 in both cell lines (Figure 4B). [score:3]
The outcomes showed that miR-373 and E-cadherin expressions were also significantly lower in tumor tissues than adjacent normal tissues (Figure 1C, 1D). [score:3]
Similarly, the multivariate Cox regression mo del indicated that low expression level of miR-373 and E-cadherin in BCa was correlated with a poor prognosis for OS (HR = 5.29, 95% CI: 2.02–33.96; P = 0.014), independent of other clinicopathologic factors (Table 2). [score:3]
Both (E) and (F) showed positive correlation between miR-373 and E-cadherin expression levels in BCa and adjacent normal tissues. [score:3]
As shown in Figure 5D, Lenti-miR-373 significantly inhibited xenograft tumor growth. [score:3]
Relationship between expression of miR-373, E-cadherin, and clinicopathologic factors in patients with BC (n=40). [score:3]
To assess the potential value of miR-373 and E-cadherin in BCa, we detected both miR-373 and E-cadherin expression in BCa cells and clinical tissues. [score:3]
These results demonstrated that miR-373 could attenuate the migration and invasion ability of BCa cells mainly by inducing E-cadherin expression. [score:3]
We next analyzed selected patients’ subgroups based on the combination of miR-373 and E-cadherin expression. [score:3]
MiR-373 exerted a potent inhibiting effect on migration and invasion of the both cell lines (*P<0.05, **P<0.01). [score:2]
MiR-373 activates E-cadherin expression in BCa cells. [score:2]
MiR-373 inhibited cells proliferation in both EJ and 5637 cells. [score:2]
The expression levels of miR-373 and E-cadherin were decreased in 3 BCa cell lines including EJ, 5637 and T24 cells compared with SV-HUC-1 cells (Figure 1A, 1B). [score:2]
MiR-373 and E-cadherin expressions are reduced in BCa tissues and cells and are correlated with BCa progression. [score:2]
In the present study, we examined the role of miR-373 in BCa cells development. [score:2]
MiR-373 inhibited BCa cells proliferation in vitro and in vivo. [score:2]
Figure 1 (A) E-cadherin and (B) miR-373 expressions were reduced in EJ, 5637 and T24 cell lines compared with primary normal human bladder epithelial cells (SV-HUC-1), (*P<0.05, **P<0.01). [score:2]
Compared with dsControl, miR-373 displayed a potent inhibition on migration of the tested cell lines. [score:2]
MiR-373 can effectively activate E-cadherin expression both in EJ and 5637 cells. [score:2]
E-cadherin expression was dramatically decreased in co-transfection group compared with the miR-373 group. [score:2]
MiR-373 suppresses BCa cells migration and invasion. [score:2]
And linking a biotin group to the 5′-end of the strand of miR-373 abolished activation of E-cadherin, whereas biotin labeling at the 3′-end did not significantly affect miR-373 activity (**P<0.01). [score:1]
miR-373 interacts with E-cadherin promoter. [score:1]
Then, the EJ cells were stably transfected miR-373 or dsControl, and the transfected EJ cells were used to generate the xenograft mo del in nude mice. [score:1]
Besides, Lenti-miR-373 and Lenti-dsControl were structured by GenePharma (Shanghai, China). [score:1]
However, opposite results are also found for miR-373 in several cancer types [22, 27, 28]. [score:1]
The biotin was covalently linked to either the 5′-end or the 3′-end of miR-373 and dsControl antisense. [score:1]
Before they were used in, we first tested RNAa activity of these biotinylated miR-373 in EJ and 5637 cells. [score:1]
Then, we evaluated the miR-373 and E-cadherin expression levels in 40 pairs of BCa and the corresponding adjacent normal tissues. [score:1]
Figure 2 (A) Transfection ratio was tested by qRT-PCR, dsControl and miR-373 were significantly increased in mimic group than baseline in EJ and 5637 cells. [score:1]
As far as know, this is the first study of the role of miR-373 role in BCa. [score:1]
As shown in Figure 3C and 3D, both 3′-end and 5′-end of the biotin -labelled miR-373 pulled down promoter proximal DNA (from -728 to -603) more effectively than the dsControl did. [score:1]
As shown in Figure 3A, linking a biotin group to the 5′-end of miR-373 (miR-373-5′-Bio) abolished activation of E-cadherin, whereas 3′-end of miR-373 (miR-373-3′-Bio) did not affect its activating activity. [score:1]
Nevertheless, further study is required to clarify the exact mechanism of RNAa and expand the application domain of miR-373 in different type tumors therapeutics. [score:1]
As shown in Figure 6A and 6C, miR-373 failed to decrease Cyclin D1, C-myc and MMP2 mRNA levels after siCDH1 co-transfection. [score:1]
The metastasis associated gene MMP2 was also decreased after miR-373 treatment. [score:1]
indicated that transfection of miR-373 led to slower wound closing speed than dsControl group from 12h in tested cells (Figure 7A and 7B). [score:1]
high) 5.31(2.09-27.15) 0.0083 3.98(1.21-17.02) 0.021 Low miR-373 and E-cadherin vs. [score:1]
On the contrary, there was no significant difference in the binding of miR-373 and dsControl RNAs to the negative control (-1235 to -1013). [score:1]
In the present study, we tested RNAa activity of these biotinylated miR-373 in EJ and 5637 cells, linking a biotin to the 5′-end of miR-373 (miR-373-5′-Bio) abolished activation of E-cadherin, whereas biotin labeling at the 3′-end of miR-373 did not affect miR-373’s activating activity. [score:1]
EJ cells (about 5 × 10 [6], 200 μL) infected with Lenti-miR-373 or Lenti-dsControl were injected subcutaneously into the right back of male BALB/c-nude mice, respectively. [score:1]
Our results indicate that miR-373 may serve as a new candidate anti-cancer drug for BCa management. [score:1]
The results showed miR-373 caused a marked decrease of CyclinD1, C-myc and MMP2 mRNA levels in both EJ and 5637 cells (Figure 6A and 6B). [score:1]
In addition, the colony formation rates of miR-373 transfected both EJ and 5637 cells were significantly lower than dsControl treatment (Figure 4E). [score:1]
And several proliferation related genes (Cyclin D1 and C-myc) were decreased following miR-373 transfection. [score:1]
Hence, we tested the effects of miR-373 in migration and invasion capacities of BCa cells. [score:1]
In contrast, there was no difference in the binding of miR-373 and dsControl RNAs to the DNA upstream of the E-cadherin promoter that served as a negative control. [score:1]
[1 to 20 of 88 sentences]
5
[+] score: 251
Following the observation of the elevated expression of miR-373 in human gastric adenocarcinoma tissue samples and AGS cells, the study demonstrated that: i) Overexpression of miR-373 is associated with accelerated cell differentiation; ii) miR-373 directly targets and downregulates the expression of TNFAIP1; and iii) the knockdown of miR-373 by miRNA inhibitors recapitulates the differentiation phenotype created by the overexpression of TNFAIP1. [score:18]
Abnormal upregulation of miR-373 was observed in the gastric adenocarcinoma tissue and AGS cells, while low expression was observed in the matched normal tissue, indicating that miR-373 expression is upregulated in gastric cancer (Fig. 1A). [score:11]
This conclusion was established by results showing that the downregulation of miR-373 expression by miR-373 -ASO suppressed the growth of AGS cells and increased apoptosis. [score:8]
One notable point observed in this study was that the upregulation of miR-373 and the downregulation of TNFAIP1 was all in grade I, II and III gastric adenocarcinoma tissues. [score:7]
miR-373 negatively regulates TNFAIP1 expression by targeting the 3′UTR. [score:6]
When the AGS cells were transfected with miR-373 inhibitors (miR-373 -ASO), which are 2′OMe chemically modified, single-stranded nucleic acids designed to specifically bind to and inhibit endogenous miR-373 molecules, the observations indicated that TNFAIP1 was negatively regulated by miR-373 at the protein and mRNA levels. [score:6]
Previously, it was observed that miR-372 and miR-373 act as oncogenes in the tumorigenesis of human testicular germ cell tumors (Tera-1 and 833KE cells), through the direct inhibition of LATS2 expression (11). [score:6]
However, when transected with miR-373 inhibitors (miR-373 -ASO) in AGS cells, which are 2′OMe chemically modified, single-stranded nucleic acids designed to specifically bind to and inhibit endogenous miR-373 molecules, the observations indicated that TNFAIP1 was negatively regulated by miR-373 at the protein level (Fig. 4B). [score:6]
High expression of miR-373 inversely correlated with lower expression of TNFAIP1 in human gastric cancer (Fig. 3B). [score:5]
To confirm the expression level of miR-373 in gastric adenocarcinoma tissue and normal gastric tissues, total RNA was extracted from 15 gastric adenocarcinoma samples, consisting of five grade I, five grade II and five grade III gastric adenocarcinoma tissues, 15 matched normal tissues and three human gastric carcinoma cell lines, and then qPCR was performed to analyze the expression profile. [score:5]
However, it is not clear whether miRNA-373 affects the growth of gastric cancer cells through the inhibition of TNFAIP1 expression. [score:5]
There is, however, a limitation within the present data interpretation with regard to the correlated expression of miR-373 and TNFAIP1, since human gastric adenocarcinoma tissue and normal gastric tissues were used to detect their expression levels. [score:5]
Conversely, reducing miR-373 expression using miRNA inhibitors greatly sensitized the cells to apoptosis. [score:5]
In addition, miR-373 was noted to affect esophageal cancer cell growth through the inhibition of LATS2 expression (12). [score:5]
The expression of miR-372 or miR-373 suppressed the firefly luciferase activities of the MRE-containing 3′UTR of TNFAIP1 (Fig. 2B). [score:5]
Recent evidence suggests that miR-373 is tumorigenetic in human reproductive system cancers and human embryonic stem cells (ESCs) by targeting the tumor suppressor LATS2 (25). [score:5]
Moreover, a high expression of miR-373 inversely correlated with a lower expression of TNFAIP1 in these gastric adenocarcinoma tissues. [score:5]
The high expression of miR-373 was observed in human gastric adenocarcinoma tissue and AGS cells, while the potential expression levels of TNFAIP1 were not clear. [score:5]
Two putative miR-373 binding sites were predicted to have greater specificity to the TNFAIP1 3′UTR, ranging from dinucleotide 170–192 bp or 570–593 bp, as predicted by four algorithms (TargetScan, PicTar, miRanda and miRBase Target). [score:5]
s showed that the proliferation rate was reduced following the overexpression of TNFAIP1, which was able to produce the same effect as miR-373 inhibitor treatment in the AGS cells (Fig. 5A and D). [score:5]
The results showed that the overexpression of miR-373 markedly decreased the expression of TNFAIP1 at the protein and mRNA levels. [score:5]
To examine the effect of miR-373 on endogenous TNFAIP1 expression, miR-373 mimics were transfected into HGC-27 cells, which are known to express high levels of TNFAIP1 protein. [score:5]
In the present study, the expression of miR-373 was detected in human gastric adenocarcinoma tissue samples and gastric cancer cell lines and observed to be upregulated compared to levels in normal gastric tissues. [score:5]
This supports the hypothesis that miR-373 induces the proliferation of gastric cancer cell lines by negatively regulating the expression of TNFAIP1 at the protein level. [score:4]
qPCR was used to determine the expression levels of TNFAIP1 and miR-373 using the primers presented in Table I. β-actin levels were used to normalize expression. [score:4]
Collectively, these findings demonstrate an oncogenic role for miR-373 in controlling cell growth and apoptosis through the downregulation of TNFAIP1. [score:4]
The enhanced expression of miR-373 in the HGC-27 cells significantly decreased the amount of TNFAIP1 protein expression compared with mock transfection (Fig. 4A). [score:4]
To determine whether increasing miR-373 reversed the inhibition of cellular proliferation observed due to overexpression, the GES-1 cells were transfected with miR-373 mimics and compared with the results for miR-373 -ASO, miR-NC -ASO and miR-NC. [score:4]
Considering that miR-373 overexpression is able to increase the proliferation of gastric cancer cells, several predicted target genes associated with tumorigenesis or cell proliferation were subjected to a luciferase reporter assay in the present study. [score:4]
