sort by

28 publications mentioning mmu-mir-382

Open access articles that are associated with the species Mus musculus and mention the gene name mir-382. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 268
More importantly, co-transfection with miR-382 inhibitor and siRNA-PTEN (sequence-01 or -02) abolished the inhibitory effect of miR-382 inhibitor on hepatocyte proliferation and cell growth (Figure 5C-5F). [score:7]
B. qRT-PCRs showed that miR-382-5p was upregulated, while miR-504-3p, -3068-3p, -664-5p, and -5100 were downregulated in the mouse liver at PH-48h (n=5). [score:7]
Using PTEN siRNA and Akt activator/inhibitor, our data further provide key evidence indicating that Akt phosphorylation, at least in part associated with PTEN inhibition, is essential for miR-382 overexpression -induced hepatocyte proliferation and cell growth. [score:7]
For overexpression or suppression of miR-382, cells were transfected with miR-382 mimics (50 nM, RiboBio, China), miR-382 inhibitor (100 nM, Ribobio, China), or their negative controls for 48 hrs, respectively. [score:7]
Figure 7CCK-8 cell counting (n=10) A., EdU (green) cell proliferation assay (n=5) B., Ki67 (red) immunostaining (n=5) C., and flow cytometry (n=5) D. demonstrated that Akt activator (Akt-a) reversed miR-382 inhibitor (miR-382-i) -induced suppression of NCTC1469 cell proliferation and cell cycle progression, while Akt inhibitor (Akt-i) abolished miR-382 mimics (miR-382-m) -induced cell proliferation and cell growth. [score:6]
miR-382-m or miR-382-i. CCK-8 cell counting (n=10) A., EdU (green) cell proliferation assay (n=5) B., Ki67 (red) immunostaining (n=5) C., and flow cytometry (n=5) D. demonstrated that Akt activator (Akt-a) reversed miR-382 inhibitor (miR-382-i) -induced suppression of NCTC1469 cell proliferation and cell cycle progression, while Akt inhibitor (Akt-i) abolished miR-382 mimics (miR-382-m) -induced cell proliferation and cell growth. [score:6]
We further found that miR-382 overexpression increased Akt phosphorylation in NCTC1469 cells, while miR-382 downregulation showed inverse effect (Figure 4A and 4B). [score:6]
We further found that miR-382 overexpression was associated with a reduced cell population in G1 phase and an increased cell population in S phase using flow cytometry, indicating that miR-382 promoted the transition of NCTC1469 cell population from G1 phase to S phase of the cell cycle, while miR-382 downregulation had inverse effect (Figure 2E). [score:6]
miR-382 overexpression negatively correlates with PTEN protein level and parallels with increased Akt phosphorylation both in vitro and in vivoPTEN has previously been confirmed as a direct target of miR-382 in HIF-1α-stimulated vascular endothelial cells [25]. [score:6]
Noteworthy, miR-382-5p (previous IDs: miR-382) overexpression or suppression was found to be effective to modify hepatocyte proliferation (for detail see following results). [score:5]
Our data show that miR-382 overexpression increases cell proliferation and induces a G1 to S phase transition of the cell cycle in both mouse NCTC1469 and human HL7702 liver cells, while miR-382 inhibition exhibits inverse effects, indicating miR-382 as a promoter for hepatocyte proliferation and cell cycle progression that might contribute to liver regeneration at proliferative stage. [score:5]
Additionally, miR-382 overexpression negatively correlated with PTEN expression at post transcriptional level both in vivo and in vitro. [score:5]
Here we demonstrated that miR-382 mimics reduced, while miR-382 inhibitor increased PTEN expression at protein level in NCTC1469 liver cells (Figure 4A and 4B). [score:5]
In conclusion, the present study shows an induction of miR-382 in the mouse liver during the proliferative phase of liver regeneration, and further demonstrates that miR-382 overexpression promotes hepatocyte proliferation and cell growth via targeting PTEN-Akt axis. [score:5]
We further confirm that PTEN inhibition and Akt phosphorylation are required for miR-382 overexpression -induced hepatocyte proliferation and cell cycle progression. [score:5]
Here we showed that miR-382 mimics or Akt activator enhanced, while miR-382 inhibitor or Akt inhibitor reduced the proliferation of NCTC1469 liver cells (Figure 7A-7C). [score:5]
Using PTEN siRNA and Akt activator/inhibitor, we further confirmed that PTEN inhibition and Akt phosphorylation were essential for mediating the promotive effect of miR-382 in hepatocyte proliferation and cell growth. [score:5]
Noteworthy, co-treatment with miR-382 mimics and Akt inhibitor significantly abolished miR-382 overexpression -induced hepatocyte proliferation and cell growth (Figure 7A-7D). [score:5]
MiR-382 mimics increased, while miR-382 inhibitor reduced miR-382 level in NCTC1469 and HL7702 liver cells, confirming that these mimics and inhibitor took effects (Figures 2A and 3A). [score:5]
Meanwhile, miR-382 mimics or Akt activator induced a G1 to S phase transition of NCTC1469 cells, while miR-382 inhibitor or Akt inhibitor caused a G1 phase arrest (Figure 7D). [score:5]
Furthermore, we demonstrate that miR-382 negatively regulates PTEN expression and increases Akt phosphorylation in cultivated hepatocytes. [score:4]
CCK-8 cell counting (n=10) C., EdU (green) cell proliferation assay (n=5) D., and Ki67 (red) immunostaining (n=5) E. demonstrated that siRNA-PTEN (sequence-01 or -02) reversed the suppressive effect of miR-382 inhibitor (miR-382-i) on the proliferation of NCTC1469 cells. [score:4]
