sort by

15 publications mentioning mmu-mir-383

Open access articles that are associated with the species Mus musculus and mention the gene name mir-383. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 336
Forced expression of miR-383 decreased the expression of Gadd45g through binding to the 3′ untranslated region (3′-UTR), whereas inhibition of miR-383 increased Gadd45g expression. [score:11]
We found that ectopic expression of miR-383 in R1 ES cells also results in the down-regulation of Gadd45g both at the mRNA and protein levels, while anti-miR-383 up-regulates Gadd45g (Fig. 4A and B), suggesting a consistent role of miR-383 in regulation Gadd45g. [score:10]
In RA -induced ES cells, when Gadd45g was knocked down, the increase of Isl1 expression and the decrease of Dppa4 and Gdf3 expression in response to ES cell differentiation were inhibited, which was comparable to the effect of miR-383 overexpression (Fig. 5D). [score:10]
Since Nanog, Sox2 and Nestin are not potential targets predicted by the computer-aided algorithms (TargetScan, miRBase and Picta), miR-383 may indirectly regulate these genes through targets other than Gadd45g. [score:9]
Both miR-383 overexpression (Fig. 5E) and Gadd45g depletion (Fig. 5F) down-regulated Isl1 protein levels and up-regulated Gdf3 and Dppa4 protein levels. [score:9]
We further observed that, in RA -induced differentiating ES cells, an overexpression of miR-383 or depletion of Gadd45g suppressed the expression of Isl1 and increased the expression of Dppa4 and Gdf3. [score:9]
We demonstrate for the first time that miR-383 can specifically regulates the expression of Gadd45g by directly targeting to the 3-UTR region of Gadd45g mRNA, a regulatory process conserved in human tumor cells and mouse embryonic stem cells. [score:8]
However, the RA -induced up-regulation of Gadd45g was inhibited by miR-383 in miR-383 overexpressed R1 cells (Fig. 5A). [score:8]
Moreover, following RA treatment, up-regulation of Nestin and Isl1, and down-regulation of Sox2, Nanog, Dppa4 and Gdf3 were blocked by overexpression of miR-383 compared with those in control cells (Fig. 5A and B). [score:8]
Moreover, miR-383 is suggested to function as a negative regulator of embryonic stem cell differentiation via down-regulation of Gadd45g expression. [score:7]
miR-383 down-regulates Gadd45g by directly targeting the 3′-UTR of Gadd45g. [score:7]
Consistent with these data, in our experiments, miR-383 is down-regulated during RA -induced ES cell differentiation or ES spontaneous differentiation, coupled with an up-regulation of Gadd45g. [score:7]
Fig. 3C shows that Gadd45g expression plasmid rescues the down-regulation of Gadd45g induced by miR-383 (Fig. 3C, upper panel). [score:6]
miR-383 represses Gadd45g expression by directly targeting Gadd45g 3′-UTR. [score:6]
A previous report has shown that in testicular embryonic carcinoma cells miR-383 induces a decreased proliferation rate by targeting interferon regulatory factor-1 (IRF1) [46], implying that miR-383 exerts effects through various targets. [score:6]
The mouse ES cell line R1 was treated with with Rotinoid Acid (RA) for differentiation, and we found that miR-383 expression was down-regulated in during ES cell differentiation (Fig. 4F). [score:6]
Further, when Gadd45g cDNA lacking the 3′-UTR was overexpressed in breast cancer cells, the enhancement of cytotoxic agents -induced apoptosis by miR-383 was rescued indicating that the key target of miR-383 in regulating the sensitivity to genotoxic stress is Gadd45g. [score:6]
In our experiments, we demonstrated that miR-383 binds to the 3′-UTR of Gadd45g so as to down-regulate its expression. [score:6]
These results therefore support a role for miR-383 in controlling Gadd45g expression during the cellular response to UV irradiation, and the down-regulation of miR-383 may be involved in UV -induced apoptosis. [score:6]
Taken together, these data demonstrate that inhibition of Gadd45g expression is at least partially responsible for the miR-383 enhanced apoptotic sensitivity to genotoxic stress. [score:5]