miR-373 is upregulated in human gastric adenocarcinoma tissue and AGS cells. [score:4]
The study further demonstrated that miR-373 induces the cell proliferation of gastric cancer cells in vitro, via the downregulation of TNFAIP1. [score:4]
In order to further investigate the effect of miR-373 on the regulation of TNFAIP1 expression in the AGS cells, AGS cells grown on a 6 cm plate were co -transfected with miR-373 mimics and TNFAIP1 expression vector pCMV-TNFAIP1, pCMV-TNFAIP1-3′UTR and pCMV-TNFAIP1-3′UTRMT, respectively. [score:4]
To determine whether miR-373 has a direct effect on TNFAIP1 expression, miR-373 mimics or miR-373 -ASO were transfected into the HGC-27 or AGS cells to alter the level of miR-373. [score:4]
Moreover, the bioinformatics prediction and experimental results indicated that miR-373 is able to target TNFAIP1. [score:3]
The growth rate of the AGS cells transfected with the miR-373 inhibitor was lower than in those transfected with the miR-NC, miR-NC -ASO and miR-373 mimics (Fig. 5A). [score:3]
miR-373 overexpression affected the cell growth and correlated with the level of TNFAIP1. [score:3]
Once the conserved targeting regions for miR-373 recognition had been mutated, the relative luciferase activity of the TNFAIP1 gene was also restored. [score:3]
Three mutant vectors of the 3′UTR of TNFAIP1 were also constructed: Two single site mutation vectors, with one binding site with miR-373 and a whole site mutation vector, with no binding site with miR-373. [score:3]
Computational algorithms showed >500 targets of miR-373. [score:3]
miR-373 represses endogenous TNFAIP1 expression. [score:3]
The present study has shown the expression of miR-373 in three gastric cancer cell lines to be consistent with a previous study (16) (Fig. 1B), indicating that this may play a possible role as an oncogene. [score:3]
miR-373 induces AGS cell proliferation by targeting TNFAIP1. [score:3]
Overexpression of miR-373 in the HGC-27 cells increased cell growth. [score:3]
The present study demonstrated that miR-373 is upregulated in gastric adenocarcinoma tissue and gastric carcinoma cell lines when compared to normal gastric tissues. [score:3]
The predicted MRE, wild-type 3′UTR of TNFAIP1, was cloned downstream of the firefly luciferase of the pmirGLO vector and co -transfected with miR-372 or miR-373 mimics (double-stranded processed miRNA) into HEK293 cells, which do not express miR-372 or miR-373. [score:3]
The relative expression of miR-373 measured using RT-PCR demonstrated that miR-373 expression levels in the AGS cells were markedly higher than in the GES-1 cells, where the level was almost undetected. [score:3]
These observations indicate that TNFAIP1 is negatively regulated by miR-373. [score:2]
miR-373 regulates growth of gastric cell lines. [score:2]
Thus, we conclude that miRNA-373 accelerates gastric cancer cell differentiation by negatively regulating TNFAIP1. [score:2]
The results showed that, among these selected genes, TNFAIP1 was negatively regulated by miR-373. [score:2]
This showed that, in grades I, II and III gastric adenocarcinoma tissues, the upregulation of miR-373 was more marked than that in 15 matched normal tissues, while the mRNA levels of TNFAIP1 in all investigated gastric adenocarcinoma tissues were lower than those in matched normal tissues (Fig. 3A). [score:2]
To characterize the effects of miR-373 on cell growth, the AGS cells were transfected with miR-373 -ASO, and growth was monitored using a cell growth curve, which indicated that the knockdown of miR-373 inhibited cell growth. [score:2]
These findings are in agreement with a previous report demonstrating that miR-373 has oncogenic properties (11). [score:1]
Quantitative (q)PCR analyses for miR-373 and U6 were performed in triplicate with the SYBR-Green PCR Master mix (Perkin-Elmer Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s instructions. [score:1]
In conclusion, the present study established the important role played by miR-373 in gastric cancer. [score:1]
The present study validated whether the predicted MRE could be recognized by the miR-372/miR-373 family using the dual-luciferase vector pmirGLO. [score:1]
These observations indicate that the predicted complementary sequence in TNFAIP1 3′UTR is a functional element of miR-373. [score:1]
Whether miR-373 and TNFAIP1 may be used as molecular markers for the diagnosis of gastric adenocarcinoma requires more evidence. [score:1]
The growth of gastric cell lines affected by miR-373 was then studied using an. [score:1]
A correlation was observed between the level of miR-373 and the mRNA levels of TNFAIP1 in gastric adenocarcinoma tissue. [score:1]
Nevertheless, the stomach is a mixture of different cell types and detection of miR-373 and TNFAIP1 by other methods may be required. [score:1]
These studies indicate that AGS and GES-1 cell growth may be positively modulated by miR-373. [score:1]
In conclusion, these results showed an inverse correlation between miR-373 and TNFAIP1 mRNA levels. [score:1]
The relative quantification of miR-373 in gastric cancer was 26.861 times that of miR-373 in the normal gastric tissue (P<0.05). [score:1]
Equally, the TNFAIP1-3′UTR mutant vectors, which contained mutated miR-373 binding sites, were cloned to the pmirGLO between the same sites. [score:1]
To investigate whether miR-373 affects the TNFAIP1 expression in vivo, the mRNA levels of TNFAIP1 in gastric adenocarcinoma tissue and normal gastric tissues were determined by RT-PCR. [score:1]
RNA extraction and real-time quantification of miRNA-373 and TNFAIP1. [score:1]
Conversely, treatment with miR-373 mimics or control (miR-NC) was performed in the HGC-27 cells. [score:1]
The relative quantification of miR-373 in gastric cancer was 0.5243 times that of normal gastric tissue (P<0.01). [score:1]
[1 to 20 of 69 sentences]
6
[+] score: 204
The repression of miR-372 and miR-373 is associated with the upregulation of their target, the cell cycle regulator large tumor suppressor homolog 2 (LATS2), leading to the inhibition of cell cycle progression in H. pylori-infected cells. [score:11]
Altogether, these results indicate that LATS2 is a functional target of miR-372 and miR-373 in AGS cells and that the high expression of miR-372 and miR-373 confers to them a growth advantage through the inhibition of LATS2 expression. [score:9]
To ascertain that the inhibition of G1/S transition was due to the downregulation of miR-372 and miR-373, we treated AGS cells with synthetic miR-372 and miR-373 prior to infection, in order to dampen their downregulation upon infection. [score:9]
Using a deep sequencing approach in the AGS cell line, a wi dely used cell culture mo del to recapitulate early events of H. pylori infection of gastric mucosa, we reveal that hsa-miR-372 is the most abundant microRNA expressed in this cell line, where, together with hsa-miR-373, it promotes cell proliferation by silencing large tumor suppressor homolog 2 (LATS2) gene expression. [score:7]
miR-372 and miR-373 downregulation is involved in H. pylori -induced cell cycle arrest in G1 phaseTo assess whether LATS2 upregulation was functionally relevant, we analyzed cell cycle progression of AGS cells upon infection. [score:7]
Figure 2 miR-372 and miR-373 -mediated regulation of large tumor suppressor homolog 2 (LATS2) translation and AGS cell proliferation. [score:6]
These data confirm that the CagA -dependent accumulation of LATS2 protein involves a post-transcriptional release of its expression mediated by the downregulation of miR-372 and miR-373. [score:6]
Repressing LATS2 synthesis, through miR-372 and miR-373 overexpression, could represent an alternative pathway to the downregulation of p21 [cip1/waf1 ]or p27 [kip1 ]in the sequence of events leading to the malignant transformation of cells. [score:6]
As expected from cells expressing high miR-372 and miR-373 levels, we observed a 60% inhibition of luciferase expression, as compared to the control pGL3 reporter (Figure 2C). [score:6]
miR-372 and miR-373 were initially discovered as novel oncogenes participating in the development of human testicular germ cell tumors by targeting the cell cycle inhibitor LATS2 [36]. [score:6]
To confirm that LATS2 synthesis was derepressed at the post-transcriptional level after miR-372 and miR-373 downregulation in AGS cells infected with wild-type H. pylori, we generated a stable LATS2 reporter AGS cell line expressing a fluorescent sensor containing the 3'UTR of LATS2 downstream of the enhanced green fluorescent protein (EGFP). [score:6]
H. pylori represses the miR-371-372-373 expression via its major virulence factor CagAWe report here that H. pylori specifically inhibits the synthesis of miR-372 and miR-373 at the primary transcript level and that this repression relies on CagA translocation in AGS cells through a functional T4SS. [score:5]
No such inhibition was observed when the pGL3-LATS2 vector was transfected in MKN-74 cells, which express very low miR-372 and miR-373 levels [see Additional File 2, Figure S1]. [score:5]
To evaluate the effects of the downregulation of miR-372 and miR-373, we analyzed the regulation of their common target, LATS2, in AGS cells upon H. pylori infection. [score:5]
Large tumor suppressor homolog 2 (LATS2) translation efficiency in AGS (high miR-372 and miR-373) and MKN-74 (low miR-372 and miR-373) cells. [score:5]
Shortly after H. pylori infection, miR-372 and miR-373 synthesis is highly inhibited, leading to the post-transcriptional release of LATS2 expression and thus, to a cell cycle arrest at the G1/S transition. [score:5]
miR-372 and miR-373 regulate LATS2 expression in AGS cells. [score:4]
Downregulation of miR-372 and miR-373 upon infection was also shown by northern blot analysis (Figure 3C), which in addition revealed that miRNA precursors (pre-miRNA) were even more strongly repressed than the mature forms (Figure 3C, upper part of the blot for miR-373). [score:4]
Altogether, these results indicate that LATS2 is indeed a direct target of miR-372 and miR-373 in AGS cells. [score:4]
The effects of these experimental manipulations of miR-372 and miR-373 and their common target LATS2 on the efficiency by which wild-type H. pylori blocks AGS cell cycle demonstrate that the regulation of these miRNAs contribute to the arrest at the G1/S transition in infected AGS cells. [score:4]
miR-372 and miR-373 downregulation is involved in H. pylori -induced cell cycle arrest in G1 phase. [score:4]
Mature miR-371-3p, miR-372 and miR-373 were all significantly downregulated (up to 50%) upon infection, as shown by RT-qPCR and northern blot analysis (Figure 3B,C, respectively). [score:4]
Other members of the miR-371-372-373 cluster, miR-373 and miR-371-5p, also appeared significantly downregulated upon infection (Figure 3A, P values = 8.3 × 10 [-8 ]and 0.009, respectively). [score:4]
Altogether, these results reveal an unexpected mechanism involved in the cell cycle arrest upon infection: the CagA -dependent derepression of LATS2 by the downregulation of miR-372 and miR-373. [score:4]
Figure 3 Helicobacter pylori -induced downregulation of mature miR-371, miR-372 and miR-373 levels in AGS cells. [score:4]
These data constitute a novel example of host-pathogen interplay involving microRNAs, and unveil the couple LATS2/miR-372 and miR-373 as an unexpected mechanism in infection -induced cell cycle arrest in proliferating gastric cells, which may be relevant in inhibition of gastric epithelium renewal, a major host defense mechanism against bacterial infections. [score:3]
This reporter system senses changes in the miR-372 and miR-373 levels and allows a direct observation of LATS2 post-transcriptional regulation in living cells. [score:3]
In as372-373 treated cells, the firefly luciferase expression was significantly derepressed and almost reached the levels of that of the control vector (Figure 2C), contrarily to the cells treated with sc372-373, which did not affect the basal miR-372 or miR-373 levels. [score:3]
This repression was dependent on the two miR-372 and miR-373 binding sites located in the LATS2 3'UTR, as no significant inhibition was observed in AGS cells transfected with the pGL3-LATS2mut vector mutated for these sites [see Additional File 2, Figure S1]. [score:3]
However, because the 3'UTR of p21 [cip1/waf1 ]has also been proposed to be targeted by miR-372 and miR-373 [54], we certainly cannot exclude that its induction also participates in this cell cycle arrest [24, 49]. [score:3]