PTEN has previously been confirmed as a direct target of miR-382 in HIF-1α-stimulated vascular endothelial cells [25]. [score:4]
First, as multiple secreted and soluble factors, such as tumor necrosis factor (TNF), interleukin-6 (IL-6), hepatocyte growth factor (HGF), epidermal growth factor (EGF) and transforming growth factor-α (TGF-α), are responsible for initiating and promoting the liver regeneration process [43], it will be of interest to examine whether miR-382 upregulation during liver regeneration is related to these factors. [score:4]
The upregulation of miR-382 during the proliferative phase of liver regeneration is intriguing. [score:4]
PTEN, has previously been identified as a direct target gene of miR-382 contributing to hypoxia -induced angiogenesis [25]. [score:4]
The overexpression of miR-382 may be considered as a prospective novel therapeutic target to improve liver regeneration. [score:4]
miR-382 is upregulated in mouse regenerating liver. [score:4]
Moreover, miR-382 negatively regulates PTEN expression and increases Akt phosphorylation both in vitro and in vivo. [score:4]
Figure 3 A. qRT-PCR analysis for miR-382 level in HL7702 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
E. Flow cytometry showed that miR-382 mimics induced a G1 to S phase transition of the cell cycle of NCTC1469 cells, while miR-382 inhibitor had inverse effect (n=5). [score:3]
Figure 4miR-382 negatively correlates with PTEN expression at protein level both in vitro and in vivo A. for PTEN, p-AKT, and total AKT in NCTC1469 cells transfected with miR-382 mimics (miR-382-m) or negative control (nc-m) (n=3). [score:3]
On the other hand, miR-382 has been identified as metastasis-suppressive miRNA in melanoma [33]. [score:3]
F. Flow cytometry showed that miR-382 inhibitor -induced G1 phase arrest of NCTC1469 cells was significantly abolished by siRNA-PTEN (sequence-01 or -02) (n=5). [score:3]
miR-382 promotes hepatocyte proliferation and cell growth via targeting PTEN. [score:3]
Akt activation is involved in miR-382 overexpression -induced hepatocyte proliferation. [score:3]
siRNA-PTEN reverses miR-382 inhibition -induced NCTC1469 cell growth arrest. [score:3]
Thus, the present study identifies miR-382 as a promoter for hepatocyte proliferation and cell growth via targeting PTEN-Akt axis. [score:3]
Meanwhile, miR-382 inhibitor caused a G1 phase arrest in NCTC1469 cells, while siRNA-PTEN-01 or -02 induced a transition of the cell population from G1 to S phase (Figure 5F). [score:3]
A. qRT-PCR analysis for miR-382 level in HL7702 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
A. qRT-PCR analysis for miR-382 level in NCTC1469 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
The total Akt protein level was found unchanged in NCTC1469 cells either with miR-382 mimics or inhibitor transfection (Figure 4A and 4B). [score:3]
Figure 2 A. qRT-PCR analysis for miR-382 level in NCTC1469 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
Collectively, these data indicate that miR-382 is a promoter for hepatocyte proliferation and liver regeneration via targeting PTEN-Akt axis. [score:3]
These data indicate a potential relationship between miR-382 overexpression and the PTEN/Akt signaling pathway during the proliferative phase of liver regeneration that might contribute to the cell growth and proliferation of hepatocytes. [score:3]
E. Flow cytometry showed that miR-382 mimics induced a G1 to S phase transition of the cell cycle of HL7702 cells, while miR-382 inhibitor had inverse effect (n=5). [score:3]
B. for PTEN, p-AKT, and total AKT in NCTC1469 cells transfected with miR-382 inhibitor (miR-382-i) or negative control (nc-i) (n=3). [score:3]
Akt activation is required for miR-382 overexpression -induced hepatocyte proliferation. [score:3]
miR-382 negatively correlates with PTEN expression at protein level both in vitro and in vivo. [score:3]
Also, Akt activator could reverse miR-382 inhibition -induced NCTC1469 cell growth arrest (Figure 7A-7D). [score:3]
miR-382 overexpression promotes hepatocyte proliferation and G1/S phase transition of the cell cycle in vitro. [score:3]
Also, miR-382 inhibits tumor growth and metastasis in osteosarcoma [34, 35]. [score:3]
miR-382 overexpression negatively correlates with PTEN protein level and parallels with increased Akt phosphorylation both in vitro and in vivo. [score:3]
These data suggest that the promotive effect of miR-382 on hepatocyte proliferation and cell growth is closely related to PTEN inhibition. [score:3]
Next, qRT-PCRs were further conducted, verifying that the expression of miR-382-5p was significantly increased, while miR-3068-3p, -664-5p, and -5100 decreased in the mouse liver at PH-48h (Figure 1B). [score:3]
miR-382-m or miR-382-i. Liver regeneration after PH is principally mediated by the proliferation of hepatocytes which can be impacted by dysregulated miRNAs, though the underlying molecular mechanisms are still largely unclear. [score:2]
However, whether the PTEN/Akt axis is regulated by miR-382 in hepatocytes is unknown. [score:2]
CCK-8 cell counting, EdU cell proliferation assay, and Ki67 immunostaining showed that NCTC1469 cell proliferation was reduced by miR-382 inhibitor, while increased by siRNA-PTEN-01 or -02 (Figure 5C-5E). [score:2]
CCK-8 cell counting, EdU cell proliferation assay, and Ki67 immunostaining showed that miR-382 mimics promoted, while miR-382 inhibitor reduced the proliferation of NCTC1469 liver cells (Figure 2B-2D). [score:2]
