sort by

113 publications mentioning mmu-mir-375 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-375. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 562
Interestingly, both BIRC5 and BCL2L1 were up-regulated in CRC tissue samples and down-regulated as a result of miR-375 up-regulation or siRNA silencing of YAP1 in HCT116 in the present study. [score:10]
Among others, YAP1 is up-regulated in many epithelial cancers, and is mainly known as an effector of the Hippo signaling pathway involved in cell growth, division and apoptosis [56], [57], whereas up-regulation of YWHAZ has been shown to be associated with low miR-375 expression and reduced overall survival in gastric cancer [58]. [score:9]
As expected, more mRNAs were down-regulated than up-regulated as a result of miR-375 ectopic expression (Figure 4B). [score:9]
Finally, miR-375 target analysis demonstrated that the pro-apoptotic role of miR-375 by may be exerted through direct targeting of YAP1 resulting in down-regulation of the anti-apoptotic genes BIRC5 and BCL2L1. [score:9]
Interestingly, six of these known miR-375 targets were also significantly down-regulated in HCT116 upon miR-375 ectopic expression. [score:8]
Additionally, miR-375 has previously been shown to be down-regulated in different cohorts of CRC samples [35], [36] and in several other human cancers (see Table S6 in File S1 for references) indicating that the down-regulation of miR-375 is a general event in tumor development. [score:8]
In addition, down-regulation of the YAP1 downstream targets BIRC5 (54%) and BCL2L1 (72%) as a result of miR-375 ectopic expression was also confirmed at the RNA level (Figure 4E). [score:8]
Interestingly, like YAP1 we found that BIRC5 and BCL2L1 were down-regulated as a result of miR-375 up-regulation in HCT116 (FC [(log2)]: −0.9 (BIRC5) and −0.7 (BCL2L1) and p<0.05). [score:7]
To identify biologically relevant miR-375 targets, we set out to analyze the correlation between the expression of the above identified putative miR-375 targets and miR-375 in clinical CRC samples (normal colon mucosa n = 10 and adenocarcinoma n = 11). [score:7]
Furthermore, results from our laboratory have shown that miR-375 is up-regulated upon inhibition of β-catenin/TCF4 activity in the dox inducible dominant negative (dn)TCF4 DLD1 cell line (DLD TR7), which has been used as a mo del to study Wnt regulation of miRNAs in CRC [25]. [score:7]
Subsequently, we analyzed whether mRNAs that had previously been identified as direct miR-375 targets in other tissue were affected in HCT116 cells upon up-regulation of miR-375. [score:7]
To identify potential miR-375 mRNA targets the expression of miR-375 was correlated to genome-wide mRNA expression profiles. [score:7]
Furthermore, like miR-375 ectopic expression, silencing of YAP1 resulted in down-regulation of BIRC5 (∼30%) and BCL2L1 (∼40–50%) further emphasizing the role of miR-375 and YAP1 in the regulation of these molecules in HCT116 cells (Figure 5A). [score:7]
While no miR-375 expression was observed in the HCT116_ScrH cells +/− dox, a minor level of miR-375 expression was observed in the untreated HCT116_miR-375H cells (Figure 7A), which could indicate a minor leakage from the miR-375-tRFP expression cassette in the absence of dox. [score:7]
The mRNAs with minimum one 7mer-m8 seed match within the 3′ UTR showed a higher propensity to down-regulation upon miR-375 over -expression. [score:6]
Overall, these results indicate that the down-regulation of miR-375 in CRC is a result of a reduction in the miR-375 expression in epithelial cells of the tumor. [score:6]
Expression of known direct miR-375 targets. [score:6]
Initial analysis confirmed the down-regulation of HELLS, NOLC1 and YAP1 at the mRNA and protein level in response to ectopic miR-375 expression in HCT116 cells (Figures 4D–F). [score:6]
The clearly epithelial origin of the high miR-375 expression in normal colon mucosa and the down-regulation of miR-375 in epithelial cells from adenocarcinomas led to the selection of miR-375 for further analysis. [score:6]
Thus down-regulation of BIRC5 and BCL2L1 may among others explain the apoptotic phenotype induced as a result of miR-375 ectopic expression. [score:6]
In all, 224 genes had at least one 7mer-m8, 7mer-m1 or 8mer miR-375 seed match in their 3′UTR and were down-regulated (FC [(log2)]≤−0.5 and p<0.05) upon miR-375 ectopic expression. [score:6]
We hypothesize that miR-375 exerts its tumor suppressive role partly by acting as an upstream regulator of BIRC5 and BCL2L1 through the targeting of YAP1 (Figure 8). [score:6]
The carried out in the present study, however, demonstrated that miR-375 is most likely not under direct β-catenin/TCF4 control and rather suggest that yet unidentified downstream targets of the Wnt pathway affect miR-375 expression in CRC. [score:6]
Stimulated by the observation that our in silico/in vitro approach accurately identified many known direct miR-375 targets, we decided to investigate if YAP1 and two other miR-375 target candidates HELLS and NOLC1 were directly regulated by miR-375 in CRC cells. [score:6]
Subsequently, genome wide microarray transcription profiling of HCT116 cells over -expressing miR-375 was carried out to screen for target candidates regulated at the transcriptional level. [score:6]
To further analyze the role of YAP1 down-regulation in the phenotypes induced by miR-375 ectopic expression, YAP1 was silenced in HCT116 cells using two different siRNAs. [score:6]
Overall, the frequent down regulation of miR-375 in cancer and the phenotypic characterization of miR-375 in vivo and in vitro clearly emphasize its tumor suppressive role and have encouraged the search for miR-375 targets mediating the tumor suppressive effects. [score:6]
Integration of the transcription data with in silico target prediction revealed, that miRNAs harboring miR-375 seed matches in the 3′UTR were more frequently down-regulated than mRNAs with no seed match (Figure 4B). [score:6]
We conclude that down-regulation of YAP1 mimics the apoptotic phenotype induced by miR-375 ectopic expression. [score:6]
Thorough analysis of MIR-375 methylation and expression in CRC cell lines and tissue samples only identified MIR-375 promoter methylation and concurrent miR-375 down-regulation in three CRC cell lines including HCT116. [score:6]
We showed that HELLS and NOLC1 were down-regulated both at the mRNA and protein level as a result of miR-375 ectopic expression. [score:6]
We next sought to elucidate whether HELLS and NOLC1 were directly or indirectly targeted by miR-375. [score:5]
miR-375 expression analysis demonstrated that HCT116, SW480 and Colo205 all exhibited lower expression of miR-375 than the cell lines with no methylation (Figure 3B). [score:5]
Induction of miR-375 expression significantly reduced the growth of the tumors confirming the results from esophageal squamous cell carcinoma in which miR-375 was shown to effectively suppress tumor formation and metastasis [42]. [score:5]
Identification of potential miR-375 targets based on mRNA profiling and in silico target predictionThe mRNA profiling of miR-375 transfected HCT116 cells and the clinical samples are described in the Supplementary Material (Methods S1). [score:5]
Scr and miR-375 transfected cell (∼3.5×10 [6]) were scraped of culture flasks on ice in gentle lysis buffer (20 mM TRIS pH 7.5, 10 mM NaCl, 0.5% NP-40, 2 mM EDTA supplemented with RNase inhibitor RNaseOut (Invitrogen) and Complete Mini Protease Inhibitor Cocktail (Roche)) and hypertonically lysed by increasing the NaCl concentration to 150 mM. [score:5]
Figure S5 miR-375 expression in cohort 2. (A) Box plots comparing the relative expression of miR-375 in 25 samples from normal colon mucosa and 63 primary MSS stage I–IV CRCs (T2-4, N0-3, M0/1)×Minimum and maximum outliers. [score:5]
None of the tissue samples demonstrated MIR-375 promoter methylation although miR-375 was clearly down-regulated in a subset of the samples indicating that in vivo miR-375 is mainly regulated by other mechanisms than hypermethylation in CRCs. [score:5]
Additionally, their knock-down reduced cell viability and induced cellular death mimicking the phenotype induced by miR-375, although they were not identified as direct miR-375 targets using a. 10.1371/journal. [score:5]
Additionally, miR-375 expression in normal epithelial cells was significantly higher than the expression in epithelial cells from adenocarcinoma (p = 0.03). [score:5]
mRNA profiling of HCT116 cells upon ectopic expression of miR-375 and miR-375 target identification. [score:5]
Furthermore, the apoptotic death induced by miR-375 could be inhibited with z-DEVD-fmk (Caspase 3/7 inhibitor) (Figure 2D) demonstrating that the induced apoptosis is dependent on Caspase 3/7 activity. [score:5]
Identification of potential miR-375 targets based on mRNA profiling and in silico target prediction. [score:5]
Indeed, individual elimination of HELLS and NOLCL1 reduced the viability and induced cellular death in a manner similar to miR-375 ectopic expression (Figures 6C and D) but did not induce apoptotic death (Figure 6E) and hence other miR-375 targets such as YAP1 are responsible for the apoptotic phenotype. [score:5]
In addition, suppression of colony formation and reduced migration and invasion has also been linked to miR-375 expression [37], [40], [42], [49]. [score:5]
Using TarBase6.0, we identified nine mRNAs, which had all been identified as direct miR-375 targets using (Table 3) [47]. [score:4]
A significant up-regulation of mature miR-375 was observed 24 hours post-transfection. [score:4]
Additionally, miR-375 has also been shown to be up-regulated upon 5-aza-2′-deoxycytidine treatment in HCT116 and to a less extent in DLD1 [53]. [score:4]
On the contrary, Infinium HumanMethylation450 BeadChip methylation analysis of normal colon mucosa with paired adenomas or adenocarcinomas did not identify any hypermethylation of MIR-375 in the adenomas and adenocarcinomas (Figure 3C), although miR-375 was down-regulated (FC (log2)>1.5) in 7/12 pairs (Figure 3D). [score:4]
miR-375 was significantly down-regulated not only in stage II tumors (p = 0.0002 and absolute FC = 4.9) but also in the cohort as a whole combining tumors of different stages (p = 0.0002 and absolute FC = 4.5). [score:4]
Recently, miR-375 was also shown to play a role in cell cycle regulation through the inhibition of G1/S transition in HCT116 cells [54]. [score:4]
The mechanism behind miR-375 down-regulation has been studied in several cancers. [score:4]
In addition to the results of the present study, down-regulation of miR-375 has been demonstrated in several types of cancer including CRC [35], [40], [49]– [51]. [score:4]
At present, YWHAZ, JAK2, PDK1 and YAP1 have been identified as cancer relevant direct miR-375 targets in human gastric, esophageal and liver cancer usings [37], [49], [50], [52], [55]. [score:4]
Methylation analysis in melanoma and esophageal cancer later confirmed that methylation played a role in miR-375 down-regulation not only in cell lines but also in tissue samples [37], [40], [42]. [score:4]
We showed that methylation of miR-375 is not a common mechanism behind miR-375 down-regulation in CRC. [score:4]
Finally, lymphoid-specific helicase (HELLS) and nucleolar and coiled-body phosphor protein 1 (NOLC1) were identified as down-stream targets of miR-375 potentially playing a role in cell cycle regulating pathways. [score:4]
* indicate the pairs of clinical samples with significant miR-375 down-regulation (FC [(log2)]>1.5). [score:4]
Validation of miR-375 down-regulation in clinical samples. [score:4]
Hence our data do not support the hypothesis that miR-375 expression is directly modulated by chromatin-bound β-catenin/TCF4 complexes. [score:4]
YAP1 knock-down affects the expression BIRC5 and BCL2L1 and mimics the phenotypes induced by miR-375. [score:4]
To validate the identified phenotypes, the miRNAs that were down-regulated in clinical samples and Top-40 ranked in the phenotype screen (miR-150, miR-375, miR23b, miR-138, miR-139-5p and miR-9) were subjected to detailed functional analysis using HCT116, HT29, LS174T TR4, DLD1 TR7 and SW480 colon cancer cell lines. [score:4]
The Ago2-IP analysis provided strong evidence that YAP1 is indeed a direct miR-375 target in CRC cells. [score:4]
The down-regulation of miR-375 in stage II CRC observed in the present study was confirmed in an independent cohort (cohort 2) of 25 normal colon mucosa samples and 63 primary CRCs of different stages (stage I–IV, T2-4, N0-3, M0/1) (Figures S5A and B). [score:4]
MIR-375 methylation analysis in CRC cell lines and clinical CRC samplesmiR-375 is an intergenic miRNA and is associated with a CpG island indicating that this miRNA may be down-regulated by epigenetic silencing. [score:4]
Previous studies have shown that miR-375 is indeed down-regulated due to hypermethylation in esophageal and breast cancer [37]– [40]. [score:4]
We cannot rule out that methylation of other CpG sites than the ones addressed in the present study are important for miR-375 down-regulation in CRC, however, previous methylation analysis of MiR-375 has demonstrated homogenous methylation throughout the analyzed genomic regions, making this unlikely. [score:4]
indicated that YAP1 is a direct miR-375 target in CRC. [score:4]
To add evidence for the direct interaction of miR-375 and YAP1 in CRC cells, we performed (Ago2-IP) using lysates from miR-375 and Scr transfected HCT116 cells followed by YAP1 expression analysis of immunoprecipitated RNA. [score:4]
These results indicate that miR-375 may act as an upstream regulator of BIRC5 and BCL2L1 through the targeting of YAP1. [score:4]
These results indicate that epigenetic silencing of MIR-375 is not the general mechanism of miR-375 down-regulation in CRC. [score:4]
miR-375 is an intergenic miRNA and is associated with a CpG island indicating that this miRNA may be down-regulated by epigenetic silencing. [score:4]
Finally, miR-375, miR-138 and miR-9 were selected for further analysis due to their down-regulation in clinical samples and their ability to induced phenotypic changes in vitro. [score:4]
YAP1 has previously been shown to be a direct miR-375 target in liver cells using a [49]. [score:4]
In the present study, only YAP1 demonstrated an inverse correlation with the expression of miR-375 both in vitro and in clinical CRC samples. [score:3]
The generation of stable HCT116 cells with inducible expression of miR-375 is described in detail in the Supplementary Material (Methods S1). [score:3]
miR-375 has also been shown to inhibit G1/S transition in HCT116 [54]. [score:3]
To gain insight into the over-all biological changes introduced by the ectopic expression of miR-375, the most effected transcripts (p-value<0.05, FC [(log2)]<−1.0 or >1.0 (206 genes) or FC [(log2)]<−0.5 or >0.5 (1236 genes)) were analyzed using the Ingenuity Pathway analysis (IPA) software. [score:3]
Identification of biological relevant miR-375 targets using clinical CRC samples. [score:3]
Figure S7 Ingenuity pathway analysis of genes affected by miR-375 over -expression. [score:3]
Whereas in the adenocarcinoma miR-375 was expressed at comparable levels in epithelial and stromal cells (p = 0.27). [score:3]
On the contrary, miR-375 was not differentially expressed between the tumors of different stages. [score:3]
In order to elucidate the mechanism behind the induction of apoptotic death by miR-375 we set out to identify miR-375 targets. [score:3]
In conclusion, reduced expression of HELLS and NOLC1 only partly mimic the phenotypes induced by miR-375 10.1371/journal. [score:3]
The tRFP fluorescence marker was used as a surrogate to sort for cell populations expressing the highest level miR-375 after induction of dox. [score:3]
In order to obtain a pool of cells with a more uniform expression of tRFP, and thus miR-375, upon dox induction, we applied FACS sorting. [score:3]
In conclusion, reduced expression of HELLS and NOLC1 only partly mimic the phenotypes induced by miR-375 10.1371/journal. [score:3]
The expression of miR-375 in the input and IP fractions is shown in Figures S8A (input) and B (IP). [score:3]
Dox dependent expression of mature miR-375 in the HCT116_miR-375H cells was analyzed using RT-qPCR as describe earlier. [score:3]
Initially, we analyzed the expression of mature miR-375 in HCT116 transfected with a miR-375 mimic at different time points post transfection (Figure 4A). [score:3]
These analyses showed that in normal colon mucosa miR-375 was expressed at a higher level in the epithelial cells than in stromal cells (p = 0.02) (Figure 2E). [score:3]
Most strikingly, YAP1 was found to be negatively correlated to miR-375 in CRC tissue samples indicating that targeting of YAP1 by miR-375 is also relevant for the tumorigenesis of colorectal cancer (Table 3 and Table S7 in File S1). [score:3]
To induce expression of miR-375, dox (Vibradox Sandoz)(0,2 mg/ml) was added to the drinking water of the mice in group A, when the tumors reached a size of approximately 50 mm [3]. [score:3]
Further functional studies indicated that the pro-apoptotic role of miR-375 most likely is mediated by YAP1 and its anti-apoptotic down-stream targets BIRC5 and BCL2L. [score:3]
In accordance with the in vitro results, the results of the in vivo analysis clearly indicate that miR-375 expression reduces tumor growth (Figure 7F). [score:3]
Of these, 18 genes were significantly up-regulated in CRC compared to normal mucosa and showed a negative correlation to miR-375 (Pearson≤−0.6) (Table S7 in File S1). [score:3]
Identification of miR-375 targets using transcription profiling. [score:3]
Expression of miR-375 in laser capture microdissected colorectal cancer tissue. [score:3]
In the present study, we identified several genes related to cell cycle progression among the clinically relevant putative miR-375 targets, including HELLS and NOLC1. [score:3]
These results indicate that HELLS and NOLC1are probably downstream targets in the cellular pathways affected by miR-375. [score:3]
These analyses showed that YAP1 is enriched in immunoprecipitates from miR-375 transfected cells compared to Scr transfected cells in an Ago2 dependent manner, thus providing strong evidence that YAP1 is indeed a direct miR-375 target in CRC cells. [score:3]
The ectopic expression of miR-375, miR-9 and miR-138 significantly reduced the viability of more than one cell line (MTT reduction >20% and p≤0.05) (Figure 2A (HCT116) and Figure S2), possible due to a general anti-proliferative or pro-apoptotic role of these miRNAs. [score:3]
Correlation analysis of both in vitro mo del systems and clinical CRC samples revealed that expression of Yes -associated protein 1 (YAP1) was negatively correlated to miR-375. [score:3]
Characterization of stable HCT116 with inducible miR-375 expression and in vivo tumor growthTo analyze the effect of miR-375 on tumor growth in vivo HCT116 cells stably transfected with a polycistronic dox-inducible expression cassette, producing both tRFP and miR-375, was generated. [score:3]
To analyze the effect of miR-375 on tumor growth in vivo HCT116 cells stably transfected with a polycistronic dox-inducible expression cassette, producing both tRFP and miR-375, was generated. [score:3]
All together, the above results strongly indicate that miR-375 has the ability to suppress tumor growth through the induction of apoptosis. [score:3]
To study the effect of miR-375 on tumor growth in vivo HCT116 cells stably transfected with an inducible miR-375 expression-cassette were used to generate mouse xenograft tumors. [score:3]
The location and number of miR-375 seed sequences (i. e. complementary to the position 2–8 of the miRNA) within the full length mRNA sequence were mapped using sequence data retrieved from TargetScan v5.2 and Ensembl 62 databases [26], [27]. [score:3]
Knock-down of HELLS and NOLC1 partly mimic the phenotype induce by miR-375. [score:2]
Compared to untreated HCT116_miR375H cells dox treated cells induced an eighteen-fold increase in miR-375 expression level. [score:2]
Next we analyzed whether knock-down of HELLS and NOLC1 could reduce the viability of HCT116 and induce a pro-apoptotic phenotype, thus mimicking the phenotype induced by miR-375. [score:2]
Mo del of the role of miR-375 in the regulation of apoptotic death. [score:2]
A previous study, has suggested a direct link between β-catenin activation and miR-375 repression in hepatocellular tumors [43]. [score:2]
Regulation of miR-375 by β-catenin/TCF4 activity. [score:2]
Alternatively, it has been suggested that miR-375 might be regulated negatively by the Wnt pathway [25], [43]. [score:2]
Additionally, knockdown of YAP1 using siRNAs mimicked the apoptotic phenotype induced by miR-375. [score:2]
Furthermore both BIRC5 and BCL2L1 were negatively correlated to miR-375 in clinical samples (Pearson = −0.6). [score:1]
In the present study, miR-375 was shown to reduce viability and to induce Caspase 3/7 dependent apoptotic death in CRC cell lines. [score:1]
Selected fragments of the 3′UTRs of HELLS (NM_018063) and NOLC1 (NM_004741) containing putative miR-375 binding sites were amplified from normal human genomic DNA and cloned downstream of the Renilla Luciferase gene in the siCHECK-2 vector (Promega, Fitchburg, WI, USA). [score:1]
The Relative expression of miR-375 was measured using RT-qPCR. [score:1]
The miR-375 expression was measured in triplicates and normalized to miR-340. [score:1]
Methylation of MIR-375 in CRC cell lines and clinical samples using Infinium HumanMethylation450 BeadChips. [score:1]
Next we analyzed whether the silencing of YAP1could reduce the viability of HCT116 cells through induction of apoptosis thus mimicking the phenotype induced by miR-375. [score:1]
using HELLS and NOLC1 3′UTRs and a miR-375 mimic demonstrated no binding of miR-375 to the wt 3′UTR of HELLS and NOLC1 (data not shown). [score:1]
Originally, MIR-375 hypermethylation was reported in cell lines originating from breast and gastric cancer [38], [52]. [score:1]
To address the functional role of miR-375, we and others have carried out in vitro phenotype analyses. [score:1]
We identified two TCF4 sites within 80–90 kb of the miR-375 hairpin and analyzed the binding of TCF4 to both sites using a chromatin immunoprecipitation (ChIP) approach with polyclonal TCF4 antibody in DLD1 TR7 cells (Figure S6). [score:1]
Although, we did find that TCF4 bound to the MYC enhancer region, we did not detect any TCF4 binding at the MIR-375 locus. [score:1]
Detection of miR-375, miR-138 and miR-9 in laser microdissected colorectal tissue. [score:1]
We specifically look at the methylation level of 11 CpG sites situated in close vicinity to the pri-miR-375 transcription start site [41]. [score:1]
These data encouraged us to study the methylation of MIR-375 in CRC cell lines and clinical CRC tissue samples using Infinium HumanMethylation450 BeadChips. [score:1]
Biological functions significantly associated with altered intracellular levels of miR-375 in HCT116 cells 48 h post transfection. [score:1]
Figure S8 from cell lysates of miR-375 or Scr transfected cells. [score:1]
Among the remaining miRNAs, miR-375 was identified as an apoptosis inducing miRNAs in the high-throughput screen. [score:1]
CpG sites in close proximity to MIR-375 (CpG1-11) were analyzed. [score:1]
0096767.g004 Figure 4(A) Reconstitution of mature miR-375 upon transfection with pre-miR-375 or Scr (RT-qPCR). [score:1]
The IDs of the CpG sites in close proximity to MIR-375 were as follows CpG1; cg00215432, CpG2; cg00218620, CpG3; cg00705280, CpG4; cg02257674, CpG5; cg04348419, CpG6; cg06214770, CpG7; cg14358282, CpG8; cg21615583, CpG9; cg22306928, CpG10; cg01822124 and CpG11; cg26394220. [score:1]
Among them miR-375 was selected for further in vitro and in vivo analyses, which confirmed that miR-375 reduces tumor growth through the induction of apoptotic death. [score:1]
0096767.g003 Figure 3Methylation of MIR-375 in CRC cell lines and clinical samples using Infinium HumanMethylation450 BeadChips. [score:1]
To elucidate the cellular origin of miR-375, miR-138 and miR-9, we measured their expression in laser captured microdissected colorectal adenocarcinomas and adjacent normal colon mucosa (Figure 2E and Figure S4). [score:1]
The reduction of cellular viability by miR-375 has previously been shown in cell lines from several cancers, [40], [49], [50], [52], [54] whereas the apoptotic phenotype has been demonstrated in cells from gastric and esophageal cancer [37], [52]. [score:1]
A 1∶1 ratio of the lysates from miR-375 and Scr transfected cells was used for FLAG immunoprecipitation. [score:1]
To investigate whether the miR-375 induced repression of HELLS and NOLC1 play a role in the phenotype induced by miR-375, we specifically silenced these mRNAs in HCT116 cells using two independent siRNAs to each target. [score:1]
Figure S6 Association of TCF4 with chromatin in the genomic region of miR-375 using ChIP followed by qPCR. [score:1]
MIR-375 methylation analysis in CRC cell lines and clinical CRC samples. [score:1]
Initially, MIR-375 was cloned into the 3′ UTR region of the turbo red fluorescence protein gene (tRFP) of the pSBInducer10 vector (MIR375_pSBInducer10). [score:1]
The phenotype induced by the miR-375 mimic was more pronounced than that induced by the YAP1 siRNAs, probably reflecting that YAP1 only represents one out of a number of critical nodes in the pleiotropic miR-375 network. [score:1]
We selected miR-375 for detailed functional characterization and target identification. [score:1]
Only mRNAs demonstrating p-values<0.05 and log2 ratios <−0.5 or >0.5 (1236 genes) (A) or <−1.0 or >1.0 (206 genes) (B), comparing miR-375 and Scr transfected cells, were included in the analyses. [score:1]
The MIR-375 methylation levels in CRC cell lines and clinical samples. [score:1]
The mRNA profiling of miR-375 transfected HCT116 cells and the clinical samples are described in the Supplementary Material (Methods S1). [score:1]
To study the binding of miR-375 to YAP1 in a physiologically relevant manner we carried out Ago2-IP. [score:1]
0096767.g008 Figure 8 In conclusion, combing high-throughput functional screening with miRNA profiling of CRC tissue samples, we have identified clinically relevant miRNAs in colorectal cancer including miR-375. [score:1]
In CRC MIR-375 promoter methylation has only been demonstrated in the cell line HCT116 [39]. [score:1]
Subsequently, the cells were treated with 50 ug/ml doxycycline (dox) (Sigma) for 48 hours leading to transcriptional activation of the tRFP- MIR375 cassette. [score:1]
Generation and characterization of stable HCT116 cells with inducible miR-375 expression (HCT116-miR-375H). [score:1]
The mice were divided into two groups with 6 animals in each: Group A; miR-375 (+ dox) and Group B; control (− dox). [score:1]
In conclusion, the validation analysis confirmed the anti-proliferative role of miR-9 and miR-138, and the apoptosis inducing capacity of miR-375 as identified in the high-throughput analysis. [score:1]
Generation and characterization of stable HCT116 cells with inducible miR-375 expression. [score:1]
Characterization of stable HCT116 with inducible miR-375 expression and in vivo tumor growth. [score:1]
We therefore asked whether we could detect chromatin occupancy of β-catenin/TCF4 complexes at TCF4 sites in proximity to the miR-375 hairpin. [score:1]
Hypermethylation of MIR-375 has also been demonstrated in melanoma and in the CRC cell line HCT116 cell [39], [40]. [score:1]
[1 to 20 of 162 sentences]
2
[+] score: 487
The overexpression of miR-375 suppressed FZD8 expression in HCT116 cells, whereas the up-regulation of FZD8 inhibited this effect, thus confirming a direct association between miR-375 and FZD8 (Figure 4D). [score:13]
Conversely, the transfection of miR-375 inhibitor in SW620 CRC cells upregulated the expression of TCF4, MMP7 and nuclear β-catenin and downregulated the expression of phosphorylated β-catenin protein. [score:13]
The overexpression of miR-375 suppressed FZD8 expression in CRC cell lines, whereas the up-regulation of FZD8 antagonized the suppressive effect of miR-375, which confirmed a direct interaction between miR-375 and FZD8. [score:13]
We found that FZD8-siRNA significantly reduced the expression of FZD8 protein and subsequently inhibited the levels of TCF4, MMP7 and nuclear β-catenin, whereas it upregulated the expression of phosphorylated β-catenin protein (Figure 5C); these effects recapitulated those of the overexpression of miR-375. [score:12]
Several in vitro and in vivo studies have shown that pancreatic miRNA-375 directly targets PDK1, plays key roles in the glucose regulation of insulin gene expression and β-cell growth and is down-regulated in pancreatic carcinoma [15]. [score:10]
For example, several studies reported that pancreatic miRNA-375, which directly targets PDK1, plays key roles in the glucose regulation of insulin gene expression and β-cell growth and was evidently downregulated in pancreatic carcinoma [14, 15]. [score:10]
Functional assays showed that the down-regulation of FZD8 inhibited HCT116 cell migration and invasion (Figure 5D), which resembled the inhibitory effects of miR-375 overexpression on cells described above. [score:9]
Therefore, we speculated that miR-375 may inhibit Wnt/β-catenin signaling pathway by suppressing its direct target-FZD8 to regulate the metastasis of CRC. [score:9]