In our studies, we determined that the expression of Gadd45g was elevated post UV irradiation, which result is inversely correlated with miR-383 expression. [score:5]
Additionally, miR-383 has been shown to be down-regulated in mouse testis after birth until 14 days postpartum [46], suggesting that miR-383 may be involved in mouse embryonic development. [score:5]
We also compared the expression of other differentiation associated genes, such as Sox17 and Gata5, but miR-383 had no effect on the expression of these genes (Fig. 5A). [score:4]
The expression of Nanog, Sox2 and Nestin, which were also observed to be regulated by miR-383, was unchanged by Gadd45g depletion. [score:4]
Thus, miR-383 has the potential to inhibit ES cell differentiation by regulating these genes. [score:4]
Here, we report that overexpression of miR-383 in breast cancer cells increased the apoptotic sensitivity to UV or cisplatin, indicating that miR-383 regulates cell apoptosis induced by genotoxic stress. [score:4]
Notably, miR-383 regulates the expression of Gadd45g in ES cells, but not their apoptosis. [score:4]
To ascertain the roles of Gadd45g in miR-383 regulated apoptotic sensitivity induced by genotoxic stress, MCF-7 cells were co -transfected with miR-383 construct and a miR-383-insensitive Gadd45g expression plasmid without the 3′-UTR. [score:4]
In this study, we found that Gadd45g is a direct target of miR-383, and miR-383 is able to increase the sensitivity of breast cancer cells to both UV irradiation and cisplatin treatment. [score:4]
The activity of the Firefly luciferase construct containing wild-type 3′-UTR of Gadd45g was suppressed by ectopic expression of miR-383 as compared with control (Fig. 1C). [score:4]
We propose that miR-383 functions through multiple targets that synergize so as to regulate ES cell differentiation. [score:4]
miR-383 also regulates the expression of Gadd45g in embryonic stem (ES) cells, but not their apoptosis under genotoxic stress. [score:4]
miR-383 regulates cellular apoptotic sensitivity to genotoxic stress through targeting Gadd45g. [score:4]
These results support that miR-383 functions as a negative regulator of ES cell differentiation by targeting Gadd45g. [score:4]
In order to determine the regulatory relationship between miR-383 and Gadd45g, we examined the expression levels of Gadd45g and miR-383 post UV irradiation. [score:4]
Thus, we assume that miR-383 participates in regulating ES cell differentiation through targeting Gadd45g. [score:4]
miR-383 was further showed to negatively regulate ES cell differentiation via targeting Gadd45g, which subsequently modulates the pluripotency -associated genes. [score:4]
We further observed that endogenous Gadd45g mRNA was also down-regulated by miR-383 mimic in both MCF-7 and MDA-MB-231 cells (Fig. 1F). [score:4]
Taken together, these data indicate that Gadd45g is a direct target of miR-383. [score:4]
Moreover, we showed that Gadd45g is also a target of miR-383 in mouse ES cells. [score:3]
The mature miR-383 and U6 expression levels were detected using a modified stem-loop RT-PCR method [50]. [score:3]
In our studies, we found that the expression of miR-383 is involved in cellular response to genotoxic stress. [score:3]
One miRNA, miR-383, was found to target Gadd45g using the three algorithms, and the putative binding site of miR-383 in the 3′-UTR of Gadd45g is highly conserved in different species (human, mouse, rat, rhesus monkey and horse) (Fig. 1A). [score:3]
The expression of miR-383 and Gadd45g is negatively correlated post UV irradiation. [score:3]
The protein levels of Isl1, Dppa4 and Gdf3 were also examined after Gadd45g depletion or miR-383 overexpression. [score:3]
Exctopic expression of miR-383 does not affect apoptosis in ES cells. [score:3]
Gadd45g levels were reduced by miR-383 mimic, and rescued by the Gadd45g expression plasmid (top). [score:3]
As shown in Fig. 1E, the endogenous protein levels of Gadd45g were reduced by ectopic expression of miR-383 in MCF-7 and MDA-MB-231 cells. [score:3]
Figure S2 Analysis by light microscopy revealed that overexpression of miR-383 increased the sensitivity to UV irradiation or cisplatin in MCF-7 (A) and MDA-MB-231 cells (B). [score:3]