It belongs to a cluster located on the chromosomic region 19q13.42, which comprises four miRNAs, all of them highly expressed in AGS cells: miR-371-5p, miR-371-3p, miR-372 and miR-373 (Figure 1A, black bars). [score:3]
miR-373 expression has already been detected in stomach [33]. [score:3]
However, we were surprised to discover that the most abundant of this repertoire, miR-372, belongs to a specific cluster encoding three other miRNAs, miR-371-5p, miR-371-3p and miR-373, expressed notably in human embryonic stem cells [34, 44]. [score:3]
To validate this hypothesis, we transfected into AGS cells the luciferase sensor pGL3-LATS2, containing the 3' untranslated region (UTR) of LATS2, which harbors two miR-372 and miR-373 pairing sites [36] downstream to the firefly luciferase coding sequence (Figure 2A). [score:3]
Conversely, blocking miR-372 and miR-373 with as372-373 prior to infection facilitated the infection -induced inhibition of DNA synthesis, which then reached its maximum (Figure 5B). [score:3]
It appears that the LATS2 level was inversely correlated to the expression of miR-372 and miR-373 in these cell lines (Figure 2B, lower panel). [score:3]
We report here that H. pylori specifically inhibits the synthesis of miR-372 and miR-373 at the primary transcript level and that this repression relies on CagA translocation in AGS cells through a functional T4SS. [score:3]
Inhibition of LATS2 by miR-372 and miR-373 confers a growth advantage to cells [36, 37]. [score:3]
miR-372 or miR-373 expression is considered as a rare event in tumors, and has only been found in testicular germ cell tumors [36], esophageal tumors [37] and thyroid adenomas [38]. [score:2]
Our work uncovers the unexpected pair of miR-372 and miR-373 as a novel example of miRNAs dysregulated in gastric cancer. [score:2]
TaqMan microRNA assays (Applied Biosystems, Carlsbad, CA, USA) were used to quantify the expression of mature miR-371-3p (AB 002124), miR-372 (AB 000560) and miR-373 (AB 000561). [score:2]
In testicular and esophageal tumors, in which they are abundant, miR-372 and miR-373 have been reported to act as oncogenes repressing LATS2, a serine-threonine kinase involved in cell cycle regulation [36, 37]. [score:2]
However, the block at the G1/S transition in AGS cells requires the derepression of LATS2 synthesis via the repression of miR-372 and miR-373. [score:1]
To confirm that LATS2 is a functional target of miR-372 and miR-373 in AGS cells, we analyzed cell cycle progression of either as372-373 -treated or LATS2 -transfected cells using the 5-bromo-2'-deoxyuridine (BrdU) incorporation method, which measures the rate of DNA synthesis occurring in the S phase of the cell cycle. [score:1]
Therefore, one could imagine that the observed repression of miR-372 and miR-373 in AGS cells could be a consequence of a block in cell division. [score:1]
We unveil LATS2/miR-372 and miR-373 as a novel mechanism in CagA -induced cell cycle arrest in proliferating gastric cells. [score:1]
Seed regions of miR-372 and miR-373 are underlined. [score:1]
Indeed, as372-373 -treated cells, in which miR-372 and miR-373 levels were decreased, turn fluorescent, whereas sc372-373 did not [see Additional File 5, Figure S4]. [score:1]
miR-372, miR-373 and miR-371-5p are shown (empty plots). [score:1]
We observed that LATS2 mRNA (Figure 4B) and protein levels (Figure 4C) were inversely correlated to those of miR-372 and miR-373 upon H. pylori infection. [score:1]
Thereby, as in the testicular germ cell tumors, abundant miR-372 and miR-373 in AGS cells, that totally silence LATS2, may participate in their active cell cycle progression despite high levels of p21 [cip1/waf1]. [score:1]
Indeed, H. pylori is much less efficient in blocking cell proliferation when the level of LATS2 is maintained at a low level either by miR-372 and miR-373 mimics or by specific anti-LATS2 siRNAs. [score:1]
The levels of detectable miR-372 or miR-373 were each specifically decreased by 90% by as372/as373, as verified by RT-qPCR and northern blot analysis [see Additional File 3, Figure S2A,B]. [score:1]
To confirm the role of miR-372 and miR-373 in this repression, we designed antisense oligonucleotides (as372, as373) and their scrambled controls (sc372, sc373) in order to block these miRNAs. [score:1]
Also shown is the predicted base pairing formed between miR-372 or miR-373 with each of the LATS2 3'UTR binding sites as predicted by http://pictar. [score:1]
In testicular germ cell tumors, which retained functional, wild-type p53, miR-372 and miR-373 act as oncogenes, silencing LATS2 and thus allowing cell proliferation [36]. [score:1]
Figure 5Role of miR-372 and miR-373 in Helicobacter pylori -induced cell cycle arrest in AGS cells. [score:1]
These results suggest that LATS2 could be repressed at the post-transcriptional level by miR-372 and miR-373 in AGS cells. [score:1]
Indeed, miR-372 and miR-373 belong to the miR-106b family which includes miR-93, miR-17-5p and miR-20a [45]. [score:1]
[1 to 20 of 59 sentences]
7
[+] score: 109
This dysregulates cell survival by targeting the newly discovered targets, SHMT-2 and MECP-2, respectively; apoptosis was induced by the inhibition of miR-370 or miR-373, and also by the overexpression of SHMT-2 or MECP-2. These results suggest that the decreased functions of miR-370 and miR-373 in OA chondrocytes lead to the disinhibition of SHMT-2 and MECP-2, respectively, thereby promoting apoptotic cell death. [score:12]
miRNA inhibitor -mediated knockdown and pre-miR-370/373 -mediated upregulation of miR-370 and miR-373. [score:7]
The previously identified targets for miR-370 and miR-373 were largely associated with cancer pathogenesis (e. g., oncogenes and tumor suppressors), suggesting that the utilized target genes may contribute to the tissue- and cell-type-specific performances of these miRNAs (Akhtar et al., 2010). [score:7]
In in vivo study using DMM mice, overexpression of MECP2 and knockdown of miR-373 induced severe cartilage degradation, whereas knockdown of MECP2 and overexpression of miR-373 successfully blocked cartilage degradation induced by DMM surgery. [score:7]
miR-373 regulates MMP activity by modulating MAPK signaling or targeting mTOR and SIRT1 in human fibrosarcoma cells (Fan et al., 2013), and by targeting ZIP4 in pancreatic cancer (Liu & Wilson, 2012). [score:6]
To further test whether MECP-2 is a target of miR-370 or miR-373, we cloned the entire 3′UTR of MECP-2 into a luciferase reporter vector, electroporated the vector into chondrocytes along with the precursor of miR-370 or miR-373 or a cognate nontargeting negative control, and assayed cell lysates for luciferase expression. [score:6]
Co-induction of miR-373 significantly inhibited MECP-2 -upregulated apoptosis-related gene cell death in normal chondrocytes (Fig. 6D). [score:6]
Fig 6miR-373 regulates OA pathogenesis by targeting MECP-2. (A) Luciferase reporter assays were performed on OA chondrocytes harboring a vector construct driven by the 3′UTR of MECP-2 or mutated 3′UTR of MECP-2 (3′UTR mt) with or without forced expression of miR-373 (left panel). [score:5]
In sum, we herein show for the first time that miR-370 and miR-373 directly target and negatively regulate SHMT-2 and MECP-2, respectively, in human articular chondrocytes, where they contribute to the pathogenesis of OA. [score:5]
Here, we present the first evidence suggesting that miR-370 and miR-373 may potently regulate one-carbon metabolism by directly targeting SHMT-2 and MECP-2, respectively. [score:5]
RNA level of MECP was examined with treatment of the miR-373 precursor (miR-373) or miR-373 inhibitor (anti-miR-373) (right panel). [score:3]
We identify serine hydroxymethyltransferase (SHMT)-2 and methyl-CpG -binding protein (MECP)-2 as targets of miR-370 and miR-373, respectively, and hypothesize that these interactions contribute to the pathogenesis of OA. [score:3]
The precursors or inhibitors of miR-370 and miR-373 (Ambion, Austin, TX, USA) were electroporated into cells using a square-wave generator (BTX-830; Gentronics, San Diego, CA, USA) with 20 ms, 200 square pulses. [score:3]
Next, to investigate whether modulation of miR-373 induced the same effects as modulation of MECP-2, we altered the expression level of miR-373 using its specific inhibitor or precursors (Fig. 6B). [score:3]
Annexin V staining revealed that the induction of miR-373 in OA chondrocytes significantly reduced this apoptotic cell death to 2.26%, whereas inhibition of miR-370 increased cell death up to 10% in normal chondrocytes. [score:3]
Furthermore, decreased levels of miR-370 and miR-373 were observed in OA chondrocytes from majority of patients, as confirmed by analysis of MMP-13 expression (Fig. 3B). [score:3]
Finally, we propose that miR-370 and miR-373 could be potent therapeutic targets for OA. [score:3]
For miRNA target validation, cells were electroporated as described above with 25–50 ng of each firefly luciferase reporter construct, 150–175 ng of empty pcDNA3 vector (Clontech, Mountain View, CA, USA), 200 ng pcDNA3 harboring the Renilla luciferase gene (transfection control), and 30 pmol of pre-miR-370, pre-miR-373, or pre-miR-neg (Ambion). [score:3]
Here, we found that miR-370 and miR-373 were significantly downregulated in OA chondrocytes compared to normal chondrocytes. [score:3]
In addition, induction of miR-373 decreased RNA level of MECP-2, whereas knockdown of miR-373 increased RNA level of MECP-2 in OA chondrocytes (Fig. 6A, right panel). [score:2]
However, chondrocytes transfected with the SHMT-2 3′UTR -driven vector plus pre-miR-373 showed no difference in luciferase activity compared to cells that received the reporter plus the nontargeting negative control (data not shown). [score:2]
We found that cells transfected with the MECP-2 3′UTR -driven vector plus pre-miR-373 exhibited significantly less luciferase activity, but mutated MECP-2 3′UTR -driven vector plus pre-miR-373 did not alter luciferase activity compared to cells that received the reporter plus the nontargeting negative control (Fig. 6A, left panel). [score:2]
These results provide novel insights into OA and may facilitate the development of therapeutic approaches based on the modulation of miR-370 and/or miR-373. [score:2]
In addition, folate treatment decreased the level of miR-373 in OA chondrocytes suggesting that miR-373 may be involved in one-carbon metabolism (Fig. 6E). [score:1]
Human 293FT cells were transfected with lentiviral vectors encoding miR-370, miR-373, SHMT-2, or MECP-2 or the negative control lentivirus (Applied Biological Materials, Canada) using the third-generation packaging mix (Applied Biological Materials, Canada) and Lentifectin (Applied Biological Materials, Canada). [score:1]
The most severe cartilage destruction (as visualized by safranin O staining and OARSI scoring) was observed among mice infected with the combination of anti-miR-373- and MECP2-encoding lentiviruses (Fig. 6F). [score:1]
Fig 3miR-370 and miR-373 are involved in OA pathogenesis. [score:1]
In this prospective study, we examined the potential functional role of miR-370 and miR-373 in OA pathogenesis. [score:1]
Here, we report the first study showing that the levels of miR-370 and miR-373 are significantly lower in OA chondrocytes. [score:1]
DMM surgery was performed in male mice, and lentiviruses were injected intra-articularly with 1 × 10 [9] plaque-forming units (PFU) of lentiviral vectors encoding miR-370, miR-373, SHMT-2, or MECP-2 every week for 8 weeks. [score:1]
Among we analyzed, miR-370 and miR-373 seem highly OA specific (Fig. 3A). [score:1]
[1 to 20 of 31 sentences]
8
[+] score: 60
Mechanistically, both miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1 -mediated Ras/Raf/MEK/Erk signaling pathway and NF-κB factor. [score:8]
This suggests that these same microRNAs were upregulated on PAA and we choose to confirm this by performing on reported and predicted miR-520c and miR-373 targets that are involved in MMP regulation and TNFα and TGFβ signaling. [score:7]
We also examined CD44, a well-established biomarker for PNET in children[28] and with prognostic value[29], which is involved in the activation of MMP9 [30], and is targeted by miR-520c and miR-373 by suppressing CD44 translation [26, 31]. [score:7]
Further clinical specimen analyses show that significant upregulation of miR-373 that correlated inversely with CD44 expression. [score:6]