Representative images show higher FZD8 expression in human samples expressing low miR-375 levels and lower FZD8 expression in human samples expressing high miR-375 levels. [score:9]
As anticipated, our data showed that the overexpression of miR-375 significantly inhibited the Wnt/β-catenin pathway and downregulated FZD8, which consequently decreased cancer cell invasion and metastasis. [score:8]
F. Altered FZD8 expression in HCT116 cell bearing up-regulated miR-375 in response to FZD8 transfection and the expression of phosphorylated β-catenin, TCF4, MMP7 and nuclear β-catenin protein were analyzed by western blotting. [score:8]
Likewise, PCR and western blot analyses confirmed that the ectopic restoration of miR-375 in HCT116 cells inhibited the expression of FZD8, whereas the knockdown of miR-375 in SW620 cells significantly elevated FZD8 expression (Figure 4C). [score:8]
miR-375 has been suggested to inhibit colorectal cancer growth by targeting the PI3K/Akt signaling pathway [37] and reduce cell viability by targeting YAP1 to induce apoptosis [38]. [score:7]
As shown in Figure 4F, the expression of FZD8 was higher in human tissue samples that expressed low miR-375 levels, whereas FZD8 was low in tissues that expressed high miR-375 levels. [score:7]
Western blot analyses showed that the ectopic restoration of miR-375 downregulated the expression of FZD8 protein. [score:6]
Moreover, the up-regulation of miR-375 suppressed colorectal cancer cell migration and invasion in vitro and reduced tumor metastases in murine mo dels established with both orthotopic implantation and spleen injection. [score:6]
A. Western blot analysis of phosphorylated β-catenin, TCF4, MMP7 and nuclear β-catenin protein expression response to deregulated miR-375 expression in the indicated cells. [score:6]
As expected, a western blot analysis demonstrated that FZD8 reversed the miR-375 -mediated inhibition of TCF4, nuclear β-catenin, and MMP7 and upregulated phosphorylated β-catenin protein (Figure 5F and Supplementary Figure S8). [score:6]
As shown in Figure 1A, miR-375 expression was distinctively downregulated in colorectal cancer tissues relative to their matched NCTs (p<0.0001). [score:6]
We further verified that Frizzled 8 (FZD8) is a direct and functional target of miR-375, and its overexpression is associated with decreased survival in CRC patients. [score:6]
Figure 5 A. Western blot analysis of phosphorylated β-catenin, TCF4, MMP7 and nuclear β-catenin protein expression response to deregulated miR-375 expression in the indicated cells. [score:6]
Moreover, wound-healing assays showed that miR-375 up-regulation inhibited the rate of HCT116 cell migration, whereas miR-375 knockdown increased this rate in SW620 cancer cells (Figure 2D–2E). [score:6]
Up-regulation of miR-375 inhibits CRC metastasis in vivo. [score:6]
For this purpose, we predicted likely targets of miR-375 using bioinformatics and identified FZD8, a member of the Frizzled (FZD) family, as a direct target of miR-375. [score:6]
To establish a cell line that stably expressed ectopic miR-375, miR-375 expression vectors were transfected into HCT-116 cells, and the cells were selected with G418 (400μg/ml) for 3-4 weeks. [score:5]
To further verify that FZD8 is a key factor in the miR-375 -mediated regulation of Wnt/β-catenin pathway, we used specific siRNAs against FZD8 to knockdown FZD8 expression in HCT116 cells. [score:5]
Moreover, we transiently transfected a miR-375 inhibitor into SW620 cells, which expressed relatively high levels of endogenous miR-375 (Supplementary Figure S2). [score:5]
Using target gene prediction and signal pathway analyses, we previously identified FZD8 as a likely target of miR-375 in CRC [17]. [score:5]
Because FZD8 is a key receptor for the initiation of Wnt/β-catenin signaling pathway [18], which is well known for its role in the development and promotion of cancer metastasis, we investigated the ability of miR-375 to regulate Wnt/β-catenin signaling by inhibiting FZD8 expression. [score:5]
We first confirmed that up -regulating miR-375 in vitro suppressed CRC cell migration and invasion, whereas miR-375 knockdown in colorectal cancer cells promoted their migration and invasion. [score:5]
Accordingly, the restoration of FZD8 expression neutralized the inhibition of Wnt/β-catenin signaling by miR-375. [score:5]
Taken together, our data show that miR-375 functions as an important tumor suppressor in CRC by suppressing tumorigenesis and metastatic colonization. [score:5]
These results indicate that miR-375 is a key inhibitor that suppresses CRC tumor cell growth and metastasis in vivo. [score:5]
Recently, Dai et al reported that miR-375 expression is frequently down-regulated in colorectal cancer tissues compared with the non-tumor counterparts [36]. [score:5]
Whereas miR-375 expression was low, FZD8 expression was drastically elevated in CRC patients, in liver and lymph nodes metastases. [score:5]
A transwell assay showed that miR-375 up-regulation drastically suppressed the invasiveness and migration of HCT116 CRC cells (Figure 2B). [score:5]
Therefore, we selected HCT116, which expressed the lowest levels of miR-375, to stably over-express miR-375 by plasmid transfection. [score:5]
Specifically, miR-375 expression was markedly downregulated in cancer tissues compared with their corresponding NCTs. [score:5]
B. CRC patients with vessel emboli (n=41) expressed lower levels of miR-375 than patients without vessel emboli (n=49) (** p=0.004), indicating that miR-375 expression may inversely correlate with the metastatic potential of CRC patients. [score:5]
However, the contribution of this down-regulation to the development and progression of CRC remains unknown, and the related mechanisms and functions of miR-375 in CRC are yet to be determined. [score:5]
Specifically, miR-375 expression was lowest in HCT116 cells, whereas SW620 cells expressed relatively high levels of miR-375 (* p<0.05). [score:5]
We observed that the expression of miR-375 was inversely associated with FZD8 expression in 33 CRC patients (p=0.006, r=−0.53, Figure 4E). [score:5]
However, the molecular mechanisms related to the downregulation of miR-375 in CRC have not been fully studied. [score:4]
We found that miR-375 was not only markedly downregulated in human CRC tissues but could also predict the metastatic potential of CRC patients. [score:4]
FZD8 is a direct target of miR-375 and is associated with poor prognosis in CRC patients. [score:4]
As expected, miR-375 overexpression and FZD8-siRNA decreased the transactivating activity of β-catenin in HCT116 cells, whereas miR-375 inhibitor increased the transactivating activity of β-catenin in SW620 cells, as determined by a β-catenin reporter assay (Figure 5E). [score:4]
miR-375 may function as an important negative regulator of the Wnt/β-catenin pathway by targeting FZD8. [score:4]
Collectively, these findings suggest that FZD8 is an essential functional mediator of miR-375-repressed cell migration and invasion and that miR-375 regulates the Wnt/β-catenin pathway by targeting FZD8 in CRC. [score:4]
The successful up-regulation of mature miR-375 was confirmed by qRT-PCR (Supplementary Figure S1). [score:4]
G. The migration and invasiveness of HCT116 cell bearing up-regulated miR-375 were analyzed after FZD8 transfection. [score:4]
In HCT116 cells, the overexpression of miR-375 inhibited the migration rate of cells at 24, 48 and 72 hours compared with the control cells, which were transfected with miR-NC vector (p=0.040,0.005 and 0.008, respectively). [score:4]
The overexpression of miR-375 markedly suppressed the invasiveness and migration of HCT116 cells compared with the control group (vs. [score:4]
As shown in Figure 5A, the levels of TCF4, MMP7 and nuclear β-catenin were downregulated by the ectopic restoration of miR-375 in HCT116 CRC cells. [score:4]
The down-regulation of miR-375 significantly increased cell migration and invasion (vs. [score:4]
Among these miRNAs, miR-375 has recently been documented to be downregulated in various types of cancers. [score:4]
We and other groups have found that the down-regulation of miR-375 is pronounced in the plasma and cancer tissues of colorectal cancer patients [16, 17]. [score:4]
C. PCR analyses showed that the ectopic restoration of miR-375 downregulated the mRNA levels of FZD8. [score:4]
Our findings provide novel insights into the functions and clinical relevance of miR-375 in CRC and suggest that miR-375 and FZD8 may be used as novel prognostic markers and potential therapeutic targets in clinical practice. [score:3]
Furthermore, we observed that miR-375 expression in CRC was not associated with gender, age, differentiation, stage, metastases or perineural invasion (all p>0.05) but correlated well with vessel embolus (p=0.004, Supplementary Table S1). [score:3]
We suggest that miR-375 may be clinically useful for developing a new prognostic biomarker and therapeutic target for CRC metastasis. [score:3]
As demonstrated in Figure 2C, the inhibition of miR-375 significantly increased cancer cell migration and invasion. [score:3]
Figure 2 A. Real-time PCR analysis of the relative expression levels of miR-375 in four CRC cell lines (HCT116, HCT29, SW480, and SW620) and noncancerous tissues (NCTs). [score:3]
In contrast, the median level of miR-375 in patients without vessel embolus was 0.3, whereas the median level in patients with vessel embolus was 0.1, suggesting that patients expressing low levels of miR-375 were more likely to develop a vessel embolus (Figure 1B, p=0.004). [score:3]
Considering the canonical role of the Wnt/β-catenin pathway in tumorigenesis and metastases and because FZD8 is an upstream receptor in the canonical Wnt/β-catenin signaling pathway [21], we hypothesized that miR-375 similarly inhibits the Wnt/β-catenin pathway. [score:3]
We also demonstrated that the level of miR-375 was significantly decreased in the plasma of CRC patients and correlated well with the expression observed in tissue samples, suggesting that miR-375 may serve an alternative biomarker of minimally invasive CRC [17]. [score:3]
E. An inverse correlation was observed between FZD8 and miR-375 expression in CRC patients. [score:3]
Figure 4 A. Schematic of the human FZD8 3′-UTR luciferase constructs containing wild-type and mutant (FZD8 3′-UTR) miR-375 target sequences. [score:3]
D. Changes in FZD8 expression in HCT116 cell bearing miR-375 in response to FZD8 transfection were analyzed by western blotting. [score:3]
miR-375 suppresses CRC cell migration and invasion in vitro. [score:3]
The nuclear translocation of β-catenin was also activated in the miR-375 inhibitor group. [score:3]
Our results showed that the overexpression of miR-375 diminished the number of liver metastases in both mo dels. [score:3]
A. Schematic of the human FZD8 3′-UTR luciferase constructs containing wild-type and mutant (FZD8 3′-UTR) miR-375 target sequences. [score:3]
Likewise, immunofluorescence staining showed that the overexpression of miR-375 reduced the nuclear accumulation of β-catenin in HCT116 CRC cells, which is an important feature of the activation of Wnt/β-catenin signaling (Figure 5B). [score:3]
Additionally, miR-375 was negatively associated with the FZD8 expression levels in human CRC tissues. [score:3]
Strikingly, the reductions in CRC cell migration, invasion and TCF/LEF transcriptional activity caused by miR-375 overexpression were effectively reversed by FZD8 (Figure 5G–5H). [score:3]
To further validate that miR-375 suppresses CRC metastasis, as described above, we established an orthotopic implantation murine mo del to represent tumor growth and metastasis. [score:3]
We injected HCT116 cells stably expressing miR-375 or miR-NC vector into the spleens of 6-week-old male BALB/C nude mice. [score:3]
Briefly, HCT116 cells stably expressing miR-375 or miR-NC vector (miR -negative control vector) were subcutaneously injected into 6-week-old male BALB/C nude mice. [score:3]
Low miR-375 expression predicts metastatic potential in human colorectal cancer (CRC) patients. [score:3]
A. Real-time PCR analysis of the relative expression levels of miR-375 in four CRC cell lines (HCT116, HCT29, SW480, and SW620) and noncancerous tissues (NCTs). [score:3]
Notably, our extensive analysis of clinical samples showed that low miR-375 expression was not only prominent in the tissues of CRC patients but also associated with metastatic. [score:3]
The average expression levels of miR-375 were normalized using U6 as a reference gene, and the 2 [−Δct] method was subsequently applied. [score:3]
miR-375 modulates the Wnt/β-catenin pathway by targeting FZD8. [score:3]
The miR-375 expression plasmid was generated by cloning the genomic pre-miR-375 gene, flanked by a 300-nt-sequence on each side, into OriGene's pCMV6-Mir Vector to generate the plasmid pCMV-miR-375. [score:3]
In the current study, we, for the first time, identified miR-375 as a novel metastasis inhibitor of CRC with clinical relevance. [score:3]
To this end, we searched for a correlation between the miR-375 levels and the expression of FZD8 in human CRC tissues. [score:3]
Furthermore, to test the impact of miR-375 on the survival of mice bearing tumors, we injected HCT116 cells stably expressing miR-375 or miR-NC vector into 2 groups of 6-week-old male NOD/SCID mice. [score:3]
The 2 [−ΔΔct] method was used to express the level of miR-375 in CRC tissues and matched normal mucosa samples. [score:3]
Taken together, these results suggest that miR-375 is inversely associated with FZD8, whose expression might serve as predictor of poor survival among human CRC patients. [score:3]
Low expression of miR-375 predicts the metastatic potential of human colorectal cancer. [score:3]
Compared with the miR-NC group, the number of total metastases, tumor volume and disease severity were lower in the miR-375 group (2 liver metastases for the miR-375 group vs. [score:2]
Collectively, these results suggest that miR-375 is a negative regulator of CRC metastasis. [score:2]
Collectively, these in vitro and in vivo results suggest that miR-375 plays an anti-metastatic role in CRC, which provides new insights into the functions of miR-375 in the development and progression of CRC. [score:2]
E. In SW620 cells, knocking down miR-375 increased the migration rate at various time points (vs. [score:2]
Among the samples from 90 colorectal cancer patients, 61 cases(67.7%) exhibited a >50% reduction in miR-375 expression compared with their NCTs. [score:2]
B. HCT116 cells were co -transfected with the luciferase constructs and miR-375. [score:1]
no metastases for the miR-375 group) (Figure 3B). [score:1]
Figure 3 A. Photographs of xenograft formation in mice implanted withHCT116 cells containing miR-375 or miR-NC vector. [score:1]
After 3 months, we observed that the miR-375 group exhibited a tendency for longer survival than the miR-NC group (Figure G). [score:1]
Figure 1 A. miR-375 expression was measured in 90 paired human CRC and adjacent noncancerous tissues (NCTs) by quantitative reverse transcription polymerase chain reaction (qRT-PCR). [score:1]
Because vessel emboli have been associated with an increased incidence of tumor metastasis (especially liver metastasis for CRC) and an overall decrease in the survival rate [19– 20], we investigated the relationship between low miR-375 expression and CRC metastasis. [score:1]
G. Six-week-old male NOD/SCID mice were subcutaneously injected with HCT116 cells stably expressing the miR-375 or miR-NC vector, and the survival rates of the two groups of mice were calculated. [score:1]
A. Photographs of xenograft formation in mice implanted withHCT116 cells containing miR-375 or miR-NC vector. [score:1]
However, possible other functions of miR-375 have not yet been identified. [score:1]
More importantly, orthotopically implanted miR-375 HCT116 cells gave rise to fewer liver metastases than orthotopically implanted miR-NC cells (2 liver metastases for the miR-NC group vs. [score:1]
Additionally, we performed a rescue experiment by co-transfecting HCT116 cells with miR-375 and FZD8. [score:1]
A. miR-375 expression was measured in 90 paired human CRC and adjacent noncancerous tissues (NCTs) by quantitative reverse transcription polymerase chain reaction (qRT-PCR). [score:1]
Finally, HCT116 cells stably expressing miR-375 or miR-NC were subcutaneously injected into 2 groups of 6-week-old NOD/SCID mice to investigate the association between miR-375 and the survival of nude mice. [score:1]
The correlation between miR-375 and FZD8 was determined with linear regression lines, and the significance was assessed with a Spearman correlation (p=0.006). [score:1]
Double-stranded oligonucleotides containing the wild-type (wt-3′UTR) or mutant (mt-3′UTR) miR-375 binding sites in the FZD8 3′ UTR were synthesized. [score:1]
The miR-NC mice displayed prominent liver metastases, peritoneal metastases and ascites, whereas significant liver metastases, peritoneal metastases or ascites were not observed in the miR-375 group (Supplementary Figure S3-4, Supplementary Table S2). [score:1]
The miR-375 group did not exhibit significant metastases, whereas the miR-NC group showed higher metastatic potential at various sites, including the lung, liver and peritoneum (no metastases for the miR-375 group vs. [score:1]
Anti-miR-375, a nonspecific anti-miR-375 control, FZD8 siRNA oligonucleotides, and the control siRNA oligonucleotides were purchased from Riobio(Guangzhou, China) and transfected at a concentration of 100nmol/l using riboFECT CP Reagent (Guangzhou, China). [score:1]
Next, we established another murine liver tumor metastasis mo del via spleen injection, which mimics the colonization and outgrowth phases of the tumor metastatic cascade, to further validate the role of miR-375 in CRC metastases. [score:1]
The identified link between miR-375 and FZD8 in CRC cell lines led us to attempt to recapitulate this relationship in human CRC. [score:1]
Two liver metastases were found in the miR-NC group, but no metastases were found in the in miR-375 group. [score:1]
Indeed, miR-375 was previously found to be restricted only to pancreatic islets, but it has since been revealed to have important functions in tumorigenesis [14, 35]. [score:1]
HCT116 CRC cells were co -transfected with the luciferase reporter vectors and the miR-375 or control vector in 24-well plates using Lipofectamine 2000 transfection reagent (Invitrogen). [score:1]
The metastasis rate in the miR-375 group was 33.3%, whereas it was 66.7% in the miR-NC group. [score:1]
On average, the miR-375 levels were decreased 2- to 3-fold in human colorectal cancer tissues relative to their NCTs. [score:1]
Survival tended to be longer in the miR-375 group than in the control group. [score:1]
In summary, the results presented herein show that miR-375 exerts anti-metastatic effects during the progression of CRC. [score:1]
In contrast, miR-375 did not decrease the luciferase activity of a mutant construct (Figure 4B). [score:1]
Additionally, we adopted two murine metastasis mo dels to deeply explore the role of miR-375 in the metastasis of CRC. [score:1]
B. The migration and invasiveness of HCT116 cells were analyzed after transfection with miR-375. [score:1]
We examined the miR-375 levels in all 90 pairs of human colorectal cancer tissues and their corresponding noncancerous tissues (NCTs) by qRT-PCR. [score:1]
C. The migration and invasiveness of SW620 cells after transfection with miR-375 inhibitor were also investigated. [score:1]
[1 to 20 of 127 sentences]
3
[+] score: 415
The results from this study suggest that docetaxel may further upregulate miR-375 expression during chemotherapy and confer chemo-resistance by inhibiting expression of SEC23A and YAP1. [score:10]
Previous studies showed that miR-375 is down-regulated in many types of cancer [15], and therefore, miR-375 is believed to act as a critical tumor suppressor by targeting important oncogenes, and modulating cancer-related processes such as cell proliferation, apoptosis, invasion and migration, metastasis and autophagy [15, 19– 22]. [score:8]
Potentially, overexpression of miR-375 in PC cells directly inhibits production of SEC23A, which prevents the secretion of metastasis-suppressive proteins, thus enabling the metastatic spread and colonization of the cancer cells. [score:8]
To further study the impact of docetaxel chemotherapy on the expression of miR-375 in PC cells, we then treated DU145 and PC-3 cells with docetaxel in different concentrations (1 nM, 2.5 nM, and 5 nM) for 72 h. qRT-PCR analysis showed that miR-375 expression was significantly upregulated after docetaxel treatments (Fig.   1b). [score:8]
miR-375 regulates SEC23A and YAP1 expressionmiR-375 has been shown to target YAP1 in lung cancer cells [18] and also SEC23A at its 3′-UTR in PC cell lines to regulate cell growth [16]. [score:7]
In addition, we examined expression levels of the two miR-375 target genes (SEC23A and YAP1) and observed significant reduction in the expression at both protein and mRNA levels in miR-375 transfected prostate cancer cell lines. [score:7]
Although upregulated in primary PC, miR-375 is significantly downregulated in multiple other tumors [15, 16]. [score:7]
a qRT-PCR analysis showed that YAP1 and SEC23A expressions were downregulated after miR-375 transfection in PC-3 cells. [score:6]
However, miR-375 is also reported to be upregulated in some cancer types including PC [15] and higher expression of miR-375 is associated with PC stage and lymph node metastasis [23]. [score:6]
Our data showed docetaxel -associated progressive upregulation of miR-375 expression in both DU145 and PC-3 cells. [score:6]
miR-375 expression was upregulated during treatment and gradually reduced after removal of docetaxel. [score:6]
A recent study shows that SEC23A is a novel target of miR-375 and is significantly downregulated in PC cells and tissues [31]. [score:6]
This study further confirms that miR-375 is not only an important candidate biomarker for clinical outcome prediction but also a key target for future therapeutic drug development with or without targeting SEC23A and YAP1 activity. [score:6]
ds showed suppression of YAP1 and SEC23A proteins in xenograft tumors overexpressing miR-375. [score:5]
Ectopical expression of miR-375 significantly reduced the YAP1 expression of these cell lines both in mRNA and protein level. [score:5]
We then performed a correlation analysis between the expression levels of miR-375 and its two target genes. [score:5]
This conflicting result demonstrates that under the condition of docetaxel treatment the anti-apoptotic effect of miR-375 overexpression overshadows its growth inhibition. [score:5]
Our results suggest that miR-375 or its target genes, SEC23A or YAP1, might serve as potential predictive biomarkers to docetaxel -based chemotherapy and/or therapeutic targets to overcome chemo-resistance in mCRPC stage. [score:5]
Because miR-375 level keeps increase (in PC-3 cells) or remain unchanged (in DU145) for several days after docetaxel removal, this docetaxel -induced miR-375 upregulation was more likely to be an indirect effect. [score:5]
While miR-375 overexpression caused cell growth inhibition and cell apoptosis, elevated miR-375 also significantly reduced cell sensitivity to docetaxel treatment in vitro, as evidenced by decreased apoptotic cells. [score:5]
To examine the role of miR-375 in docetaxel resistance, we transfected miR-375 using a pre-miRNA lentiviral vector and examined the effects of exogenously overexpressed miR-375 on cell growth in two prostate cancer cell lines, DU145 and PC-3. To determine the effect of overexpressed miR-375 on tumor growth and chemo-resistance in vivo, we injected prostate cancer cells overexpressing miR-375 into nude mice subcutaneously and evaluated tumor growth rate during docetaxel treatment. [score:5]
Fig. 5Inverse relationship of expression levels between miR-375 and its target genes (YAP1 and SEC23A) in TCGA dataset. [score:5]
d Negative correlation of miR-375 with YAP1 expression (Pearson’s correlation r = −0.56 P < 0.0001) We previously reported a significant association of elevated plasma miR-375 expression with poor overall survival in mCRPC stage. [score:5]
Fig. 4Expression of miR-375 and its target genes (YAP1 and SEC23A) in PC cells or xenograft tumors. [score:5]
However, this finding is contradictory with other report showing tumor suppressor activity of miR-375 in multiple tumor types by targeting key oncogenes [15]. [score:5]
miR-375 is involved in development of chemo-resistance to docetaxel through regulating SEC23A and YAP1 expression. [score:5]
c qRT-PCR analysis showed that YAP1 and SEC23A expression levels were lower in xenografts overexpressing miR-375. [score:5]
The result shows dose -dependent upregulation of miR-375. [score:4]
miR-375 is upregulated in tumor tissues and is induced by docetaxel in PC cell lines. [score:4]
Knockdown of YAP1 phenocopied miR-375 overexpression. [score:4]
In this study, we examined the influence of docetaxel on miR-375 expression and its target genes using in vitro and in vivo assays. [score:4]
miR-375 has been shown to target YAP1 in lung cancer cells [18] and also SEC23A at its 3′-UTR in PC cell lines to regulate cell growth [16]. [score:4]
β-actin served as a loading control to normalize protein signal intensity miR-375 expression is inversely correlated with SEC23A and YAP1 in PC tissuesTo evaluate if miR-375 may target SEC23A and YAP1 in patient-derived PC tissues, we first compared SEC23A and YAP1 expression levels between PC tissues and normal prostate tissues in TCGA data. [score:4]
Overexpression of miR-375 by transfection with 200 nM miR-375 mimic inhibited cell growth when compared to miRNA negative control in PC-3 and DU145 cells at 72 h after transfection. [score:4]
Lastly, we utilized qRT-PCR and assay to examine two miR-375 target genes, SEC23A and YAP1, for their expression changes after miR-375 transfection. [score:4]
Moreover, miR-375 overexpression in PC xenograft tumors following lentivirus transfection contributed to development of resistance to docetaxel treatment. [score:4]
miR-375 regulates SEC23A and YAP1 expression. [score:4]
Finally, our data demonstrated that miR-375 may confer chemoresistance through reducing the levels of its target genes SEC23A and YAP1. [score:3]
c Negative correlation of miR-375 with SEC23A expression (Pearson’s correlation r = −0.62, P < 0.0001). [score:3]
These data indicate that the inhibitory effects of miR-375 on SEC23A and YAP1 are also relevant in clinical samples in PC patients. [score:3]
Under docetaxel (DTX) treatment, less apoptotic cells were observed in miR-375 overexpressed xenograft tumors than miR-375 vector controls To further evaluate the potential effect of miR-375 expression on death in vivo, we tested the presence of active caspase-3 by immunohistochemistry in xenograft tumors. [score:3]
To investigate whether miR-375 directly regulates YAP1 or SEC23A expression, we transfected PC cell lines with a miR-375 mimic for 48 h, and evaluated the SEC23A and YAP1 mRNA expression by qRT-PCR. [score:3]
Normalized miR-375 expression levels were downloaded from TCGA. [score:3]
However, miR-375 overexpression tumors treated with docetaxel showed lower levels of caspase-3 positive cells than empty vector tumors treated with docetaxel (10.5 ± 5.16 vs. [score:3]
As shown in Fig.   2a, qRT-PCR analysis confirmed the high level expression of miR-375 after transfection. [score:3]
Clearly, the higher expression of miR-375 is also associated with docetaxel resistance in vivo. [score:3]
The miR-375 expression level reached a peak at day 7 in PC-3 cells, or day 14 in DU145 cells, and gradually declined until day 21 (Fig.   1c). [score:3]
To further investigate a potential role of miR-375 in docetaxel resistance, we performed qRT-PCR and western blot analysis, and confirmed the association of elevated miR-375 with decreased expression of two target genes, SEC23A and YAP1. [score:3]
a Tumor volumes in the docetaxel -treated mice are increased with time, in particular the xenograft tumors overexpressing miR-375. [score:3]
These findings suggest that the expression level of miR-375 in PC is docetaxel -dependent. [score:3]
Both qRT-PCR and analysis showed that miR-375 transfection caused significant reduction of SEC23A and YAP1 mRNA expression (Fig.   4c), and protein (Fig.   4d) in xenograft tumors grown in mice. [score:3]
a Overexpression of miR-375 in PC tissues. [score:3]
Docetaxel treatment induced higher expression of miR-375 with 5.83- and 3.02-fold increases in DU145 and PC-3 cells, respectively. [score:3]
Number on the top of each box plot is mean value of miR-375 expression. [score:3]
c Dynamic expression changes of miR-375 during and after docetaxel treatment. [score:3]
Furthermore,ting of PC-3 cells expressing miR-375 showed a significant reduction in SEC23A and YAP1 protein levels (Fig.   4b). [score:3]
miR-375 expression is inversely correlated with SEC23A and YAP1 in PC tissues. [score:3]
Treatment of the cells with docetaxel at concentrations of 1 and 2.5 nM, induced 5.83- and 14.01-fold increase in miR-375 expression in DU145 cells, respectively, and 3.02- and 2.53- fold increase in PC-3 cells, respectively. [score:3]