However, miR-383 overexpression has almost no effect on cell apoptosis after UV irradiation or cisplatin treatment in ES cells (Fig. 4C), suggesting distinct function of miR-383 in the response to DNA damage between ES cells and tumor cells [34]. [score:3]
The expression pattern of miR383 and Gadd45g was further studied during ES cell differentiation. [score:3]
We next examined the expression levels of miR-383 in MCF-7 cells before and after UV irradiation by qRT-PCR. [score:3]
Fig. 4G, H and I showed that miR-383 was decreased in parallel with the increase of Gadd45g expression. [score:3]
Our results suggest that miR-383 regulates these ES cell pluripotency or differentiation -associated genes by down -regulating Gadd45g. [score:3]
Taken together, our study demonstrates that miR-383 is a negative regulator of Gadd45g in both tumor cells and ES cells, however, has distinct function in regulating cell apoptosis. [score:3]
The effect of miR-383 on the response to cisplatin in MCF-7 cells was also examined, and we found that miR-383 overexpressing cells exhibited a more severe cell death than control cells upon cisplatin treatment (Fig. S2A). [score:3]
The presence of miR-383 increased the cellular sensitivity to DNA damage in breast cancer cells, which was rescued by ectopic expression of Gadd45g without the 3′-UTR. [score:3]
As shown in Fig. 2E and F, statistical analysis showed that Gadd45g mRNA expression levels are inversely correlated with miR-383 (r = −0.7583, r = −0.65197, P<0.05). [score:3]
miR-383 regulates Gadd45g in mouse ES cells. [score:2]
In conclusion, we demonstrated that miR-383 negatively regulates Gadd45g in the process of genotoxic stress -induced apoptotic events and ES cell differentiation. [score:2]
To investigate the regulation of Gadd45g by miR-383 in vivo, we examined the protein level of Gadd45g under a condition of overexpression of miR-383 mimic or anti-miR-383. [score:2]
This suggests that miR-383 is a possible regulator of Gadd45g. [score:2]
These results raise a possibility that miR-383 regulates Gadd45g in the process of ES cell differentiation. [score:2]
Both the mRNA and protein levels of Gadd45g were regulated by miR-383. [score:2]
The above results suggest that these genes are likely to be regulated by miR-383-Gadd45g axis. [score:2]
Apoptosis assay shows that the effect of miR-383 on cell apoptosis induced by UV irradiation was fully rescued by overexpressing Gadd45g lacking the 3′-UTR in MCF-7 cells (Fig. 3C, lower panel). [score:2]
miR-383 regulates the cellular apoptotic sensitivity to UV or cisplatin. [score:2]
In this work, we found that miR-383 is a negative regulator of Gadd45g. [score:2]
At 12 hours after UV irradiation, morphologic examination performed under light microscopy indicated that there were more cells displaying apoptosis in miR-383 transfected cells than control cells (Fig. S2A). [score:1]
Sixteen hours before transfection, MCF-7 or MDA-MB-231 cells were seeded onto culture plates and transfected with 200 nM of miR-383 mimic or 100 nM of anti-miR-383 using lipofectamine 2000 (Invitrogen) according to manufacturers' instructions. [score:1]
miR-383 negatively modulates ES cell differentiation through Gadd45g. [score:1]
0110472.g004 Figure 4(A) Relative mRNA expression of Gadd45g was measured by qRT-PCR in mouse ES cells (R1) transfected with miR-383 mimic or anti-miR-383. [score:1]
This suggests that miR-383 is likely the upstream modulator of Gadd45g in response to environmental stress. [score:1]
For R1 cell transfection, cells were cultured on gelatin-coated 6-well plates without feeder cells, then 200 nM of miR-383 mimic or 100 nM of Gadd45g siRNA were introduced using lipofectamine 2000. [score:1]
Anti-miR-383 and anti-control were purchased from Ambion. [score:1]
Figure S3 (A) MDA-MB-231 cells were transfected with miR-383 mimic or control, and treated with UV irradiation (60 J/m2, post 12 h) or cisplatin (25 µM, post 24 h). [score:1]