A previous study on fibrosarcoma cells showed an increase in MMP9 activity could be explained by miR-520c and miR-373 that acts by targeting the 3’UTR of mTOR and SIRT1 and its downstream effectors and kinases to inactivating signaling pathways that negatively regulate MMP9 expression [21]. [score:6]
Both miR-520c and miR-373 confer robustness to biological processes by upregulation of activity of MMP9 in human fibrosarcoma cells [21]. [score:4]
Liu and Wilson made a direct connection that miR-520c and miR-373 increased the expression and activity of MMP9 in 3D type I collagen gels [21]. [score:4]
This involvement of miRNA expression will be further directly measured by managing miR-520c and miR373 expression in the brain-like microenvironment. [score:4]
Nevertheless, the expression of miR-520c and miR373 involved in the up regulation of MMP9 could nicely explain the experiments described on the modulation of cytokines activity by the substrate stiffness on MMP activities. [score:4]
This is a component of NF-κB, a transcription factor for MMP9 [20, 27] and the receptor for TGFβ2, TGFβR2, which are both targeted by miR-520c and miR-373 [20]. [score:3]
Our study predicted that both mir-520c and miR-373 binding sites were common among the 3’ UTRs of genes downregulated on PAA compared to PS (S1 Dataset). [score:3]
The identification of stem cell specific miRNAs(miR-520, miR-302, miR-372, and miR-373) [40, 41], which was predicted to be increased on PAA is an indication that the PAA tissue environment may allow the PNET cells to return to a less differentiated state (S1 Dataset). [score:1]
MicroRNA 520c and 373 (miR-520c and miR-373) have been characterized as oncogenes in prostate cancer [31]), cancer cell metastasis-promoting factors in breast cancer [26], and tumor suppressors in estrogen receptor negative breast cancer [20]. [score:1]
Huang and colleagues found that human miR-373 and miR-520c stimulated cancer cell migration and invasion in vitro and in vivo, and that certain cancer cell lines depend on endogenous miR-373 activity to migrate efficiently [26]. [score:1]
These implicate that miR-373 and miR-520c promote tumor invasion and metastasis [26]. [score:1]
[1 to 20 of 15 sentences]
9
[+] score: 42
Based on the criteria mentioned in material and methods part we found ITGA3 (as target of miR-654-5p), SOCS4 & MAP3K1 (as target of miR-640), BRMS1L & ZNFX1 (as target of miR-526b*) and CD44 & VEGFA (as target of miR-373). [score:9]
Expression patterns of miR-654-5p and miR-640 (up-regulated in exosomal fraction follicular fluid derived from follicles containing BCB- oocytes) and miR-526b* and miR-373 (up-regulated in exosomal fraction of follicular fluid from BCB+ groups) were investigated in surrounding follicular cells namely: cumulus oocyte complex (COCs), granulosa cells (GC), and theca cells (TC) from the same category of follicle which were used for miRNA PCR array analysis. [score:7]
Among the up-regulated miRNAs, miR-654-5p & miR-640, and down-regulated miRNAs, miR-373 & miR-526b*, displayed the greatest fold change difference in the exosomal fraction of follicular fluid. [score:7]
0078505.g004 Figure 4Expression patterns of miR-654-5p and miR-640 (up-regulated in exosomal fraction follicular fluid derived from follicles containing BCB- oocytes) and miR-526b* and miR-373 (up-regulated in exosomal fraction of follicular fluid from BCB+ groups) were investigated in surrounding follicular cells namely: cumulus oocyte complex (COCs), granulosa cells (GC), and theca cells (TC) from the same category of follicle which were used for miRNA PCR array analysis. [score:7]
We choose miR-654-5p, miR-640, miR-526b* and miR-373 because these miRNAs were differentially expressed in exosomal fraction of follicular fluid and they were also substantially expressed in exosomes. [score:5]
MicroRNAs like miR-640, miR-526b* and miR-381 were abundant at higher level in theca cells, while miR-373, miR-30e* and miR-19b-1* expressed more in COCs. [score:3]
Importantly, we found that miR-654-5p, miR-640 and miR-526b*, and miR-373 were more abundant in exosomes from follicular fluid of follicles containing BCB- and BCB+ oocytes, respectively (Figure 7 ). [score:1]
While exosomal miRNAs namely, miR-640 and miR-526b* were more abundant in theca cells, miR-373 was detected at higher level in COCs. [score:1]
Then the expression level miR-654-5p and miR-640 (enriched in exosomes derived from BCB- follicular fluid) and miR-526b* and miR-373 (enriched in follicular fluid derived from follicles with BCB+ oocyte) were investigated by real time PCR. [score:1]
Similarly, miR-526b* and miR-373 (in exosomal) and miR-381 and miR-30e* (in non-exosomal) were more abundant in follicular fluid from follicles with a fully grown oocyte (BCB+) (Table 2 ). [score:1]
[1 to 20 of 10 sentences]
10
[+] score: 35
To probe the susceptibility of TGFBR2 to repression by non-expressed miRNAs, we tested two mimics of miRNAs not expressed in HaCaT cells: miR-373, which is predicted to target TGFBR2, and miR-34b, which is predicted not to target TGFBR2. [score:9]
There are a number of other miRNAs predicted to target the 3' UTR regions of the type I and type II TGF-β receptors that are expressed in cancer cell lines [62], including miR-373, which is predicted to target TGFBR2 and has been implicated as an oncogene in testicular germ-cell tumors [63]. [score:7]
We therefore went beyond the siRNA screen and looked for evidence for repression of TGFBR2 by expressed miRNAs (in HaCaT cells), such as miR-20a, miR-93, miR-34a and miR-423, and non-expressed miRNAs, such as miR-373. [score:5]
Based on these results, we identified miR-20a, miR-34a and miR-373 as miRNAs that inhibit TGFBR2 expression. [score:5]
miR-20a and miR-34a were expressed in HaCaT cells, whereas miR-373 was not, but all had predicted target sites on the TGFBR2 UTR and could cause repression. [score:5]
Transfection of miR-373 did cause a decrease in TGFBR2 mRNA levels (Figure 10A), but consistent with target prediction, we did not observe an effect for miR-34b. [score:3]
miR-20a UAAAGUGCUUAUAGUGCAGGUAG miR-20a* ACUGCAUUAUGAGCACUUAAAGU miR-34b UAGGCAGUGUCAUUAGCUGAUUG miR-34b* AUCACUAACUCCACUGCCAUCA miR-373 GAAGUGCUUCGAUUUUGGGGUGU miR-373* ACUCAAAAUGGGGGCGCUUUCC We used antibodies recognizing phospho-tail SMAD2 Ser-465/467 (Cell Signaling, Danvers, MA, USA) and murine antibodies against α-tubulin (Sigma-Aldrich, St. [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 30
Finally, they analyzed the miR-373 expression in breast cancer clinical specimens and found a significant up-regulation of miR-373 in 11 matched normal/tumor samples, which inversely correlated with CD44 expression, in particular in tumors exhibiting lymph node metastasis. [score:8]
Moreover, enhanced expression of a CD44 gene that was unresponsive to miR-373/miR-520c inhibited the migratory activity of MCF7 cells overexpressing miR-373 and miR-520c. [score:7]
Up-regulated miRNAs in NSCLC included miR-142-5p, miR-148b, miR-148a, miR-369-3p, miR-215, miR-152 and miR-155, whereas down-regulated miRNAs were miR-373 and miR-138-I. Some of these miRNAs have a well-characterized association with cancer progression, e. g., miR-10b, miR-21, miR-30a, miR-30e, miR-125b, miR-141, miR-200b, miR-200c, and miR-205 [90]. [score:5]
Previously, the same group identified miR-373 as a potential oncogene in testicular germ-cell tumors where it suppressed the oncogene -induced p53 pathway, which cooperates with oncogenic RAS to promote cellular transformation [55]. [score:3]
Interestingly, Huang and coworkers found that miR-373 and miR-520c “seed” sequences were similar and both target CD44 messenger RNA. [score:3]
The second hallmark report [48] established that miR-373 and miR-520c can also promote tumor invasion and metastasis by regulating the cell-surface glycoprotein encoding gene CD44 (cell surface receptor for hyaluronan). [score:2]
Similarly to miR-10b, miR-373 and miR-520c did not affect cell proliferation. [score:1]
In order to identify new potential metastasis-promoting miRNAs, Huang, et al. from Agami’s group set up a genetic screen using the non-metastatic MCF7 cell line, and found that miR-373 and miR-520c stimulated cell migration and invasion in vitro and in vivo. [score:1]
[1 to 20 of 8 sentences]
12
[+] score: 30
Since the transcriptional regulation of E-cadherin has been well studied, we examined the seed -dependent off-target silencing effects of the RNAa-inducible and E-cadherin promoter-directed siRNAs, dsEcad215, dsEcad320, and dsEcad640 [30], and miR-373 [36], which has the same seed sequence with dsEcad640, reported previously [30], [36]. [score:5]
In the promoter analyses, miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes showed the effects to increase the expression of proE-cad178-Luc and proE-cad670-Luc (Figure 6B, and D). [score:3]
of a one-sided K-S test for seed -dependent off-target effects are as follows: transcripts with seed-complementary sequences of dsEcad640, P≤10 [−59]; those of miR-302a, P≤10 [−45]; those of miR-372, P≤10 [−20]; those of miR-373, P≤10 [−39]; those of miR-520c, P≤10 [−40]; those of miR-520f using common seed sequence, P≤10 [−14]; miR-520f using own seed sequence, P≤10 [−57]. [score:3]
of a one-sided K-S test for seed -dependent off-target effects is as follows: transcripts with complementary seed sequences of the opposite strand of dsEcad640, P = 0.999; those of miR-302a, P = 0.266; those of miR-372, P = 0.449; those of miR-373, P = 0.953; those of miR-520c, P = 0.031; those of miR-520f, P = 0.998. [score:3]
The mean expression levels of the transcripts that have common seed-complementary sequences, AGCACUU, to dsEcad640 and miR-302/372/373/520 miRNA family members in their 3′UTR were apparently reduced by the transfection with dsEcad640, miR-302a, miR-372, miR-373, and miR-520c duplexes (Figure S1). [score:3]
To assess the parallel genome-wide regulation by dsEcad640 and the members of miR-302/372/373/520 family, microarray analyses were performed using PC-3 cells transfected with each of the miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes, as well as with dsEcad640 at 24 hour. [score:2]
The seed sequence of dsEcad640 antisense strand (AAGUGCU) is same as those of the miR-302/372/373/520 miRNA family members, miR-302a, miR-372, miR-373, miR-520a-3p, and miR-520f, although the seed sequence of miR-520f is shifted by 1 nt to 1–7 nt from 2–8 nt (Figure 1B). [score:1]
The effects of dsEcad215, dsEcad302, dsEcad640, miR-302a, miR-372, miR-373, miR-520c, miR-520f, and siZEB1_CDS were determined using stably transfected cells with each luciferase reporter, and shown as Renilla/firefly. [score:1]
The miR-302a duplex is composed of miR-302a and miR-302*; the miR-373 duplex, miR-373 and miR-373*; and the miR-520c duplex, miR-520c-5p and miR-520c-3p. [score:1]
Microarray profiles of transcripts containing variable seed-complementary sequences of the opposite strands in their 3′UTRs by the transfection of (A) dsEcad640, (B) miR-302a duplex, (C) miR-372 duplex, (D) miR-373 duplex, (E) miR-520c duplex, and (F) miR-520f duplex. [score:1]
The transcripts of ZEB1, MED8, MTPN, LATS2, and RAB31 possess seed-complementarities to either of dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f. [score:1]
The silencing activities by dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f on wild-type pLuc-CDS (WT), pLuc-CDS-m640-1, -2, and -1+2 are shown as Renilla/firefly. [score:1]
The seed sequences of dsEcad640 sense strand, miR-302*, the opposite strand of miR-372, miR-373*, miR-520c-5p, and the opposite strand of miR-520f, are different (Figure 1B). [score:1]
Microarray profiles of transcripts containing common seed-complementary sequences of dsEcad640 and members of miR-302/372/373/520 family by the transfection of (A) dsEcad640, (B) miR-302a duplex, (C) miR-372 duplex, (D) miR-373 duplex, (E) miR-520c duplex, and (F) miR-520f duplex. [score:1]
MiR-302a, miR-372, miR-373, miR-520c, miR-520f miRNA duplexes were synthesized to form the same sequences and structures described in miRBase [51]. [score:1]
Then, the effects on ZEB1 CDS were determined by the transfection of miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes along with pLuc-CDS and pGL3-Control into PC-3 cells (Figure 1). [score:1]
Chemically synthesized dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes were transfected into PC-3 cells. [score:1]
[1 to 20 of 17 sentences]
13
[+] score: 28