CCK-8 cell counting (n=10) B., EdU (green) cell proliferation assay (n=5) C., and Ki67 (red) immunostaining (n=5) D. demonstrated that miR-382 mimics promoted while miR-382 inhibitor reduced NCTC1469 cell proliferation. [score:2]
CCK-8 cell counting (n=10) B., EdU (green) cell proliferation assay (n=5) C., and Ki67 (red) immunostaining (n=5) D. demonstrated that miR-382 mimics promoted while miR-382 inhibitor reduced HL7702 cell proliferation. [score:2]
As certain cyclins such as cyclin D1 and cyclin E are key regulators for G1/S phase transition, further study is needed to examine the molecular mechanisms by which miR-382 impacts the proliferation and cell cycle progression of hepatocytes [36- 39]. [score:2]
Transfection with miR-382 mimics or siRNA-PTEN (sequence-01 or -02) alone also induced a transition of cell population from G1 to S phase in NCTC1469 cells (Figure 6D). [score:1]
miR-382-i. To further examine to which extent PTEN modulation mediates the role of miR-382 on hepatocyte proliferation, miR-382 mimics and siRNA-PTEN were co -transfected to NCTC1469 liver cells. [score:1]
miR-382-i. To further examine to which extent PTEN modulation mediates the role of miR-382 on hepatocyte proliferation, miR-382 mimics and siRNA-PTEN were co -transfected to NCTC1469 liver cells. [score:1]
miR-382-m or miR-382-i. Our group has previously demonstrated that hepatocyte proliferation peaked at 48 hrs after PH in the mouse liver as represented by a peak of PCNA protein level and EdU positive cells [4]. [score:1]
Thus, the biological functions of miR-382 are tissue and cell dependent. [score:1]
miR-382 promotes hepatocyte proliferation and cell growth in vitroTo investigate the effects of miR-382 on the cell growth and proliferation of hepatocytes, miR-382 mimics, inhibitor, or their negative controls were transfected to mouse NCTC1469 and human HL7702 normal liver cells, respectively. [score:1]
miR-382-m or miR-382-i; ##, P<0.01 vs. [score:1]
miR-382 promotes the proliferation and cell growth of mouse NCTC1469 liver cells. [score:1]
A. for PTEN, p-AKT, and total AKT in NCTC1469 cells transfected with miR-382 mimics (miR-382-m) or negative control (nc-m) (n=3). [score:1]
To investigate the effects of miR-382 on the cell growth and proliferation of hepatocytes, miR-382 mimics, inhibitor, or their negative controls were transfected to mouse NCTC1469 and human HL7702 normal liver cells, respectively. [score:1]
These data, together with the results of PTEN, fully support that the PTEN/Akt signaling pathway is a downstream mechanism mediating the role of miR-382 in hepatocyte proliferation and cell growth. [score:1]
Thus, miR-382 is validated as a promoter for cell growth and proliferation of hepatocytes in vitro. [score:1]
Indeed, it will be highly needed to further examine the in vivo effect of miR-382 in liver regeneration in the future. [score:1]
Meanwhile, the promotive effect of miR-382 in the proliferation and cell growth of hepatocytes were also found in human HL7702 liver cells (Figure 3B-3E). [score:1]
Our data showed that miR-382 could promote hepatocyte proliferation and cell growth in vitro. [score:1]
miR-382 promotes hepatocyte proliferation and cell growth in vitro. [score:1]
However, co-transfection with miR-382 mimics and siRNA-PTEN did not further enhance the proliferation or cell growth of hepatocytes (Figure 6A-6D). [score:1]
Previously, miR-382 induced by HIF-1α has been identified as an angiogenic miRNA in vascular endothelial cells [25]. [score:1]
miR-382-i; ##, P<0.01 vs. [score:1]
miR-382 promotes the proliferation and cell growth of human HL7702 liver cells. [score:1]
In the current study, we found a marked induction of miR-382 in the mouse liver at 48 hrs after 70% PH. [score:1]
D. Flow cytometry showed that siRNA-PTEN (sequence-01 or -02) did not further enhance the miR-382 mimics -induced G1 to S phase transition of the cell cycle of NCTC1469 cells (n=5). [score:1]
siRNA-PTEN does not further enhance the promotive effect of miR-382 on the proliferation and cell growth of NCTC1469 cells. [score:1]
Besides that, increased serum miR-382 has been suggested to be a potential biomarker for breast cancer [32]. [score:1]
In this study, we found a significant elevation of miR-382 in the mouse liver at 48 hrs after 70% PH using microarrays and quantitative reverse transcription-polymerase chain reactions (qRT-PCRs). [score:1]
As PTEN is an inhibitor for Akt phosphorylation, we further investigated whether Akt contributes to the promotive effect of miR-382 on hepatocyte proliferation and cell growth. [score:1]
miR-382, one of the miRNA located in chromosome 14q32 locus, has been reported to be involved in angiogenesis as well as in cancer growth and invasion [25, 28- 31]. [score:1]
[1 to 20 of 89 sentences]
2
[+] score: 213
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21a, hsa-mir-382, mmu-mir-21b, mmu-mir-21c
Inhibiting the expression of miR-382 with anti-miR-382 led to an increased expression of Trx, as well as a decreased expression of 3-NT in UUO mice. [score:9]
LNA-anti-miR-382 treatment (10 mg/kg) significantly reversed the downregulation of Trx and suppressed the expression of 3-NT in mice subjected to UUO (10 mg/kg anti-382 group versus anti-NC group, Trx: 0.43 ± 0.13 versus 0.20 ± 0.06, P < 0.05; 3-NT: 2.11 ± 0.27 versus 4.52 ± 0.16, P < 0.05). [score:8]
Anti-miR-382 oligo treatment inhibited the upregulation of miR-382 and reversed the decrease of HSPD1 expression induced by TGF- β1 in cultured HK2 cells (Figure 3(b)). [score:8]
Treatment with anti-miR-382 oligos significantly reversed TGF- β1 -induced suppression of E-cadherin expression and augmentation of α-SMA expression [5]. [score:7]