The levels of endogenous miR-383 were reduced in a time and dose dependent manner in response to UV irradiation (Fig. 2C and D). [score:1]
As shown in Fig. 3B, nearly two folds of MCF-7 cells show positive staining with Annexin V in miR-383 transfected cells than in control cells. [score:1]
Therefore, miRNAs, including miR-383, are candidate antineoplastic agents based on their capacity to alter the responsiveness to cytotoxic agents [45]. [score:1]
miR-383 may be used as antineoplastic agents in cancer chemotherapy. [score:1]
To further evaluate the role of miR-383 in ES cell differentiation, we overexpressed miR-383 mimic in ES cells followed by RA treatment for 3 days. [score:1]
The miRNA profiling was carried out in primary human fibroblasts at a low dose of UV irradiation, but miR-383 was found to be unchanged [43]. [score:1]
MCF-7 cells were seeded in a 24-well plate and transfected with either 100 nM of miR-383 mimic or control, 100 ng of pMIR-Gadd45g 3′-UTR or pMIR-Gadd45g-mut, and 10 ng of pRL vector, using lipofectamine 2000 according to manufacturer's protocol. [score:1]
0110472.g005 Figure 5 (A and B) Quantitative RT-PCR analysis for differentiation (A) and pluripotency (B) marker genes in miR-383 mimic or control transfected ES cells cultured with LIF or with RA for 3 days. [score:1]
The effect of miR-383 on cell viability was further confirmed in MDA-MB-231 cells treated with UV irradiation or cisplatin. [score:1]
miR-383 modulates ES cell differentiation through Gadd45g. [score:1]
Intrerestingly, miR-383 was not involved in the apoptosis of ES cells under the same genotoxic stress. [score:1]
The effect of miR-383 on cell apoptosis caused by genotoxic stress is mediated by Gadd45g. [score:1]
Similarly, the apoptosis after cisplatin treatment is increased in miR-383 mimic transfected cells, but this increase is only happened in the absence of miR-383-resistent Gadd45g plasmid (Fig. 3D). [score:1]
0110472.g001 Figure 1 (A) Schematic representation of miR-383 binding site on the Gadd45g 3′-UTR. [score:1]
The wild-type or mutant pMIR-Gadd45g-3′-UTR reporter was co -transfected with a control or a miR-383 mimic plasmid, and a pRL-SV40 vector containing the Renilla luciferase gene was also co -transfected as a normalization control. [score:1]
The inversed correlation between Gadd45g and miR-383 was also observed in spontaneous differentiation of embryonic body (EB). [score:1]
These results indicate that miR-383 increases the sensitivity of breast cancer cells in response to UV irradiation and cisplatin treatment, and thus enhances stress -induced apoptosis. [score:1]
Gadd45g and miR-383 are negatively correlated in response to UV irradiation. [score:1]
miR-383 enhanced the cytotoxicity caused by both types of genotoxic stress in MDA-MB-231 cells (Fig. S3A). [score:1]
Alternatively, 100 nM of anti-miR-383 or negative control were cotransfected with 100 ng of pMIR-Gadd45g 3′-UTR supplemented with 10 ng of pRL vector. [score:1]
To determine whether the relationship between miR-383 and Gadd45g are conserved in physiological conditions, we employed mouse ES cell as mo del system. [score:1]
After transfection with miR-383 mimic or control, MCF-7 cells were irradiated with UV (60 J/m [2]). [score:1]
Additionally, transfection of MCF-7 or MDA-MB-231 cells with anti-miR-383 increased the Gadd45g protein levels (Fig. 1E). [score:1]
[1 to 20 of 99 sentences]
2
[+] score: 92
It was observed that mir-383, mir-384-3p, and mir-488 were up-regulated in ob/ob and db/db mice and mir-488 was down-regulated in leptin -treated mice. [score:7]
The double-staining of POMC-Tau-Topaz GFP mice brain sections with the fluorescein-labeled probes and an antibody against GFP revealed that a high proportion of POMC neurons express mir-383, mir-384-3p, and mir-488, suggesting that these miRNAs target the expression of protein-coding genes that are distributed in this neuronal population. [score:7]
Quantitative analysis of double-labeled neurons showed that, in the whole arcuate nucleus, 80.7 ± 3.4% of the GFP -positive neurons expressed mir-383 miRNAs, 39.8 ± 2.5% of the GFP -positive cells expressed mir-384-3p miRNAs and 64.9 ± 3.2% of the GFP- immunoreactive cells contained mir-488 miRNAs (Figures 2D–F). [score:5]