In prostate cancer both miR-373 and miR-520c although found to be downregulated stimulated migration and invasion in vitro [9]. [score:4]
We then quantified the expression of miR-371-3p, miR-372, and miR-373 in the cell lines where comparable results were obtained (Figure 3d). [score:3]
In breast cancer, miR-373 and miR-520c promote tumor invasion and metastasis in vivo and in vitro by the suppression of CD44 [10]. [score:3]
In these tumors the expression of miR-373 was shown to allow tumorigenic growth in the presence of wild-type p53 [8]. [score:3]
Moreover, forced expression of miR-373 leads to a reduction in the nucleotide excision repair (NER) protein, RAD23B, as well as in RAD52 [19] thereby possibly contributing to a higher genome instability. [score:3]
Expression of miR-520c, miR-371-3p, miR-372 and miR-373 in cell lines and primary tumors. [score:3]
All tumors with 19q13 rearrangements were shown to express significantly higher levels of miR-371-3p, miR-372, and miR-373 than three samples of surrounding histologically normal thyroid tissue (p≤0.02236) and the five cytogenetically normal adenomas (p≤0.01428) (Figure 3c). [score:3]
Recently, Huang et al. [10] were able to demonstrate that miR-373 and miR-520c promote tumor invasion and metastasis in vivo and in vitro by the suppression of CD44. [score:3]
In human testicular germ cell tumors evidence for an oncogenic potential of miR-373 has been obtained. [score:1]
First evidence for an oncogenic potential of miR-373 has been obtained in human testicular germ cell tumors where it was shown to allow tumorigenic growth in the presence of wild-type p53 [8]. [score:1]
As another example in a recent paper hsa-miR-518c and hsa-miR-373 were among the microRNAs associated with the tumorigenesis of retinoblastomas [17]. [score:1]
[1 to 20 of 11 sentences]
14
[+] score: 28
miR-520c and miR-373 upregulate MMP-9 expression and enhance human fibrosarcoma cell migration and growth not by direct binding to the MMP-9 promoter, but by directly targeting the 3′-UTR of the mRNAs of mTOR and SIRT1, which are negative regulators of MMP-9 expression [58]. [score:13]
In PC3 cells, miR-373 may promote the development of metastases from prostate cancer by targeting the E-cadherin promoter region and rapidly inducing its expression [29]. [score:6]
Similar to miR-210, miR-373 promotes tumor invasion and metastasis, as demonstrated by its overexpression in the nonmigratory and nonmetastatic phenotype MCF7 cells, which enhanced cancer cell migration and invasion in vitro and in vivo [27]. [score:3]
Furthermore, the expression of miR-373 has been correlated with increased cell proliferation and tumorigenesis [28]. [score:3]
Of these, miR-210 and miR-373 have been studied extensively as hypoxia-regulated miRNAs with a role in cancer [21]. [score:2]
Thus, miR-373, similar to miR-210, is induced during hypoxia and acts as an oncogene, providing a link to hypoxia -induced tumor progression. [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 28
TRAF6 and TAOK3 are inhibited by mir-373, GYK and APPBP2 are inhibited by mir-200a, TRAF6, TAOK3 and ZNF302 are inhibited by mir-141, CBX2 is inhibited by mir-1, APBB1 is inhibited by mir-148b, POLR3D is inhibited by mir-374b, NAE1 is inhibited by mir-503, and GTF2I is inhibited by mir-98. [score:17]
The specific core GEN of old women demonstrated that TAOK3 and TRAF6 are inhibited by mir-141 and mir-373, respectively, and DNA methylation of MAX, TAOK3, and MYD88 in order to overcome dysregulation of the MAPK signaling and Toll-like receptor signaling pathways as well as dysfunctions of the immune system, proliferation, and metabolism. [score:4]
TAOK3 and TRAF6 are inhibited by mir-373, and are involved in the MAPK signaling pathway. [score:3]
In addition, TAOK3 and TRAF6 are inhibited by mir-141 (c [il] = −0.2235-TAOK3; c [il] = −0.36144-TRAF6) and mir-373 (c [il] = −0.10454-TAOK3; c [il] = −0.12645-TRAF6). [score:3]
Pathway analyses demonstrated that there are two core miRNAs, mir-373 and mir-141 (Figure 13). [score:1]
[1 to 20 of 5 sentences]
16
[+] score: 25
miR-373 up-regulation could enhance cell proliferation, G1-phase cell proportion, migration and invasion, while miR-373 silencing could decrease cell proliferation, G1-phase cell proportion, migration and invasion and induce cell apoptosis by directly targeting TIMP3. [score:7]
miR-373 expression was up-regulated in esophageal cancer tissues and patients’ plasma. [score:6]
Other miRNAs like miR-138, miR-375, miR-593, miR-133a were down-regulated in esophageal cancer tissue, serving as tumor suppressors, while miR-34b, miR-16, miR-208, miR-423, miR-21, miR-31, miR-223 and miR-373 could have oncogenic actions [18– 23] (Figure 1). [score:6]
Overexpression of miR-373 in ECA109 caused a reduction of TIMP3 mRNA and protein, whereas suppression of miR-373 in KYSE410 led to an increase of TIMP3 mRNA and protein [39]. [score:5]
miR-373 has different functions among different tumor types. [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 25
In addition, β-catenin is also known to up-regulate the expression of the miR-372/miR-373 cluster through promoter transactivation [30]. [score:6]
Recently, miR-372/miR-373 have been found to be up-regulated in response to hypoxia via HIF1α and TWIST1 in SW620 CRC cells [22]. [score:4]
Furthermore, up-regulation of miR-372/miR-373 has been found in HNSCC tissues during previous screenings [1, 29]. [score:4]
Furthermore, β-catenin transactivates miR-372/miR-373, which then target DKK1 [30]. [score:3]
The miR-372 and miR-373 miRNA cluster were originally associated with stemness in embryonic cells and oncogenicity in human testicular germ cell tumors via a concomitant targeting of LATS2 and CD44 [23]. [score:3]
The treatment resulted in the expression of miR-372, but not of miR-373 or miR-372* (detailed analysis not shown). [score:3]
miR-372, miR-373, miR-302, miR-520 and some other miRNAs are members of miR-93 family. [score:1]
The miR-372 and miR-373 miRNA cluster were originally found to be associated with stemness in embryonic cells. [score:1]
[1 to 20 of 8 sentences]
18
[+] score: 23
Interestingly, except for miR-373-3p:circ-SP140L (both upregulated), other miRNA:circRNA pairs had opposing deregulated expressions: in the cancer samples, miRNAs were downregulated and their paired circRNAs were upregulated (Table 1). [score:13]
Based on the collected miRNA-circRNA interactions and the deregulated RNA molecules, we collected several abnormally expressed miRNAs, including 11 downregulated miRNAs (miR-124-3p, miR-129-5p, miR-135a-5p, miR-153-3p, miR-204-5p, miR-208a-3p, miR-211-5p, miR-218-5p, miR-488-3p, miR-490-3p, and miR-504-5p) and 1 upregulated miRNA (miR-373-3p). [score:10]
[1 to 20 of 2 sentences]
19
[+] score: 22
Ectopic overexpression of CD44 reduced migration of MCF-7 cells that express miR-373 and miR-520c, which indicates that the downregulation of CD44 is essential to the migration of these cells [114]. [score:8]
Furthermore, several cancer lines even required miR-373 for migration and the miRNAs also elicited a migratory phenotype by inhibiting the expression of the metastasis repressor CD44 [113]. [score:5]
Finally, miR-373 was also shown to be upregulated while CD44 was decreased in metastatic breast cancer tissue specimens [115], which additionally implicate these miRNAs for their roles in breast cancer metastasis. [score:4]
In a genetic screen that overexpressed approximately 450 miRNAs in the nonmetastatic MCF-7 breast cancer cell line, authors found that miR-373 and miR-520c promoted migration and invasion in vivo and in vitro. [score:3]
The miR-373 and miR-520c are prometastatic miRNAs [79, 112]. [score:1]
4.4. miRNA-373/520c. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 21
Co-transfection of miR-371–373 reporters harboring perfectly complementary miRNA binding sites and a miR-371–373 expression construct into miR-290–295 null ES cells resulted in efficient silencing of the miR-371-5p, miR-371-3p, miR-372-3p and miR-373-3p luciferase reporters but not of the reporter constructs carrying miR-372-5p and miR-373-5p target sites (Figure 3D, Figure S3B, Table S1). [score:5]
As with miR-290–295, dilution of the miR-371-373 reporter constructs had no effect on the relative silencing of the reporters confirming that the failure to silence the miR-372-5p and miR-373-5p reporters is not due to excess of the mRNA targets over the hypothetical miRNAs. [score:3]
In this case pre-miR-295 and pre-miR-372 would express the same single 2-7U 7mer seed, which is shared with pre-miR-291a, pre-miR-294 and pre-miR373 and, importantly, is represented in all homologous miR-290–295/miR-371–373 loci. [score:3]
Thus, similarly to its interaction with the mouse miR-291-3p0, miR-294-3p0 and/or miR-295-3p0, the 2-7C-S target appears to interact via G:U wobble base pairing with miR-372-3p0 and/or miR-373-3p0 which also have a 2-7U seed. [score:3]
Thus, we ruled out the possibility that the miR-371-3p reporter is silenced by miR-372-3p or miR-373-3p by documenting its silencing by a single pre-miR-371 expression construct but not by a rescue construct in which pre-miR-371 was deleted (Figure 3E). [score:3]
Thus, given the conservation of all other miR-290–295/miR-371–373 seeds we favor a mo del in which both miR-295-3p+1 and miR-373-3p+1 are not active. [score:1]
This proposition is supported by the fact that pre-miR-372 and pre-miR-373, but not pre-miR-371 have oncogenic properties in tissue culture mo dels [21]. [score:1]
The assignment of active miRNAs to the 3p- strands of the pre-miR-372 and pre-miR-373 hairpin stems is consistent with the corresponding strand bias in sequencing data from human ES cells (Compare Figures 2 and 3D). [score:1]
Therefore, pre-miR-291a, pre-miR-291b and pre-miR294 are likely co-orthologs of pre-miR-372 and pre-miR-295 is an ortholog of the promoter distal pre-miR-373. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 21
One is the mir-371,2,3 cluster, consisting of differentially down-regulated miR-372, miR-373 and up-regulated miR-371-5p in patients with NOA; the other cluster, of 13 differentially down-regulated miRNAs (See additional file 3: Table S3 for Several differentially expressed miRNA clusters in NOA patients. [score:12]
Therefore, mir-17-92 cluster and miR-372/miR-373 may down-regulate apoptosis genes and potentially have a role in inhibiting apoptosis. [score:6]
The expression of miR-372 and miR-373 permits proliferation and tumorigenesis of primary human cells by harboring both oncogenic RAS and active wild-type p53 [27]. [score:3]
[1 to 20 of 3 sentences]
22
[+] score: 20
Other miRNAs from this paper: hsa-mir-30b, hsa-mir-302a, hsa-mir-367, hsa-mir-371a, hsa-mir-372
The levels of B-HCG, AFP and LDH were not increased at this time point (Fig. 5a and not shown), whereas of the different miRs tested miR-373-3p showed an elevated level just above the threshold (Fig. 5c, black arrow). [score:1]
A single positive score for miR-373-3p and miR-371a-3p (just above cut-off level) was obtained seven years after primary diagnosis, but without known clinical consequences. [score:1]
During follow-up an additional positivity was noted for miR-371a-3p, miR-373-3p and LDH, all just above the threshold levels, at the same time point. [score:1]
At primary diagnosis the levels of miR-371a-3p and miR-373-3p were elevated in 4/4, and miR-367-3p in 3/4 patients. [score:1]
In the current proof-of-concept study, we examined the levels of miR-371a-3p, miR-373-3p and miR-367-3p in serum samples of a follow-up series of selected TGCC patients ranging from the time of primary diagnosis to relapse and complete remission. [score:1]
In particular, it has been found that the expression of miR371a-3p, miR-372-3p, miR-373-3p and the miR-302a-d/367-3p cluster is characteristic for (T)GCC as well as embryonic tissues, excluding fully somatic differentiated (TE) tissues. [score:1]
Similarly, miR-371a-3p, miR-373-3p and miR-367-3p showed high levels (Supplementary Table 1, Fig. 6d and not shown). [score:1]
The miR-371a-3p, miR-373-3p and miR-367-3p levels were also found to be elevated at primary diagnosis (Supplementary Table 1, Fig. 1d-f). [score:1]
Fig. 2Levels of serum markers at time of diagnosis, of treatment and follow-up of TGCC case 2. a The levels of B-HCG (U/L), b miR-371a-3p, c miR-371a-3p during the first 12 months of follow-up, d miR-373-3p, e miR-373-3p during the first 12 months of follow-up. [score:1]