The current study suggests that upregulation of miR-382, which targets antioxidative stress genes and HSPD1, may partially contribute to the development of renal tubulointerstitial fibrosis. [score:7]
Meanwhile, the downregulation of Trx or the upregulation of Bax secondary to UUO was partially reversed after anti-miR-382 treatment but not reversed with anti-miR-382 treatment combined with HSPD1 siRNA treatment (Figures 9(b), 9(c), and 9(e)). [score:7]
The inverse relationship between miR-382 expression and renal expression of HSPD1 also exists in the obstructed kidneys of UUO mice as well as in patients with chronic kidney disease. [score:7]
Renal histological analysis showed that blocking the expression of miR-382 could attenuate renal interstitial fibrosis (Figures 1(a), 1(c), and 1(d)) and the immunohistochemical staining indicated that the upregulation of α-SMA and Vimentin was partially reversed in obstructed kidneys after 10 mg/kg anti-miR-382 treatment (Figures 1(e) and 1(f)). [score:6]
The antioxidative capacity of renal tissue declined when HSPD1 expression was downregulated, which suggested that excessive oxidative stress may be an important mechanism whereby miR-382 participates in renal fibrosis. [score:6]
Anti-miR-382 treatment with a dosage of 10 mg/kg suppressed the downregulation of HSPD1 in UUO mice (Figure 4). [score:6]
Overexpression of miR-382 Reduces the Antioxidant Capacity of Renal Tissues by Downregulating HSPD1. [score:6]
Similarly, HSPD1 expression was upregulated and TIF in the obstructed kidneys was alleviated after LNA-anti-miR-382 (10 mg/kg) treatment. [score:6]
Her study revealed that the upregulation of miR-382 contributed to the inner medullary interstitial fibrosis in mice, partially mediated by targeting of KLK5 [30]. [score:6]
In our previous study, the abundance of miR-382 in HK2 cells was upregulated with the development of EMT induced by TGF- β1. [score:5]
Treatment with 10mg/kg dosage of anti-miR-382 suppressed the expression of Vimentin in UUO mice, but not with the dosage of 20mg/kg. [score:5]
In vitro experiments revealed that the mRNA expression of HSPD1 was significantly suppressed by pre-miR-382 in HK2 cells, whereas anti-miR-382 treatment significantly reversed the decrease of HSPD1 mRNA. [score:5]
In this study, we found that transfecting HK2 cells with pre-miR-382 significantly suppressed the protein expression of HSPD1 (pre-382 versus pre-NC, 0.60 ± 0.04 versus 1.00 ± 0.04, resp. [score:5]
Treatment with 10mg/kg anti-miR-382 suppressed the expression of α-SMA in obstructed kidneys but not with the dosage of 20mg/kg. [score:5]
Intravenous injection of LNA-anti-miR-382 oligonucleotides (10 mg/kg) significantly alleviated the pathological damage in the obstructed kidneys and suppressed the protein expression of Vimentin and α-SMA. [score:5]
Owing to only a subset of target genes of a miRNA being expressed in a tissue, limited tissue-specific functional roles of the miR-382 can be expected. [score:5]
Mutations introduced into the predicted binding site of miR-382 within the 3′-UTR of HSPD1 prevented the suppression of HSPD1 by pre-miR-382 (Figure 3(c)). [score:4]
In the anti-miR-382 group, the expression of miR-382 was significantly suppressed by 10 mg/kg LNA-anti-miR-382 treatment compared with the antiscrambled (10 mg/kg anti-382 versus antiscrambled, 1.95 ± 0.33 versus 3.98 ± 0.54, resp. [score:4]
Fluorescence immunoblotting test showed that the downregulation of 3-NT secondary to anti-miR-382 treatment was blocked by HSPD1 siRNA (Figures 9(f) and 9(h)). [score:4]
Therefore, HSPD1 serves as one of the target genes of miR-382, which was further verified by site-directed mutagenesis. [score:4]
In addition, in vivo study found that the renal protective effects of miR-382 blockade against fibrosis, apoptosis, and redox imbalance of the obstructed kidneys were abolished by renal knockdown of HSPD1, which further proved our hypothesis that miR-382 might contribute to renal interstitial fibrosis by oxidative stress -induced apoptosis secondary to the inhibition of HSPD1. [score:4]
As excessive oxidative stress contribute to the development of TIF, therefore, inhibiting the antioxidative capacity of renal tissue may be one of the important mechanisms in which miR-382 promotes renal tubular interstitial fibrosis. [score:4]
Besides ECM genes, a cluster of mitochondrial proteins including HSPD1 was identified as new predicted target genes of miR-382, suggesting that the contribution of miR-382 in the development of TIF could be mediated by pathways of different mechanisms [5]. [score:4]
Recently, Xu et al. reported miR-382 as an inhibitor of metastasis and EMT in osteosarcoma, which was contradictory to our results from renal tissue [27]. [score:3]
Expression levels of miR-382 were quantified by real-time reverse transcription-PCR with the TaqMan chemistry (Applied Biosystems) as previously described [5, 13]. [score:3]
Kriegel AJ, a member of our research group, had demonstrated that Kalliken5 (KLK5), a (chymo) trypsin-like proteinase that mediates degradation of many extracellular matrix proteins, was a target of miR-382 in the mouse UUO mo del. [score:3]
In IgAN patients with TIF, miR-382 abundance was significantly upregulated compared to that in IgAN patients with no TIF (5.59 ± 0.79 versus 1.00 ± 0.23, P < 0.01, Figure 5(c)). [score:3]
Identification of HSPD1 as a New Target of miR-382. [score:3]