We first transfected PC cells with 200 nM miR-375 mimic for 24 h and then treated the cells with docetaxel (50 nM) for another 24 h. Our results showed that ectopic miR-375 expression decreased docetaxel -induced cellular apoptosis. [score:3]
bs showed suppression of YAP1 and SEC23A proteins in the miR-375 -transfected PC-3 cells. [score:3]
miR-375 expression in tissue or circulation has been shown to potentially serve as a biomarker for PC diagnosis or prognosis [12– 14]. [score:3]
b Xenografts with empty control vector were significantly smaller than the miR-375 overexpression group. [score:3]
Cells with miR-375 overexpression is clearly resistant to docetaxel treatment in PC cells. [score:3]
d Negative correlation of miR-375 with YAP1 expression (Pearson’s correlation r = −0.56 P < 0.0001) Docetaxel is a common chemotherapeutic agent used to treat multiple malignancies including mCRPC stage. [score:3]
Surprisingly, the current study demonstrated consistent growth inhibition of elevated miR-375 in PC cell lines. [score:3]
We observed consistently higher tumor volume in tumors with miR-375 overexpression than tumors with empty vector under docetaxel administration, in particular, at day 28 after initiation of docetaxel treatment (Fig.   3a). [score:3]
The immunostaining analysis showed that miR-375 overexpression tumors had significantly higher levels of activated caspase-3 positive cells than empty vector control tumors (11.13 ± 5.64 vs. [score:3]
In the present study, we performed a series of in vitro and in vivo tests and found consistently higher expression levels of miR-375 in PC tissues and docetaxel -treated PC cells. [score:3]
This analysis demonstrated that the levels of SEC23A and YAP1 were inversely correlated with miR-375 expression level (r = −0.62 for SEC23A and −0.56 for YAP1, p < 0.05) (Fig.   5c and d). [score:3]
MicroRNA expression values were rescaled relative to the blank control To evaluate the long term effects of docetaxel on miR-375 expression, DU145 and PC-3 cells were cultured with 1 nM docetaxel. [score:3]
This conflicting result suggests that while high miR-375 causes cell growth arrest the treatment with docetaxel may create an environment that favors cell growth, possibly through inhibiting cell apoptosis. [score:3]
The miRWalk database was used to identify potential targets of miRNA-375. [score:3]
This unexpected growth inhibition seems contradictory to poor overall survival in patients with higher level of miR-375. [score:3]
The predicted miR-375 targets are listed in Additional file 1: Table S1. [score:3]
We observed 8.45-fold increase of miR-375 expression in PC tissues than in normal tissues (Fig.   1a). [score:3]
We previously reported a significant association of elevated plasma miR-375 expression with poor overall survival in mCRPC stage. [score:3]
Under docetaxel (DTX) treatment, less apoptotic cells were observed in miR-375 overexpressed xenograft tumors than miR-375 vector controls To further evaluate the potential effect of miR-375 expression on death in vivo, we tested the presence of active caspase-3 by immunohistochemistry in xenograft tumors. [score:3]
Transfection with miR-375 in PC-3 cells resulted in significant reduction of SEC23A and YAP1 mRNA expression with 31 and 78 % decreases, respectively (Fig.   4a). [score:3]
miR-375 targeted genes. [score:3]
TCGA dataset analysis further confirmed the negative correlations between miR-375 and the two target genes (r = −0.62 and −0.56 for SEC23A and YAP1, respectively; p < 0.0001). [score:3]
Higher miR-375 suppresses cell proliferation in PC cells. [score:3]
a After miR-375 lentivirus transfection, both DU-145 and PC-3 cell lines show stably high level expression. [score:3]
To generate miR-375 stable transfectants, PC cell lines (DU145 and PC-3) were transfected with lentiviral expressing vectors, and stable clones were selected. [score:3]
MicroRNA expression values were rescaled relative to the blank control To evaluate the long term effects of docetaxel on miR-375 expression, DU145 and PC-3 cells were cultured with 1 nM docetaxel. [score:3]
By examining 495 tumor tissues and 52 normal tissues from TCGA data, we found that compared to normal prostate, miR-375 was significantly overexpressed in prostate cancer tissues (8.45-fold increase, p value = 1.98E-23). [score:2]
Therefore, these experimental evidences strongly support that miR-375 induces PC docetaxel resistance by down -regulating SEC23A and YAP1. [score:2]
Our results suggest that miR-375 contributes to the development of chemo-resistance in PC. [score:2]
qRT-PCR assays were used to detect the expression of miR-375 in these stable cell lines. [score:2]
Compared to normal prostate tissues, expression levels of miR-375 in PC tissues are significantly higher. [score:2]
To evaluate the involvement of miR-375 in regulation of docetaxel sensitivity, we stably transfected a miR-375 expression lentivirus and control vector into PC cell lines. [score:2]
β-actin served as a loading control to normalize protein signal intensity To evaluate if miR-375 may target SEC23A and YAP1 in patient-derived PC tissues, we first compared SEC23A and YAP1 expression levels between PC tissues and normal prostate tissues in TCGA data. [score:2]
We first compared miR-375 expression levels between PC tissues and normal prostate tissues in TCGA dataset. [score:2]
Number on the top of each bar plot is mean fold change of miR-375 expression when compared to controls. [score:2]
A recent study in cervical cancer showed that miR-375 is associated with paclitaxel treatment response through regulation of epithelial–mesenchymal transition (EMT), leading to chemo-resistance [17]. [score:2]
This study revealed that ZEB1-miR-375-YAP1 pathway regulates epithelial plasticity in PC. [score:2]
We first compared miR-375 expression level between prostate cancer tissues and normal prostate tissues using data from The Cancer Genome Atlas (TCGA). [score:2]
Since some of these patients in this cohort had also received docetaxel chemotherapy [13] we tested if miR-375 is involved in the development of docetaxel resistance and may have impacted the overall survival. [score:2]
The IC [50] values were increased in PC-3 and DU145 with miR-375 overexpression (60.05 ± 1.63 and 21.55 ± 0.96 nM, respectively) when compared to vector controls (19.98 ± 1.54 and 5.29 ± 0.57 nM, respectively) (PC-3, P = 0.021; DU145, P = 0.033). [score:2]
In vivo xenograft mouse study showed that tumors with increased miR-375 expression were more tolerant to docetaxel treatment, demonstrated by greater tumor weight and less apoptotic cells in miR-375 transfected group when compared to empty vector control group. [score:2]
This study suggests that miR-375 may be involved in the development of chemo-resistance in PC to commonly used anti-cancer drug, docetaxel. [score:2]
In this study, we evaluated if miR-375 induced chemo-resistance to docetaxel through regulating target genes associated with drug resistance. [score:2]
miR-375 is involved in the development of docetaxel resistance in PC cells grown as xenograft tumors in nude mice. [score:2]
Nude mice were inoculated with PC-3 cells transfected miR-375 or control vector to allow tumor development. [score:2]
Selth LA, Das R, Townley SL, Coutinho I, Hanson AR, Centenera MM, Stylianou N, Sweeney K, Soekmadji C, Jovanovic L, et al. A ZEB1-miR-375-YAP1 pathway regulates epithelial plasticity in prostate cancer. [score:2]
Further understanding biological role of miR-375 in PC therapeutics will facilitate discovery of new treatment approaches to improve drug efficacy in the patients with advanced PC. [score:1]
Prostate cancer miR-375 Docetaxel resistance SEC23A YAP1 Prostate cancer (PC) is the most common non-skin cancer and the second leading cause of cancer- related mortality in men, with >220,000 newly diagnosed cases and 27,000 deaths annually in the United States [1]. [score:1]
Interestingly, miR-375 appeared to play a dual role in prostate cancer proliferation. [score:1]
For example, when comparing post- to pre-docetaxel treatment, PE-labeled Annexin V positive cell fraction increased from 3.92 to 15.3 % in control DU145 cells, while decreased from 13.2 to 6.34 % in miR-375 transfected DU145 cells. [score:1]
Elevated miR-375 significantly reduced sensitivity of PC cells to docetaxel treatment, as evidenced by reduced apoptotic cells. [score:1]
c 24 h after miR-375 transfection, cells were treated with docetaxel (50 nM) for another 24 h. analyses show that high levels of miR-375 protect cells from apoptosis in both PC-3 and DU145 cell lines. [score:1]
At the end of experiment period, the mean wet weight of tumors was significantly higher in miR-375 transfected group than in empty vector control group (p < 0.05) (Fig.   3b and c). [score:1]
We have previously shown that elevated miR-375 is significantly associated with poor overall survival in mCRPC patients [13]. [score:1]
b PC cells were treated with different concentrations of docetaxel for 48 h. shows that cells with miR-375 transfection are more tolerant to docetaxel toxic effect. [score:1]
To date, the biological role and mechanisms of action of miR-375 in chemotherapy response of mCRPC are not fully understood. [score:1]
The lentivirus vector, hsa-mir-375 lentivirus or miR -negative control lentivirus, was obtained from Biosettia (San Diego, CA, USA) with a titer of 10 [7] IU/mL. [score:1]
Fraction of apoptotic cells are shown in lower right corners To further test for the involvement of miR-375 in docetaxel resistance, we injected the stably transfected cell lines grown as xenograft tumors in athymic nude mice. [score:1]
b Response of miR-375 to docetaxel in PC cells. [score:1]
However, further in vitro and in vivo study showed that higher miR-375 also rendered resistance to docetaxel treatment. [score:1]
Transfection with miR-375 mimics and negative controls. [score:1]
We recently showed significant association of elevated miR-375 levels in plasma with poor overall survival of mCRPC patients [13]. [score:1]
miR-375 expression levels were measured by qRT-PCR under different concentrations of docetaxel. [score:1]
miR-375 is inversely correlated with EMT signature [27]. [score:1]
The final concentration of miR-375 mimic, and negative control in the transfection system was 200 nM, respectively. [score:1]
miR-375 contributes to docetaxel resistance in PC cell lines. [score:1]
We also evaluated if elevated miR-375 impacts the transcription levels of its target genes in vivo in PC xenograft tumors. [score:1]
To determine the effect of miR-375 on proliferation of PC cell lines, PC-3 and DU145 cells were transiently transfected with 200 nM miR-375 mimic. [score:1]
Mice were inoculated subcutaneously (s. c. ) at two sites per mouse with PC-3 cells stably transfected with lentivirus for either miR-375 or empty vector (n = 16). [score:1]
We performed qRT-PCR and measured expression levels of miR-375 at days 0, 3, 7, 14, and 21, respectively. [score:1]
c Tumor weights at the end of the treatment period (28 days after first docetaxel injection) were significantly higher in miR-375 group. [score:1]
We performed cell line and animal -based studies to establish a role for miR-375 in docetaxel resistance. [score:1]
We previously reported that elevated miR-375 levels were significantly associated with poor overall survival of mCRPC patients. [score:1]
The miR-375 mimic and negative control were obtained from Ambion (Life Technologies, Grand Island, NY, USA). [score:1]
Another study shows that miR-375 mediated chemo-resistance in cervical cancer by facilitating EMT [17]. [score:1]
d Caspase-3 immunohistochemistry analyses of xenograft tumors with empty control vector or miR-375 lentivirus vector after docetaxel treatment. [score:1]
Fig. 3Effect of miR-375 on docetaxel resistance in xenograft mice. [score:1]
Therefore, high level of miR-375 is expected to promote tumor growth and reduce overall survival during docetaxel treatment. [score:1]
As shown in Fig.   2b, miR-375 transfected cells consistently showed higher survival rate (therefore, docetaxel resistance) in both PC-3 and DU145 cell lines. [score:1]
[1 to 20 of 137 sentences]
4
[+] score: 229
In primary hepatic cancer, over -expression of miR-375 suppresses the expression of aeg-1, induces apoptosis and inhibits migration of the liver cancer cells [11]. [score:9]
Over -expression of miR-375 down-regulated the JAK2/STAT3 and MAPK/ERK signaling pathways but ATG7 down-regulation was cell line specific. [score:9]
However, over -expression of miR-375 down-regulated ATG7 in HCT116 cells without autophagy suppression (Figure 3B). [score:8]
miR-375 expression suppressed the oncogene AEG-1/MTDH in head and neck squamous cell carcinoma [15], and knockdown of miR-375 increased the phosphorylation of Akt in BMPACs and post MI heart by targeting PDK-1 [16]. [score:8]
In order to test the target genes of miR-375 in CRC and the related signal pathways, we searched the databases miRTarBase, PicTar, TargetScan, miRecord and miRanda, and found that jak2, usp1, map3k8, timm8a, yap1, pdk1, atg7 are predicted to be the target genes of miR-375. [score:7]
miR-375 down-regulated JAK2/STAT3 and MAPK/ERK signaling pathways, but miR-375 down-regulated ATG7 in a cell line specific way. [score:7]
In our all 3 CRC cell lines, over-expressed miR-375 had an inhibited effect on both the JAK2/STAT3 and MAPK/ERK signaling pathways, leading to the inhibition of cell proliferation in CRC cells. [score:7]
Furthermore, the miR-375 over -expression in nude mice significantly inhibited tumor formation without damaging the health of the mice, indicating miR-375 as a potential therapeutic target for CRC. [score:7]
To elucidate these signaling pathways and the regulatory mechanisms of miR-375 in CRC, we constructed miR-375 stable expressing CRC cell lines, in agreement with the results in tissues, we found that Jak2, map3k8 and their downstream genes were up-regulated in all 3 cell lines. [score:7]
In addition, miR-375 targeted genes (predicted by TargetScan, miRTarBase and miRecords, jak2, map3k8 and atg7) were increased with their downstream genes on the mRNA level in CRC carcinoma tissues. [score:5]
Our previous results showed that miR-375 has lower expression in CRC carcinoma tissues than that in para-carcinoma tissues, indicating miR-375 as a tumor suppressor. [score:5]
Thus, we speculated that miR-375 might participate in the occurrence and development of CRC by regulating these targeted genes and related signaling pathways. [score:5]
In summary, our study observed that miR-375 suppressed the cell proliferation and tumor formation in colorectal cancer by mainly targeting both JAK2/STAT3 and MAPK/ERK signaling pathways. [score:5]
A significant suppression of cell proliferation was found in pCDH-miR375-Caco2 and pCDH-miR375-HCT116 cells, though the suppression of cell proliferation in pCDH-miR375-HT29 was not significant (Figure 4A). [score:5]
Collectively, these results suggest that over-expressed miR-375 has a significant inhibiting effect on the proliferation of CRC cells. [score:5]
These results indicated that the over -expression of miR-375 significantly suppressed the proliferation of CRC cells in vivo. [score:5]
Over -expression of miR-375 suppressed the tumor formation of CRC cells in nude mice. [score:5]
Over -expression of miR-375 suppressed the proliferation of CRC cells. [score:5]
In our research, pCDH-miR375-HT29 cells showed the same trend as down-regulation of p-STAT3 and p-Erk. [score:4]
Thus, we hypothesized that miR-375 might suppress CRC by negatively regulating these key genes. [score:4]
To explore whether miR-375 also regulate autophagy in CRC, we detected another target gene of miR-375—autophagy associated gene atg7 and LC3B-II/LC3B-I as autophagy indicator in these 3 cells lines. [score:4]
This implied that autophagy is a complicated process influenced by many factors, atg7 is validated as a target gene of miR-375, but its regulation by miR-375 is cell line specific. [score:4]
Our results showed that the protein level of JAK2 was down-regulated in pCDH-miR375-Caco2 and pCDH-miR375-HCT116 cells, so was the protein level of p-JAK2. [score:4]
To explore the mechanism underlying the miR-375 regulation, we focused on the miR-375's influence on the expression of predicated genes and their downstream cascades, as well the cell proliferation and tumorigenesis in nude mice. [score:4]
The down-regulation of atg7 by miR-375 showed a cell line specific manner, the autophagy levels varies in different cell lines. [score:4]
miR-375 inhibited the cell proliferation. [score:3]
JAK2, MAP3K8 and ATG7 are predicted target genes for miR-375. [score:3]
Infected cells expressing green fluorescence were detected by flow cytometry (BD, US) to evaluate the infection efficiency, and selected miR-375 stable expressing cells using puromycin. [score:3]
microRNA-375 (miR-375) located in chromosome 2 functions as a cancer suppressor, which showed significant lower levels in alimentary canal cancers, such as esophageal squamous cancer, gastric cancer, liver cancer and pancreatic cancer [9– 11]. [score:3]
Recent evidence suggests an association of decreased miR-375 expression with alimentary system tumourigenesis [17]. [score:3]
In conclusion, JAK2/STAT3 and MAPK/ERK signaling pathways were suppressed by miR-375. [score:3]
This suggests that miR-375 might mediate CRC through targeting autophagy related gene, atg7. [score:3]
The expression level of miR-375 was quantified by Real-Time PCR (Figure 2D). [score:3]
Thus, our results suggested that low expression of miR-375 activates JAK2/STAT3 and MAP3K8/ERK pathways in cancer cells, which in turn promotes cell proliferation. [score:3]
Faltejskova [18] reported that the expression of miR-375 was significantly lower in CRC tissues than in normal colorectum tissues. [score:3]
We found that proliferation rates of pCDH-miR375-HT29 cells, pCDH-miR375-HCT116 cells and pCDH-miR375-Caco2 cells were significantly suppressed by miR-375 since the second day of planking (Figure 4B). [score:3]
Autophagy had been increased only in miR-375 over -expressing Caco2 cells, whereas its ATG7 had no change. [score:3]
miR-375 suppressed the tumoregenesis in nude mice. [score:3]
The results suggest that miR-375 has inhibiting effect on JAK2/STAT3 pathway. [score:3]
miR-375 can suppress cell growth by arresting cancer cells in G0 phase in pancreatic cancer [12]. [score:3]
miR-375 stable expressing pCDH-miR375-Caco2/HCT116/HT29 cells and pCDH vector controls were selected by puromycin. [score:3]
Total RNAs were isolated from carcinoma tissues and para-carcimona tissues to measure the expression level of target genes, or above cells to measure the expression level of miR-375. [score:3]
Western Blot results showing no significant change for ATG7 in miR-375 over -expressing HT29 and Caco2 cells, although increase of LC3B-II/I ratio indicated autophagy activation only in Caco2 cells. [score:3]
Establishment of miR-375 expressing cell lines with pCDH-CMV-MCS-EF1-GFP-T2A-Puro vector. [score:3]
In accordance with that result, our preliminary study finds that miR-375 has lower expression levels in CRC carcinoma tissues than in para-carcinoma tissues. [score:3]
Hsa-miR-375 participates in the development of the pancreas through reducing the secretion of insulin in pancreatic beta cells [13, 14]. [score:2]
The cell migration for miR-375 expressing and control HT29/HCT116 cells during 7 days of wound healing assay. [score:2]
However, the mechanism underlying miR-375 regulation remains unclear. [score:2]
These results implied that ATG7 and autophagy might play a role in CRC, but regulated by miR-375 in a cell line specific way. [score:2]
Figure 5 The cell migration for miR-375 expressing and control HT29/HCT116 cells during 7 days of wound healing assay. [score:2]
It suggested that miR-375 had no effect on migration in CRC cells. [score:1]
Recombinant pCDH-puro-miR-375 or pCDH-puro empty vector with packaging plasmid PMD2. [score:1]
pCDH-miR-375 and pCDH-puro control cells were incubated respectively in 96-well plates at the density of 4 × 10 [3] cells/well. [score:1]
Nude mice mo del was employed to identify the in vivo effects of miR-375 on CRC tumorigenesis. [score:1]
In our study, miR-375 was significantly lower, atg7 and autophagy (indicated by LC3II/I conversion rate) were activated in CRC carcinoma tissues. [score:1]
These findings support tumor repressive miR-375 as a potential new approach for colorectal cancer diagnosis and therapy. [score:1]
However, in our cell lines, atg7 had been silenced by miR-375 only in HCT116 cells, with no effect on the LC3II/I conversion rate. [score:1]
In gastric and liver cancers, miR-375 functions through the JAK2/STAT3 signaling pathway to control cell proliferation and apoptosis [22]. [score:1]
Our study aims to investigate the target genes and related signal pathways of miR-375 in CRC. [score:1]
Our preliminary data revealed much lower levels of miR-375 in CRC carcinoma than in para-carcinoma tissue, suggesting that miR-375 might involve in cell growth or migration in CRC. [score:1]
miR-375 had no effects on cell migration. [score:1]
Results showed no difference between miR-375 group and control group for healing speed (Figure 5). [score:1]
miR-375 virus particles were produced from pCDH-miR-375 construction (Figure 2A), and infected Caco2/HCT116/HT29 cells respectively. [score:1]
Figure 6(A) Nude mice injected with pCDH-HCT116 control (Group A) and pCDH-miR375-HCT116 (Group B) (B) Growth curve of tumor size. [score:1]
miRNAs can be easily and sensitively detected in peripheral blood [25], which highlights miR-375 as a potential target for the non-invasive measurement for CRC. [score:1]
Next, we explored the biological role of miR-375 at cellular level. [score:1]
CRC bearing nude mice mo dels were generated by subcutaneously inoculated with pCDH-miR375-HCT116 cells act as treatment group, while nude mice subcutaneously inoculated with mock-carrier (pCDH-HCT116) cells act as control group. [score:1]
[1 to 20 of 67 sentences]
5
[+] score: 211
We confirmed that expression of validated mRNA targets of miR-375 such as Gphn, Chsys, Insig2, Mtpn, and Eef1e1 were downregulated in Tg375 islets (Fig.   1b) [10]. [score:8]
This analysis revealed that HuD is upregulated ≈3-fold in miR-375 KO islets but downregulated in β-Rescue mice to similar levels than WT animals (Fig.   2b). [score:7]
b Relative expression of validated miR-375 targets in islets of male Tg375 mice and WT controls at 12 week of age. [score:5]
b Relative expression of the miR-375 target HuD in islets of male WT, Tg375, miR-375 KO, and β-Rescue mice at 12 weeks of age (n = 4–5). [score:5]
Therefore, any further increase in miR-375 levels is unlikely to influence target expression. [score:5]
This could be explained by the high endogenous miR-375 levels in pancreatic islets of both mouse and human [7, 10, 28], where miR-375 mRNA targets regulating β-cell homeostasis are fully engaged and repressed by this miRNA. [score:4]
To show that selective expression of miR-375 in β-cells of miR-375 KO mice is sufficient for the regulation of glucagon signaling in the liver, pyruvate tolerance was examined in mutant mice. [score:4]
l Circulating miR-375 levels in healthy or no diagnosed metabolic disease patients (n = 51), HNF1α/MODY3 mutation carriers (n = 47), T1D (n = 38) and T2D (n = 58). [score:4]
Transgenic mice expressing miR-375 under the regulation of the rat insulin promoter (RIP) were generated by inserting a 141-bp fragment encompassing the genomic murine pre-miR-375 sequence into KpnI and HindII sites of pCRII-RIP generating pCRII-RIP-miR-375. [score:4]
To further validate the selective reconstitution of miR-375 levels in β-Rescue mice, we measured mRNA levels of HuD, encoding an RNA -binding protein that regulates translation of the insulin2 mRNA [21] and an evolutionarily conserved and experimentally validated miR-375 target in β-cells [10]. [score:4]
Crossing of both mouse lines allowed us to generate mice expressing miR-375 exclusively in pancreatic β-cells. [score:3]
Quantitative PCR (qPCR) indicated that expression of miR-375 was recovered to ≈85 % of wildtype (WT) in β-Rescue islets (Fig.   2a). [score:3]
We now report the generation of a miR-375 gain-of-function mouse mo del with selective overexpression of miR-375 in pancreatic β-cells. [score:3]
Two founder lines were derived from pronuclei microinjections, and both lines displayed ≈2-fold overexpression of miR-375 in pancreatic islets, without “leakage” in other organs such lung, spleen, muscle, colon, kidney, or heart, except minor escape in the brain, consistent with leakage of the insulin promoter in selected hypothalamic neurons (Fig.   1a). [score:3]
Thus, therapeutic approaches aimed at increasing β-cell growth and proliferation through upregulation of miR-375 function should be considered only in a setting of reduced miR-375 levels. [score:3]
Selective re -expression of miR-375 in β-cells of miR-375 KO mice restores normal glycemic control. [score:3]
Overexpression of miR-375 in β-cells does not influence β-cell mass and function. [score:3]
Quantitative PCR analyses revealed that miR-375 and the broadly expressed miR-16 are both readily detected in the circulation of C57BL/6 mice (20.8 ± 0.3 Ct, n = 3, Fig.   5a). [score:3]
Transgenic mice overexpressing miR-375 in β-cells have normal glucose tolerance. [score:3]
Here, we show that mice overexpressing miR-375 exhibit normal β-cell mass and function. [score:3]
Finally, in situ hybridization with miR-375 probes confirmed restoration of miR-375 expression in the core of pancreatic islets of β-Rescue mice (Fig.   2c). [score:3]
Together, these findings indicate that selective re -expression of miR-375 in β-cell of miR-375 KO mice is sufficient to restore normal glycemic control. [score:3]
a Relative miR-375 expression in islets and indicated organs of male wildtype (WT) and Tg375 mice at 12 weeks of age (n = 5 for islets, n = 2 for all other tissues). [score:3]
Selective re -expression of miR-375 in β-cells of miR-375 KO mice normalizes both, α- and β-cell phenotypes as well as glucose metabolism. [score:3]
miR-375 represents the most highly transcribed miRNA gene in β-cells with significant expression in other endocrine organs such as the pituitary, adrenal glands, skin, and intestine [6– 9]. [score:3]
miR-375 KO, [#] p < 0.05, [##] p < 0.01, [###] p < 0.005, β-Rescue versus miR-375 KO Several studies have suggested that miRNA expressed in β-cells are also found in the circulation [17]. [score:3]
Therefore, the protective role of miR-375 overexpression on β cell growth might become more important in mo dels of pancreatic β-cells failure where loss of β-cell function represents the main driving force of metabolic dysfunction. [score:3]
Circulating miR-375 levels in mice exclusively expressing miR-375 in β-cells corresponded to approximately 1 % of WT mice. [score:3]
a Relative miR-375 expression in islets of male WT, Tg375, miR-375 KO, and β-Rescue mice at 12 weeks of age (n = 4–5). [score:3]
Together, these results show that the Tg375 transgene could selectively and functionally restore endogenous miR-375 expression in β-cells of miR-375 KO mice. [score:3]
These studies are difficult to reconcile considering the selective expression of miR-375 in neuroendocrine organs [6] and intestinal goblet cells [37] and may indicate that metabolic effects influence the secretion, clearance, or stability of miR-375. [score:3]
This mo del was used to rescue miR-375 expression in pancreatic β-cells of global miR-375 KO animals and to investigate miR-375’s specific role in the maintenance of β-cell function and regulation of blood glucose homeostasis in vivo. [score:2]
We observed that circulating miR-375 levels were increased by ≈2-fold in STZ -treated diabetic mice as compared to controls (Fig.   6c), while those of miR-16, a ubiquitously expressed miRNA was unaffected by STZ treatment (Fig.   6d). [score:2]
These data indicate that the primary defect of global miR-375 KO mice is caused by the loss of miR-375 in pancreatic β-cells, which results in a secondary and indirect α-cell growth and proliferative response. [score:2]
Previous studies reported that miR-375 levels correlate with advanced prostate [35] and hepatocellular carcinoma [36] in humans and revealed to be among the most highly differentially regulated blood miRNAs in apoE -deficient mice [14]. [score:2]
Several negative regulators of cell growth are induced in miR-375 KO islets and underlie the anti-proliferative effects in pancreatic β-cells. [score:2]
To further dissect the role of miR-375 gene dosage in the regulation of pancreatic endocrine cell mass and glucose metabolism, we generated and characterized transgenic mice overexpressing miR-375 selectively in pancreatic β-cells (named “Tg375”). [score:2]
The genetic rescue experiment further demonstrates that the content of miR-375 in β-cells can indirectly influence the function and growth of α-cells. [score:2]
Interestingly, reconstitution of miR-375 expression in β-cells of miR-375 KO mice also decreased plasma glucagon levels compared to miR-375 KO mice (Fig.   4d). [score:2]