This resulted in a 89% sensitivity and a 90% specificity for miR-371a-3p, a 70% sensitivity and a 89% specificity for miR-373-3p and a 79% sensitivity and a 85% specificity for miR-367-3p. [score:1]
The miR-371a-3p and miR-373-3p levels were, however, found to be increased (Fig. 5b and c, red arrow). [score:1]
The miR-373-3p level was below cut-off level (Fig. 4c). [score:1]
The miR-371a-3p and miR-373-3p levels were both found to be elevated at the moment of ICM detection. [score:1]
Remarkably, for as yet unknown reasons, positive ampTSmiR scores were found for miR-371a-3p, miR-373-3p and miR-367-3p (not shown) at 15 months after relapse. [score:1]
The levels of both B-HCG and miR-371a-3p, miR-373-3p and miR-367 indicated the presence of a PILN, of which the first miR (as well as B-HCG, being borderline) were the first to be positive. [score:1]
The ampTSmiR test revealed elevated levels of miR-371a-3p, miR-373-3p and miR-367-3p (Supplementary Table 1, Fig. 2b-e and not shown). [score:1]
A single elevated level of miR-373-3p was observed 8 months after diagnosis of which the impact is still unclear. [score:1]
At this time point, an elevated level of miR-371a-3p was detected (Fig. 3c, red arrow), with undetectable miR-373-3p and miR-367-3p levels (Fig. 3d and e). [score:1]
Here we show that, besides B-HCG, miR-371a-3p and miR-373-3p are able to predict the presence of an ICM as a TGCT relapse. [score:1]
During follow-up two serum samples were found to be miR-373-3p positive, without known clinical consequences. [score:1]
[1 to 20 of 20 sentences]
23
[+] score: 20
In the analysis, we observed terms associated significantly with the target genes (27 for miR-1, 26 for miR-124a, and 23 for miR-373) [see Additional file 2] included in the GO gene-association database (goa_human and Affymetrix HG_U95AV2 Human known genes) among the top 50 target genes. [score:5]
Through microarray experiments, Lim et al. [40] reported genes downregulated by miR-1, miR-124a, and miR-373, respectively. [score:4]
We have shown the results for miR-1, miR-124a, and miR-373 and these are consistent with the general idea that miRNA targets are diverse in function [23]. [score:3]
In miR-124a and miR-373, excluding miR-1, miTarget was more significant than the seed match. [score:3]
This predicted significant functions of human miRNA miR-1, miR-124a, and miR-373 by GO analysis. [score:1]
Supplementary Table 3. This table lists statistically significant GO terms in the prediction results for miR-1 (Supplementary Table 3-1), miR-124a (Supplementary Table 3-2), and miR-373 (Supplementary Table 3-3). [score:1]
For miR-373, the best GO was GO:0016021 (integral to membrane, adjusted P = 0.000324) in the cellular component category. [score:1]
The genes were used for GO analysis for miR-1 (Supplementary Table 2-1), miR-124a (Supplementary Table 2-2), and miR-373(Supplementary Table 2-3). [score:1]
We predicted significant functions for human miR-1, miR-124a, and miR-373 using Gene Ontology (GO) analysis and revealed the importance of pairing at positions 4, 5, and 6 in the 5' region of a miRNA from a feature selection experiment. [score:1]
[1 to 20 of 9 sentences]
24
[+] score: 19
The 10 most upregulated and downregulated miRNAs are shown in Figure 1. The most upregulated miRNA was miR-373-5p, while the most downregulated miRNA was miR-15b-5p. [score:13]
The most upregulated miRNA in long-lived participants, miR-373-5p, is part of the miR-373 family, which functions as a tumor suppressor in breast cancer [26]. [score:6]
[1 to 20 of 2 sentences]
25
[+] score: 18
OncomiRs Breast cancer-related proteins encoded by mRNAs that are oncomiRs targets Reference miR-21 Bcl-2, PDCD4, TPM1, TIMP3(18– 22) miR-155 Caspase 3, SOCS1(5, 66) miR-27a ZBTB10, FOXO1(67, 68) miR-96 FOXO1(68) miR-182 FOXO1(68) miR-128a TGF-βR1(69) miR-10b Tiam1, TWIST, HOXD10, E-cadherin(5, 70) miR-9 E-cadherin(5, 71) miR-373 CD44(7) miR-520c CD44(7)Bcl-2, B cell lymphoma2 (antiapoptotic protein); PDCD4, programed cell death 4 (neoplastic transformation inhibitor); TPM1, tropomyosin 1 (alpha); PTEN, phosphatase and tensin homolog; TIMP3, TIMP metallopeptidase inhibitor 3; SOCS1, tumor suppressor gene suppressor of cytokine signaling; ZBTB10, zinc finger and BTB domain containing 10; FOXO1, Forkhead box protein O1; TGF- βR1, transforming growth factor- β type 1 receptor; Tiam1, T lymphoma invasion and metastasis; TWIST, twist-related protein; HOXD10, homeobox D10. [score:11]
miRNA HLN targets ReferenceLet-7 [b]APP, NRAS, e-MYC [a](12– 14)miR-15 [b] Bcl-2, CCNE1(15, 16)miR-19a [b] IMPDH, NPEPL1(17)miR-21 [b] Bcl-2, PDCD4, TPM1, TIMP3(18– 22)miR-24 [b] Bim, Bcl-2(23, 24) miR-124 SphK1(25)miR-126 [b] SDF-1α(26) miR-145 CDH2, Oct4, MUC1(27, 28)miR-146a/b [b] UHRF1(29)miR-155 [b] STAT3, SOCS1(30, 31)miR-214 [b]PTEN [a](32)miR-221 [b] Slug (SNAI2)(33)miR-290 [b] Arid4b(34) miR-373 TXNIP, TRPS1, RABEP1, GRHL2, HIP1(35) [a]Proteins with altered levels in age-related diseases. [score:5]
Global identification of miR-373-regulated genes in breast cancer by quantitative proteomics. [score:2]
[1 to 20 of 3 sentences]
26
[+] score: 16
Our data also reiterate the senescence -associated up-regulation of miR-373* and miR-663 and down-regulation of miR-197 observed in WI-38 cells [5] although less is known about the targets of these miRNAs. [score:9]
Our data also corroborate the up-regulation of miR-373* and miR-663 and down-regulation of miR-197 observed in senescent and quiescent WI-38 cells [5]. [score:7]
[1 to 20 of 2 sentences]
27
[+] score: 16
We identified five downregulated miRNAs (miR-26b, miR-125b, miR-203, miR-218, and miR-373) and one upregulated miRNA (miR-15a) when we compared miRNA expression in HNSCC cells versus primary human keratinocytes (Figure 1A). [score:8]
To assess the function of the deregulated miRNAs in HNSCC, we generated two YFP-luciferase -expressing cell lines—SCC13 (established facial SCC; Rheinwald and Beckett, 1981) and SJG15 (primary lingual SCC; Goldie et al., 2012)—in which we knocked down miR-15a or stably overexpressed miR-26b, miR-125b, miR-203, miR-218, or miR-373 using lentiviral approaches (Figure S1A). [score:7]
miR-125b and miR-373 were excluded from further analysis because their effects were not consistent between SCC13 and SJG15 cells. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 16
More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55]. [score:16]
[1 to 20 of 1 sentences]
29
[+] score: 15
Finally, the differential expression of mir-373 was reported in several neoplastic diseases except in lymphomas [32]; on the contrary, both the mir-135a downregulation (able to target JAK2) and miR-135a overexpression were associated to relapse of Hodgkin's [33] and follicular and diffuse large B cell lymphomas [29, 31]. [score:12]
Our study identified 8 new differentially expressed miRNAs: mir-323, mir-138, mir-9*, mir-211, mir-149, mir-373, mir-135a and mir-184; that have not been reported in literature so far. [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 14
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
[1 to 20 of 2 sentences]
31
[+] score: 14
Other miRNAs from this paper: hsa-let-7b, hsa-mir-21, hsa-mir-27a, hsa-mir-148a, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-141, hsa-mir-126, hsa-mir-146a, hsa-mir-1-1, hsa-mir-155, hsa-mir-34b, hsa-mir-34c, hsa-mir-296, hsa-mir-370, hsa-mir-342, hsa-mir-526a-1, hsa-mir-526a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-542, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1246, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The ectopic expression of miR-342-5p, miR-373 or miR-542-5p suppresses Enterovirus replication, but miR-10* facilitates CVB3 replication. [score:5]
Both miR-373 and miR-542-5p target the 5′ untranslated region (5′ UTR) of EV71 vRNA and thus attenuate viral propagation as assayed in RD cells (Figure 2) [100]. [score:4]
Similarly, miR-373 and miR-542-5p attenuate EV71 propagation by targeting the 5′ UTR of EV71 vRNAs. [score:3]
Yang Z. Tien P. MiR373 and miR542-5p regulate the replication of enterovirus 71 in rhabdomyosarcoma cells Chin. [score:2]
[1 to 20 of 4 sentences]
32
[+] score: 14
In brief, the levels of three preselected miRs (miR-371a-3p, miR-373-3p and miR-367-3p) were determined in a RT-qPCR assay after a magnetic bead -based isolation and a targeted pre-amplification step. [score:2]
Boxplots of the serum levels of A. miR-371a-3p, B. miR-373-3p, and C. miR-367-3p of NGCC subgroups, HD (n =104), and TGCC (GCC) patients (n = 236). [score:1]
In this context, it is of notion that in our series no increased miR levels were observed in cases with inflammation or necrosis, including torsio testis for miR-373-3p and miR-367-3p. [score:1]
NGCC and HD were significantly separated by levels of miR-371a-3p, 367-3p, and by miR-373-3p as well (p < 0.000). [score:1]
A. miR-371a-3p, B. miR-373-3p, and C. miR-367-3p of NS (n = 110), SE (n = 128), and HD (n =104). [score:1]
Figure 5Boxplots of the serum levels of A. miR-371a-3p, B. miR-373-3p, and C. miR-367-3p of NGCC subgroups, HD (n =104), and TGCC (GCC) patients (n = 236). [score:1]
Area under the curve (AUC) for miR-371a-3p was 0.951 for the comparison of TGCC with HD, being 0.888 for miR-373-3p and 0.861 for miR-367-3p. [score:1]
Serum levels of A. miR-371a-3p, B. miR-373-3p, and C. miR-367-3p discriminate patients with TGCC from those with NGCC and HD. [score:1]
TE related samples showed higher levels of miR-371a-3p (p = 0.001), miR-373-3p (p = 0.002) and miR-367-3p (p = 0.007) than HD (Figure 4). [score:1]
For miR-373-3p a sensitivity of 70% and specificity of 89% was reached. [score:1]
Also a relation was observed for levels of miR-373-3p and miR-367-3p and tumor size in patients with stadium I TGCC. [score:1]
Figure 3 A. miR-371a-3p, B. miR-373-3p, and C. miR-367-3p of NS (n = 110), SE (n = 128), and HD (n =104). [score:1]
miR-373-3p was elevated in NM, LCT, and BCL only. [score:1]
[1 to 20 of 13 sentences]
33
[+] score: 14
According to the online database for miRNA target prediction and functional annotations, miRDB [61, 62] the number of predicted targets for miRNAs in the miR-371–373 and miR-302 families range from 469 to 529; interestingly, LATS2 is one of the highest ranking targets on the list for all miR-302 family members as well as miR-372 and miR-373 (Target Score > 98) [62]. [score:9]
We also observed differences in, with miR-371-5p, miR-122, miR-302a, miR-302d, and miR-373 showing elevated expression in one or more histologic subtypes. [score:3]
Functional studies have demonstrated that miRNA-372 and miRNA-373 act as oncogenes in TGCT through interactions with the p53 pathway, in particular through regulation of LATS2 [32]. [score:2]
[1 to 20 of 3 sentences]
34
[+] score: 14
Similar to observations in p21, cultures treated with E-cadherin 640 or miR373 demonstrated a significant suppression of the E-cadherin antisense transcription which correlated with a distinct increase in E-cadherin sense/mRNA transcript expression (Figure S2D). [score:5]
A similar observation was noted for the E-cadherin targeted siRNA E-cad640 and miRNA miR373, both of which had been shown to mediate gene activation of E-cadherin (Figure S2A) [5], [11]. [score:3]
p21siRNA, E-cadherin 640, and miR373 Transfections and mRNA Knockdown. [score:2]
MCF-7 cells were transfected with either miR373 or E-cadherin and assayed 48 hrs later by directional RT for E-cadherin expression (using E-cad qPCR primers, Table S1). [score:2]
Similar to observations with p21, both E-cadherin 640 and miR373, shown previously to function as activating RNAs [5], [11], were also capable of priming the reverse transcription of E-cadherin (Figures S2B and S2C, respectively). [score:1]
Several ESTs have been reported and can, based on computational predictions using the program Amplify, bind either E-cadherin 640 and/or miR-373 [14]. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 14
As noted above, the HuH6 EVs carried the most specific miRNA load, missing or carrying at lower concentration some miRNA particularly abundant in the EVs of other cells, but showing several uniquely enriched miRNAs as follows: miR-372-3p; miR-371a-3p; miR-371a-5p; miR-373-3p; miR-34a-3p and miR-122-5p The EV-cargos did show some specificity with the detection of miRNAs expressed at high levels in only one line: miR-16-5p in HuH7-EVs only; miR-18a-5p and miR-20a-5p in Hep3B-EVs only and miR-451a in HepG2-EVs only. [score:3]