We also found that anti-miR-382 treatment alone could, to some extent, induce HSPD1 expression independently of TGF- β1. [score:3]
Since enhanced oxidative stress or redox imbalance has been proved to correlate with renal dysfunction [10, 11], miR-382 or HSPD1 might potentially serve as a new target for therapy in advanced CKD. [score:3]
Tubulointerstitial fibrosis developed after 7 days of UUO in the obstructed kidneys (Figure 1(a)), and the expression of miR-382 was higher in the UUO group (UUO versus control, 4.32 ± 0.45 versus 1.00 ± 0.13, resp. [score:3]
Proteomic and bioinformatic analyses revealed that heat shock protein 60 (HSPD60, HSPD1) was a target gene of miR-382 [5]. [score:3]
Expression of miR-382 was detected by in situ hybridization (ISH), following the protocol of “One-day microRNA ISH” suggested by Exiqon. [score:3]
According to our previously published data, we found that miR-382 targeted a cluster of oxidative-related genes including HSPD1 [5]. [score:3]
We proved that miR-382 -targeted HSPD1 participated in the setting of renal tubulointerstitial fibrosis. [score:3]
Primers used for introducing point mutations for HSPD1 were as follows: forward primer, 5- CAAGGCAGTGTTCCTCACCAATA gaTTCAGAGAAGACAGTTG -3; reverse primer, 5- CAACTGTCTTCTCTGAA tcTATTGGTGAGGAACACTGCCTTG -3. Underlined nucleotides represent the mutations introduced, and these nucleotides are located in the core region of the predicted target site for miR-382. [score:2]
Fibrosis quantification from Sirius red-stained tissues indicated that anti-miR-382 -treated mice with renal knockdown of HSPD1 were not protected from developing tubulointerstitial fibrosis (Figures 9(f) and 9(g)). [score:2]
In this study, we explored the role of miR-382 in the development of renal fibrosis and its possible mechanism. [score:2]
Therefore, the goals of this study mainly were to verify the complementary relationship between miR-382 and HSPD1, as well as to further explore the role of miR-382 in the development of renal tubulointerstitial fibrosis. [score:2]
It is possible that miR-382 may serve as either the downstream of TGF- β1 or being in parallel to TGF- β1. [score:1]
In our in vivo animal study, mice that underwent UUO were treated with either anti-miR-382 or antiscrambled control. [score:1]
Therefore, the role of miR-382 could be different in different subtypes of EMT [22]. [score:1]
3.1. miR-382 Contributes to the Progression of Renal Tubulointerstitial Fibrosis in UUO Mice. [score:1]
More work is needed to examine, and miR-382 is a potential therapeutic candidate for prevention or treatment of renal tubulointerstitial fibrosis in combination with others. [score:1]
Briefly, HeLa cells (80–90% confluency) were cotransfected with the following: a 3′-UTR reporter construct (100 ng per well), a pRL-TK internal control plasmid (50 ng per well), and control pre-miR-382 oligonucleotides (10 pmol per well, from Ambion). [score:1]
Pre-miR-382 or anti-miR-382 oligonucleotides were obtained from Ambion. [score:1]
Locked nucleic acid- (LNA-) modified anti-miR-382 oligonucleotides antiscrambled (Exiqon) were diluted in saline (5 mg/ml) and intravenously delivered via tail vein (10 mg/kg) within 30 mins prior to UUO, and the dosage was repeated 24 hours after the surgery. [score:1]
Besides, anti-miR382 treatment also attenuated renal injury with less increased serum creatinine (Figure 1(f)) and blocked inflammatory cell infiltration in the obstructed kidney (Figure 2). [score:1]
There also existed an inverse relationship between HSPD1 and miR-382 abundance. [score:1]
Cotransfection with pre-miR-382 to the HeLa cells reduced the luciferase activity significantly. [score:1]
Renal HSPD1 Mediates the Protective Effects of miR-382 Blockade against Renal Tubulointerstitial Fibrosis. [score:1]
Locked nucleic acid- (LNA-) modified anti-miR-382 (10 mg/kg) was delivered by tail vein injection 30 min prior to UUO, and the dosage was repeated 24 h after the surgery. [score:1]
In the mouse UUO mo del, we found that the progression of TIF was accompanied with an increased abundance of miR-382 in the obstructed kidneys. [score:1]
Besides, the endogenous abundance of miR-382 in HK2 cells should be taken into account. [score:1]
The interaction between miR-382 and HSPD1 was also observed in a clinical study. [score:1]
2.8. miR-382 In Situ Hybridization. [score:1]
[1 to 20 of 60 sentences]
3
[+] score: 28
[29] ST2 stromal cells unknownInduced double-strand DNA breaks and reactive oxygen speciesaccumulation in transfected cells [30] miR-22-3p SIRT1 CDK6 SP1Induced growth suppression and acquisition of a senescentphenotype in human normal and cancer cells [31] human HDAC6Promoted osteogenic differentiation and inhibits adipogenic differentiationof human adipose tissue-derived mesenchymal stem cells [32] human miR-31-5p RhoBTB1Repression of miR-31 inhibited colon cancer cell proliferation andcolony formation in soft agarose [33] HT29 cells unknownIs associated with marked change in the expression of specificmiRNA during aging in skeletal muscle [34] mouse miR-378-5p NephronectinGalNT-7Inhibited osteoblast differentiation [35] MC3T3-E1 miR-382-5p unknownDownregulated in skeletal muscle of old mice [34] mouseIn order to validate the sequencing data, we selected several miRNAs from Table 2 for additional qRT-PCR validation, which the minimum normalized read count of miRNAs was 5 in young, adult and old groups, including miR-210 [29], miR-22 [31], [32], miR-31 [36], [37], and miR-10b [16](Figure 3). [score:14]