All data shown are mean ± s. e. m; * p < 0.05, ** p < 0.01, *** p < 0.005 Lastly, we extended our findings to diabetic patients and measured circulating miR-375 levels in human subjects with inactivating mutations in HNF1α (maturity-onset of the young, type 3 (MODY3)), T2D, T1D, and healthy subjects (no diagnosed metabolic disease (NDMD)). [score:2]
All data shown are mean ± s. e. m; * p < 0.05, ** p < 0.01, *** p < 0.005Lastly, we extended our findings to diabetic patients and measured circulating miR-375 levels in human subjects with inactivating mutations in HNF1α (maturity-onset of the young, type 3 (MODY3)), T2D, T1D, and healthy subjects (no diagnosed metabolic disease (NDMD)). [score:2]
We now provide the first evidence for secretion of miR-375 by pancreatic β-cells in vivo in unstressed conditions (Fig.   5). [score:1]
To address this, we took advantage of our β-cell-specific miR-375 expressing mouse mo del to measure the contribution of β-cells to circulating miR-375 levels in vivo. [score:1]
c, d miR-375 copy number per ml of plasma of wildtype (WT), Tg375, miR-375 KO, and β-Rescue mice at 20 weeks of age. [score:1]
These results indicate that β-cell miR-375 deficiency is the primary cause underlying the phenotype of global miR-375 KO mice and that the increase in α-cell mass and glucagon secretion arises secondarily to the β-cell defect. [score:1]
h Blood glucose, i pancreatic insulin content, and j circulating miR-375 and k miR-16 in C57BL/6 (WT) mice fed a normal or high-fat diet (HFD, for 25 weeks) and ob/ob (C57BL/6 background) mice (23-week-old) (n = 5). [score:1]
Considering the small contribution of β-cells to miR-375 levels in the blood, we believe that the most likely explanation for this observation is that hyperglycemia per se elicits increased miR-375 secretion from tissues other than pancreatic β-cells. [score:1]
This reduction in plasma miR-375 levels may be due to increased renal clearance, since miRNAs are secreted in the urine, and body weight is positively correlated with glomerular filtration rate [38, 39], and an inverse correlation exists between miRNAs abundance and kidney function [40]. [score:1]
Fig. 4Hormone levels and islet cell mass in miR-375 β-Rescue mice. [score:1]
We found increased circulating miR-375 levels in response to acute pancreatic β-cell injury induced by STZ, indicating that acute β-cell death can result in increased circulating miR-375 levels. [score:1]
IPGTT revealed marked glucose intolerance in miR-375 KO animals, whereas β-Rescue mice showed a glucose response similar to WT littermates (Fig.   3d). [score:1]
c Detection of miR-375 and 28S rRNA in pancreatic tissue sections from wildtype (WT), miR-375 KO, and β-Rescue mice using miRNA FISH. [score:1]
For example, the levels of HuD mRNA are unchanged in Tg375 islets but found at higher levels in miR-375 KO islets (Figs.   1 and 2). [score:1]
Increased α-cell mass in miR-375 KO arises secondarily to loss of miR-375 in β-cells. [score:1]
miR-375 has been shown to be increased in the plasma of two murine mo dels with profound pancreatic β-cell death, NOD, and streptozotocin (STZ) -treated mice [18]. [score:1]
These findings are supported by higher miR-375 levels in the circulation of type 1 diabetes (T1D) subjects but not mature onset diabetes of the young (MODY) and type 2 diabetes (T2D) patients. [score:1]
However, the relative importance of α- and β-cell defects in the diabetic phenotype of global miR-375 KO mice still remains to be determined. [score:1]
Importantly, our quantitative finding that release of miR-375 from living β-cells in vivo only contributes a very small fraction to the total plasma levels offers a rational explanation why changes in β-cell function and mass are insufficient to translate into measurable alterations in miR-375 plasma levels. [score:1]
miR-375 KO mice were maintained on a pure C57BL/6N background and described previously [10]. [score:1]
miR-375 KO, [#] p < 0.05, [##] p < 0.01, β-Rescue vs. [score:1]
Plasma miR-375 therefore is unlikely to serve as a marker of altered β-cell function, a notion also supported by the similar plasma miR-375 levels in subjects with MODY3 that is known to exhibit β-cell dysfunction. [score:1]
A 1.1-kb DNA fragment generated upon digestion of pCRII0-RIP-miR-375 with NsiI and containing the pRIP-miR-375 transgene was injected into male pronuclei of C57BL/6N zygotes to generate “Tg375” transgenic mice. [score:1]
e Blood glucose and f circulating miR-375 and g miR-16 levels in WT and db/db (BKS-background) male mice at 8 weeks of age (n = 4–5). [score:1]
e Relative miR-375 levels in supernatant of pancreatic islets isolated from WT, miR-375 KO, and Tg375 mice cultured in serum-free media for 16 h at 37 °C. [score:1]
Together, these results indicate that miR-375 levels in the circulation do not correlate with β-cell function or mass but may be a surrogate marker for β-cell injury and cell death. [score:1]
Fasting insulin levels were not significantly different between miR-375 KO, β-Rescue, Tg375, and WT control mice (Fig.   4a). [score:1]
Together, our data support an essential role for miR-375 in the maintenance of β-cell mass and provide in vivo evidence for release of miRNAs from pancreatic β-cells. [score:1]
In agreement with this study, we also found increased circulating miR-375 levels in a mouse mo del of BKS- db/db mice that display β-cell apoptosis and profound hyperglycemia. [score:1]
Furthermore, acute and profound β-cell destruction is sufficient to detect elevations of miR-375 levels in the blood. [score:1]
As depicted in Fig.   4f, miR-375 KO mice displayed augmented gluconeogenesis, as shown by higher blood glucose levels in response to a tolerance test (PTT). [score:1]
Release of miR-375 from pancreatic β-cells into circulation. [score:1]
Two transgenic founder lines, designated as B6N-Tg(Rip-375)416; 417Biat, were characterized and displayed similar expression levels of miR-375 and metabolic phenotypes. [score:1]
The miR-375 probe was synthesized with a linker that enabled conjugation of six biotin moieties: 5′-AGCCGaaCGaAcaaA-(L)3-B-L-B-L-B-L-B-N-B-(B-CPG), where uppercase letters indicate DNA nucleotides, lowercase letters indicate LNA modification, L represents spacer 18 (GlenResearch, catalog no. [score:1]
Noteworthy is the increased α-cell mass and circulating glucagon levels found in miR-375 KO mice, which induce augmented hepatic glucose production and, together with the decreased β-cell function, further exacerbates glycemic control [10]. [score:1]
Only a small proportion of circulating miR-375 levels originates from β-cells. [score:1]
To our surprise, our data indicate that circulating miR-375 levels are increased in human T1D. [score:1]
Interestingly, these β-Rescue mice were indistinguishable from wildtype animals in several aspects, including: (1) miR-375 levels in islet, (2) insulin and glucagon levels, (3) glucose, insulin and pyruvate tolerance, and (4) α- and β-cell mass (Figs.   3 and 4). [score:1]
To determine if plasma miR-375 originates from pancreatic β-cells, we took advantage of our β-Rescue mouse mo del displaying selective expression of endogenous miR-375 levels in pancreatic β-cells and performed quantitative measurements in mouse plasma. [score:1]
Absolute miRNA quantification was performed by reverse transcription of serial dilutions of synthetic oligonucleotides with sequence to mature mmu-miR-375 (5′-UUUGUUCGUUCGGCUCGCGUGA-3′), mmu-miR-16 (5′-UAGCAGCACGUAAAUAUUGGCG-3′), and mmu-miR-194 (5′-UGUAACAGCAACUCCAUGUGGA-3′). [score:1]
However, when islet miR-375 gene dosage is decreased in islets of Tg375 through inactivation of endogenous alleles of the miRNA (β–Rescue mice), the repressive action of miR-375 on HuD mRNA is recovered. [score:1]
Increased plasma levels of miR-375 in response to β-cell destruction. [score:1]
These results indicate that increased miR-375 gene dosage in pancreatic β-cells of mice does not alter pancreatic endocrine cell composition and glucose tolerance. [score:1]
In contrast, plasma miR-16 levels were not different between WT, miR-375 KO, and β-Rescue animals (Fig.   5d). [score:1]
These data are in accordance with Erener et al. reporting increased miR-375 levels in STZ -treated and NOD mice and islets [18]. [score:1]
This indicates that although β-cells contribute to the circulating levels of miR-375, most of the miRNA originates from other organs, most likely neuroendocrine cells from lung, gastrointestinal tract, thyroid, and adrenals. [score:1]
Together, these results indicate that the β-cell-enriched miR-375 is secreted from pancreatic islets, but miRNA release from this organ contributes only a small fraction to the overall blood levels in mice. [score:1]
In contrast, plasma miR-375 levels were reduced in two normoglycemic mo dels of obesity (HFD and ob/ob on C57BL/6 background) with increased pancreatic β-cell function, proliferation and absence of apoptosis. [score:1]
After culture of pancreatic islets for 16 h in serum-free media, islet supernatants were recovered, centrifuged, and miR-375 levels quantified by qPCR. [score:1]
Tg375 islets secreted 1.9 ± 0.45-fold more miR-375 than WT islets, whereas miR-375 levels were virtually absent in the supernatant of miR-375 KO islets (Fig.   5e). [score:1]
Circulating miR-375 levels are not a biomarker for pancreatic β-cell function. [score:1]
MiRNA-375 Pancreatic β-cells Biomarker Diabetes β-cell mass Pancreatic α- and β-cells are the main cell types regulating glucose metabolism through the secretion of glucagon and insulin, respectively. [score:1]
Global miR-375 gene inactivation in mice leads to overt diabetes due in part to decreased β-cell mass [10]. [score:1]
To assess the relative importance of α- and β-cell mass remo deling for the overall phenotype of global miR-375 KO mice, we conducted genetic rescue experiments using Tg375 mice and global miR-375 KO mice (Fig.   3). [score:1]
Green: miR-375, Red: 28S rRNA, Blue: cell nuclei. [score:1]
The data in Fig.   5e show that supernatant miR-375 levels correlate with islet miR-375 gene dosage. [score:1]
Using this mo del, we also analyzed the contribution of β-cells to the total plasma miR-375 levels. [score:1]
It was previously shown that β-cell destruction by low doses of STZ leads to α-cell hyperplasia, partially phenocopying the β-cell hypoplasia and α-cell hyperplasia of miR-375 KO mice [10, 30]. [score:1]
c Circulating miR-375 and d miR-16 copy number in plasma of 6-h fasted C57BL/6 WT mice (10-week-old) after being injected with STZ (+, 1 × 150 mg/kg) or PBS as control (−) for 3 days (n = 7–8). [score:1]
Together, these results indicate that plasma miR-375 levels do not discriminate between different forms of T2D but may be used as an indicator of acute β-cell destruction and autoimmune diabetes. [score:1]
Insulin tolerance tests were similar in WT, Tg375, miR-375 KO, and β-Rescue mice, indicating that insulin sensitivity was unchanged (Fig.   3e). [score:1]
b Copy number of circulating miR-375 and miR-16 in C57BL/6 mice at 7 weeks. [score:1]
The importance of miR-375 in obesity -induced β-cell mass expansion was demonstrated in miR-375 and leptin double deficient (miR-375 KO; ob/ob) mice, which exhibit impaired β-cell proliferation and profoundly impaired compensatory β-cell hypertrophy [10]. [score:1]
Mice with genetic deletion of miR-375 exhibit impaired glycemic control due to decreased β-cell and increased α-cell mass and function. [score:1]
Lastly, it is possible that continuous autoimmune destruction and regeneration of β-cells in T1D may contribute to increased plasma miR-375 levels. [score:1]
Previous work from our group revealed that miR-375 is required for maintenance of α- and β-cell mass in mice [10]. [score:1]
Alternatively, increased miR-375 levels in the plasma of T1D may result in reduced renal clearance, a notion that is supported by the correlation of urinary miR-21 levels with the rate of kidney function decline and risk of progression to dialysis -dependent kidney failure [40, 42]. [score:1]
As expected, miR-375 KO animals developed random fed (Fig.   3b) and fasting hyperglycemia (Fig.   3c) from weaning (3 weeks of age) throughout adult life [10]. [score:1]
The relative importance of these processes for the overall phenotype of miR-375 KO mice is unknown. [score:1]
Fig. 2Functional characterization of miR-375 KO mice with selective re -expression of miR-375 in pancreatic β-cells. [score:1]
However, whether circulating miR-375 levels derive from β-cells in these mo dels and if miR-375 levels are modulated in diabetes remains to be determined. [score:1]
Increased α-cell mass observed in human T1D patients could also contribute to the elevated miR-375 levels in the circulation in the absence of β-cells [44– 46]. [score:1]
Only a small proportion (≈1 %) of circulating miR-375 originates from β-cells. [score:1]
Fig. 6Correlation between circulating miR-375 levels and β-cell injury. [score:1]
Fig. 5Pancreatic islets secrete miR-375 in the circulation. [score:1]
This may also explain why miR-375 levels were not significantly increased in our T2D cohort in contrast to what was recently reported by Higuchi et al. where patients exhibits a much higher BMI (31.6) than the cohort we analyzed (BMI = 25.9) [41]. [score:1]
The small contribution of β-cells to total plasma miR-375 levels make this miRNA an unlikely biomarker for β-cell function but suggests a utility for the detection of acute β-cell death for autoimmune diabetes. [score:1]
Using genetic loss of function experiments, we found that genetic inactivation of miR-375 decreases β-cell mass but concomitantly increases α-cell mass. [score:1]
Generation of miR-375 transgenic mice. [score:1]
To substantiate these findings, we performed in vitro experiments on pancreatic islets from miR-375 KO, WT and Tg375 mice displaying increasing miR-375 gene dosage (Fig.   5e). [score:1]
[1 to 20 of 119 sentences]
6
[+] score: 204
Previously, we found that miR-375 is significantly down-regulated in HCC cell lines and tissues, and demonstrated that miR-375 suppresses malignant traits of HCC by targeting AEG-1 and ATG7 [2, 7]. [score:8]
Additionally, Liu et al. found that miR-375 was notably down-regulated in HCC and increasing miR-375 expression decreased HCC cell invasion and proliferation by targeting oncogene YAP1 [9]. [score:8]
Delivered miR-375 significantly downregulated its downstream target genes, suggesting that AuNPs delivered miR-375 has same biological function as endogenous miR-375. [score:6]
Similarly, Ki67 expression was also down-regulated in AuNP-miR-375 treated primary HCC tumor tissues (Figure 6F). [score:6]
These results are in agreement with our previous research, in which overexpression of miR-375 in hepatoma cells by transfection of miR-375 precursor with Lipofectamine™ 2000 inhibited tumor growth [2]. [score:5]
Thus, we detected the expression of those genes using western blotting and found that expression of AEG-1, YAP1 and ATG7 were significantly reduced in Hep3B cells after AuNP-miR-375 treatment (Figure 4B). [score:5]
Our study also highlights the therapeutic potential of miR-375 in HCC treatment and support the development of more effective therapeutic strategies that target miR-375 (or other dysregulated miRNAs) by nanotechnology. [score:5]
Growing evidences have demonstrated that miR-375 functions as an important tumor suppressor in HCC and represents a promising candidate for miRNA replacement therapy due to its capacity to inhibit tumor cell growth in vitro and in vivo [2, 6, 7, 9]. [score:5]
Released miR-375 acts on its target genes like AEG-1, YAP1, and ATG7, and suppresses tumor malignant phenotypes of HCC cells. [score:5]
Morphological analysis revealed that delivered miR-375 can function as tumor suppressor in HCC cells, indicating that artificial replacement of miR-375 could restore the regulating networks of miR-375. [score:4]
Furthermore, we found that the hypermethylation of CpG islands in miR-375 promoter region may have led to the down-regulation of miR-375 in HCC [8]. [score:4]
Among them, down-regulation of miR-375 has been reported in various tumors, including HCC, gastric cancer, esophageal cancer, pancreatic cancer and so on [2– 6]. [score:4]
To investigate whether the AuNPs interfere with the working of miR-375, we determined the expression of miR-375′s downstream gene targets in Hep3B cells treated with AuNP-miR-375. [score:3]
Firstly, we found that AuNP-miR-375 induced significant cell growth inhibition and cell death in HepG2 and Hep3B cells based on microscopic cell counting (Figure 3A). [score:3]
AuNP-miR-375 showed marked suppression of growth of xenograft tumors, as shown by gross morphology (Figure 6A) and growth curves (Figure 6B). [score:3]
These results collectively confirmed that miR-375 delivered by Au-NPs could suppress tumor cell proliferation and migration in vitro. [score:3]
E. The expression levels of mature miR-375 in hepatoma cells were detected by TaqMan qRT-PCR. [score:3]
Furthermore, miR-375 was recently found to strongly inhibit Akt/Ras induced hepatocarcinogenesis in a primary mouse mo del of liver cancer [10]. [score:3]
Collectively, these studies suggest that miR-375 is an attractive therapeutic target for HCC. [score:3]
As shown in Figure 3B, cell growth inhibition in HepG2 or Hep3B cells was increased along with escalation of AuNP-miR-375 dose. [score:3]
AuNP-miR-375 suppresses tumor cell phenotypes in vitro. [score:3]
In xenograft tumor tissues, the expression of Ki67 in AuNP-miR-375 treated xenograft tumors was much lower than that in AuNP-miR-NC or saline treated xenograft tumors (Figure 6F). [score:3]
Correspondingly, AuNP-miR-375 treatment induced higher level of expression of cleaved Caspase-3 (Figure 6F). [score:3]
AuNPs delivered miR-375 can act on its downstream gene targets. [score:3]
Previous studies have shown that AEG-1, YAP1 and ATG7 are three major targets of miR-375 in HCC [2, 7, 9]. [score:3]
Furthermore, we used TaqMan qRT-PCR to detect release of mature miR-375 in hepatoma cells and found that expression of miR-375 was increased nearly 900 times in Hep3B and HepG2 cells treated with AuNP-miR-375 (Figure 2E). [score:3]
These results indicate that cell proliferation was inhibited and cell apoptosis was induced in tumors treated with AuNP-miR-375. [score:3]
AuNP-miR-375 suppressed tumor growth in primary and xenograft tumor mouse mo dels. [score:3]
Our study indicated that miR-375 delivered by nanoparticle delivery system could enter HCC cell or tissues and function as a tumor suppressor. [score:3]
In addition, miR-375 showed high accumulation in the liver, which potentially favors its efficacy in HCC treatment (Figure 5A). [score:1]
However, the lack of an efficient delivery system has been a major obstacle impeding the therapeutic application of miR-375 in HCC. [score:1]
D. Absorbance specturm of AuNP and AuNP-miR-375 nanoparticles obtained using a UV-Vis spectrophotometer. [score:1]
MiR-375 mimics and the negative control miR-NC were synthesised by Guangzhou Ribobio Company (Guangzhou, China). [score:1]
High uptake efficiency and release of intact miR-375 suggests that AuNPs are indeed apt to be taken up by HCC cells and protect miRNA from degradation. [score:1]
A. Apoptosis determined by flow cytometry analysis in Hep3B cells treated with AuNP-miR-375. [score:1]
Then mice were given tail vein injections of AuNP-miR-NC or AuNP-miR-375 (4 nmol/kg miR-375), once every other day for total 3 weeks. [score:1]
The results showed no significant difference between AuNP-miR-375 and AuNP-miR-NC treatment groups (Figure 6C). [score:1]
Tumor bearing nude mice were injected via tail vein with a single dose AuNP-miR-375 (4 nmol/kg miR-375) when tumors grew to ∼500 mm [3]. [score:1]
Two weeks after Akt/Ras injection, tumors formed in mice and then AuNP-miR-375 was administrated by tail vein injection. [score:1]
Anti-tumor effects of AuNP-miR-375 in xenograft and primary HCC mouse mo dels. [score:1]
Accordingly, body weights of mice treated with AuNP-miR-375 was also much lower than those of mice treated with AuNP-miR-NC, suggesting a reduction of tumor burden in mice (Figure 6E). [score:1]
Taken together, these results from xenograft and primary tumor mouse mo dels clearly demonstrated potent therapeutic effects of AuNP-miR-375 in vivo, suggesting that AuNP is an effective carrier for miRNA delivery and that AuNP-miR-375 is a potential agent for HCC treatment. [score:1]
The mice were given a single injection of AuNP-miR-375 via tail vein and then examined using a small animal in vivo imaging system. [score:1]
The nanoparticles exhibited high cellular uptake efficiency, successfully preserved miR-375′s biological function. [score:1]
After 1 h incubation, Hep3B and HepG2 cells treated with AuNP-miR-375 showed significant red fluorescence in almost all cells, indicating efficient and rapid uptake of AuNP-miR-375 by the cells (Figure 2A). [score:1]
A double stranded miR-375 mimic was covalently linked to AuNPs to form AuNP-miR-375. [score:1]
B. Viabilities of HepG2 and Hep3B cells treated with AuNP-miR-NC or AuNP-miR-375 for 48 h at different concentration of miR-375 as indicated. [score:1]
After being taken up by hepatoma cells, AuNP-miR-375 nanoparticles escape from endosome/lysosome and mature miR-375 is released to the cytoplasm. [score:1]
An animated PEG layer on the particle surface was used to stabilize AuNP-miR-375. [score:1]
In primary and xenograft tumor mouse mo dels, AuNP-miR-375 was shown to be highly effective as miR-375 replacement therapy without apparent toxicity to host mice. [score:1]
A miR-375 mimic, labeled with Cy3 at the 3’ end of the antisense strand, was linked to AuNPs covalently through a gold-sulfur bond, and can be easily tracked by fluorescence imaging. [score:1]
B. The shape of AuNP and AuNP-miR-375 nanoparticles imaged by a transmission electron microscope (TEM). [score:1]
The polydispersity of AuNPs was 0.197 ± 0.034 and it increased slightly to 0.321 ± 0.191 in AuNP-miR-375, suggesting that both AuNPs and AuNP-miR-375 had narrow size distribution. [score:1]
After conjugation to miR-375 and PEG, AuNP-miR-375 showed no significant change in morphology based on TEM images (Figure 1B), but had increased sizes, with a mean hydrodynamic diameter of 53 ± 8 nm by DLS (Table 1). [score:1]
For AuNP-miR-375 preparation, thiolated miR-375 was added to 10 nM solution of AuNPs at a ratio of 1 nmol RNA per 500 μL AuNP solution supplemented with 0.1% Tween-20. [score:1]
Figure 5 A. Distribution of miR-375 delivered by AuNP-miR-375 in xenograft mice. [score:1]
For toxicology examination of Au-NP-miR-375, FVB/N mice were administrated with AuNP-miR-375 suspensions (equal as 8 nmol/kg miR-375) intravenously via tail vein. [score:1]
Preparation of AuNPs and AuNP-miR-375. [score:1]
A. Effects of AuNP-miR-375 on the growth of pre-established HepG2 xenografts at a gross morphology level. [score:1]
These results demonstrate that AuNPs can efficiently and specifically deliver miR-375 into tumor tissues and maintain elevated miRNA concentration in these tissues. [score:1]
In addition, AuNP-miR-375 showed a maximum absorption peak at 529 nm, indicating a red shift caused by miR-375 conjugation (Figure 1D). [score:1]
In this study, we developed an AuNP-miRNA delivery system to deliver miR-375 into HCC cells and tissues and proved the therapeutic effect of miR-375 in HCC. [score:1]
C. Body weights of mice with xenografts treated with AuNP-miR-NC or AuNP-miR-375. [score:1]
Then those mice were given injections of AuNP-miR-NC or AuNP-miR-375 (4 nmol/kg miR-375), once every other day for total 3 weeks. [score:1]
The concentratin of miR-375 in AuNP-miR-375 solution were determined following release of the miRNA from the NPs with dithiothreitol (DTT) using previously described procedures [22]. [score:1]
B. Cellular uptake of AuNP-miR-375 in HepG2 and Hep3B cells determined by flow cytometry analysis. [score:1]
AuNP-miR-375 induced cell apoptosis in Hep3B cells and acted on miR-375′s downstream genes. [score:1]
Herein, we designed and prepared an AuNP system to deliver miR-375 for miRNA replacement therapy in HCC (see schematic illustration in Figure 1A). [score:1]
Similarly, we found in a transwell assay that AuNP-miR-NC and AuNP-miR-375 treatment resulted in significant migration inhibition, leading to 15% and 40% reduction in migration compared to control, respectively (Figure 3D). [score:1]
Cellular uptake of AuNP-miR-375 and release of miR-375 in hepatoma cells. [score:1]
HepG2 and Hep3B cells were treated with AuNP-miR-375 (50 nM miR-375). [score:1]
Imaging of isolated organs showed the distribution of miR-375 in tumor tissue more clearly than in vivo imaging (Figure 5A). [score:1]
Cellular uptake of AuNP-miR-375 in hepatoma cells and release of miR-375. [score:1]
Tissue distribution and toxicity of AuNP-miR-375. [score:1]
In addition, AuNP-miR-375 administration resulted in a minor reduction in white pulp in spleens, but did not lead to severe injury. [score:1]
Interestingly, miR-375 showed significant clearance from the liver at 8 h post injection, but a high accumulation in the tumor tissue. [score:1]
Importantly, our results from primary and xenograft tumor mouse mo dels also indicate that AuNP-miR-375 can overcome physiological obstacles and deliver miR-375 into HCC tissues in mice. [score:1]
These results suggested efficient cellular uptake of AuNP-miR-375 and release of intact mature miR-375 in HCC cells. [score:1]
E. Body weight of mice with primary liver tumor treated with AuNP-miR-NC or AuNP-miR-375. [score:1]
X-ray (upper row) and bioluminescence were performed on mice injected with AuNP-miR-375 after anesthesia. [score:1]
D. Tumor morphology and sizes in mice with primary HCC treated with AuNP-miR-NC or AuNP-miR-375. [score:1]
B. Tumor growth curve of mice with pre-established HepG2 xenografts treated with AuNP-miR-NC or AuNP-miR-375. [score:1]
Uptake experiments revealed that AuNP-miR-375 could efficiently deliver miR-375 into HCC cell and tissues. [score:1]
Increased fluorescence was detected in Hep3B cells at 3 h, and fluorescence were increased only slightly from 3 to 6 h, suggesting that the uptake of AuNP-miR-375 was saturated (Figure 2C). [score:1]
B. Histological analysis of hearts, livers, spleens, lungs and kidney from mice treated with AuNP-miR-375. [score:1]
Figure 2 A. Cellular uptake of AuNP-miR-375 in HepG2 and Hep3B cells visualized by fluorescence microscope. [score:1]
To explore whether miR-375 can be efficiently and specifically delivered into tumor tissues by AuNP-miR-375, we examined the distribution of Cy3-labeled miR-375 in tumor bearing BALB/c nude mice following i. v. administration. [score:1]
To determine the anti-tumor effect of AuNP-miR-375 in HepG2 xenograft tumor mouse mo del, AuNP-miR-375 was administrated by intratumoral injection upon the subcutaneous tumor reaching ∼ 100 mm [3]. [score:1]
Overall, these results indicate that miR-375 can be efficiently and specifically delivered into tumor tissues by AuNP-miR-375, and that AuNP-miR-375 has negligible side effects in the treatment of liver cancer. [score:1]
FVB/N mice were given a single injection of AuNP-miR-375 (8 nmol/kg miR-375) via tail vein. [score:1]
Finally, flow cytometry analysis of cell apoptosis showed that AuNP-miR-375 induced apoptosis in more than 47% of Hep3B cells, whereas AuNP-miR-NC treated group showed only a weak induction of apoptosis in Hep3B cells (Figure 4A). [score:1]
Figure 6 A. Effects of AuNP-miR-375 on the growth of pre-established HepG2 xenografts at a gross morphology level. [score:1]
A. Cellular uptake of AuNP-miR-375 in HepG2 and Hep3B cells visualized by fluorescence microscope. [score:1]
Zeta potential of AuNPs was -55 ± 0.7 mv, and it increased to -34 ± 1.8 mv in AuNP-miR-375 (Table 1). [score:1]
Examination under TEM showed that AuNP-miR-375 particles were localized in endosomes or lysosomes (Figure 2D). [score:1]
Anti-tumor activities of AuNP-miR-375 in hepatoma cells. [score:1]
Hepatoma cells were incubated with Cy3-labeled AuNP-miR-375 (50 nM miR-375) for different time and then stained with DAPI and observed under a fluorescence microscope. [score:1]
Hep3B cells were treated with AuNP-miR-NC or AuNP-miR-375 (100 nM miR-375) for 48 h. Quadrants from lower left to upper left (counter clockwise) represent healthy, early apoptotic, late apoptotic, and necrotic cells, respectively. [score:1]
AuNPs and their miR-375 conjugates AuNP-miR-375 were prepared as described in the methods section. [score:1]
Taken together, these results indicated that AuNP-miR-375 was successfully synthesized and had the expected properties. [score:1]
The hepatoma cell lines Hep3B and HepG2 were treated with AuNP-miR-375 (equal as 100 nM miR-375, unless noted otherwise), or equal concentration of AuNP-miR-NC as negative group, or media control, and then harvested for further study 48 h later. [score:1]
At the tumor volume of 100 mm [3], AuNP-miR-375 was injected via intra-tumor injection as described in the method section. [score:1]
After 1 h treatment, more than 95% Hep3B cells were Cy3 -positive, indicating cellular uptake of AuNP-miR-375 (Figure 2B). [score:1]
Figure 4 A. Apoptosis determined by flow cytometry analysis in Hep3B cells treated with AuNP-miR-375. [score:1]
For in vivo imaging, the tumor bearing BALB/c nude mice (n = 3) were injected with a single dose of AuNP-miR-375 (equal as 4 nmol/kg miRNA) via tail vein when the tumors reached ∼500 mm [3]. [score:1]