Considering these expression patterns, we focused our work on mir-383, mir-384-3p as mir-488 which are expressed in the hypothalamus. [score:5]
Relative expression levels of mir-383, mir-384-3p, mir-471-3p, and mir-488 are expressed in fold change of the normalized level obtained in the hypothalamus. [score:5]
The above data suggest that leptin may be involved in the regulation of the expression of mir-383, mir-384-3p, and mir-488 miRNAs in the hypothalamus. [score:4]
The expression profiles of mir-383, mir-384-3p, and mir-488 miRNAs presented many similarities, but also major differences. [score:3]
To evaluate whether leptin signaling in hypothalamus is essential for the expression of mir-383, mir-384-3p, or mir-488 miRNAs, we analyzed the expression of these miRNAs among groups of leptin -deficient (ob/ob) mice and C57BL/6 controls. [score:3]
The absence of effect by central infusion of leptin on the hypothalamic expression of mir-383 and mir-384-3p can be explained by the peripheral effect of leptin. [score:3]
Firstly, we studied the pattern of expression of miRNAs, i. e., mir-383, mir-384-3p, and mir-488, in the CNS. [score:3]
The expression of mir-488 is decreased in the hypothalamus of C57BL/6 mice after central leptin administrationBecause leptin exhibits a large range of effect at peripheral level (Margetic et al., 2002), we next investigated the effect of a daily i. c. v leptin administration (5 μg/mice) during 4 days on hypothalamic expression of mir-383, mir-384-3p, and mir-488 miRNAs. [score:3]
We observed an up-regulation of mir-383, mir-384-3p, and mir-488 miRNAs in 12-week-old ob/ob animals treated with vehicle compared to C57BL/6 control mice (+42, +32%; P < 0.05 and +137%; P < 0.01, respectively) (Figure 4). [score:3]
Several GFP neurons did not contain mir-383 miRNAs and, reciprocally, several mir-383 miRNAs -expressing neurons did not contain GFP protein (Figure 2A). [score:3]
In one hand, we identified three conserved miRNAS (mir-383, mir-384-3p, and mir-488) with targetscan. [score:3]
The present study shows that leptin peripheral treatment rescues the expression of mir-383, mir-384-3p, and mir-488 in ob/ob mice. [score:3]
This data provides the first evidence that the expressions of mir-383, mir-384-3p, and mir-488 are associated with an impaired leptin signaling pathway. [score:3]
White arrowheads point to POMC neurons expressing miR-383, miR-384-3p or miR-488 miRNA. [score:3]
Figure 2 Expression of mir-383, mir-384-3p, and mir-488 in POMC neurons of the arcuate nucleus. [score:3]
As shown in Figure 3B, the mir-383, mir-384-3p, and mir-488 miRNAs levels were over-expressed in 16-week-old db/db mice compared to C57BL/6 animals (+25, +32 and +110%, respectively; P < 0.001). [score:2]
To directly test this hypothesis, ob/ob mice were i. p. injected with leptin at dose of 5 mg/kg and the hypothalamic expression of mir-383, mir-384-3p, and mir-488 miRNAs was evaluated by qRT-PCR 4 h later. [score:2]
As expected, leptin treatment significantly reduced hypothalamic expression of mir-383, mir-384-3p, and mir-488 miRNAs in 12-week-old ob/ob animals treated with leptin compared to vehicle -treated ob/ob mice (−25, −21%; P < 0.05 and −58%; P < 0.01, respectively) (Figure 4). [score:2]
The proportion of GFP neurons that exhibited mir-383, mir-384-3p, or mir-488 miRNAs were not different in the anterior and posterior subdivisions of the arcuate nucleus (Figures 2D,F). [score:1]
These observations suggest that, mir-383, mir-384-3p, and mir-488 in the arcuate nucleus are involved in a complex network controlling the sensitivity of POMC neurons to peripheral signals. [score:1]
Chronic i. c. v administration of leptin had no effect on mir-383 and mir-384-3p miRNAs levels (Figure 5D). [score:1]
Thus, in the CNS, the hypothalamus, brainstem, and cortex were the three regions that contained the highest densities of mir-383 miRNAs (Figure 1B). [score:1]
For the first time, we found that the miRNAs encoding the mir-383, mir-384-3p, and mir-488 miRNAs are abundant in the arcuate nucleus. [score:1]