[29] ST2 stromal cells unknownInduced double-strand DNA breaks and reactive oxygen speciesaccumulation in transfected cells [30] miR-22-3p SIRT1 CDK6 SP1Induced growth suppression and acquisition of a senescentphenotype in human normal and cancer cells [31] human HDAC6Promoted osteogenic differentiation and inhibits adipogenic differentiationof human adipose tissue-derived mesenchymal stem cells [32] human miR-31-5p RhoBTB1Repression of miR-31 inhibited colon cancer cell proliferation andcolony formation in soft agarose [33] HT29 cells unknownIs associated with marked change in the expression of specificmiRNA during aging in skeletal muscle [34] mouse miR-378-5p NephronectinGalNT-7Inhibited osteoblast differentiation [35] MC3T3-E1 miR-382-5p unknownDownregulated in skeletal muscle of old mice [34] mouse In order to validate the sequencing data, we selected several miRNAs from Table 2 for additional qRT-PCR validation, which the minimum normalized read count of miRNAs was 5 in young, adult and old groups, including miR-210 [29], miR-22 [31], [32], miR-31 [36], [37], and miR-10b [16](Figure 3). [score:14]
[1 to 20 of 2 sentences]
4
[+] score: 23
The double-stranded oligonucleotides encoding the pre-miRNA sequences of miR-376a, miR-299, miR-382 or irrelevant miRNA (a miR -negative control, predicted not to target any known vertebrate gene) were cloned into the pcDNA6.2-GW/EmGFP-miR expression vector such that the pre-miRNA insertion site was in the 3′ untranslated (3′UTR) region of the green fluorescent protein (GFP) gene as per the instruction manual (Invitrogen, Carlsbad, CA). [score:7]
To determine whether the overexpression of the identified signature miRNAs could confer phenotypic changes, stable cell lines were created by cloning the pre-miRNA sequences of miR-376a, miR-376abc, miR-299, or miR-382 into the pcDNA6.2-GW/EmGFP-miR vector, which contains a green fluorescent protein (GFP) cassette, and introducing them into the non-tumorigenic 10-87 LP cells. [score:3]
As found for 10-87 HP cells and 10-87 T cells, SF-VERO cells and A4497 VERO cells expressed increased levels of miR-376a, miR-654-3p, miR-543, and miR-382 over the levels found in pAGMK cells (Table 4). [score:3]
No change in migration and invasion phenotypes was observed in cells expressing miR-382 or miR-299-5p. [score:3]
However, little or no migration was observed for cells expressing miR-299 or miR-382. [score:3]
In agreement with the wound-healing assay, over -expression of miR-376a or miR-376abc also resulted in more than a four-fold increase in invasiveness, whereas miR-299 or miR-382 had no effect (Fig. 4B). [score:2]
qRT-PCR analysis confirmed that miR-376a, miR-654-3p, miR-543, miR-382, miR-31, miR-200c, miR-218, and miR-183 paralleled the microarray miRNA levels. [score:1]
miR-299-5p sense, 5′- tgctGAAGAAATGGTTTACCGTCCCACATACATTTTGAATATGTATGTGGGATGGTAAACCGCTTCTT-3′ and miR-299-5p anti-sense 5′-cctgAAGAAGCGGTTTACCATCCCACATACATATTCAAAATGTATGTGGGACGGTAAACCATTTCTTC-3′, miR-382 sense 5′- tgctGTACTTGAAGAGAAGTTGTTCGTGGTGGATTCGCTTTACTTATGACGAATCATTCACGGACAACACTTTTTTCAGTA-3′ and miR-382 anti-sense 5′-cctgTACTGAAAAAAGTGTTGTCCGTGAATGATTCGTCATAAGTAAAGCGAATCCACCACGAACAACTTCTCTTCAAGTAC-3′. [score:1]
[1 to 20 of 8 sentences]
5
[+] score: 22
miRNAs Deregulated in OS Expression Levels Compared to the Controls Overall Function miR-382 Down-regulated Poor survival outcome and metastasis marker[70, 83] miR-154 Down-regulated Poor survival outcome[70] miR-33a Up-regulated Chemoresistance[84] miR-34c Down-regulated Chemoresistance[85] Most forms of human cancer have changes in the epigenome compared to the normal cellular counterparts from which they are derived. [score:14]
Xu M. Jin H. Xu C. X. Sun B. Song Z. G. Bi W. Z. Wang Y. miR-382 inhibits osteosarcoma metastasis and relapse by targeting Y box -binding protein 1 Mol. [score:5]
We confirmed that subset of these 50 miRNAs (miR-382, miR-369-5p, miR-544 and miR-134) could target the 3′ UTR of cMYC transcript. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 18
While did not induce any DLK1-Dio3 miRNA expression in unstimulated splenocytes (medium, Fig 3A), it did induce the expression of DLK1-Dio3 miRNAs including miR-154, miR-127, miR-379, miR-382, miR-433, and miR-300 substantially in Con A activated splenocytes (Con A, Fig 3A). [score:5]
Impressively, of the 17 upregulated miRNAs in MRL- lpr mice, 11 miRNAs (miR-154, miR-127, miR-379, miR-382, miR-433, miR-300, miR-376b, miR-394, miR-299, miR-495, and miR-329) are located at a genomic imprinted DLK1-Dio3 region. [score:4]
While miR-154 showed a similar increase in splenocytes and in different splenic immune cell subsets, the other six DLK1-Dio3 miRNAs including miR-127 (Fig 5B), miR-411 (Fig 5C), miR-379 (Fig 5D), miR-382 (Fig 5E), miR-433 (Fig 5F), and miR-300 (Fig 5G) were upregulated more dramatically in CD4 [-]CD19 [-] cells when compared to that in purified CD4 [+] T and CD19 [+] B cells. [score:3]
In this study, we performed Taqman miRNA assays to confirm the upregulation of selected DLK1-Dio3 miRNAs such as miR-154, miR-127, miR-379, miR-382, miR-300, and miR-433 in MRL- lpr splenocytes. [score:3]
The expression levels of miR-154 (A), miR-127 (B), miR-411 (C), miR-379 (D), miR-382 (E), miR-433 (F), and miR-300 (G) in vehicle and 5-aza-CdR treated splenocytes, purified CD4 [+] T cells, CD19 [+] B cells, and splenic CD4 [-]CD19 [-] cells were quantified by Taqman miRNA assays. [score:2]
Unlike that we observed in splenocytes, there was a slight but significant increase of several DLK1-Dio3 miRNAs such as miR-154, miR-127, miR-379, and miR-382 even in the unstimulated CD4 [+] T cells from MRL mice (medium). [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 18