In conclusion, our study illustrated the reliability of AuNPs to deliver miR-375 into HCC cells and the therapeutic effects of AuNP-miR-375 in HCC treatment. [score:1]
To quantify the fraction of cells taking up AuNP-miR-375, we used flow cytometry analysis to detect Cy3 -positive cells. [score:1]
Importantly, livers in saline or AuNP-miR-NC treated mice were more inhomogeneous in color, were paler, and had more nodular lesions than those in AuNP-miR-375 treated mice. [score:1]
A. Schematic illustration of gold nanoparticles delivered miR-375 for replacement therapy in hepatocellular carcinoma (HCC). [score:1]
After administration of 10 doses, liver weights of mice treated with AuNP-miR-375 were much smaller than those of the controls, with average weights of 3.2, 4.8 and 5.5 g, respectively (Figure 6D). [score:1]
Figure 1 A. Schematic illustration of gold nanoparticles delivered miR-375 for replacement therapy in hepatocellular carcinoma (HCC). [score:1]
We then studied the therapeutic activity of AuNP-miR-375 in primary HCC tumors. [score:1]
This result indicates that AuNPs in the miRNA conjugates did not affect the biological function of miR-375. [score:1]
HepG2 cells were incubated with AuNP-miR-375 in 10 cm culture dishes for 6 h and then observed under a transmission electron microscope (TEM). [score:1]
A. Distribution of miR-375 delivered by AuNP-miR-375 in xenograft mice. [score:1]
Observations revealed that miR-375 appeared in tumor tissues at 1 h post injection (red circle) and the peak time was around 4 h after injections (Figure 5A). [score:1]
For anti-tumor study in xenograft tumor mo del, AuNP-miR-375 or AuNP-miR-NC was injected via intratumoral injection when the tumor volume reached about 100 mm [3], at a dose of 4 nmol/kg miRNA for 4 times at day 7, 10, 14, 17 after HepG2 cells inoculation. [score:1]
[1 to 20 of 117 sentences]
7
[+] score: 163
We then transfected the miR-375-3p mimics or inhibitors into the MC3T3-E1 cells and results showed that both LRP5 and β-catenin were downregulated by miR-375-3p mimics while they were upregulated significantly by miR-375-3p inhibitors (Fig 3A and 3B). [score:11]
We also showed that LRP5 and β-catenin were targeted and downregulated by miR-375-3p, indicating that miR-375-3p might strongly downregulate Wnt signaling pathways and bone formation. [score:9]
0171281.g006 Fig 6 In this study we revealed that miR-375-3p targeted both LRP5 and β-catenin and significantly decreased the expression of β-catenin, indicating that miR-375-3p might strongly suppress Wnt signaling pathways, which were essential for bone formation. [score:7]
In other words, miR-375-3p inhibited its wild type targets more significantly than mutant ones, so resistance of mutant luciferase vectors to miRNAs confirmed the specific targeting. [score:7]
Our data showed that miR-375-3p negatively modulate osteogenesis, so the expression levels of this miRNA in the specimens from patients with osteoporosis were expected to be upregulated. [score:6]
Finally, we tried to have a better understanding of the important downstream effective molecules of miR-375-3p (β-catenin) expression pattern in bone disease. [score:5]
In other words, miR-375-3p mimics decreased the mRNA levels of LRP5 and β-catenin whilst its inhibitor increased their levels, suggesting that β-catenin, the downstream molecule and effector of LRP5 in the Wnt signaling pathways, was also suppressed by miR-375-3p. [score:5]
We further examined the expression levels of the downstream effectors and targets of miR-375-3p (LRP5 and β-catenin) during osteogenesis of MC3T3-E1. [score:5]
Overexpression of miR-375 also induced G1 cell cycle arrest through a decrease in the expression of cyclin D1 and cyclin D3, which was consistent with our data. [score:5]
0171281.g003 Fig 3 (A) Relative expression levels of LRP5 in MC3T3-E1 cells upon transfection of miR-375-3p mimics or inhibitors. [score:5]
In conclusion, our findings reveal miR-375-3p inhibits LRP5 and β-catenin mediated osteogenesis by targeting them, and loss function of LRP5 damages osteogenesis. [score:5]
Taken together, these results suggested that miR-375-3p directly targeted LRP5 and β-catenin in MC3T3-E1 cells. [score:4]
Our results showed that the expression levels of osteoblast differentiation biomarker RUNX2 declined (Fig 1A) while the negative regulators (SOST) of osteogenesis rose sharply (Fig 1B) after the osteoblast precursor cells MC3T3-E1 were transfected with miR-375-3p mimics (2.5 nM), suggesting that miR-375-3p damaged osteogenesis. [score:4]
Clinically, miR-375-3p and its targets LRP5 and β-catenin might be used as diagnostic biomarkers for osteoporosis, osteoarthritis or osteosarcoma because they regulate or disturb osteogenesis. [score:4]
Taken together, these data strongly suggested that the miR-375-3p downregulated β-catenin at both mRNA and protein level. [score:4]
Transfection of miR-375-3p mimics resulted in a significant reduction in luciferase activity in MC3T3-E1 cells transfected with wild type plasmids (Fig 2B and 2C), while the inhibition of luciferase activity by miR-375-3p was abrogated in cells transfected with mutant plasmids (Fig 2B and 2C). [score:3]
Because miR-375-3p has these effects which are similar to miR-214, it might be a promising miRNAs inhibiting bone formation. [score:3]
miR-375-3p arrested the expression levels of LRP5 and β-catenin. [score:3]
do), and LRP5 and β-catenin were predicted to be the targets of miR-375-3p. [score:3]
The expression dynamics of effectors of miR-375-3p during osteogenesis. [score:3]
In our present study we explored the roles of β-catenin targeted by miR-375-3p in osteoblastic differentiation cell mo del MC3T3-E1. [score:3]
miR-375-3p targeted LRP5 and β-catenin. [score:3]
We revealed that miR-375-3p specifically targeted to the LRP5 and β-catenin. [score:3]
For example, medical workers including doctors and nurses could detect the expression levels of miR-375-3p in the patients’ blood or bone tissues. [score:3]
miR-375-3p arrested the expression of LRP5 and β-catenin. [score:3]
miR-375-3p, LRP5 and β-catenin as molecules could be used in translational medicine, which means "laboratory-to-clinic". [score:3]
0171281.g001 Fig 1. (A) Relative expression levels of RUNX2 in MC3T3-E1 cells treated with miR-375-3p mimics. [score:3]
We further studied the downstream targets of miR-375-3p. [score:3]
According to our results, miR-375-3p was a negative regulator of osteogenesis and it decreased the levels of LRP5. [score:2]
Taken together, all these results strongly suggested that miR-375-3p negatively regulated osteogenesis. [score:2]
Several previous studies showed that Wnt signaling pathways were regulated by miR-375 [11, 12, 13]. [score:2]
Most of these studies showed that miR-375 negatively regulated carcinogenesis [23, 24]. [score:2]
In our study we revealed that miR-375 might negatively regulate osteogenesis by inducing cell apoptosis, and further studies of miR-375 should be conducted. [score:2]
Further studies showed that miR-375-3p decreased the levels of LRP5 and β-catenin by directly binding to their 3’UTR. [score:2]
The studies of the effects of miR-375 on osteogenesis and bone formation are few. [score:1]
The current study explored the effects of miR-375-3p and LRP5 on osteogenesis. [score:1]
Fig 2A showed the binding sites between miR-375-3p and the 3’UTR of LRP5 or β-catenin. [score:1]
Most studies of miR-375 focused on the cancer including the osteosarcoma. [score:1]
Thus, studying miR-375-3p in the first place was reasonable. [score:1]
We revealed that miR-375-3p negatively affected osteogenesis. [score:1]
The relevant products of miR-375-3p might be developed into molecular drugs in the future. [score:1]
Increased levels of miR-375-3p in the patients’ bone damaged osteogenesis and bone formation, resulting in osteoporosis. [score:1]
Fig 1C and 1D showed that the percentage of the red (TUNEL positive) cells was much higher in the miR-375-3p mimics treated group than the control group, suggesting that miR-375-3p induced cell apoptosis in MC3T3-E1 cells. [score:1]
In addition, another study also showed that miR-375 increased apoptosis [22]. [score:1]
0171281.g002 Fig 2. (A) The binding sites between miR-375-3p and the 3’UTR of LRP5 and β-catenin. [score:1]
More TUNEL positive staining cells (Red) were found after the cells were transfected with miR-375-3p mimics. [score:1]
To our knowledge, there are no studies of the effects of miR-375-3p on osteogenesis. [score:1]
To further confirm β-catenin was restrained by miR-375-3p at protein level, we conducted immunocytochemistry, and results showed the number of green cells and the degree of green were lower after the cells were treated with miR-375-3p mimics (Fig 3C), indicating that the protein levels of β-catenin were decreased by miR-375-3p. [score:1]
Based on our consistent findings from in vitro studies, it is reasonable to speculate that the blocking of function of miR-375-3p, such as by injection of miR-375-3p antagomir, Wnt/LRP5 signaling can be activated, and therefore the bone loss due to the decreased bone formation in aged mice might be rescued or even reversed. [score:1]
In the present study, we investigated the roles of miR-375-3p in osteogenesis and verified the binding relationship between the miR-375-3p and its targets LRP5 and β-catenin. [score:1]
We co -transfected the MC3T3-E1 cells with the plasmids and miR-375-3p mimics. [score:1]
miR-375-3p might be also as novel therapeutic agents in osteoporosis treatment. [score:1]
In brief, the MC3T3-E1 cells were seeded in 12 well chamber (ibidi, Martinsried, Germany) and transfected with miR-375-3p. [score:1]
So we successfully inserted the wild type and mutant fragments of the 3’UTR of LRP5 containing the binding sites of miR-375-3p into the luciferase vector. [score:1]
miR-375-3p damaged osteogenesis by inducing cell apoptosis. [score:1]
Less green cells were found after the cells were transfected with miR-375-3p mimics. [score:1]
We then hypothesized that the reasons why miR-375-3p damaged osteogenesis were that it induced cell apoptosis. [score:1]
We then silenced the functions of LRP5 to imitate the effects of miR-375-3p. [score:1]
Therefore, in the present study we explored whether miR-375-3p could affect osteogenesis. [score:1]
Further studies including the animal studies of the functions of miR-375-3p are needed. [score:1]
[1 to 20 of 60 sentences]
8
[+] score: 152
miR-375 was expressed at an average of 4 × 10 [4] copies/ng of RNA (Fig. 1 F), whereas miR-200a and miR-200c were expressed about 10-fold higher (Fig. 1, G and H). [score:5]
D–G, expression of miR-375 targets Khsrp (D), Pop4 (E), Chsy1 (F), and Slc16a2 (G) in D14 offspring livers from the miR-375 pup exchange (n = 17–19). [score:5]
Multiplication of relative miR-375 expression levels in Ad-miR-375-infected hepatocytes by baseline expression generated values of copy numbers per hepatocyte. [score:5]
miR-375 Target Gene Validation in Hepatocytes and Correlation to miR-375 Expression. [score:5]
Importantly, quantification of hepatic target gene repression with increasing miR-375 expression implies that such a low copy number would not be sufficient for canonical miRNA function. [score:5]
As expected due to unaltered miR-375 copy numbers, expression levels remained unchanged for all targets, suggesting insufficient uptake of miR-375 to have any functional output in the liver (Fig. 4, D–G). [score:5]
miR-375 copies per cell represent detected copies in virus-infected hepatocytes of a multiplicity of infection of 0–50 (n = 4) on the basis of the standard curve in A, with relative target gene expression normalized to a multiplicity of infection of 0. ApoM was used as a negative (neg) control. [score:5]
Data were plotted against miR-375 copy number adjusted for baseline expression, enabling quantitative correlation between miR-375 and target gene levels in hepatocytes. [score:5]
Interestingly, this contamination was of greater importance in D3 than in D14 samples, perhaps because of smaller milk clot size and, therefore, a greater surface-to-volume ratio, although some variation in D14 was apparent, as demonstrated by the relatively high miR-375 expression detected in other WT pup, 375 KO milk samples by Northern blot analysis (Fig. 2, E and F). [score:3]
Insufficient miR-375 Copy Numbers in the Liver to Induce Target Gene Engagement. [score:3]
These comparisons reveal that miR-375 and miR-200c are genuinely highly expressed in milk clots and are not solely the result of contaminating cells or secretions. [score:3]
In this study, we chose to concentrate on miR-375 because of its robust expression in murine milk as well as its unique sequence, enabling its unequivocal identification. [score:3]
Incubation of milk clots from 375 KO pups receiving WT milk with intestinal contents from 375 KO pups receiving 375 KO milk, assumed to contain intestinal and pancreatic digestive enzymes as well as bile, revealed a time -dependent decrease in miR-375 expression, suggesting that milk miRNAs may, in fact, be degraded by the digestive system (Fig. 5 C). [score:3]
Four predicted miR-375 target genes, Khsrp, Pop4, Chsy1, and Slc16a2, revealed dose -dependent repression with increasing miR-375 copy number in infected hepatocytes (Fig. 4 B). [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
E, Northern blot analysis of miR-375 expression in D14 milk (14 μg of RNA pooled from three to four pups), with mammary tissue (14 μg of RNA) used as the positive control. [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
Systematic analysis of miR-375 and miR-200c expression in pup tissues of KO pups receiving WT milk provided no evidence of miRNA uptake from milk. [score:3]
This clearly indicates that, even if minimal miRNA uptake from milk were to occur, perhaps undetectable via qPCR, then it would not be sufficient to enable miR-375 to carry out its canonical role of repressing gene expression. [score:3]
As an additional example of murine milk miRNA, we selected miR-200c, expressed roughly 10-fold higher than miR-375 in murine milk. [score:3]
In our study, we chose to focus on D14 of lactation because of the persisting expression of both miR-375 and miR-200c in milk at this later lactation day. [score:3]
The source of miR-375 in WT pups drinking milk from KO foster mothers likely comes from epithelial cells of the stomach because miR-375 is highly expressed in this tissue (data not shown). [score:3]
B, miR-375 target gene fold-change relative to miR-375 copy number in Ad-miR-375-infected hepatocytes. [score:3]
To prevent confounding effects of miRNAs that are derived from tissues of suckling offspring, we utilized two different miRNA -deficient mouse strains as a mo del system, the miR-375 knockout (375 KO) mouse and the miR-200c/141 knockout (200c KO) mouse. [score:3]
Four target genes were selected (Khsrp, Pop4, Chsy1, and Slc16a2), and their relative expression was evaluated by qPCR in Ad-miR-375-infected hepatocytes. [score:3]
miR-375 Overexpression and Absolute Quantification in Hepatocytes. [score:3]
To further examine expression patterns throughout lactation, miR-375 and two representative members of the miR-200 family, miR-200a and miR-200c, were absolutely quantified in milk from pups ranging in age from day 1–14 of lactation. [score:3]
To quantitatively assess the copy number of miR-375 necessary for target gene repression, we used primary hepatocytes that were infected at increasing multiplicities of infection of Ad-miR-375 as a mo del system. [score:3]
The plasma fraction of blood was analyzed as the next possible compartment of miRNA uptake, again revealing no difference in miR-375 expression between 375 KO pups receiving WT or 375 KO milk (Fig. 3 D). [score:3]
Our study accentuates this lack of uptake even further because the miR-375 copy number difference between WT milk and 375 KO milk is more than 1000-fold (a difference of 10 Ct cycles), as opposed to a 31-fold copy number difference between WT milk and miR-30b -overexpressing gastric milk. [score:3]
Importantly, both miR-375 and miR-200c have been detected in rat milk whey (18) and have been found to be among the top 10 most expressed miRNAs in porcine milk exosomes (17) and, in the case of miR-200c, in human milk as well (21). [score:3]
Hepatocytes were isolated as described previously (33), plated, and infected in quadruplicates with a recombinant adenovirus expressing miR-375 (Ad-miR-375) (24) at 7 multiplicities of infection: 0, 1.5, 3, 6, 12.5, 25, and 50. [score:3]
A–K, relative (Rel) miR-375 expression or copy number per microliter of plasma in D14 upper enterocytes (jejunum) (WT pups, n = 8; KO pups, n = 6) (A), D14 lower enterocytes (ileum, n = 8) (B), D14 colon enterocytes (n = 8) (C), D14 plasma (WT pups, n = 10; KO pups, n = 7) (D), D14 liver (n = 14) (E), D14 spleen (n = 9) (F), D3 jejunum (WT pups, n = 8; KO pups, n = 6) (G), D3 ileum (WT pups, n = 8; KO pups, n = 6) (H), D3 colon enterocytes (WT pups, n = 8; KO pups, n = 6) (I), D3 plasma (n = 6–8) (J), and D3 liver (WT pups, n = 14; KO pups, n = 8) (K). [score:3]
FIGURE 4. Evaluation of miR-375 target gene regulation using hepatocytes as a mo del. [score:2]
miR-375 was originally described as pancreas-specific and as an important regulator of insulin secretion and α and β cell mass (24, 25). [score:2]
Nevertheless, the data show that, for D14 milk, the majority of miR-375 comes from the milk itself because there was no significant difference between WT pups and 375 KO pups receiving WT milk (Fig. 2 B). [score:1]
No Evidence of miRNA Uptake from Milk into Pup Tissues andTo determine whether miRNAs are taken up from maternal milk into offspring tissues, miR-375 expression was evaluated at several potential levels of uptake in D14 offspring from the study groups described previously. [score:1]
FIGURE 3. miR-375 and miR-200c are not taken up into offspring tissues or blood. [score:1]
For the miR-375 portion of this study, offspring of the WT and 375 KO genotypes were generated by setting up appropriate matings, and litters were exchanged immediately after birth to generate the following four study groups: WT pups receiving WT milk (WT pup, WT milk), WT pups receiving KO milk (WT pup, KO milk), KO pups receiving WT milk (KO pup, WT milk), and KO pups receiving KO milk (KO pup, KO milk) (Fig. 2 A). [score:1]
B and C, miR-375 copy number per nanogram of RNA in D14 gastric milk (B) and D3 gastric milk (C) from pups of the miR-375 pup exchange (n = 4). [score:1]
This suggests that a low number of miR-375 copies may survive the digestive tract but not in a consistent manner. [score:1]
miR-375 was measured as target of interest and miR-200c as a positive control for RNA loading. [score:1]
This was confirmed further by Northern blot analysis, in which 40 μg of RNA from intestinal contents was loaded to maximize the potential to detect any miR-375 copies (Fig. 5 B). [score:1]
Poy M. N., Hausser J., Trajkovski M., Braun M., Collins S., Rorsman P., Zavolan M., Stoffel M. (2009) miR-375 maintains normal pancreatic α- and β-cell mass. [score:1]
Nevertheless, less than 10% of miR-375 copies remained after 2 h of incubation, suggesting that, under physiological digestive conditions, exosomes can be disrupted effectively, thereby subjecting milk-derived miRNAs to enzymatic degradation. [score:1]
Furthermore, miR-375 uptake was also undetectable in gastric epithelium (data not shown). [score:1]
Of note, the miRNA copy number in the stomach contents of avocado-fed mice (≈1 × 10 [7] copies of miR-156a and miR-168a) was in a similar range as that of milk-fed pups in our study (estimated at 2.5 × 10 [8] copies of miR-375), assuming the average D14 milk clot to have a mass of 100 mg with 70 ng of RNA/mg. [score:1]
FIGURE 5. miR-375 is virtually absent from intestinal contents. [score:1]
For absolute quantification of miRNAs, synthetic miRNAs comprising the mature miRNA sequence (Sigma) were serially diluted in water and used as input for RT-qPCR reactions, generating standard curves against which to compare experimental cycle threshold (Ct) values (mmu-miR-375-3p, 5′-UUUGUUCGUUCGGCUCGCGUGA-3′; mmu-miR-200a-3p, 5′-UAACACUGUCUGGUAACGAUGU-3′; mmu-miR-200c-3p, 5′-UAAUACUGCCGGGUAAUGAUGGA-3′; mmu-let-7f-5p, 5′-UGAGGUAGUAGAUUGUAUAGUU-3′; mmu-miR-194-5p, 5′-UGUAACAGCAACUCCAUGUGGA-3′; mmu-miR-122-5p, 5′-UGGAGUGUGACAAUGGUGUUUG-3′; mmu-miR-33-5p, 5′-GUGCAUUGUAGUUGCAUUGCA-3′; and mmu-miR-16-5p, 5′-UAGCAGCACGUAAAUAUUGGCG-3′). [score:1]
Yan J. W., Lin J. S., He X. X. (2014) The emerging role of miR-375 in cancer. [score:1]
B, miR-375 Northern blot analysis of D14 intestinal contents (40 μg) with adult mammary tissue (14 μg) used as a positive control. [score:1]
To determine whether milk miRNAs can be degraded by the mouse digestive system, murine digestive conditions were mimicked by incubating the gastric milk of D14 375 KO offspring receiving WT milk with the intestinal contents of 375 KO offspring receiving 375 KO milk (in each case pooled from eight offspring), in this manner eliminating all sources of miR-375 other than the milk itself. [score:1]
F, density quantification of miR-375 Northern blot analysis normalized to the mammary gland. [score:1]
A, miR-375 copy number in stomach milk and downstream intestinal contents of D14 375 KO offspring (milk, n = 8; intestinal contents, n = 12). [score:1]
Although the average miR-375 Ct value in the intestinal contents of 375 KO pups receiving WT milk was slightly above the detection limit, several individual pups presented values below, which was not the case for 375 KO pups receiving 375 KO milk. [score:1]
These data are in agreement with our results because we also found less than one copy per cell of miR-375 in tissues of 375 KO pups receiving WT milk, following the assumption that the average cell has 10 pg of RNA. [score:1]
A, standard curve built by spiking non-infected hepatocytes with serially diluted synthetic miR-375 (n = 3). [score:1]
Importantly, the choice of WT milk from 375 KO pups eliminated any potential contribution of miR-375 copies by pup cells. [score:1]
miR-375 and miR-200c probes were designed as the reverse complement of the mature miRNA sequence (Sigma; miR-375, 5′-TCACGCGAGCCGAACGAACAAA-3′; miR-200c, 5′-TCCATCATTACCCGGCAGTATTA-3′), and 20 pmol was labeled with [γ- [32]P]dATP (PerkinElmer Life Sciences) using T4 polynucleotide kinase (New England Biolabs). [score:1]
Importantly, the miR-375 copy number across all tissues and plasma samples in 375 KO pups, regardless of milk, was always at or below the detection limit of qPCR. [score:1]
L, tissue panel comparing endogenous miR-375 level/10 pg of RNA (roughly one cell), represented by WT pups receiving WT milk, and exogenous miR-375 level, represented by 375 KO pups receiving WT milk (n = 6–10). [score:1]
F–H, copy number per nanogram of RNA of miR-375 (F), miR-200a (G), and miR-200c (H) in WT milk throughout lactation (n = 4–6). [score:1]
miR-375 and miR-200c analysis of pup plasma, however, revealed no further indication of miRNA uptake. [score:1]
Our final observation that only few copies of miR-375 remain in the contents of the small intestine is important in understanding the fate of milk miRNAs. [score:1]
To determine whether miRNAs are taken up from maternal milk into offspring tissues, miR-375 expression was evaluated at several potential levels of uptake in D14 offspring from the study groups described previously. [score:1]
Importantly, this repression only began to be substantial at ∼10 [4] copies of miR-375/cell. [score:1]
For absolute quantification of miR-375 in hepatocytes, non-infected hepatocyte lysates were spiked with serially diluted synthetic miR-375 as well as miR-33 and miR-16 as controls. [score:1]
A standard curve was generated via qPCR, comparing synthetic miR-375 copies spiked into hepatocyte lysates with miR-375 copies detected, revealing a baseline level of ∼20 copies of miR-375/cell. [score:1]
[1 to 20 of 68 sentences]
9
[+] score: 117
Furthermore, we found that the inhibition of miR375 hugely up-regulated the expression level of p-p38/p38, p-Erk/Erk and IRF7, but down-regulated the expression level of p-IkBa/IkBa and p-Jnk/Jnk which suggested activation of P38, Erk, NF-κB, and IFN signaling pathway. [score:13]
Then, we found that over expressed miR375 significant decreased the expression level of p-IkBa/IkBa and IRF7, whilst the over expression of miR181b significant decreased the expression level of p-IkBa/IkBa, IRF3 and IRF7, but significant increased the expression level of p-Erk/Erk. [score:11]
Each 100 nM miRNA inhibitor (micrOFF™ mmu-miR-181b-3p inhibitor, micrOFF™ mmu-miR-375-5p inhibitor, and micrOFF™ inhibitor Negative Control) was transfected into BMDCs for 24 h to analyze their effect on DCs via detection of- phenotypic alteration with FACS. [score:9]
While inhibition of miR375 greatly down-regulated the MFI of CD80 and CD86, but up-regulated the MFI of CD40 and MHCII when compared with the blank group (Figures 4A,B). [score:8]
Our results show that IRF-3 and IRF-7 were all down-regulated in miR375 and miR181b groups, while inhibition of endogenous miR375 and miR181b significantly decreases IRF-3 and IRF7, suggesting that miR375 and miR181b are necessary for the production of IFN-α. [score:6]
For the miRNAs down-regulated by H9N2, the PB1 segment also mostly reduced their expression, especially for miR339, miR375, and miR146 (Figures 2A,B). [score:6]
As H9N2 and PB1 significantly down-regulated the expression of miR375 (Figure 2), we examined the functions of miR375 in BMDCs. [score:6]
On the other hand, our results also suggest that miR375 can inhibit maturation of DC by decreasing expression of surface markers. [score:5]
PB1 over -expression increased the levels of CD80-, CD86-, MHCII-, and CD40 in cultured BMDCs, whilst the inhibition of endogenous miR375 had the opposite effect (Figures 4C,D). [score:5]
Also, we demonstrated that expression of miR375 was suppressed by PB1. [score:5]
MiR375 also modestly decreased the expression of CD80; this effect was reversed by inhibiting endogenous miR375. [score:5]
FACS revealed that the inhibition of endogenous miR375 and miR181b decreased the expression of co-stimulatory molecules (CD80/CD86 and CD40) and MHCII, which was induced by PB1 (P < 0.05; Figures 4C,D). [score:5]
To detect whether the phenotypic alteration of BMDCs induced by PB1 was mediated by miR181b or miR375, miRNAs inhibitors were transfected into BMDCs for 4 h as described above, before PB1 over -expression plasmid was transfected. [score:5]
Our research suggests that increased expression of miR375 attenuated the DC immune responses induced by PB1. [score:3]
Inhibition of endogenous miR375 and miR181b blocked PB1 -induced phenotypic alterations in BMDCs. [score:3]
In this report, we focused on miR375, which exhibited decreased expression in the PB1 segment stimulated group. [score:3]
We propose that PB1 may enhance the function of DC by down -regulating miR375. [score:2]
The immune function of miR375 and miR181b in regulating mice BMDCs. [score:2]
Here, we demonstrated a previously unidentified role for PB1 in the regulation of murine immune responses of DCs, which was mediated by miR375 and miR181b. [score:2]
FACS showed that miR375 over -expression decreased the percentage of CD80-, CD86-, CD40-, and MHCII when compared with the pSilencer4.1 group. [score:2]
MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway. [score:2]
BMDCs were transfect with PB1, miR375, miR181b, In-miR375, and In-miR181b for 48 h. Then cells were collected and washed with PBS three times for the next experiments. [score:1]
MicroRNA-375 was observed to influence cell proliferation, apoptosis and differentiation through the Notch signaling pathway, while microRNA-181b modulated the secretion of TNF-α and IL-1β in macrophages (Zhang et al., 2015; Wang et al., 2016). [score:1]
Four selected miRNAs (miR375 and miR181b) were amplified and then cloned into pSilencer4.1. [score:1]
Supplementary Image 2Identification and construction of pSilencer-miR375 and pSilencer-miR181b by digestion with BamHI and HindIII. [score:1]
Previous studies demonstrated that PB1 and a number of miRNAs, including miR375 and miR181b, can influence the phenotype of BMDCs. [score:1]
Effects on signaling pathways stimulated by PB1, miR375 and miR181b. [score:1]
MiRNAs (miR-375 and miR-181) were amplified and cloned into pSilencer4.1 (Invitrogen). [score:1]
Figure 4 The immune function of BMDCs stimulated by miR375 andmiR181b. [score:1]
MiR181b and miR375 inhibitors, which were chemically modified single stranded RNAs, were designed and purchased from RiboBio to evaluate miRNA function (Guangzhou, China). [score:1]
[1 to 20 of 30 sentences]
10
[+] score: 96
Transfection of mimics of miR-186, miR-24, and/or miR-375 downregulates Gabra4 expressionWe assessed the effects of mimics or inhibitors of miR-155, miR-186, miR-24, or miR-375 on changes in Gabra4 expression in control and AW8 neurons. [score:10]
This may suggest that the upregulation in expression of miR-186, miR-24 and/or miR-375 during AW modulates Gabra4 expression at the posttranscriptional level. [score:8]
Transfection with molecular mimics of miR-186, miR-24, or miR-375 also downregulated Gabra4 expression, whereas transfection with the corresponding inhibitors of these microRNAs normalized Gabra4 expression in AW neurons to the level measured in control neurons. [score:8]