As noted above, the HuH6 EVs carried the most specific miRNA load, missing or carrying at lower concentration some miRNA particularly abundant in the EVs of other cells, but showing several uniquely enriched miRNAs as follows: miR-372-3p; miR-371a-3p; miR-371a-5p; miR-373-3p; miR-34a-3p and miR-122-5p The EV-cargos did show some specificity with the detection of miRNAs expressed at high levels in only one line: miR-16-5p in HuH7-EVs only; miR-18a-5p and miR-20a-5p in Hep3B-EVs only and miR-451a in HepG2-EVs only. [score:3]
RT-qPCR analysis of the expression levels in LCC-EVs and LCC-lines of the following 6 miRNAs: miR-17-5p, miR-451a, miR-21-5p, miR-92a-3p, miR-373, miR-93-5p. [score:3]
HB is considered to be an embryonal tumor probably originating from hepatoblasts and it has already been reported that miR-373 and miR371 are overexpressed in HB. [score:2]
Only the HuH6-derived EV cargoes contained abundant levels of miR-372-3p, miR-371a-3p, miR-371a-5p and miR-373-3p. [score:1]
Accordingly miR-373, which had already been proposed as a blood -based biomarker for more aggressive tumors, may also be a candidate as an HB EV-cargo marker [61]. [score:1]
The validation of the RNA-seq data was achieved partially with 3 miRNAs only, miR-17-5p, miR-92a and miR-373. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 13
Agami and colleagues were able to show that miR-372 and miR-373 neutralize p53 -mediated CDK inhibition, possibly through direct inhibition of the expression of the tumor-suppressor LATS2. [score:10]
Two miRNAs in this cluster, miR-372 and miR-373 induced cell transformation with oncogenic RAS and WT p53. [score:1]
Their results suggest that miR-272 and miR-373 may participate in the tumorigenesis of tumors with WT p53 and are sensitive to DNA damaging treatment. [score:1]
miR-372 and miR-373 can Substitute for Loss of Wild Type (WT) p53. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 12
Except for miR-373 and miR-497*, the mature miRNA levels of all tested miRNAs were significantly lower after XPO5 down-regulation (Figure 4D). [score:4]
The cytoplasmic levels of miR-373 and miR-497*, which were not decreased by XPO5 knockdown via siRNA treatment, were significantly decreased by XPO1 inhibition via LMB treatment (Figure 4E and 4F), indicating that XPO1 acts as an alternative nucleo-cytoplasmic transporter for these miRNAs. [score:4]
The levels of the miRNAs miR-302c, miR-302c*, miR-125b, miR-196a, miR-155, miR-527, miR-30b*, miR-106b, miR-373 and miR-497* were chosen to exemplify the effect of XPO5 knockdown on the cytoplasmic level of miRNAs. [score:2]
The levels of (E) miR-373 and (F) miR-497* were significantly lower after XPO1 inhibition via leptomycin B (LMB) compared with control -treated cells (Ctrl). [score:2]
[1 to 20 of 4 sentences]
38
[+] score: 12
For example, miR-106b, miR-107, miR-130a, miR-34 [9], miR-93, miR-155, miR-181a, miR-21, miR-23a, miR-320a [8], miR-193b, miR-320b [13] are significantly up-regulated and miR-148a [11, 14], miR-330-5p [15], miR-373 [16] significantly down-regulated. [score:7]
Interestingly, most of these miRNAs are coincident with those appearing in Table 1 (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-93, miR-106b, miR-497, miR-23a, miR-19b, miR-107, miR-15a, miR-330-5p, miR-144), indicating that, apart from being targeting many mRNAs, these miRNAs are participating in the most reliable interactions. [score:3]
It is worth noting that these 10 miRNAs together (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-448, miR-93, miR-106b, miR-217, miR-539) could potentially be regulating 41% of the mRNAs significantly altered in PDAC. [score:2]
[1 to 20 of 3 sentences]
39
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
In a review, Gramantieri et al. (2008) show miRNAs aberrantly expressed in HCC compared to non-tumorous liver tissue (up -expression of miR-33, miR-130, miR-135a, miR-210, miR-213, miR-222, miR-331, miR-373, miR-376a, and down -expression of miR-130a, miR-132, miR-136, miR-139, miR-143, miR-145, miR-150, miR-200a, miR-200b, miR-214). [score:6]
Stimulation of HCC proliferationBudhu et al., 2008; Gramantieri et al., 2008; Huang et al., 2009, 2011 miR-373 Invasion and metastasisMeng et al., 2007; Bartels and Tsongalis, 2009; Wu et al., 2011 miR-374 DevelopmentWang et al., 2008; Wong et al., 2008, 2010; Koh et al., 2013 miR-375 Stimulation of HCC proliferationLiu et al., 2010; He et al., 2012 miR-376a Proliferation and apoptosisMeng et al., 2007; Zheng et al., 2012b miR-423 Enhanced CDK2 activityLin et al., 2011 miR-491-5p Inhibition of TNF-α-related apoptosisYoon et al., 2010 miR-500 Elevated in HCC, returned to physiologic level after surgical interventionYamamoto et al., 2009 miR-637 Active STAT3Zhang et al., 2011 let-7a/a-1/a-2/b/c/d/e/f/f-2/g Development. [score:5]
MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 11
For instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[73]. [score:7]
Another member in this cluster, miR-373, was found to be upregulated in EB by our results, which was consistent with a recent report [26]. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 10
miR-372 and miR-373 can also promote the proliferation and tumorigenesis of primary human cells by neutralizing p53 -mediated CDK inhibition, which possibly through the direct inhibition of tumor-suppressor LATS2’s expression [14]. [score:10]
[1 to 20 of 1 sentences]
42
[+] score: 10
Among negative and significant correlations (70/215), we observed a strong correlation (−0.903) between ID1, one of the main down-stream targets of TGFbeta signaling [37], and miR-520e, a microRNA belonging to the miR-373/520 family: its over -expression has been recently described to have a tumor suppressive role in breast cancer, also by down-regulation of the TGFbeta signaling [38]. [score:10]
[1 to 20 of 1 sentences]
43
[+] score: 10
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
[1 to 20 of 2 sentences]
44
[+] score: 9
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-451a, hsa-mir-451b
On the other hand, miR-373 could be down-regulated by aberrant promoter methylation in colon cancer, with a concomitant up-regulation of its target, Rab22A [72]. [score:9]
[1 to 20 of 1 sentences]
45
[+] score: 9
Liu P. Wilson M. J. miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-kappaB factor in human fibrosarcoma cellsJ. [score:8]
miR-520c and miR-373 are two miRNAs which are also involved in the modulation of the extracellular matrix of fibrosarcomas [86]. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 9
miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-kappaB factor in human fibrosarcoma cells. [score:8]
miR-520c and miR-373 have been shown to activate Ras/MAPK pathway via activation of MMP9 in fibrosarcoma cell lines (Liu and Wilson, 2012). [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 8
While miR-21, miR-30a and miR-373 were expressed in all 7 tissues including testis, kidney, lung, spleen, heart, liver and skeletal muscle, miR-422, miR-28, miR-379, miR-431 and miR-648 demonstrated more restricted expression patterns (Figure 2). [score:5]
The mature sequences for miR-373 and miR-373* are encoded from the same pre-miRNA on complementary strands of the hairpin stem (see additional file 1). [score:1]
Rhesus miR-371 has one nucleotide mismatch with the human sequence and rhesus miR-373* has three nucleotide differences (Table 2, Figure 1A). [score:1]
Rhesus miR-372 and miR-373 have 100% similarity in mature miRNA sequences with the human orthologs. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 8
Similar seedpairing in miRNA families indicates that they may function through the same pathways and share mRNA targets – such as CD44, identified as a target of miR-373 and known to correlate with survival in breast cancer patients [53]. [score:5]
Two miRNAs from this location, miR-373 and miR-520c, have previously been shown to stimulate cancer cell migration and invasion in both in vitro and in vivo mo dels and to be expressed at increased levels in metastatic breast cancer [43]. [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 8
miR-372 and miR-373 are specifically expressed in placenta, while miR-206 is specifically expressed in skeletal muscle. [score:5]
However, there are a few outliers; miR-372, miR-373, and miR-206 that are associated with 5, 4, and 4 diseases, whereas they show high tissue specificity index values of 0.86, 0.82, and 0.78, respectively. [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 8
Voorhoeve et al. carried out studies on the expression of miR-371-3 cluster in testicular GCTs and they found that miR-372 and miR-373 were overexpressed: in particular they showed that miR-372 and miR-373, together with RAS, induced neoplastic transformation in presence of wild-type p53 [65]. [score:5]
Syring et al. demonstrated that serum miRNAs can be used as novel and more sensitive and specific biomarkers in TC; in fact, they detected high levels of miR-371a-3p, miR-372-3p, miR-373-3p and miR 367-3p in patients with locally advanced disease [88]. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 8
Among the 16 miRNAs, the expression of miR-96-5p and miR-373-3p was low. [score:3]
Notably, the expression of miR-96-5p and miR-373-3p was very low (data not shown). [score:3]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs Validation of by real-time PCRWe validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs We validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
[1 to 20 of 4 sentences]
52
[+] score: 8
From 245 miRNAs expressed in both sALS and controls but at statistically different levels, 6 were expressed in sALS at higher levels than controls [miR-373*, miR-551a (p < 0.01); miR-506, miR-518a-5p, miR-518e*, and miR-890 (p < 0.05)] (Table  3) and all the remaining (239) were down-regulated in the sALS SC tissue (Additional file 1: Table S1). [score:8]
[1 to 20 of 1 sentences]
53
[+] score: 8
Several recent studies suggest that miR-15b, miR-16, miR-21, miR-221, miR-222, miR-372, miR-373, miR-92a and miR-182 can regulate the expression level of RECK by targeting its conserved sequences of 3’-UTRs in different diseases [25– 27]. [score:8]
[1 to 20 of 1 sentences]
54
[+] score: 7
To determine if this effect was simply due to over -expressing miRNAs, we repeated the experiment while over -expressing mir-373, a miRNA not predicted to target the APP 3'UTR. [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 7
HCV infection also stimulates miR-373 expression, and thereby impairs by directly targeting JAK1 and IFN -regulating factor 9 [43]. [score:7]
[1 to 20 of 1 sentences]
56
[+] score: 7
To date, only two miRNAs, miR-320a and miR-373, have been demonstrated to regulate gene expression in the nucleus through targeting the promoter regions of protein-coding genes [10] [11]. [score:6]
However, recent studies have reported that a few miRNAs, such as miR-320, miR-373 and miR-29b, localize to or function in the nucleus [9]– [11]. [score:1]
[1 to 20 of 2 sentences]
57
[+] score: 7
Another example of invasion/metastasis-promoting miRNAs is miR-373, which was initially considered as an oncomiR functioning to target LATS2, a tumor suppressor gene in testicular germ-cell tumors [85]. [score:4]
BRMS1 was shown to act as a repressor for metastasis-promoting miRs such as miR-10b, miR-373 and miR-520c and an activator for metastasis-suppressing miRs miR-146a/b, miR-335 and miR-21 [109] (Figure  4). [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 7
Employing a similar microarray -based approach, Triboulet et al. [181] showed that, while 11 cellular miRNAs (including miR-122, miR-297, miR-370, and miR-373) were upregulated, just two cellular miRNAs, miR-17-5p and miR-20a were downregulated upon HIV-1 infection in the Jurkat cells. [score:7]
[1 to 20 of 1 sentences]
59
[+] score: 7
They included known oncogenic miRNAs such as miR-372 (cell viability, 187%) and miR-373 (165%), and tumor suppressive miRNAs such as miR-124a (28.3%), miR-7 (37.1%), miR-192 (36.6%) and miR-193a (29.7%) in several different cancer types (18, 25– 27). [score:3]
By the same miRNA mimics library screening, we found that miR-93/miR-372/miR-373 and miR-124a were pro-proliferative and anti-proliferative, respectively, in DLD-1 colorectal cancer cells (23), suggesting consistent roles of these miRNAs on cell proliferation in ovary and colorectal cancer cells. [score:1]