Given that more miRNAs increase than decrease in the circulation with acute liver injury it would require a highly selective process of altered clearance to explain the specific decrease in miR-382-5p and decreased tissue expression seems more plausible. [score:3]
Across all our human array studies and in mice mo dels miR-382-5p decreased in circulating concentration with liver injury. [score:1]
The mechanism of this circulating decrease of miR-382-5p is unknown, but conceptually could be either a decrease in production (such as reduced gene transcription in the injured liver) or increased clearance. [score:1]
The most abundant miRNA species in the liver 20, miR-122-5p, was the highest increased circulating miRNA but other species were elevated to comparable degrees (miR-885-5p, miR-151-3p) or were ranked higher by random forest analysis in terms of ability to report injury (miR-382-5p). [score:1]
The largest fold change miRNAs (miR-122-5p, miR-885-5p and miR-151-3p) and the best discriminating miRNA (miR-382-5p) were taken forward and tested for specificity. [score:1]
Cisplatin had no effect on miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Fig. 5E–H). [score:1]
Figure (A– D) present circulating miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in APAP-no TOX patients and patients with acute liver injury (ALI) induced by APAP overdose or another aetiology (non-APAP). [score:1]
Figure (E– H) present miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in control mice, APAP overdose mice and cisplatin -induced acute kidney injury (AKI) mice. [score:1]
There was a group of patients with lower miR-30b-5p, miR-186-5p, miR-382-5p, miR-27a-3p, miR-15a-3p and miR15a-5p. [score:1]
miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p reported acute liver injury due to causes other than acetaminophen, which is consistent with them being liver specific and demonstrates that this panel has utility in the diagnosis of acute liver injury due to multiple causes. [score:1]
The 3 largest fold increase miRNAs (miR-122-5p, miR-885-5p and miR-151a-3p) and the miRNA with the lowest prediction error from the classifier mo del (miR-382-5p) were taken forward and tested for specificity and sensitivity. [score:1]
miR-885-5p, miR-151a-5p and miR-382-5p were inferior to ALT for early prediction of liver injury (Fig. 7). [score:1]
In line with the array data, both miR-382-5p and miR-19a substantially decreased in concentration and, interestingly, they remained below the hospital admission level (Fig. 6C,D). [score:1]
Comparative biomarker profiles for miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p are summarized in supplementary Table 5. Although miR-122-5p had the highest fold increase in APAP-TOX patients, it was ranked 11th place in the miRNA panel, suggesting that other microRNA species may have greater clinical utility. [score:1]
By contrast with vehicle treated controls (N = 7), acetaminophen toxicity in mice resulted in increased miR-122-5p and miR-151a-3p, and decreased miR-382-5p, in line with our human data (Fig. 5E–H). [score:1]
However, there was no difference in miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Table 1). [score:1]
[1 to 20 of 16 sentences]
8
[+] score: 16
Furthermore, for example, miR-382 is overexpressed in multiple myeloma disease [71], while miR-485 is downregulated in ovarian cancer [75]. [score:8]
Furthermore, miR-382 has already been shown to be a crucial target of TGF-β in EMT of human renal epithelial cells [62], supporting the hypothesis that the identified direct miRNA targets of TGF-β mediate the pathway’s function. [score:6]
Positions of miRNAs are indicated with blue lines and in yellow for miR-382 (B). [score:1]
miR-181 family members and miR-382 have been previously reported to respond to TGF-β/Activin treatment in different cells and tissues [46], [61], [62], [63]. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 12
Additionally, several miRNAs that are known to exhibit tumour suppressive functions, like miR-30a-5p, miR-31, miR-335, miR-382 and miR-503, were downregulated in the p53R172H cells upon reprograming to iPS cells. [score:6]
Furthermore, a high number of miRNAs that were downregulated in p53 compromised iPS cells convey tumour suppressive functions, that is, miR-30a-5p, [55] miR-31, 56, 57 miR-335, [58] miR-382 [59] and miR-503. [score:6]
[1 to 20 of 2 sentences]
10
[+] score: 10
This connectivity diagram showed the multitude of regulatory interactions between these seven miRNAs and their three target mRNAs because miR-382 is also FGF2-regulated, targets c-Maf, resides at the rat chromosome 6 gene cluster of 61 miRNAs, and was included in Figure 7A. [score:7]
We predict that several important regulatory genes of lens fiber cell differentiation, including c-Maf, Kdm5b/Jarid1b, Med1/PBP, Nfat5/OREBP, and N-Myc, are connected by multiple shared miRNAs, with four of them, including miR-381, miR-495, miR-382, and miR-543, encoded by a miRNA cluster on rat chromosome 6, a syntenic region with mouse chromosome 12, and human 14q32.2 imprinted regions. [score:2]
The miR-381, miR-495, miR-543, and miR-382 form a miRNA-gene cluster on rat chromosome 6q32. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 10
Other miRNAs from this paper: mmu-mir-27b
Inhibition of ROR1 expression using miR382 suppressed ovarian cancer cell migration and invasion by downregulating epithelial-mesenchymal transition [25]. [score:10]