This study provides evidence for a novel role for miR-186, miR-24 and/or miR-375 in mediating the effects of AW on downregulation of Gabra4 expression in cultured mouse cortical neurons. [score:6]
We determined changes in miR-155, miR-186, miR-24, and miR-375 expression at various time intervals after onset of AW, and found that these miRNAs were significantly upregulated at AW5 min, AW6, AW8, AW12, and/or AW24 h (Fig. 5A– D). [score:6]
Figure 6Transfection of mimics to miR-186, miR-24, or miR-375 into cortical neurons downregulates Gabra4 expression during AW. [score:6]
Figure 5Time course of upregulation of miR-155, miR-186, miR-24, and miR-375 gene expression during AW in cultured mouse cortical neurons. [score:6]
Transfection of mimics of miR-186, miR-24, and/or miR-375 downregulates Gabra4 expression. [score:6]
microRNA profiling in neurons undergoing AW revealed upregulation in the expression of miR-155, miR-186, miR-24, and miR-375 after 8 h of AW. [score:6]
We assessed the effects of mimics or inhibitors of miR-155, miR-186, miR-24, or miR-375 on changes in Gabra4 expression in control and AW8 neurons. [score:5]
The sequence of upregulated miRNAs (miR-155, miR-186, miR-24, and miR-375) from TLDA card was verified as the 5p or 3p strand using www. [score:4]
Promoter-reporter experiments supported the idea that miR-155, miR-186, miR-24, miR-27b, or miR-375 bind to the 3′UTR of Gabra4 and thereby inhibit protein production. [score:3]
Control neurons (C) or AW8 neurons were transfected with scrambled oligos (30 nmol/L), mimic (30 nmol/L) or inhibitor (100 nM) of (A) miR-186, (B) miR-24, (C) miR-375, (D) miR-155. [score:3]
We confirmed changes in expression of selected miRNAs (miR-155, miR-186, miR-24, miR-375) by qPCR. [score:3]
Several bioinformatic databases and prediction algorithms showed that the selected miRNAs (miR-155, miR-186, miR-24, miR-27b, and miR-375) have a large number of potential target genes including Gabra4. [score:3]
To address this, we focused on the effects of miR-155, miR-186, miR-24 and/or miR-375 on changes in Gabra4 expression during AW. [score:3]
miR-375 mimic reduced Gabra4 expression, but this reduction was similar to that observed in AW8 + Scr neurons (Fig. 6C). [score:3]
Cortical neurons were seeded at 10 [6] cells/mL in a 12-well plate then transfected at DIV8 for 2–3 h with mimic or inhibitor of miR-155, miR-186, miR-24, or miR-375 following the manufacturer’s instructions. [score:3]
miR-155, miR-186, miR-24, miR-27b, and miR-375 have predicted binding sites along the 3′UTR of Gabra4 (1965 bp, NM_010251) (www. [score:1]
Figure 7Transfection of miR-155, miR-186, miR-24, miR-27b, or miR-375 mimics decreases luciferase activity and Gabra4 protein levels in cultured mouse cortical neurons. [score:1]
Cortical neurons were cotransfected with pMIR-Gal + pMIR-Luc (Gal/Luc), pMIR-Gal + pMIR-Luc-3′UTR in the absence (Gal/Luc-3′UTR) or presence of scrambled oligo (Gal/Luc-3′UTR + Scr) or mimic of miR-155 (m155), miR-186 (m186), miR-24 (m24), miR-27b (m27b), or miR-375 (m375). [score:1]
miR-375 has a poorly conserved seed match among vertebrates at positions 511–517 (7mer-1A) of Gabra4 3′UTR. [score:1]
[1 to 20 of 22 sentences]
11
[+] score: 94
Since this pattern of expression in different animals presumably results from independent insertions into random genomic loci, we conclude that the region upstream of miR-375 contains the pri-miR-375 gene promoter, and is capable of directing GFP expression selectively to pancreatic islets in vivo. [score:6]
The aim of this study was to determine whether transcriptional control plays a significant role in directing cell-specific expression of the pri-miR-375 gene which is expressed selectively in pancreatic islets. [score:6]
Taken together, these results suggest that selective expression of miR-375 is controlled by a number of transcription factors that participate in the transcriptional cascade that shapes pancreatic development, and is therefore consistent with the possibility that miR-375 itself is a component of this cascade Thus far, relatively few potential targets of miR-375 have been experimentally validated [11]. [score:6]
Recently, PDK1, a mediator of the PI3K/PKB signaling cascade, was identified as a potential target of miR-375; in the same study, glucose was shown to inhibit production of miR-375 [35]. [score:5]
The identification of miR-375 as a likely target for key pancreatic transcription factors further strengthens the emerging notion that miRNAs are involved in regulatory networks controlling pancreatic development. [score:5]
A role for miR-375 has also been demonstrated in pancreatic islet development, through use of morpholino oligonucleotides to reduce expression of miR-375 in developing zebrafish embryos [13]. [score:4]
The possibility that glucose modulates miR-375 expression through regulation of promoter activity needs to be further explored. [score:4]
This does not exclude possible involvement of post-transcriptional control mechanisms, and indeed a recent study raises the possibility that expression of miR-375 in the developing endocrine pancreas may be controlled in part by selective processing [32]. [score:3]
Expression of GFP in pancreas and islets of miR-375-EGFP transgenic mice. [score:3]
Portions of the miR-375 upstream region were deleted according to the location of the conserved blocks (Fig. 1) and ability to drive expression of firefly luciferase reporter gene was determined in the context of the promoter-less pGL3-basic vector. [score:3]
More detailed analyses of the transcriptional control mechanisms controlling miR-375 and other selectively expressed miRNA genes will help to shed light on these networks, and permit a more detailed understanding of many aspects of cell function in both physiological and pathological states. [score:3]
The aim of the current study was to determine the molecular basis for the selective expression of the pri-miR-375 gene in pancreatic islets. [score:3]
A. Portions of the miR-375 upstream region were deleted according to the location of the conserved blocks (Fig. 1) and ability to drive expression of firefly luciferase reporter gene was determined in the context of the promoter-less pGL3-basic vector. [score:3]
This raises the possibility that the miR-375 gene may be regulated by bHLH transcription factors such as Ngn3 and NeuroD1, which are known to play a central role in pancreas endocrine development and in mature beta cell function respectively [33]. [score:3]
miR-375 is selectively expressed in pancreatic islets [8], [11]. [score:3]
Our study provides some indications of transcription factors that may be involved in regulating the activity of the pri-miR-375 promoter. [score:2]
miR-375 gene regulatory region. [score:2]
A and B. Nucleotide sequence of conserved regions of mouse miR-375 promoter. [score:1]
To further examine the idea that the conserved E-boxes of the miR-375 promoter act as binding sites for transcription factors of the bHLH family, we tested the effects of the dominant negative HLH proteins Id2 and Id3 [28]. [score:1]
A plasmid (miR-375-EGFP) containing the mouse miR-375 gene upstream region (768 bp) was generated by replacement of the firefly luciferase open reading frame in pGL3-375a with the EGFP open reading frame (ORF) from the plasmid pEGFP-N1 (using XbaI and BglII sites). [score:1]
Activity of the miR-375 promoter in cultured cells. [score:1]
Identification of conserved regions upstream of miR-375. [score:1]
Immunofluorescence analysis of pancreas from miR-375-EGFP transgenic mice. [score:1]
These data suggest that transcription of the pri-miR-375 indeed initiates 24 bases downstream of the conserved TATA box, and that the conserved blocks 1 and 2 contain the promoter of the miR-375 gene. [score:1]
Since mammalian transcriptional control regions often contain transcriptional enhancers, we tested the ability of the upstream miR-375 sequences to activate transcription from the heterologous promoter TK. [score:1]
Transgenic mice containing a miR-375-EGFP construct. [score:1]
0005033.g001 Figure 1 Genomic locus of the mouse miR-375 gene and upstream conserved regions from UCSC browser (upper figure) with a graphic representation of the conserved regions upstream of the pre-miR-375 sequence (lower figure). [score:1]
Function of pri-miR-375 promoter in vivo. [score:1]
Although in some sporadic cases, additional bands were obtained (marked with small arrowheads in Fig. 3B), sequence analysis showed that they were either non-relevant (sequences unrelated to miR-375) or shorter species, most likely resulting from premature polymerase termination caused by high GC content, or stable secondary structure of the pri-miR-375. [score:1]
Mapping of transcription start site of miR-375 gene by 5′-RACE. [score:1]
This experiment therefore identifies multiple cis-elements required for full activity of the miR-375 promoter. [score:1]
B. Alignment of miR-375 upstream sequences (from −96 to +244, relative to transcription start site) of mouse, rat and human. [score:1]
The location of conserved blocks 1–4, and pre-miR-375 is indicated. [score:1]
The putative promoter region of the miR-375 gene (construct 375b) was ligated upstream to the firefly luciferase reporter gene in the promoter-less pGL3-basic vector. [score:1]
Transgenic miR-375-EGFP mice were dissected and examined under an Olympus binocular microscope (SZX12) for GFP detection. [score:1]
0005033.g004 Figure 4 The putative promoter region of the miR-375 gene (construct 375b) was ligated upstream to the firefly luciferase reporter gene in the promoter-less pGL3-basic vector. [score:1]
Genomic locus of the mouse miR-375 gene and upstream conserved regions from UCSC browser (upper figure) with a graphic representation of the conserved regions upstream of the pre-miR-375 sequence (lower figure). [score:1]
Using the 5′-RACE procedure with mRNA derived from the beta cell line βTC1 [24], we were unable to identify a discrete band corresponding to the start site of the endogenous pri-miR-375, presumably because of rapid processing of the precursor molecule [27]. [score:1]
Strikingly, this putative start site is 24 bases downstream of an evolutionarily conserved TATA box located at the 3′ end of conserved block 2. Additional 5′-RACE experiments performed using primers distributed in the miR-375 regulatory region identified the same start site (not shown). [score:1]
Stars indicate nucleotides conserved among mouse, rat, and human miR-375 genes. [score:1]
0005033.g006 Figure 6 A and B. Nucleotide sequence of conserved regions of mouse miR-375 promoter. [score:1]
A DNA fragment (MluI-SalI) containing the miR-375 promoter and the EGFP ORF (devoid of vector sequences) was purified and microinjected to fertilized mouse oocytes. [score:1]
Indeed, recent chromatin immunoprecipitation experiments have shown that NeuroD1 interacts with conserved sequences both upstream and downstream of the miR-375 gene [34]. [score:1]
Preferential activity of the pri-miR-375 promoter was also seen on comparison with an additional non-beta cell line NIH-3T3 (data not shown). [score:1]
In order to confirm that the 768 bp upstream of miR-375 contains a functional promoter, we wished to identify the transcription start site of the endogenous pri-miR-375 transcript. [score:1]
Taken together, these data show that blocks 1 and 2 contain the promoter of the pri-miR-375 gene, and that the TATA box area is critical for promoter activity. [score:1]
The sequence indicated a transcription start site 259 bases upstream of the pre-miR-375 start (marked with large arrowhead in Fig. 3B, and an arrow in Fig. 3C). [score:1]
[1 to 20 of 47 sentences]
12
[+] score: 91
MiR-375-3p which is highly expressed in pancreatic beta cells regulates the expression of pyruvate dehydrogenase kinase, isozyme 1 (Pdk1) and myotrophin (Mtpn) mRNAs 44, 45. [score:5]
The function of miR-709 in pancreas is not clear, whereas it is reported that miR-375-3p is expressed in pancreatic beta cells and regulates the secretion of insulin 27, 28. [score:4]
Radiation -induced cell death triggers decrease of miR-375-3p expression in pancreas and intestine. [score:3]
Expression values of miR-375-3p and miR-709 were determined by the comparative Ct method and normalized using the values of heart and testis set at 1.0, respectively. [score:3]
Figure 4High expression of miR-375-3p and miR-709 in pancreas. [score:3]
Analysis of serum miR-375-3p expression as a first screening test of many specimens may be helpful for predicting a strong ARS. [score:3]
As shown in Fig.   4a, miR-375-3p is also expressed in the intestine. [score:3]
In order to identify the possible origin of the radiation -induced miR-375-3p and miR-709 in sera of mice, we analyzed the expressions of miR-375-3p and miR-709 by in various cells and organs of the control animals. [score:3]
Expression levels of miR-375-3p and miR-709 were determined by using the comparative Ct methods. [score:3]
MiR-375-3p and miR-709 was highly expressed in pancreas (Fig.   4a and b). [score:3]
A deeper analysis is necessary to identify the relationship between the radiation dose and serum miR-375-3p expression. [score:3]
Expression levels of miR-375-3p were determined by using the comparative Ct methods. [score:3]
This observation correlated with a significant reduction of the miR-375-3p level in these organs (Fig.   5b and e), which suggests that miR-375-3p may be released from cellular to extracellular space by radiation -induced cell death, leading to its high expression in blood serum (Fig.   6). [score:3]
Therefore, we analyzed cell death and the expressions of miR-375-3p in this organ. [score:3]
We analyzed the expression of miR-375-3p using culture supernatants centrifuged at 12,000 G (including free-miR-375-3p, large EVs, and small EVs), supernatants centrifuged at 12,000 G (including free-miR-375-3p and small EVs), and EV pellets centrifuged at 110,000 G (Fig.   6c). [score:3]
Figure 5The expression of miR-375-3p decreases in irradiated pancreas and intestine. [score:3]
MiR-375-3p and miR-709 are highly expressed in pancreas of control mice. [score:3]
Figure 6The expression of miR-375-3p in pancreatic beta cell RIN-5F exposed to 7 Gy of X-rays. [score:3]
The expressions of miR-375-3p in pancreas significantly decreased at 48 h and 72 h after 7 Gy irradiation compared with 0 Gy: respectively, 0.68-fold (P ≤ 0.05) and 0.41-fold (P ≤ 0.01) (Fig.   5b). [score:2]
At 48 h and 72 h after 7 Gy irradiation the expression of miR-375-3p in serum was significantly increased as compared with 0 Gy: respectively, 2.35-fold (P ≤ 0.05) and 5.91-fold (P ≤ 0.01) (Fig.   3a). [score:2]
The expression of miR-375-3p in serum was significantly increased at 24 h, 48 h and 72 h after 7 Gy irradiation as compared with 0 Gy: respectively, 2.07-fold (P ≤ 0.01), 1.82-fold (P ≤ 0.01) and 3.23-fold (P ≤ 0.05) (Fig.   3d). [score:2]
Using a nanoString nCounter mouse miRNA expression assay (nanoString Technologies), Jacob et al. reported that serum miR-375-3p in mice increased already after 24 h following 8 Gy irradiation [25]. [score:2]
It indicates that injury of pancreatic beta cells is the major source of increased miR-375-3p levels in the blood. [score:1]
In our laboratory, it takes about one day (including blood sampling,, synthesis of cDNA and) for the analysis of serum miR-375-3p. [score:1]
It is unclear whether other miRNAs except for miR-375-3p may serve as biomarkers of a strong ARS. [score:1]
This suggests that the high, radiation -induced levels of miR-375-3p and miR-709 in serum may be released from this organ. [score:1]
In addition, we could show that radiation -induced cell death in pancreas and intestine is the major source of the high miR-375-3p level in blood serum. [score:1]
These results suggest that miR-375-3p may leak from cellular to extracellular space due to radiation -induced cell death such as apoptosis and/or necrosis. [score:1]
MiR-375-3p is released from pancreatic beta cells exposed to 7 Gy of X-ray to extracellular space in vitroIn order to analyze whether pancreatic beta cells release miR-375-3p to extracellular space following high dose radiation exposure, we investigated the expression of miR-375-3p in culture supernatants of pancreatic beta cells RIN-5F exposed to 7 Gy of X-rays. [score:1]
In addition, we investigated the expressions of miR-375-3p and miR-709 in pancreas exposed to 7 Gy of X-rays. [score:1]
These values suggest that miR-375-3p and miR-709 in serum are sensitive and specific biomarkers of exposure to 7 Gy. [score:1]
MiR-375-3p and miR-709 levels increase in serum of mice exposed to 7 Gy of X-ray. [score:1]
In order to investigate whether serum miR-375-3p is expressed inside EVs, we isolated RNAs from EV pellets collected using an ExoQuick Solution (System Biosciences, San Francisco, CA, USA) and then performed. [score:1]
These results suggest that radiation -induced death of pancreatic beta cells is associated with the release of EVs containing miR-375-3p. [score:1]
Our results suggest that radiation -induced injury in the pancreas and intestine is the source of increased miR-375-3p in serum. [score:1]
We found that serum miR-375-3p increased after 48 h and 72 h in mice exposed to an X-ray dose of 7 Gy (Fig.   3a). [score:1]
The results demonstrated that miR-375-3p released from RIN-5F cells exposed to 7 Gy of X-rays was included inside EVs. [score:1]
In order to analyze whether pancreatic beta cells release miR-375-3p to extracellular space following high dose radiation exposure, we investigated the expression of miR-375-3p in culture supernatants of pancreatic beta cells RIN-5F exposed to 7 Gy of X-rays. [score:1]
RIN-5F cells expressed miR-375-3p and U6 snRNA (Fig.   6a) indicating that they have the characteristics of pancreatic beta cells. [score:1]
Consequently, it is possible that miR-375-3p is not a suitable marker of exposure to low radiation doses. [score:1]
Therefore, elevated miR-375-3p in serum may be a predictor of tissue damage by exposure to a high radiation dose. [score:1]
It was reported that miR-375-3p increases in mouse plasma of type I diabetes mo del mice treated by streptozotocin which specifically injures pancreatic beta cells [48]. [score:1]
This result suggests that EVs are the origin of increased serum miR-375-3p levels in irradiated mice. [score:1]
8 Gy is higher than the dose used by us, but it is possible that serum miR-375-3p might serve as an early biomarker of a strong ARS after doses in excess of 7 Gy. [score:1]
We found that serum miR-375-3p and miR-709 increased in mice exposed to an X-ray dose of 7 Gy which induced a strong ARS. [score:1]
We chose miR-375-3p and miR-709 as candidate serum biomarkers of a strong ARS because these miRNAs were most frequently reported among increasing 12 miRNAs. [score:1]
The expression of (a) miR-375-3p and (b) miR-709 in serum of mice at 0 h, 24 h, 48 h and 72 h after 7 Gy X-irradiation (each n = 4−7), measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). [score:1]
If point-of-care testing of serum/plasma miR-375-3p as a biomarker of type I diabetes develops, this system may be able to be used as a biomarker of a lethal dose received by victims of severe radiation accidents. [score:1]
[1 to 20 of 48 sentences]
13
[+] score: 64
To illustrate the potential regulatory impact of these 5′-shifted isomiRs we used TargetScan [43] to predict targets for miR-375 and its 5′-shifted isomiRs, miR-375+1 and miR-375-1. While miR-375 has 390 predicted targets conserved between human and mouse, miR-375-1 targets has more than twice that many, and strikingly, miR-375+1 has only 14 (Fig. 3C). [score:10]
Mtpn is a known target of 5′-reference miR-375 but not predicted as a target for either of the 5′-shifted miR-375 isomiRs; Atp6v0c is predicted to be preferentially targeted by miR-375+1; and Cdc42 is predicted to be preferentially targeted by miR-375-1. The x-axis lists the gene symbols for each of three genes tested. [score:9]
To further evaluate the putative differential targeting of the miR-375 5′-isomiRs, we selected the following three genes: Mtpn, which regulates insulin secretion, is a known target of the 5′-reference miR-375 [6], but is not predicted to be targeted by the 5′-shifted isoforms; Atp6v0c, which mediates glucose-sensitive intracellular vesicular transport and is predicted to be preferentially targeted by the 5′-shifted isoform miR-375+1; and Cdc42, which is essential for the second phase of insulin secretion and is predicted to be preferentially targeted by the 5′-shifted isoform miR-375-1. We transfected MIN6 cells with (1) transfection reagent only (mock), (2) 10 nM of miR-375 mimic, or (3) 10 nM of a mimic for one of the 5′-shifted isomiRs of miR-375, and measured the mRNA levels of each of the three genes by RT-qPCR. [score:8]
We evaluated several predicted gene targets of our top candidate regulatory hub, miR-29, and demonstrated the potential of the 5′-shifted isomiRs miR-375+1 and miR-375-1 to differentially regulate gene expression in MIN6 cells. [score:5]
Among the remaining 21, two were in the set of top 20 most highly expressed miRNAs in each of the MIN6 and human datasets: miR-375+1 and miR-375-1. Many of the 5′-shifted isomiRs, such as miR-375+1, miR-375-1, and miR-27b-3p-1, were expressed at similar levels in MIN6, human beta cell, and human islet samples (Fig. 3B). [score:5]
MIN6 cells were transiently transfected with (1) 10 nM mmu-miR-29 mimic (Dharmacon); (2) 200 nM mmu-miR-29 hairpin -inhibitor (Dharmacon); (3) 10 nM mmu-miR-375 mimic (Dharmacon); (4) 10 nM custom mmu-miR-375+1 mimic (Dharmacon: 5′-UUGUUCGUUCGGCUCGCGUGA-3′) or (5) 10 nM custom mmu-miR-375-1 mimic (Dharmacon: 5′UUUUGUUCGUUCGGCUCGCGUGA-3′). [score:3]
Numerous studies have identified miRNAs as important modulators of a wide variety of biological pathways [4], [5]; for example, miR-375 -mediated gene regulation is critical for both beta cell development and function [6], [7]. [score:3]
As depicted in Fig. 3C, miR-375 and its 5′-isomiRs have overlapping, but distinct predicted target gene profiles. [score:3]
The y-axis depicts the relative quantitative value (RQV; expression determined by RT-qPCR and normalized to Rps9) in response to the miR-375 mimic (gray), miR-375+1 mimic (orange), or miR-375-1 mimic (green) relative to mock transfection. [score:3]
All sets are mutually exclusive: for example, a total of 390 genes have predicted conserved miR-375 target sites (42 unique to miR-375, 3 shared with miR-375+1 only, 337 shared with miR-375-1 only, and 8 common to all three). [score:3]
Only eight genes (ELAVL4, HNF1B, NFIX, NPAS3, PAX2, SHOX2, SLC16A2, and TSC22D2) have predicted conserved target sites for miR-375 and both of its 5′-shifted isomiRs. [score:3]
Strikingly, three of the 10 candidate miRNA regulatory hubs in the T2D gene network were 5′-shifted isomiRs: miR-375+1, miR-375-1, and miR-183-5p+1 (Fig. 4A). [score:2]
This is particularly intriguing, given the already well-established role of 5′-reference miR-375 in beta cell formation and function. [score:1]
Atp6v0c and Cdc42 were also modestly repressed by the 5′-reference miRNA, though slightly more so by miR-375+1 and miR-375-1, respectively (Fig. 5). [score:1]
These 187 pre-miRNAs consisted of: 166 pre-miRNAs that generate at most one mature miRNA from each arm of the hairpin-like structure (“homogenous loci”), including one locus (pre-miR-5099) that produces only a 5′-shifted isomiR (mmu-miR-5099-2); and 21 pre-miRNAs that generate more than one mature miRNA from the same arm (“heterogeneous loci”), including one locus (pre-miR-375) that produces one 5′-reference miRNA and two 5′-shifted isomiRs. [score:1]
Effects of mimics for 5′-reference miR-375, 5′-shifted miR-375+1, and 5′shifted miR-375-1 in MIN6 cells on the mRNA levels of three genes are shown. [score:1]
0073240.g005 Figure 5Effects of mimics for 5′-reference miR-375, 5′-shifted miR-375+1, and 5′shifted miR-375-1 in MIN6 cells on the mRNA levels of three genes are shown. [score:1]
5′-shifted isomiRs of the Beta Cell-enriched miRNA, miR-375. [score:1]
These 187 pre-miRNAs consisted of: 166 pre-miRNAs that generate at most one mature miRNA from each arm of the hairpin-like structure (“homogenous loci”), including one locus (pre-miR-5099) that produces only a 5′-shifted isomiR (mmu-miR-5099-2); and 21 pre-miRNAs that generate more than one mature miRNA from the same arm (“heterogeneous loci”), including one locus (pre-miR-375) that produces one 5′-reference miRNA and two 5′-shifted isomiRs. [score:1]
[1 to 20 of 19 sentences]
14
[+] score: 62
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
Recently, it has been shown that the expression of miR-375 is significantly downregulated in multiple tumor types [29], including HCC [30]. [score:6]
Overexpression of miR-375 strongly inhibits AKT/Ras but not c-Myc induced liver tumor formation in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
In agreement with the latter hypothesis, we found that miR-375 has limited tumor suppressor activity against c-Myc driven hepatocarcinogenesis, whereas it strongly inhibits AKT/Ras dependent liver tumor formation. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
miR-375 functions via targeting multiple genes involved in tumor development, including Yap [30], PDK1 [31], 14–3-3-ζ [31] and SHOX2 [32]. [score:4]
In striking contrast, miR-375 exhibited a strong tumor suppressor activity against AKT/Ras driven tumor development (Figure 4C and 4D). [score:4]
These findings suggest that genes targeted by miR-375 may have critical roles in AKT/Ras but not in c-Myc driven hepatocarcinogenesis. [score:3]
The mechanisms underlying the tumor suppressor activity of miR-375 on AKT/Ras dependent hepatocarcinogenesis remain to be defined. [score:3]
Thus, the present findings support a strong tumor suppressive role of miR-375 against AKT/Ras driven hepatocarcinogenesis and a limited antineoplastic activity toward c-Myc induced liver tumor formation. [score:3]
Overexpression of miR-375 slightly delayed c-Myc induced liver tumor formation (Figure 4A and 4B). [score:3]
miR-375 strongly inhibits AKT/Ras hepatocarcinogenesis but not c-Myc induced liver tumor formation. [score:3]
Indeed, none of the AKT/Ras/miR-375 injected mice showed any sign of tumor development 8 weeks post injection. [score:2]
Figure 4 (A) Macroscopic (upper panel) and microscopic (lower panel) appearance of livers from c-Myc/pT3 mice and c-Myc/miR-375 mice stained with H&E (100X), insets (400X). [score:1]
By 8 weeks post injection, all c-Myc/miR-375 injected mice succumbed due to the high tumor burden (Figure 4B). [score:1]
miR-375 was first identified as a pancreatic islet-specific miRNA involved in insulin secretion [28]. [score:1]
[1 to 20 of 17 sentences]
15
[+] score: 62
In humans, computational predictions show that miR-375 has two non-conserved target sites in the 3’UTR of AIFM1 mRNA (Target Scan v. 7.1 release June 2016) (Agarwal et al., 2015), and one target site in the CAV1 3’UTR identified by another miRNA target prediction program (RNA22 algorithm implemented at miRWalk 2.0) (Dweep & Gretz, 2015). [score:9]
In the rat insulin-secreting cell line, INS-1 832/13, we previously showed the reduction of Aifm1 and Cav1 mRNA expression upon miR-375 over -expression delineating the conserved targeting in rodents of these genes by miR-375 (Salunkhe et al., 2015). [score:7]
Although miR-375 is also predicted to target CAV1 3’UTR mRNA, miR-375 expression was not elevated at higher confluences, implying that CAV1 mRNA is potentially regulated by other factors. [score:6]
The negative effect of miR-375 on both the mRNA and protein levels of the two genes has been demonstrated, and in the islets of 375 KO mice, increased expression of these targets was also detected at the mRNA level (Poy et al., 2009). [score:5]
Expression of miR-375 and its targets in INS-1 832/13 cells (A–C) or in EndoC-βH1 cells (D–F). [score:5]
In INS-1 832/13 cells, we did not detect any significantly altered expression of neither miR-375 nor its targets among the different confluences (Figs. 2A– 2C). [score:5]
The genes Aifm1 and Cav1 are among the many genes shown to be directly targeted by miR-375 in mouse beta cells. [score:4]
Likewise in the human EndoC-βH1 cells, the expression of miR-375 was similar at all confluences (Fig.  3D). [score:3]
This study mainly addressed the issue whether confluence affects miR-375 expression, as it is one of the most enriched miRNAs in the pancreatic beta cells influencing diverse molecular processes, from insulin secretion to cellular growth and proliferation (Eliasson, 2017; Poy et al., 2004; Poy et al., 2009; Salunkhe et al., 2015). [score:3]
We found virtually no significant differences in the expression levels of miR-375, CAV1 mRNA and AIFM1 mRNA at higher confluences, from 60%–100%, either in the rat or human beta cell lines. [score:3]
Since its discovery, miR-375 has been shown to negatively regulate a plethora of genes involved in pancreatic beta cell function (Eliasson, 2017) such as in insulin secretion by regulating myotrophin (Mtpn) (Poy et al., 2004) and various voltage-gated sodium channels (SCNs) (Salunkhe et al., 2015). [score:3]