We discovered pro-proliferative miRNAs (miR-9 [*], miR-93, miR-130a, miR-130b, miR-301, miR-302b, miR-302d, miR-363, miR-372, miR-373), and anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506, miR-517c) in A2780 cells. [score:1]
pro-proliferative miR-93, miR-302b, miR-302d, miR-372, miR-373 and anti-proliferative miR-193a, miR-193b), supporting the importance of the seed region of miRNA on its function. [score:1]
For example, miR-93/miR-302/miR-372/mir-373 seed family miRNAs (miR-93, miR-302b, miR-302d, miR-372, miR-373) were pro-proliferative, while miR-193 seed family miRNAs (miR-193a, miR-193b) were anti-proliferative (Table I). [score:1]
[1 to 20 of 5 sentences]
60
[+] score: 7
And some of these miRNAs, such as miR-26b, miR-106a and miR-301b (targeting Hsc 70), or miR-21, miR-224 and miR-373 (targeting LAMP2A) have been confirmed to target the 3' UTR of either Hsc 70 or LAMP2A [42]. [score:7]
[1 to 20 of 1 sentences]
61
[+] score: 7
The expression levels and fold-changes of 35 most abundantly expressed miRNAs of T3/HDF and T3/CMHDF, as well as those of 31 miRNAs of T3/MEF and T3/CMMEF, cells are summarized in Table 2. These results indicate that nine hES cell-specific miRNAs (miR-302a, 302b, 302c, 302 d, 367, 371, 372, 373 & 200c) were abundantly expressed in T3/HDF and T3/CMHDF cells, and that miR-367 and miR-373 had little more than 2-fold variations between these two cell populations. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 6
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-203a, hsa-mir-193b, hsa-mir-203b
Moreover, previous studies showed that miR-373 suppresses human epithelial ovarian cancer invasion and metastasis by directly targeting RAB22A gene[47]. [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
In the first group, there were 19 miRNAs with an expression level that was four times higher in BCSCs than in MCF-7 cells: miR-122a, miR-152, miR-212, miR-224, miR-296, miR-31, miR-373*, miR-489, PRED_MIR127, PRED_MIR154, PRED_MIR157, PRED_MIR162, PRED_MIR165, PRED_MIR191, PRED_MIR207, PRED_MIR219, PRED_MIR246, PRED_MIR88 and PRED_MIR90. [score:3]
We performed real-time RT-PCR for 10 miRNAs: miR-122a, miR-188, miR-200a, miR-21, miR-224, miR-296, miR-301, miR-31, miR-373* and miR-200C. [score:1]
Moreover, miR-301, miR-296, miR-21 and miR-373* have been reported to be expressed in human embryonic stem cells and other stem cells, indicating that these miRNAs may play a constitutive role in maintaining the biological characteristics of stem cells [40, 41]. [score:1]
The analysed miRNAs included miR-122a, miR-188, miR-200a, miR-21, miR-224, miR-296, miR-301, miR-31, miR-373* and miR-200C. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 6
In ovarian cancer, HOTAIR upregulates the expression of RAB22A by sponging microRNA-373, thereby enhancing tumor proliferation and invasion, and decreasing apoptosis [40]. [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
66
[+] score: 6
For examples, miR-373 and miR-520c promote invasion and metastasis of breast cancer cells by suppression of CD44 [16], while the miR-200 family members repress cell migration and invasiveness by targeting ZEB1 and ZEB2, known regulators of EMT [17, 18]. [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 5
CagA translocation caused a strong inhibition of miRNA-372 and miRNA-373, which both promote cell proliferation by silencing large tumor suppressor homolog 2 (LATS2) (158). [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
Thirty-three microRNAs in the array were found to be highly expressed (including let7a, miR-16, miR-21, and miR-205) and 22 showed low levels of expression (including miR-342, miR-346, and miR-373*) in all cell lines. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Other miRNAs from this paper: hsa-mir-372
Recently, Voorhoeve and co-workers identified two microRNAs (miRNA), hsa-mir-372 and hsa-mir-373 that are highly expressed in TGCTs and TGCT derived cell lines, and it was reported that these miRNAs suppressed elements of the p53 pathway in TGCT cells. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
Results showed that miR-323b-5p, miR-221-3p, miR-524-5p, and miR-188-3p were underexpressed in albuminuric relative to nonalbuminuric patients, while miR-214-3p, miR-92b-5p, hsa-miR-765, hsa-miR-429, miR-373-5p, miR-1913, and miR-638 were overexpressed [71]. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
Place et al. [13] provided evidence of promoter -targeting miRNA by showing that introduction of miR-373 induced expression of CDH1 and CSDC2 containing complementary promoter sequences. [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
Altered miRNA signatures in primary breast cancers and their metastasis have been observed, including the loss of tumor suppressor miRNAs (miR-206, miR-17-5p, miR-125a, miR-125b, miR-200, let-7, miR-34 and miR-31) and the overexpression of oncogenic miRNAs (miR-21, miR-155, miR-10b, miR-373 and miR-520c) [138]. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
Here, miR-373, miR-371-5p, and miR-106b show the same expression alteration but different range in hiPSCs and hESCs compared to NHDFs, which indicates that these miRNAs should be upregulated to some extent to maintain the capacity of cell pluripotency in hESCs. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
In contrast, pro-metastatic miR-373-520c downregulates CD44 (245) indicating that oncogenic miRNAs can regulate CD44 cell behavior in a specific way. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a, hsa-mir-520c
A previous study found that both miR-520c and miR-373 suppressed SIRT1 mRNA translation, leading to activation of the Ras/Raf/MEK/Erk pathway. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
miR-520c, miR-373, and miR-211 were described as miRNAs targeting TGFBR2 and contributing to the induction of MET [25], [49] although these three miRNAs were not identified as prime candidates of EMT-suppressive miRNA in our screening. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
Consistent with other studies on TGCT [21], [22], miR-372 and miR-373 have been suggested to act as oncogenes, and were found to be up-regulated solely in TGCT as well as the star form miR-373* in our study, further confirming their special roles in TGCT development. [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 4
Eichelser C. Flesch-Janys D. Chang-Claude J. Pantel K. Schwarzenbach H. Deregulated serum concentrations of circulating cell-free microRNAs miR-17, miR-34a, miR-155, and miR-373 in human breast cancer development and progression Clin. [score:3]
Chen W. Cai F. Zhang B. Barekati Z. Zhong X. Y. The level of circulating miRNA-10b and miRNA-373 in detecting lymph node metastasis of breast cancer: Potential biomarkers Tumour Biol. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 4
Tanaka et al. [80] found that the apparent silencing of microRNA-373 plays an important regulatory role in colon cancer cell proliferation. [score:2]
Of the first 50 miRNAs predicted by GSTRW, 46 were validated in the above three databases, and four were unidentified are hsa-mir-373, hsa-mir-92b, hsa-mir-199a and hsa-mir-200a, all of which are predicted in previous colon cancer examples. [score:1]
The first unverified miRNA is hsa-mir-199a ranked 5 and the second is hsa-mir-92b ranked 8 and hsa-mir-200a ranked 12 and hsa-mir-373 ranked 19. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 4
These authors [45] also reported that miRNA-372 and miRNA-373 can neutralize p53 -mediated CDK inhibition and allow the growth of tumor cells. [score:3]
In testicular germ cell tumors the presence of miRNA-372 and miRNA-373 has been reported, whereas a miRNA302 cluster was undetected [45]. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 4
Earlier evidence suggests that miR-373 and miR-520c can stimulate migration and invasion of MCF-7 and MDA-MB-435 cells, at least in part through direct suppression of CD44 (53), which functions as a cell surface receptor for several ECM components and mediates cell-cell or cell-substrate interactions through recognition of elements of the ECM (75, 76). [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
In this study we found that a panel of stem cell-related miRNAs including miR-10b, miR-27b, miR-373, miR-181, miR-34a, and miRNA-145 is preferentially upregulated by 200 kD-HA. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
Eight miRNAs such as miR-105 were upregulated in the diffuse type while only four miRNAs such as miR-373 increased in the intestinal type [92]. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
MiR-373 can induce the expression of E-cadherin and cold-shock domain-containing protein C2 (CSDC2) by targeting their promoters [7]. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Among the upregulated miRNAs were miR-124a, miR-155, miR-328, miR-326, miR-302c, miR-345, miR-373*, and miR-210 [54]. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
Expression of mature miR-302a-d, miR-372 and miR-373 is suppressed in an endothelial differentiation-specific manner, as compared to time-matched SA461 pluripotent samples. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
Previous studies have provided evidence for the important roles of deregulated expression of miRNAs in the pathogenesis of CC, including miR-29, miR-122, miR-124, miR-145, miR-146a, miR-200c, miR-370, miR-373, miR-376c and miR-494 [30– 36]. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
Additional precursor sequences of miRNAs containing in dels include miR-520h [39], [40], [41], miR-486 [42], miR-489 [43], miR-223 [44], miR-373 [45], miR-630 [46] and miR-1233 [17], which have been shown to be involved in cancer development, and miR-631, which is associated with risk of coronary artery disease [47]. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
Top 10 up-regulated miRNAs with maximum score and high fold change were: miR-317-5p, miR-373, miR-1268, miR-191*, miR-150, miR-1275, miR-188-5p, miR-1238, miR-134 and miR-296-5p. [score:4]
[1 to 20 of 1 sentences]
91
[+] score: 3
For example, miR-373 binds to the promoter of CDH1 to increase its expression in the prostate cancer cell line, PC3 [38]. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
For example, miR-373 can induce the expression of E-Cadherin or CSDC2 when binding to these genes' promoters [11]. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
In human breast cancer it has been shown that they can act either as tumor suppressors (i. e., miR-206, miR-17-5p, miR-125a, miR-125b, miR-200, let-7, miR-34 and miR-31) or as oncogenes (i. e., miR-21, miR-155, miR-10b, miR-373 and miR-520c) [20]. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Additionally, miR-372 and miR-373 were highly up-regulated in the cerebellar tumors compared with normal cerebellum or whole brain [26]. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Several research groups demonstrated that miRNA-548d, miRNA-224, miRNA-373, miRNA-198, miRNA-106a, miRNA-26b, and miRNA-301b show altered expression in PD patients (Alvarez-Erviti et al., 2013; Burgos et al., 2014; Cardo et al., 2014). [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
A recent study on ITGA2 showed that the miR-373 represses the expression of ITGA2 and stimulates the migration of breast tumor cells [61]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Eichelser C Flesch-Janys D Chang-Claude J Deregulated serum concentrations of circulating cell-free microRNAs miR-17, miR-34a, miR-155, and miR-373 in human breast cancer development and progression. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Other miRNAs from this paper: hsa-mir-520c
In breast cancer CD44 can be suppressed by miR-373 and miR-520c [37]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Several miRNAs, such as miR-101 [6], miR-122 [7], [8], [9] miR-373 [10], miR-221/222 [11], [12], [13], miR-195 [14], miR-30d [15], miR-125b [16], miR-18a [17], miR-139 [18], miR-223 [19] and miR-29 [20], have already been reported to regulate HCC tumor progression and metastasis by regulating key genes such as Mcl-1, ADAM17, YAP, DDIT4, Cyclin D1, CDK6, E2F3, Galphai2, LIN28B, estrogen receptor-α, Rho-kinase 2, Stathmin 1 and Bcl-2 and so on. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Four other miRNAs (miR-93, miR-125a, miR-302d, and miR-373) also targeted this region. [score:3]
[1 to 20 of 1 sentences]