[1 to 20 of 1 sentences]
12
[+] score: 9
As illustrated in Figure 2, TGF-β1 up-regulates miR-21, miR192, miR-377, miR-382, and miR-491-5p, but down-regulates miR-29 and miR-200 families during renal fibrosis (Kantharidis et al., 2011; Kriegel et al., 2012; Lan and Chung, 2012; Chung et al., 2013a, b). [score:7]
MiR-382 targeting of kallikrein 5 contributes to renal inner medullary interstitial fibrosis. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 9
miR-382-5p has been reported to inhibit tumor growth and enhance chemosensitivity in osteosarcomas [56]. [score:3]
To discover the molecular mechanisms through which Runx1, Runx2, and the Runx -targeting miRNAs, miR-23b-5p, miR-139-5p, miR-205-5p, miR-221-3p, miR-375-3p, miR-382-5p, and miR-384-5p, drive prostate tumorigenesis, we interrogated well-accepted bioinformatics tools; DAVID [57, 58] and Ingenuity Pathway Analysis (IPA-www. [score:3]
Runx1 is uniquely targeted by miR-139-5p and miR-382-5p, neither miRNA has been extensively examined in association with prostate cancer. [score:3]
[1 to 20 of 3 sentences]
14
[+] score: 6
Tan H, He Q, Gong G, Wang Y, Li J, Wang J, Zhu D, Wu X miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer. [score:6]
[1 to 20 of 1 sentences]
15
[+] score: 6
MiR-382 modulated the expression of ΔFosB which had been linked directly to several addiction-related behaviors, and overexpression of miR-382 in NAc decreased voluntary intake and preference for alcohol in rats 35. [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 5
The array uncovered the induction of 117 miRNAs with the signal intensity ≥500 (the fluorescence amount of each miRNA probe is measured by a photo multiplier tube or charge-coupled device and signal scaled across the range of detection for the platform) in GA muscle (Table 1, Fig. 1A and 1B), including the highly downregulated miRNAs (≥1.5-fold) miR-194-5p, miR-101b-3p, miR-148a-3p, miR-199b-5p, miR-335-5p, miR-127-3p, miR-379-5p, miR-541-5p, miR-382-5p, miR-329-3p, miR-299-5p and miR-434-3p, and the highly up-regulated miRNAs (≥1.5 fold), miR-146b-5p and miR-146a-5p (Fig. 1C). [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 4
In the order of the significance score by SAM, 15 up-regulated miRNAs are mmu-miR-127, mmu-miR-410, mmu-miR-433, mmu-miR-138, mmu-miR-181c, mmu-miR-382, mmu-miR-19b, mmu-miR-381, mmu-miR-666-3p, mmu-miR-376a, mmu-miR-873, mmu-miR-181a, mmu-miR-383, mmu-miR-181b, and mmu-miR-99b. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 4
On the other hand, we found eight down-regulated miRNAs, some of them implicated in multiple processes such as cancer (miR20b-5p, miR-1291) 52, 53, organ injury in toxicity drug mo dels (miR-382-5p) [54], metabolic processes and steroidogenesis (miR-378b) [55], and tissue inflammation (miR-3085-3p) [56]. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 3
A recent study reported that miR-28, miR-125b, miR-150, miR-223, and miR-382 inhibit replication of the human immunodeficiency virus (HIV) in CD4 [+] T cells [14]. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
Notably, comparable miRNA profiling in OMSCs was recently performed in the context of schizophrenia [32], and similar results were obtained with increased miR-382 expression observed in OMSCs samples from patients but not in peripheral blood-derived/non-neuronal samples. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 2
Hu Y. W., Zhao J. Y., Li S. F., Huang J. L., Qiu Y. R., Ma X., Wu S. G., Chen Z. P., Hu Y. R., Yang J. Y., 2015 RP5–833A20.1/miR-382–5p/NFIA -dependent signal transduction pathway contributes to the regulation of cholesterol homeostasis and inflammatory reaction. [score:2]
[1 to 20 of 1 sentences]
23
[+] score: 1
Impressively, our previous microarray data indicated that in addition to miR-127 and miR-379, several other miRNAs from the Dlk1-Gtl2 region, including miR-433, miR-300, and miR-382, were also increased in MRL-lpr and B6-lpr mice [34]. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
In comparison to Mirg, the longest Meg9 clone has nine additional upstream exons and contains four more microRNAs: miR-382, miR-134, miR-668, and miR-485. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
Consistent with the interspecies shift based on PC2, 3 out of the first 5 implicated miRNAs (miR-411, miR-410, miR-382, miR-495 and miR-494) were differentially modulated in human and mouse samples (Table 1). [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
More than 40 microRNAs in the Uup group were shared by the above pathways, while miR-503, miR-122, miR-495, and miR-382 were exclusively involved in the focal adhesion pathway, and miR-150, miR-411, miR-146a/b exclusively participated in the MAPK pathway (S4 Table). [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
S7 7. Nrf2 -dependent effect of 5 mg / kg PQ Nrf2(+/+) PQ5—Nrf2(–/–) PQ5 miR-135a, miR-376c, miR-31, miR-let-7i*, miR-669b*, miR-344, miR-15b, miR-700*, miR-3099, miR-377, miR-338-5p, miR-382, miR-219-3p and miR-310a S8 8. Nrf2 -dependent effect of 10 mg / kg PQ Nrf2(+/+) PQ10—Nrf2(–/–) PQ10 miR-495*, miR-154*, miR-let-7b, miR-1983, miR-103 and miR-26a S9 The miR-380-3p / Sp3 mRNA pathway is worth to mention here. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Although miR-377and miR-382 have been implicated in renal fibrosis and HG response 26 27, our data show that multiple miRNAs of the megacluster and host lncRNA are concomitantly increased in the glomeruli and MCs under diabetic conditions. [score:1]
[1 to 20 of 1 sentences]