3503/fig-2 Figure 2(A) miR-375 expression at different cell confluence of INS-1 832/13 cells. [score:3]
Knock out of miR-375 in mouse (375 KO), resulted in hyperglycaemic animals with defective proliferative capacity of endocrine cells leading to decreased beta cell mass (Poy et al., 2009). [score:2]
Because many functional assays, e. g., insulin secretion assay, being performed on beta cell lines require optimal culture conditions including cell densities, we therefore set out to investigate whether confluence affects the expression of miR-375 and two of its validated targets in the mouse beta cell, Aifm1 and Cav1, in the rat INS-1 832/13 cells and in the human EndoC-βH1 cells. [score:1]
Although we showed that miR-375, which is one of the most enriched beta cell miRNA was not significantly influenced by confluence level in cultured rat and human beta cell lines, we clearly demonstrated that miR-132 and miR-212 are more dependent on cellular densities, as was shown for some miRNAs in other cells types (Hwang, Wentzel & Men dell, 2009; Van Rooij, 2011). [score:1]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
The first miRNA discovered in the pancreatic islet cells was miR-375 (Poy et al., 2004), which is one of the most highly-enriched miRNAs in the pancreatic islets. [score:1]
[1 to 20 of 17 sentences]
16
[+] score: 61
In MCF-7 and T47D cells, calycosin down-regulated miR-375 and ERα expression and up-regulated RASD1 expression according to the and results (p < 0.05; Fig.   2a-d). [score:11]
The expression levels of GPR30 and WDR7-7 were normalized to β-actin expression, and the expression level of miR-375 was normalized to U6 snRNA. [score:7]
Fig. 2Calycosin inhibits cell proliferation and survival by regulating ERα, RASD1, and miR-375 in ER+ breast cancer cells. [score:4]
The same treatment did not affect miR-375 or RASD1 expression in the ER− MDA-MB-468 or SKBR3 breast cancer cells or in the MCF10A cells (Fig. 2a-d). [score:3]
The protein and mRNA expression levels of (a, b) ERα, (a, c) RASD1, and (d) miR-375 were determined using and. [score:3]
from our previous study suggest that calycosin inhibits the proliferation of ER+ breast cancer cells and that miR-375, RAS dexamethasone -induced 1 (RASD1), and ER may be involved in this process [11, 12]. [score:3]
Likewise, in this study, we demonstrated that calycosin successfully inhibited the growth of ER+ MCF-7 and T47D breast cancer cells, which was mediated by the inactivation of the miR-375-ERα feedback loop. [score:3]
These data confirm the existence of the miR-375-ERα feedback loop via RASD1 in MCF-7 and T47D cells and its role in the calycosin -induced inhibitory effects on ER+ breast cancer cells rather than ER− cells. [score:3]
This activity depends on WDR7-7-GPR30 signaling and a feedback loop that involves miR-375, RASD1, and ERα Our observation that calycosin inhibited the proliferation of breast cancer cells in vitro led us to examine the anti-proliferative effects of calycosin in breast carcinoma tumor xenografts in vivo. [score:3]
16 μM calycosin alone In addition to the miR-375-ERα feedback loop, we explored other possible mechanisms by which calycosin inhibits the proliferation of breast cancer cells, especially in ER− subtypes. [score:3]
In contrast, the overexpression of miR-375 attenuated the anti-proliferative effects of calycosin in MCF-7 and T47D cells (p < 0.05 vs. [score:3]
Additionally, the finding that calycosin inhibited both the miR-375-ERα feedback loop and the WDR7-7-GPR30 pathway in ER+ breast cancer cells may explain why ER+ breast cancer cells seem to be more sensitive to calycosin than ER− breast cancer cells. [score:3]
The phytoestrogen calycosin has been shown to inhibit the proliferation of ER+ cells, which may be mediated by a feedback loop that involves miR-375, RAS dexamethasone -induced 1 (RASD1), and ERα. [score:3]
Involvement of the miR-375-ERα feedback loop in calycosin-regulated proliferation in MCF-7 and T47D cells. [score:2]
Lipofectamine 2000 (Invitrogen) was used to transfect MCF-7, T47D, SKBR3, MDA-MB-468, MDA-MB-231, and MCF10A cells with hsa-miR-375, pCDNA3.1-WDR7-7, miR-375 siRNA, or WDR7-7 shRNA (XuanC Bio). [score:1]
To examine whether the anti-proliferative effects of calycosin were related to the feedback loop, MCF-7, T47D, MDA-MB-468, SKBR3, and MCF10A cells were pretreated with pre-miR-375 or miR-375 siRNA prior to treatment with calycosin (16 μM). [score:1]
control (0 μM) Several studies and our previous data identified the existence of a miR-375-ERα feedback loop in ER+ breast cancer cells [11, 21]. [score:1]
Therefore, we provide evidence that, in addition to the miR-375-ERα feedback loop in ER+ breast cancer cells, a negative relationship between WDR7-7 and GPR30 exists in both ER+ and ER− breast cancer cells. [score:1]
MCF-7, T47D, SKBR3, MDA-MB-468, and MCF10A cells were treated for 48 h with calycosin (0, 16 μM), 16 μM calycosin and premiR-375, or 16 μM calycosin and miR-375 siRNA. [score:1]
Transcript levels were normalized to those of U6 snRNA in the case of miR-375. [score:1]
Pretreatment with miR-375 siRNA further increased the anti-proliferative effects of calycosin in MCF-7 and T47D cells, but not in MDA-MB-468, SKBR3, or MCF10A cells (p < 0.05 vs. [score:1]
[1 to 20 of 21 sentences]
17
[+] score: 48
miR-21a-3p, miR-31-5p, miR-155-5p and miR-200c were upregulated while miR-217-5p, miR-802-5p, miR-375-5p and miR-216-5p were downregulated (Color figure online) Surprisingly, in upregulated mRNAs, it was not the classical pancreatic progenitor-related genes that changed the most. [score:10]
miR-21a-3p, miR-31-5p, miR-155-5p and miR-200c were upregulated while miR-217-5p, miR-802-5p, miR-375-5p and miR-216-5p were downregulated (Color figure online) Surprisingly, in upregulated mRNAs, it was not the classical pancreatic progenitor-related genes that changed the most. [score:10]
Moreover in noncoding RNAs, miR-21a, miR-31 and miR-155 were upregulated and miR-217, miR-802 and miR-375 were downregulated in colonies along with a number of other miRNAs and lncRNAs. [score:7]
In our results, miR-21a, miR-31, miR-200c and miR-155 were upregulated and miR-217, miR-802, miR-375 and miR-216 were downregulated (Additional file 9: Table S5). [score:7]
In downregulated miRNAs, miR-216a-3p/5p, miR-216b-3p/5p, miR-217-5p, miR-802-3p/5p and miR-375-3p lay on the top. [score:4]
miR-375 is a well-known miRNA in regulating beta-cell development [39] and is used to generating insulin-producing cells from induced pluripotent cells [40]. [score:3]
miR-375 knockdown lead to reduced endocrine cells [50]. [score:2]
They have been reported to be important in regulation of either pancreatic progenitors or pancreatic ductal adenocarcinoma [a]mmu-miR-21a-5p is homologous to gga-miR-21 in chicken [b]Previous ID of mmu-miR-375-3p is “mmu-miR-375” Colonies from whole pancreas are comparable to CD133 [+] cell-derived coloniesCD133 is a well-recognized marker for pancreatic progenitors [11, 12, 19]. [score:2]
They have been reported to be important in regulation of either pancreatic progenitors or pancreatic ductal adenocarcinoma [a]mmu-miR-21a-5p is homologous to gga-miR-21 in chicken [b]Previous ID of mmu-miR-375-3p is “mmu-miR-375” CD133 is a well-recognized marker for pancreatic progenitors [11, 12, 19]. [score:2]
Another miRNA, miR-375, is a well-characterized miRNA regulating pancreas development [39]. [score:1]
[1 to 20 of 10 sentences]
18
[+] score: 40
In the present study, we found a higher expression of miR-375 and miR-487b in the HA group, which indicated that high concentration of astaxanthin could suppress tumor growth by inducing overexpression of miR-375. [score:7]
Also, several studies have shown that the expression of miR-375 is significantly reduced in tumor tissues, and this miRNA functions as a tumor suppressor by targeting several oncogenic genes [48, 49, 50, 51, 52]. [score:7]
Isozaki Y. Hoshino I. Nohata N. Kinoshita T. Akutsu Y. Hanari N. Mori M. Yoneyama Y. Akanuma N. Takeshita N. Maruyama T. Identification of novel molecular targets regulated by tumor suppressive miR-375 induced by histone acetylation in esophageal squamous cell carcinoma Int. [score:6]
In addition, it might suppress tumor growth through inducing overexpression of miR-375 and miR-487b. [score:5]
Kinoshita T. Nohata N. Yoshino H. Hanazawa T. Kikkawa N. Fujimura L. Chiyomaru T. Kawakami K. Enokida H. Nakagawa M. Tumor suppressive microRNA-375 regulates lactate dehydrogenase B in maxillary sinus squamous cell carcinoma Int. [score:4]
Both miR-375 and miR-487b were significantly overexpressed in the HA group (p < 0.05), confirming the results of the array. [score:3]
Miao L. Liu K. Xie M. Xing Y. Xi T. miR-375 inhibits Helicobacter pylori -induced gastric carcinogenesis by blocking JAK2-STAT3 signaling Cancer Immunol. [score:3]
Two miRNAs showing overexpression with a fold variation higher than 1.5 were picked out, one had a 1.9-fold increase (miR-375) and the other had a 2.1-fold increase (miR-487b). [score:3]
Hui A. B. Bruce J. P. Alajez N. M. Shi W. Yue S. Perez-Ordonez B. Xu W. O’Sullivan B. Waldron J. Cummings B. Gullane P. Significance of dysregulated metadherin and microRNA-375 in head and neck cancer Clin. [score:2]
[1 to 20 of 9 sentences]
19
[+] score: 38
MicroRNA-375 (miR-375) has been demonstrated to represent an islet-enriched miRNA that is highly expressed in pancreatic islets of humans and mice and is required for proper beta cell functioning as well as maintaining a normal beta cell mass [16]. [score:3]
Interestingly, the expression levels of diabetes-related miRNAs, including miR-375, in serum were found to be significantly elevated in type 2 diabetes patients compared with pre-diabetic and normal glucose-tolerant individuals [22, 23]. [score:2]
However, in their study no direct link was examined between circulating miR-375 levels and beta cell mass or beta cell death in vivo. [score:2]
Thus, PPAG and exendin-4 prevented the release of miR-375 in the blood. [score:1]
A significant, threefold increase in miR-375 level was observed at 6 hours and remained high 30 hours after STZ (Fig 1B). [score:1]
Also higher miR-375 levels could be detected in the circulation of type 1 diabetes subjects [19]. [score:1]
Approximately a doubling of the baseline miR-375 concentration was observed at 5 mM STZ where nearly 80% of cell loss occurred. [score:1]
Average +/- SEM of baseline levels of serum miRNA-375 of 15 untreated Balb/c mice. [score:1]
Erener et al. [17] showed that miR-375 is a suitable blood marker to detect beta cell death and predict diabetes in STZ -treated and NOD mice. [score:1]
Previous studies demonstrated that circulating microRNA-375 (miR-375) is a suitable plasma biomarker for real-time detection of beta cell death. [score:1]
Baseline levels of serum miRNA-375 in Balb/c mice. [score:1]
It has previously been reported that circulating miR-375 levels can serve as a tool to predict diabetes in STZ -treated mice [17]. [score:1]
Circulating miR-375 as a Biomarker of β-Cell Death and Diabetes in Mice. [score:1]
In vitro, there was a good correlation between miR-375 release and the extent of beta cell death. [score:1]
In the present study, we used miR-375 to assess the beta cytoprotective effect of PPAG in an acute mo del of beta cell damage induced by a single injection of STZ [12]. [score:1]
For unknown reasons, mice show higher baseline levels of miR-375 in blood than humans, suggesting contribution to the circulating miR-375 pool from other tissues. [score:1]
Glycemia and miR-375 release following STZ. [score:1]
We also analyzed in vitro miR-375 release by the mouse beta cell line MIN-6 after an 18-hour exposure of the cells to various concentrations of STZ in the culture medium (range 0–10 mM). [score:1]
Our data confirm that circulating miR-375 can be used as a biomarker to detect damage to the pancreatic beta cell mass. [score:1]
In vitro release of miR-375 release following STZ. [score:1]
Increased release of miR-375 in the medium appeared at 2.5 mM STZ but not at lower concentrations (Fig 2B). [score:1]
This study provides evidence that miR-375 can be used as a serological biomarker to detect beta cell death and to test drugs that could protect beta cells against cell death. [score:1]
The aim of this study was to determine whether miR-375 can be used as a biomarker to assess the beta cytoprotective effect of antidiabetic drugs. [score:1]
Furthermore, the cytoprotective effect of PPAG and exendin-4 resulted into a normal level of circulating miR-375. [score:1]
##p<0.01; ###p<0.001 Effect of PPAG and exendin-4 on STZ -induced increase of miR-375 levels. [score:1]
Blood glycemia and miR-375 blood levels after STZ injection. [score:1]
Treatment of mice with PPAG or exendin-4 significantly attenuated STZ -induced loss of beta cell mass and beta cell apoptosis, and normalized the blood level of miR-375. [score:1]
Mice that were treated with PPAG or exendin-4 showed no increase in plasma miR-375 (Fig 5). [score:1]
Furthermore, a correlation was found between miR-375 and beta cell death or survival, indicating that circulating miR-375 can be used as a biomarker to predict these effects. [score:1]
S1 Fig Average +/- SEM of baseline levels of serum miRNA-375 of 15 untreated Balb/c mice. [score:1]
In vitro, similar changes were observed on a beta cell line with nearly a doubling of the miR-375 concentration released in the culture supernatant following STZ exposure, coinciding with an approximate 80% beta cell loss. [score:1]
This may be explained by the fact that STZ also induces necrotic beta cell death [12] and that miR-375 is mainly reflecting this type of cell death rather than apoptosis. [score:1]
There was an excellent correlation between cytotoxicity/cell loss and miR-375 release, with a correlation coefficient R = 0.958 after linear regression (Fig 2C). [score:1]
After the addition of ABC buffer, a dilution series of RNase free, HPLC purified RNA duplex microRNA 375 (active strand: 5PHOS/rUrUrUrGrUrUrCrGrUrUrCrGrGrCrUrCrGrCrGmUmGmA (manufacturing ID M118344864) and inactive strand: mAmArAmCrAmArGmCrAmArGmCrCmGrAmGrCmGrCrA (manufacturing ID M118344859) (Integrated DNA technologies, Coralville, Iowa)) was added to control matrix (plasma from Balb/c mice and DMEM medium supplemented with 10% FCS) for generation of a miR-375 standard curve. [score:1]
[1 to 20 of 34 sentences]
20
[+] score: 30
Cells with the JAK2V617F mutation express abnormally increased levels of the phosphatase 2A (PP2A) inhibitor CIP2A, that resulted down-regulated by PI3K/mTOR inhibitors via a microcircuit that includes SNAI1 and miR375. [score:11]
The changes in CIP2A levels in cells exposed to PI3K/mTOR inhibitors were under the control of a microcircuit involving Hif1α [55, 56] and its target SNAI1 [57], and caused enhanced expression of miR-375, a known negative regulator of CIP2A transcription. [score:8]
It was reported that the tumor suppressor miR-375 represses CIP2A mRNA through multiple miRNA-mRNA interactions [37, 38], and it is in turn negatively regulated by SNAI1 (Snail) [39, 40]. [score:4]
Therefore, we wanted to ascertain whether the reduction of CIP2A levels determined by PI3K/mTOR inhibitors involved miR-375. [score:3]
On the contrary, ruxolitinib did not affect Snail, miR-375 and CIP2A expression, therefore addressing specifically these effects to the PI3K/mTOR pathway (Figure 4C). [score:3]
We found that when BKM120 was added to SET2 and HEL cells, the levels of miR-375 increased markedly, and such an increase was associated with concurrently decrement of CIP2A and Snail. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These candidate miRNAs included representatives that exhibited regulated patterns of expression from each of the two primary classes detected, namely: those with highest expression in the caput (let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p), or highest expression in the cauda (miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:8]
In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
0135605.g008 Fig 8In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
In this context, qPCR confirmed highly significant down-regulation of let-7c-5p, let-7b-5p, miR-375-3p, miR-467d-3p, and miR-200c-3p between the proximal and distal epididymal segments. [score:4]
[1 to 20 of 4 sentences]
22
[+] score: 26
Overexpression of the β-cell specific miRNA, miR-375, in pancreatic islets reduce insulin secretion [17] and reduced β-cell mass was detected in the miR-375 knock-out mouse as well as hyperglycaemia [19]. [score:4]
A. Insulin mRNA expression level is reduced in RIP-Cre Dicer1 [Δ/Δ], B. Mature miR-375 is significantly reduced while the pri-miR-375 species accumulates in the knockout. [score:4]
To verify that the knock-down of dicer effects miRNA expression we measured the expression of the β-cell specific miRNA, mir-375, and found that it was reduced by 70% in the RIP-Cre Dicer1 [Δ/Δ] compared to littermate control mice (Fig. 8 B). [score:3]
Insulin, miR-375 and pri-miR-375 expression in sorted β-cells. [score:3]
It remains unclear whether miR-375 knock-out mice develop overt diabetes. [score:2]
26 were not detected in the knockout including the most abundant islet miRNAs, miR-375 and miR-7a. [score:2]
Since our mo del is characterized by altered miRNAs processing, including miR-375, it is likely that the reduced expression of miR-375 in RIP-Cre Dicer1 [Δ/Δ] mice (Fig. 8B) contributes to diabetes development although it appears clear that other miRNAs have to be involved in the pathophysiology of these mice. [score:2]
The β-cell enriched miRNA miR-375 has been demonstrated to influence insulin mRNA levels [16] as well as the exocytotic process [17]. [score:1]
For mature miR-375, stem-loop qPCR was performed normalized against snoRNA-202 and snoRNA-412. [score:1]
This was accompanied by an accumulation of pri-miRNA-375 in the RIP-Cre Dicer1 [Δ/Δ] β-cells (Fig. 8B). [score:1]
Moreover, the level of miRNA-375, together with miRNA-127-3p and miR-184 is positively correlated to insulin mRNA levels in islets from human donors and the association between these miRNAs and β-cell function was deranged in islets from glucose intolerant donors [18]. [score:1]
Thus, a number of miRNAs, including miR-375, contribute to efficient β-cell function and protection from diabetes. [score:1]
These include the islet-specific miR-375 and another abundant islet miRNA, miR-7a [28]. [score:1]
[1 to 20 of 13 sentences]
23
[+] score: 26
In experimental colitis, a downregulation of miR-375 expression in IL-10 [-/-] mice once the signs of the colonic inflammation were evident was reported (Schaefer et al., 2011). [score:6]
Finally, miR-375 is considered a multifunctional miRNA, involved in different processes including pancreatic islet development, glucose homeostasis, or cell differentiation and carcinogenesis (Xu et al., 2011); miR-375 displays different expression profiles depending on the disease considered (Zhao et al., 2012). [score:4]
Similarly, in our study, the expression of miR-375 was significantly reduced in colitic mice in comparison with non-colitic ones. [score:3]
healthy control, p < 0.05) whereas the other two, miR-143 and miR-375, were significantly downregulated in colitic mice compared to non-colitic group (around twofold decrease, p < 0.05). [score:3]
miR-375 is highly expressed and possibly transactivated by achaete-scute complex homolog 1 in small-cell lung cancer cells. [score:3]
In the present study, we selected five of the eleven changed miRNA, specifically miR-143, miR-150, miR-155, miR-223, and miR-375, and questioned whether their expression was altered following treatment of DSS-colitis mice with E. coli Nissle. [score:3]
However, the probiotic used by us failed to restore the basal levels of miR-375. [score:1]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55 The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
FIGURE 5Biochemical evaluation of the effects of Escherichia coli Nissle 1917 (EcN); the expression of (A) miR-150, (B) miR-155, (C) miR-223, (D) miR-143, and (E) miR-375 was quantified by real-time PCR. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 25
Each point represents an individual sample a– b qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in all samples, normalized to the overall average expression to generate a relative expression value. [score:5]
Fig. 2 a– b qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in all samples, normalized to the overall average expression to generate a relative expression value. [score:5]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b Sperm miRNA content has been shown to be influenced by smoking 29, 30 and obesity 31, 32; however, in univariate regression analysis neither BMI nor smoking status were significantly associated with expression of sperm miR-449a or miR-34c (Extended Data, Table 1). [score:3]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, bSperm miRNA content has been shown to be influenced by smoking 29, 30 and obesity 31, 32; however, in univariate regression analysis neither BMI nor smoking status were significantly associated with expression of sperm miR-449a or miR-34c (Extended Data, Table 1). [score:3]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Fig. 3 a qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in pooled mature motile sperm isolated from stressed or control mice, n = 4–6 males per pool, 1 pool per group. [score:1]
In contrast, and consistent with human results described above, no significant difference was found for sperm miR-152 and miR-375-3p, even though the latter was previously shown to increase after exposure of male mice to two different stress paradigms 20, 21. [score:1]
a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
Fig. 1 a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
As examples, we show results for miR-152 and miR-375-3p (Fig. 1a). [score:1]
a qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in pooled mature motile sperm isolated from stressed or control mice, n = 4–6 males per pool, 1 pool per group. [score:1]
In contrast, no significant correlations were observed for the association between miR-152 and miR-375-3p and ACE score (Fig. 2d, e). [score:1]
[1 to 20 of 12 sentences]
25
[+] score: 23
Other miRNAs from this paper: mmu-mir-501
Figure 1(A) Kaplan-Meier curves, showing both tumor-free survival and patient overall survival, which were higher in the patients with pancreatic body/tail cancer than in those with pancreatic head cancer; (B) Bars representing the significantly lower expression of miR-501-3p and higher expression of miR-375 in pancreatic body/tail cancer compared with pancreatic head cancer, as assessed by qRT-PCR; (C) Kaplan-Meier curves, presenting tumor-free survival and overall survival were significantly lower in the patients with high miR-501-3p expression than those with low expression. [score:8]
We verified the lower expression of miR-501-3p and higher expression of miR-375 in the pancreatic body/tail cancer tissues compared with the pancreatic head cancer tissues (Figure 1B). [score:4]
Studies have demonstrated a down-regulation of miR-375 in PDAC [7]. [score:4]
However, two miRNAs (miR-501-3p and miR-375) were significantly differentially expressed between the two subtypes. [score:3]
We also further assessed miR-375 because it has been reported to be a potent tumor suppressor in PDAC [8]. [score:3]
Unlike miR-375, miR-501-3p has not yet been well studied in human cancers. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 21
Analysis of the expression levels of the nine-miRNA panel revealed that three miRNAs (miR-122-5p, miR-150-5p, and miR-375) were similarly altered (all up-regulated) in mice with DSS -induced and TLR5 [−/−] colitis compared to the corresponding healthy controls (Fig.   3A). [score:5]
Among the commonly deregulated miRNAs, microRNA-375 was previously described as being up-regulated in serum from UC and CD patients [49] and in IL10 [−/−] mice [50]. [score:5]
miRNA nameIL10 [−/−] mice mo del Intestinal Inflammation Inflammation mmu-miR-29b-3p x mmu-miR-122-5p x x x mmu-miR-148a-3p x mmu-miR-150-5p x x mmu-miR-192-5p x mmu-miR-194-5p x mmu-miR-146a-5p x mmu-miR-375-3p x x x mmu-miR-199a-3p x We showed that our nine-miRNA signature could discriminate between the different forms of colitis and arthritis, as well as between non-colitic mice with and without a genetic predisposition to develop the disease (WT mice versus non-colitic IL10 [−/−] mice). [score:3]
Particularly, miR-375-3p and miR-199a-3p had similar expression levels in D98 anti-TNFα treated group and non -treated group. [score:3]
Thus, among the nine miRNAs of the identified signature, two were deregulated in both intestinal inflammation and arthritis (miR-122-5p and miR-375), one was specifically deregulated in all three intestinal inflammation mo dels (miR-150-5p), and the others appeared to be specific to the IL10 [−/−] mouse mo del. [score:3]
Expressional analysis of the nine-miRNA signature in sera of CAIA mice revealed that two of the miRNAs (miR-122-5p and miR-375) were increased in arthritic mice compared to non-arthritic control mice (day 2) as it was observed in the IL10 [−/−] mice (Fig.   3A). [score:2]
[1 to 20 of 6 sentences]
27
[+] score: 20
MiR-143 has been shown to inhibit ERK5 mRNA translation 2-fold through a site in its 3′ UTR, miR-20a inhibits translation of the E2F1 mRNA approximately 4-fold, and miR-375 inhibits translation of Myotrophin mRNA 2-fold. [score:13]
Other miRNAs have been described to have a tissue-restricted pattern of expression including miR-1, expressed in the heart and skeletal muscles, and miR-375, expressed solely in pancreatic islets [31], [34], [37]. [score:7]
[1 to 20 of 2 sentences]
28
[+] score: 19
In addition, the larger list of mRNA targets of mouse miR-375 is comparable to the human list, in terms of gene. [score:3]
Mir375 is also involved in regulating insulin expression and secretion. [score:3]
Mir375, specifically expressed in islet cells, is believed to play a role in the early stages of islet development, particularly as the embryonic stem cells differentiate into liver and insulin secretory cells [48]. [score:3]
Several, including Mir375, are differentially expressed in T2D patients and rodent mo dels such as the obese diabetic mouse and the GK rat. [score:2]
The only validated mRNA target of rat Mir375 is Pdk1, also validated for the human and mouse microRNA 375. [score:2]
And Mir375 is one of a number of involved in insulin synthesis and secretion (for instance Mir9 and Mir29a/b/c), insulin sensitivity in target tissue (Mir143 and Mir29) or glucose and lipid metabolism (Mir103/107 and Mir122) and thus, having potential roles in diabetes [see for instance, [52], [53]. [score:2]
The promoter region of MIR-375 contains binding sites for ONECUT1, (also known as HNF6) and INSM1 transcription factors, both important for the development of pancreatic islets. [score:2]
The results for the human MIR375 are shown [Fig.  10 and insets]. [score:1]
Interestingly, NEUROD1 and possibly PDX1 may have a role in the transcription of MIR-375—a microRNA associated with pancreatic function [48]. [score:1]
[1 to 20 of 9 sentences]
29
[+] score: 16
Inhibition of miR-375 enhances insulin secretion, while miR-375 overexpression impairs the insulin secretory pathway by reducing expression of myotrophin [11]. [score:7]
MiR-375 also targets insulin gene expression and down-regulates phosphoinositide -dependent protein kinase-1, resulting in decreased insulin -induced phosphorylation of AKT and GSK3 [12]. [score:7]
For example, miR-375 is one of the most abundant miRNAs present in pancreatic islet cells and negatively regulates glucose-stimulated insulin secretion. [score:2]
[1 to 20 of 3 sentences]
30
[+] score: 16
We next validated the differential expression of the seven miRNAs listed in Table 1 using the liver tissues of four different Wrn [Dhel/Dhel]mutant and four wild type mice (three months of age) Of the seven miRNAs tested, only miR-375 and miR-124 showed significant differential expressions in Wrn [Dhel/Dhel] mutant compared to wild type animals (Figure 1A and Supplementary Figure S1). [score:4]
The liver of Wrn [Δ] [hel/] [Δ] [hel] mice show differential expression of miR-375 and miR-124. [score:3]
To determine whether miR-375 and miR-124 were also differentially expressed during aging, quantitative RT-PCR was performed on the liver tissues of four young (three months) and four old (21 months) wild type mice. [score:3]
miR-375 was up regulated more than three-fold and miR-124 was down regulated by ten-fold in the liver of Wrn [Dhel/Dhel] mutant mice compared to the liver of wild type animals (Figure 1A). [score:2]
The liver of Wrn [Δ] [hel/] [Δ] [hel] mice show differential expression of miR-375 and miR-124We have previously shown that in Wrn [Δ] [hel/] [Δ] [hel] mice, the liver is the first tissue to show morphological changes compared to age-matched wild type animals [16, 30]. [score:2]
org) revealed that miR-124 is conserved in the short-lived C. elegans but not the miR-375. [score:1]
In contrast, there was a non-significant increase in miR-375 level in the liver of old wild type animals. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Luminal-restricted miRNAs included miR-10a (targets KLF4 and PIK3CA) [41, 42], miR-200a/b (targets EMT (epithelial mesenchymal transition) genes) [43], miR-148a (targets Bim) [44] and miR-375 (targets PDK1) [45]. [score:9]
Tsukamoto Y Nakada C Noguchi T Tanigawa M Nguyen LT Uchida T MicroRNA-375 is downregulated in gastric carcinomas and regulates cell survival by targeting PDK1 and 14-3-3zetaCancer Res. [score:6]
[1 to 20 of 2 sentences]
32
[+] score: 15
To correct (to the extent possible) for this difference, we excluded a further 20 target sites with GU pairs and mismatches in the seed region for miR-134, and 8 target sites for miR-296 (all target sites for miR-375 have WC matches in the seed region), and report the results of 65 target genes examined for miR-134, 6 for miR-296 (for miR-296, all six sites examined were validated), and 22 for miR-375. [score:9]
miRNA Condition Number of targets miR-134 WC bp at nt 2–7 True positives 43 Sensitivity = 0.551 False negatives 35 Specificity = 0.666 False positives 3 True negatives 6 Total 87 WC bp at nt 2–7, and 40% FE threshold (−18.64) True positives 36 Sensitivity = 0.462 False negatives 42 Specificity = 0.666 False positives 3 True negatives 6 Total 87 miR-296 WC bp at nt 2–7 True positives 8 Sensitivity = 0.80 False negatives 2 Specificity = 0.50 False positives 1 True negatives 1 Total 12 WC bp at nt 2–7, and 40% FE threshold (−19.44) True positives 7 Sensitivity = 0.70 False negatives 3 Specificity = 0.50 False positives 1 True negatives 1 Total 12 miR-375 WC bp at nt 2–7 True positives 9 Sensitivity = 0.375 False negatives 15 Specificity = 0.929 False positives 1 True negatives 13 Total 38 WC bp at nt 2–7, and 40% FE threshold (−16.68) True positives 8 Sensitivity = 0.333 False negatives 16 Specificity = 0.929 False positives 1 True negatives 13 Total 38Of 158 genes experimentally tested for regulation by miR-134, 85 occur in our database, as do 14 of 24 tested for regulation by miR-296, and 22 of 44 tested for regulation by miR-375. [score:6]
[1 to 20 of 2 sentences]
33
[+] score: 15
The expression of miR-375, a known epigenetically regulated miRNA [67], was increased significantly by methylation and acetylation inhibition, while the expression of miR-331-3p remained unchanged. [score:8]
The 2 [-ΔΔCt] method was used to determine mature miR-331-3p or miR-375 expression relative to RNU6B small nuclear RNA (snRNA) [66]. [score:3]
Synthetic miRNA precursor (pre-miR) molecules corresponding to human miR-331-3p (pre-miR-331-3p; Product ID: PM10881), miR-375 (pre-miR-375; Product ID: PM10327) and a negative control miRNA (pre-miR-NC; Negative Control #1, Product ID: AM17110) were sourced from Ambion (Thermo Fisher Scientific). [score:1]
Here, we sought to investigate whether the observed absence of miR-331-3p in PCa- was due to either DNA methylation or histone deacetylase inhibition and we determined that this was not the case, when compared with a known miRNA, miR-375, whose epigenetic regulation in PCa has been well studied and is transcriptionally repressed via epigenetic mechanisms [67, 45]. [score:1]
RNA was harvested and used for Taqman RT-qPCR detection of miR-331-3p, miR-375 and RNU6B, as described above. [score:1]
miR-375 was used as a positive control miRNA for both TSA and AZA treatment [67]. [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 14
For those miRNAs down-regulated by H9N2, the NA segment greatly increased the expression of miR-181b1; however, unlike the H9N2 virus treatment, the HA treatment significantly rose the expression of miR146, miR375, and miR-29c, (Figure 1B). [score:8]
A. Flow cytometric analysis of the phenotypic alterations in DCs stimulated by miR155, miR499, miR375, miR674, or miR181b1 (i. e. the expressions of CD40, CD80/86, and MHCII on BMDCs stimulated by miRNAs). [score:3]
Figure 3 A. Flow cytometric analysis of the phenotypic alterations in DCs stimulated by miR155, miR499, miR375, miR674, or miR181b1 (i. e. the expressions of CD40, CD80/86, and MHCII on BMDCs stimulated by miRNAs). [score:3]
[1 to 20 of 3 sentences]
35
[+] score: 14
These changes in the expression levels of full length and shorter isoforms may be sustained, at least in part, by deregulation of 17 miRNAs, with particular reference to miR-200a-3p and miR-375 that exhibited very high levels of downregulation in all samples in the exploratory cohort (Figs. 5 and 6). [score:7]
Finally, 17 miRNAs to target TP53 transcripts were deregulated highlighting the levels of miR-200a-3p and miR-375 downregulation of (Fig.   5; Additional file  8: Table S6). [score:7]
[1 to 20 of 2 sentences]
36
[+] score: 14
This comparison demonstrated different groups of miRNAs preferentially altered at different time points in OIR, yet several miRNAs, including miR-150, miR-375, miR-129-5p and miR-129-3p showed consistent pattern of down-regulation at both P15 and P17. [score:4]
In addition, miR-375 was observed down-regulated in the murine retinal ischemic mo del 35 48. [score:4]
In addition four more miRNAs (mmu-miR-375, -203, -129-3p and -449a) showed significant down-regulation in mouse OIR retinas at log ratio <−0.5 (Fig. 2a,c and Table 1). [score:4]
Mir-375 is required for normal pancreatic development and also influences glucose-stimulated insulin secretion 54 55, indicting its crucial roles in diabetes. [score:1]
Our data of decreased miR-375 in OIR retinas suggest a potential additional role of miR-375 in proliferative retinopathy. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 13
For instance, modulation of miRNA-375 expression alters voltage-gated Na(+) channel (VGNC) properties and exocytosis in insulin-secreting cells [23]. [score:3]
Notably, as has been previously discussed [6], neither of the examined miRNAs (miR-375 and miR-200c) in the study of Title et al [19] was highly expressed in the wild-type mother’s milk of this murine mo del, whilst both of these miRNAs are known to be involved in the control of endocytosis and/or exocytosis and to modulate epithelial function, which may influence exosome endocytosis and hence their uptake. [score:3]
Title et al [19] studied two genetic mo dels of miRNA-375 and miRNA-200c/141 knockout (KO) mice, which received milk from wild-type foster mothers. [score:2]
Thus, the miRNA-375 and miRNA-200c KO mice appear to also be inappropriate mo dels to study milk exosome uptake, which may be critically dependent on physiological miRNA-375 and miRNA-200c signaling involved in endocytotic exosome pathway regulation. [score:2]
The nutritional hypothesis is based on three problematic mouse mo dels: 1) miRNA-375 KO mice, 2) miRNA-200c/141 KO mice, and 3) transgenic mice presenting high levels of miRNA-30b in milk. [score:1]
Further, most recent studies have shown that miRNA-375 misses a miRNA sequence motif {(A/U)(C2-4)(A/U)} that is essential for miRNA packaging into exosomes [27]. [score:1]
miRNA-375 and miRNA-200c/141 KO mice. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 12
Out of these, eight miRNAs were affected after both low- and high-dose irradiation: five miRNAs (mmu-miR-33-3p, mmu-miR-200c-5p, mmu-miR-140-3p, mmu-miR-744-3p, and mmu-miR-669o-5p) were downregulated and three miRNAs (mmu-miR-152-3p, mmu-miR-199a-5p, and mmu-miR-375-3p) were upregulated. [score:7]
Several miRNAs were connected to DNA damage repair as well such as miR-33 and miR-375, which were shown to regulate DNA damage checkpoint through the p53 (82, 84) and miR-744-3p, which significantly delayed IR -induced DNA damage repair by directly targeting RAD23B in prostate cancer cells (85). [score:5]
[1 to 20 of 2 sentences]
39
[+] score: 11
Furthermore, Wang and colleagues link the activation of Wnt/β-catenin signaling to a decreased expression of microRNA miR-375, regulating the expression of Wnt receptor frizzled 8 (FZD8), a predicted and confirmed target of miR-375 (Wang et al., 2013). [score:8]
Mir-375 regulates rat alveolar epithelial cell trans-differentiation by inhibiting Wnt/beta-catenin pathway. [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 10
MiR-375 targets Pdk-1 and decreases downstream insulin signaling [43]; this miRNA is among the most downregulated miRNAs with age in our dataset. [score:6]
Carcinogenesis doi: 10.1093/carcin/bgs130 43 El Ouaamari A Baroukh N Martens GA Lebrun P Pipeleers D 2008 miR-375 targets 3'-phosphoinositide -dependent protein kinase-1 and regulates glucose -induced biological responses in pancreatic beta-cells. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 10
In Table 1, numerous miRNAs tied to androgen response in PCa are strikingly downregulated, such as miR-27b-3p, miR-141-3p, miR-181a-5p, miR-221-3p, and miR-375-3p. [score:4]
To discover the molecular mechanisms through which Runx1, Runx2, and the Runx -targeting miRNAs, miR-23b-5p, miR-139-5p, miR-205-5p, miR-221-3p, miR-375-3p, miR-382-5p, and miR-384-5p, drive prostate tumorigenesis, we interrogated well-accepted bioinformatics tools; DAVID [57, 58] and Ingenuity Pathway Analysis (IPA-www. [score:3]
These are miR-23b-5p and miR-205 which function as tumor suppressors in many ways [26, 51], miR-375-3p is well characterized as a valuable marker of disease progression for diagnosis and prognosis [reviewed in 54], and miR-384-5p. [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 9
Analysis of the miRNA cDNA (using QuantiMiR kit) indicated that miR-196b along with miR-30D was upregulated in the presence of high glucose, whereas miR-375 level did not change significantly (Fig. 5F). [score:4]
miR-196b, miR-338-5p, miR-370 and miR-375 were previously reported to be expressed in adult mouse pancreas [22]. [score:3]
We detected miR-196, miR-30d and miR-375 in βTC6 cells using QuantiMir RT-PCR kit (Fig. 5A-B). [score:1]
In mouse embryonic pancreas at day e14.5, specific PCR products were detected corresponding to miR-196b and miR-375 (Fig. 5D), and isoforms of insulin2 mRNA such as insulin2 and insulin2-S (Fig. 5E). [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 8
MiR-375, also identified as a tumour suppressor [40] showed a strong downregulation our study. [score:5]
qPCR analysis of microRNA levels showed that androgen-stimulated cells strongly increased their mir-155, 223, 146a, 132 expression while mir-375 and 377 were unaffected (see Fig.   6e). [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 8
For example, microRNA-375, miR-29c, miR-195, miR-625, miR-203, miR-302b, miR-133a, miR-101, miR-27a, miR-655 and miR-200b can suppress the growth of ESCC cells by regulating the expression of a variety of molecules, including IGF1R (insulin-like growth factor 1 receptor), cyclin E, Cdc42, Sox2, Ran, ErbB4, FSCN1 and MMP14, enhancer of zeste homolog 2 (EZH2), KRAS, ZEB1, TGFBR2 and Kindlin-2. In this study, we revealed the inhibitory effects of both miR-26a and miR-144 on proliferation and metastasis of ESCC. [score:8]
[1 to 20 of 1 sentences]
45
[+] score: 8
Interestingly, a negative regulator of dendrite outgrowth and maintenance, mir-375 [89], was significantly upregulated (2-fold) by VPA in neural-differentiated mESCs. [score:5]
2011.04.018 89 Ab delmohsen K, Hutchison ER, Lee EK, Kuwano Y, Kim MM, et al (2010) miR-375 inhibits differentiation of neurites by lowering HuD levels. [score:3]
[1 to 20 of 2 sentences]
46
[+] score: 8
In our previous study, we identified that some tumor suppressor miRNAs in plasma, such as let-7a in gastric cancer [30] and miR-375 in esophageal [32] and pancreatic cancer [33], were significantly down-regulated in cancer patients compared with healthy volunteers. [score:5]
Indeed, we demonstrated that the low plasma level of tumor suppressor miR-375 in esophageal cancer patients was associated with worse survival [32]. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 7
Some of the miRNAs were involved in nutrient metabolism, such as miR-705 (regulation of lipid metabolism and inflammation), miR-143 (regulation of adipocyte differentiation) and miR-375 (regulator of glucagon levels and gluconeogenesis). [score:4]
miR-375 was also shown to be a key regulator of glucagon levels and gluconeogenesis and it was also significantly down regulated [52]. [score:3]
[1 to 20 of 2 sentences]
48
[+] score: 7
Other miRNAs from this paper: hsa-mir-375
Recently, Jung et al. found that a tumor-suppressive microRNA, miR-375, could suppress CIP2A and CIP2A -dependent Myc protein levels in oral cancer cells that resulted in inhibition of cancer cell proliferation, migration and invasion [46]. [score:7]
[1 to 20 of 1 sentences]
49
[+] score: 7
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
Most of the miRNAs were sequenced only a few times, whereas miR-127, miR-154 and miR-375 were sequenced thousands of times. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 7
Interestingly expression of miR-571 was not detected in mouse islets as compared to the highly expressed miR375 (data not shown). [score:4]
Data are presented respect to miR375 expression levels. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 6
mir-375 (C48) is selectively expressed in pancreas, which targets 3′-phosphoinositide dependent protein kinase-1 and regulates glucose induced biological responses in pancreatic beta-cells [27]. [score:6]
[1 to 20 of 1 sentences]
52
[+] score: 6
Other miRNAs from this paper: hsa-mir-375
In addition, miR-375 that directly inhibited MTDH expression reversed both tamoxifen resistance and accompanying epithelial-mesenchymal transition like properties in tamxifen resistant breast cancer cells [39]. [score:6]
[1 to 20 of 1 sentences]
53
[+] score: 6
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-30b, mmu-mir-141, mmu-mir-151, mmu-mir-10b, mmu-mir-191, mmu-mir-143, mmu-mir-30e, mmu-mir-34c, mmu-mir-34b, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-21a, mmu-mir-10a, mmu-mir-139, mmu-mir-196b, mmu-mir-465a, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-208b, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-6240, mmu-mir-30f, mmu-mir-465d, mmu-mir-466c-3
The ability of sperm-epididymosome interaction to facilitate transfer of miRNA cargo to sperm was directly assessed by RT-qPCR amplification of candidate miRNAs (miR-191, miR-375, miR-467a, miR-467d, and miR-467e) from sperm that were incubated in either media alone (sperm only) or epididymosomes (sperm + ES). [score:2]
Five miRNAs (miR-191, miR-375, miR-467a, miR-467d, miR-467e) were selected for inclusion in this analysis based on their high abundance in caput epididymosomes. [score:1]
Conversely, miRNAs miR-204b-5p and miR-375-3p returned an opposing accumulation profile for epididymosomes sampled from the same two epididymal segments (i. e. caput and cauda) with their respective levels reduced ~55 and 32 fold, respectively (Fig. 3c). [score:1]
The selected miRNAs fall into one of two groupings: i) high accumulation in the caput (miR-375, miR -467a, miR-467d and miR-467e), or ii) high accumulation in the cauda epididymis (miR-34b, miR-34c, miR-139 and miR-196b). [score:1]
Candidate miRNAs included representatives with the highest abundance (according to sequencing data) in epididymosomes from the proximal (caput: miR-375, miR-467a, miR-467d and miR-467e) or distal epididymis (cauda: miR-34b, miR-34c, miR-139 and miR-196b). [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 6
MiR-214 and miR-375 suppress the proliferation of HCC cells by directly targeting E2F3 and AEG-1 respectively [16, 17]. [score:6]
[1 to 20 of 1 sentences]
55
[+] score: 6
By monitored the tumor volume every four days, we demonstrated that Chol-miR-375 can significantly suppress the growth of hepatoma xenografts [14]. [score:3]
When tumor size reached approximately 100 mm [3], Chol-miR-375 was injected directly into the implanted tumor. [score:2]
For example, to exam the therapeutic effect of cholesterol-conjugated 2′-O-methyl − modified microRNA-375 mimics (Chol-miR-375), we inoculated 4 × 10 [6] HepG2 cells subcutaneously into the flanks of BALB/c athymic nude mice [14]. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 5
Although the TRAMP mo del has limitations as a disease surrogate [44], TRAMP mice have been successfully used to identify circulating miRs potentially linked to metastatic disease in humans, including mmu-miR-141, -298, -346 and mmu-miR-375 [45]. [score:5]
[1 to 20 of 1 sentences]
57
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
14-3-3ζ expression can be modulated by miR-193b and miR-375, which target 3′ UTR of 14-3-3ζ mRNA, in cancer cells (33, 34). [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 5
In contrast, miR-375 is a tumor suppressor in oral cancer [15], and miR-622 functions as a tumor suppressor in lung cancer cells [16]. [score:5]
[1 to 20 of 1 sentences]
59
[+] score: 5
MicroRNA-375 is downregulated in pancreatic cancer and inhibits cell proliferation in vitro. [score:5]
[1 to 20 of 1 sentences]
60
[+] score: 5
Similarly, another study showed that the expression of miR-148a/b and miR-375 were significantly downregulated in the PC developed from p48Cre;Kras [G12D] transgenic animals compared to the normal controls [59]. [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-200c, mmu-mir-21b, mmu-mir-21c
A novel target for miR-375 and miR-200c, its expression is reduced in prostate cancer cells and tissues [21]. [score:5]
[1 to 20 of 1 sentences]
62
[+] score: 5
control (fold change > 1.5 or < −1.5, p-value < 0.01), with the exception of pre-miR-375, which shows a 1.7-fold downregulation (S3 Table). [score:4]
Among these, six miRNAs (miR-138, miR-187, miR-375, miR-204, miR-210 and miR-672) are consistently and significantly detected at a lower intensity level (i. e., elevated Cq value or Cq values below the detection threshold) in Dicer1 c KO vs. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 5
Subsets of mRNAs (SLC1A3, PRKAR2B, HYDIN, WDR65, PRDX1, and ADAMTS5) and miRNAs (miR-1246, miR-375, miR-410, and miR-758) that were identified as differentially expressed by the microarray analysis were selected for further validation (Figure 4). [score:3]
However, we identified a large number of novel miRNAs (miR-411-5p, miR-375, miR-410, and miR-758) and genes (HYDIN, WDR65, PAQR5, MGARP, and FLJ45983) that have not previously been detected and may have roles during the steps of spermatogenesis. [score:1]
Four miRNAs (miR-1246, miR-375, miR-410, and miR-758) and six mRNAs (SLC1A3, PRKAR2B, HYDIN, WDR65, PRDX1, and ADATMS5) were selected to validate our miRNA and mRNA microarray data by qPCR. [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 5
Amylase and lipase increases were noted from 1–8 h in rats in both 15 and 50 μg/kg dose groups while pancreatic necrosis was noted at 8, 24 and 48 h. MiR-375-3p has been reported to be enriched in islets and the miRNA with the highest intra-islet expression [38] and in our study was increased from 4–24 h in the 15 and 50 μg/kg groups, returning to approximately vehicle level by 48 h. MiR-216a-5p and miR-217-5p remained elevated in the serum of rats longer than amylase or lipase and had a much greater dynamic range which could be advantageous if detection of pancreatic injury is not able to be examined at earlier time points. [score:3]
The tissue specificity/enrichment of many other tissue enriched miRNAs including muscle and heart enriched miRs-133a-3p, 499-5p, miR-1a-3p as well as pancreas enriched miRs-216a-5p, 217-5p and miR-375-3p were confirmed [38– 40] (Fig.   4). [score:1]
MiR-375-3p was increased from 4–24 h in the 15 and 50 μg/kg groups and returned to approximately vehicle level by 48 h. The pancreas enriched miRNAs conserved between rat and dog (miR-101c, 141-3p, 148a-3p, 193b-3p, 200c-3p,) that were tested displayed increases in the serum similar to amylase (data not shown), whereas miRs 320-3p, 4286 and 5100 were not increased (Fig.   7 and statistical analysis Additional file 15: Table S7). [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 4
For example, in obesity and diabetes, it has been demonstrated that miRNAs such as miR-375, miR-29, miR-320, miR-103, mir-107, and miR-126 play a crucial role in the regulation of glucose and lipid metabolism. [score:2]
It has been well demonstrated that miRNAs such as miR-375, miR-29, miR-320, miR-103, miR-107, and miR-126, play a crucial role in regulating glucose and lipid metabolism through control of pancreatic islet cell function, adipocyte insulin resistance, hepatocyte insulin signaling, and glucose homeostasis [15– 19]. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 4
Thus far, only four miRNAs have been commonly reported as being upregulated in the sperm of stressed fathers, namely miR-30c, miR-204, miR-375 and miR-532. [score:4]
[1 to 20 of 1 sentences]
67
[+] score: 4
miR-375 negatively regulates porcine preadipocyte differentiation by targeting BMPR2. [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 4
However, miR-215 [31], miR-375 [32], miR-141, and miR-200c [33], miR-200a [34], miR-429 [35], miR-625 [36], and miR-18a [37] have already been shown to be inversely correlated with the EMT, and they were found downregulated in this subtype. [score:4]
[1 to 20 of 1 sentences]
69
[+] score: 4
Among these miRNAs, it has been shown that the pancreatic expression levels of mir-375 are aberrant in ob/ob mice, indicating that they contribute to insulin resistance in this mo del (Poy et al., 2009). [score:3]
miR-375 maintains normal pancreatic alpha- and beta-cell mass. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 4
However, an interesting aspect of using miR-148a is that it has been proposed as one of the three miRNAs (together with miR-217 and miR-375) which downregulation is a signature of PDAC [22]. [score:4]
[1 to 20 of 1 sentences]
71
[+] score: 4
Elshafei A, Shaker O, Abd El-Motaal O, Salman T. The expression profiling of serum miR-92a, miR-375, and miR-760 in colorectal cancer: an Egyptian study. [score:3]
Several miRNAs have been found to participate in the pathogenesis of CRC, including miR-21, miR-451, miR-499-5p, miR-375, and miR-142-5p [8]. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 3
Other miRNAs from this paper: hsa-mir-375, dre-mir-375-1, dre-mir-375-2
The is the target of mammalian microRNAs (miRNAs) [84] and their relevance to diabetes is underscored by the finding that mouse islet-specific miR-375 affects insulin secretion [85]. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
MiR-375 and miR-7, known as islet miRNAs [11], [13], [48], [49], are only 2 and 2.7 fold more expressed in β-cells (Table 1 ). [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
Recent studies show that AEG-1 is induced by hypoxia and glucose deprivation in glioblastoma [19], activates angiopoietin-1 (Ang1), matrix metalloproteinase (MMP)-2, and HIF-1 [20, 21], and plays a critical role in hepatocellular carcinoma progression as a target of microRNA-375 [22]. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
miR-375 inhibits differentiation of neurites by lowering HuD levels. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
Chang Y, Yan W, He X, Zhang L, Li C, Huang H, Nace G, Geller DA, Lin J, Tsung A (2012) miR-375 Inhibits Autophagy and Reduces Viability of Hepatocellular Carcinoma Cells Under Hypoxic Conditions. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
It has also been reported that systemic knockout of miR-375 reduces β-cell mass in young (4-week-old) mice (Poy et al., 2009), while β-cell-specific knockout of miR-200 enhances β-cell apoptosis in obese diabetic mice (Belgardt et al., 2015). [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Recent studies from several independent groups revealed that miR-375, an islet-specific microRNA, was overexpressed in T2DM pancreata [43]– [45]. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
Other miRNAs such as miR-192, miR-139-5p, miR-483-5p, miR-142-3p, miR-142-5p, or miR-375 have not been previously described to be expressed in HSCs. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
For example, miR-375 suppresses glucose -induced insulin secretion in pancreatic β-cells [20], thus demonstrating an essential role in plasma glucose homeostasis. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
miR-375 functioned as both an oncomiR and tumor suppressor miRNA in prostate cancer, depending on the stage of tumor progression and hormone status [37]. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Other miRNAs from this paper: hsa-mir-375
Also, the molecular regulations of E6AP in cancers have been studied, yielding discoveries such as its regulation by HMGB2 [13], c-abl [14], miR-375 [15], and E6 [16]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
An increase in β-cell death was demonstrated by analysis of plasma miR-375 levels early after PDL in Stat3 [−/−] mice. [score:1]
Analysis of miR375 was performed as described by Roels et al. [72] (In preparation). [score:1]
miR375 analysis in plasma. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 3
Importantly, well established tissue-specific miRNAs, which are not expected to be expressed in the inner ear, such as mir-1/206, mir-155, mir-122 and mir-375, were not detected in either organ by our microarray analysis. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 2
miR-375 and miR-34a are associated with pancreatic development, and miR-375 and miR-9 are implicated in insulin secretion[1, 3]. [score:2]
[1 to 20 of 1 sentences]
86
[+] score: 2
A few miRNAs, like miR-30a, miR-101, miR-376b, miR-130a, miR-375, miR-502, have been identified as the regulators of autophagy [6- 9]. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
MiR-375 was also confirmed to inhibit metastasis and invasion of HCC cells [13]. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
Recently, CTCF was found to be involved in the regulation of miR-125b1, miR-375, and the miR-290 cluster in breast cancer cells and stem cells [43]. [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 2
Other sex differences such as higher levels of miR375 in males, that are directly related to stress 32, may also contribute to differing mood homeostasis (see Supplementary Figure 1B). [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
The use of diverse cell types in the studies of the role of miR-375 [23, 24] and Let-7 [25, 26] in the regulation of asthma pathogenesis prevented a consistent and clear interpretation of the results. [score:2]
[1 to 20 of 1 sentences]
91
[+] score: 2
Herein, increased miR-375 levels are shown to be specifically associated to HBV positive HCC (Li et al., 2010). [score:1]
A comprehensive study on a wide cohort of patients with HBV or HCV based HCC revealed that high miR-25, let7f and primary miR-375 profiles only occurred in HCC -positive patients. [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 1
Staying with the epithelium, several microRNA have also been implicated in foetal alveolar type II cell differentiation, including the miR-200 family [18, 19], miR-375 [20], and miR-124 [21]. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
Zhnag et al. have shown that high levels of miR-375 and low levels of miR-142-5p are a predictor for the outcome of gastric carcinoma [49]. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Mir-375 [22] and miR-9 [23] can influence insulin secretion, while mir-34a can increase hormone secretion in insulin-secreting cells when exposed to palmitate [24]. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
Mice lacking miR-375 show abnormal glucose homeostasis and pancreatic α and β cell numbers [48]. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
The sub-network III is composed of the miR-200 family (including miR-200a, miR-200b, miR-200c, and miR-141), the miR-183-96-182 cluster, and miR-375. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Madhavan et al. demonstrated that breast cancer patients that are positive for circulating tumor cells (CTCs) versus patients negative for CTCs had significantly higher levels of miR-141, miR-200a, miR-200b, miR-200c, miR-203, miR-210, miR-375, and miR-801 in their plasma [13]. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
Huang et al. reported that miR-1290 and miR-375 in EVs are promising prognostic biomarkers for prostate cancer [44]. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Chen S Zheng Y Zhang S Jia L Zhou Y Promotion effects of miR-375 on the osteogenic differentiation of human adipose-derived mesenchymal stem cellsStem Cell Reports. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
pval miRNA fold change mRNA fold change description mmu-miR-449c-5p Myc −0.89 1.2E-04 1.60E-03 −13.7 7.7 v-myc avian myelocytomatosis viral oncogene homolog mmu-miR-181a-5p Lmo1 −0.73 5.8E-03 1.80E-02 −8.1 5.1 LIM domain only 1 (rhombotin 1) mmu-let-7d-3p Ccnd2 −0.94 6.0E-06 4.00E-04 −77.7 4.3 cyclin D2 mmu-miR-375-3p Specc1 −0.83 7.4E-04 4.40E-03 −7.7 3.8 sperm antigen with calponin homology and coiled-coil domains 1 mmu-miR-92b-5p Notch1 −0.95 3.2E-06 3.10E-04 −108.1 3.5 notch 1 mmu-miR-328-3p Pim1 −0.9 7.6E-05 1.20E-03 −48.1 3.1 Pim-1 proto-oncogene serine/threonine kinase mmu-miR-223-3p Msh2 −0.88 2. 1E-04 2.10E-03 567.7 −3.6 mutS homolog 2 mmu-miR-143-3p Chek2 −0.81 1.3E-03 6.40E-03 6.9 −3.5 checkpoint kinase 2 Due to the similarity of the gene expression patterns, we further investigated whether the bronchial genomic classifier from mice can assist in the diagnosis of lung cancer in humans. [score:1]
[1 to 20 of 1 sentences]