The scramble sequences were 5′-TTCCGACAACTGCACTCTATGTTC-3′6FAM for scramble (sc) mir-383, 5′-CATGAATATTCCGTGGTTAATCATTTA-3′6FAM for scmir-384-3p and 5′-AGATTCTCAACCTGCTTTACAAAGC-3′6FAM for scmir-488. [score:1]
Absence of leptin resulted in a significant increase in mir-383, mir-384-3p, and mir-488 miRNAs (+400%, +101%; P < 0.05 and +605%; P < 0.001, respectively) (Figure 3A). [score:1]
In other CNS structures such as the cerebellum, hippocampus, and olfactory bulb, much lower concentrations of mir-383 miRNA were recorded (Figure 1B). [score:1]
Because the lack of circulating leptin was associated with a significant increase in the miRNAs of interest, we measured the expression of mir-383, mir-384-3p, and mir-488 miRNAs in the hypothalamus of db/db mice, a mo del that exhibits a non-functional leptin receptor leading to impaired leptin signaling. [score:1]
Based on bioinformatic predictions of their involvement in POMC-signaling pathway and their conservation among vertebrates, the expression of mir-383, mir-384-3p, and mir-488 were investigated in mo dels of obesity characterized by a decrease of POMC mRNA expression and leptin insufficiency (ob/ob) or leptin insensitivity (db/db) (Mizuno et al., 1998). [score:1]
The levels of mir-383, mir-384-3p, and mir-488 miRNAs in the hypothalamus of 16-week-old ob/ob and C57BL/6 mice were determined by qRT-PCR. [score:1]
In agreement with this data, we have found by using qRT-PCR that the highest concentrations of mir-383 occurred in the hypothalamus, brainstem, and cortex. [score:1]
Because leptin exhibits a large range of effect at peripheral level (Margetic et al., 2002), we next investigated the effect of a daily i. c. v leptin administration (5 μg/mice) during 4 days on hypothalamic expression of mir-383, mir-384-3p, and mir-488 miRNAs. [score:1]
In POMC-Tau-Topaz GFP mice mo del, double-staining of brain sections with the fluorescein-labeled mir-383 probe and the antibody against GFP showed that a large proportion of neurons in the arcuate nucleus contained simultaneously GFP and mir-383 miRNAs (Figure 2A). [score:1]
We used the antisense probes 5′-AGCCACAGTCACCTTCTGATCTTT-3′-6FAM for mir-383; 5′-TTACATTGCCTAGGAATTGTTTACATA-3′-6FAM for mir-384-3p; 5′-AAAACTCTCACGATAATAGACCCTT-3′-6FAM for mir-488. [score:1]
In many brain regions, mir-383, mir-384-3p, and mir-488 miRNAs distribution patterns did not match each other suggesting that the three miRNAs also exert specific roles. [score:1]
Although mir-383, mir-384-3p, and mir-488 miRNAs were evenly distributed along the rostro-caudal axis of the arcuate nucleus, the proportion of double labeled GFP/ mir-383, GFP/ mir-384-3p, and GFP/ mir-488 neurons did not reflect each other in terms of the proportion of their distribution. [score:1]
[1 to 20 of 38 sentences]
3
[+] score: 80
So, we selected the most downregulated one, miR-383-5p to further identify its expression level in mice kidney samples and human podocytes under the indicated treatments. [score:6]
As shown in Fig. 8a, the expression of miR-383-5p was downregulated after treatment with resveratrol; however, there was no difference between db/m and db/db mice. [score:6]
The sequence of the miR-383-5p mimics (5′ to 3′): sense AGAUCAGAAGGUGAUUGUGGCU antisense CCACAAUCACCUUCUGAUCUUU, the sequence of the Negative mimics (5′ to 3′): sense UUCUCCGAACGUGUCACGUTT antisense ACGUGACACGUUCGGAGAATT, the sequence of the miR-383-5p inhibitors (5′ to 3′): AGCCACAAUCACCUUCUGAUCU, the sequence of the Negative inhibitors (5′ to 3′): CAGUACUUUUGUGUAGUACAA. [score:5]
While, treatment with bafilomycin A still increased the expression of p62 and LC3-II in podocytes although the suppression of miR-383-5p decreased the level of p62 (Fig. 8e). [score:5]
In addition, miR-383-5p overexpression inhibited LC3-I to LC3-II conversion. [score:5]
Expression of miR-383-5p was suppressed after treatment with resveratrol in both db/db mice kidney and human podocytes. [score:5]
The following were purchased from GenePharma (Shanghai, China): miR-383-5p mimics; Negative mimics, miR-383-5p inhibitors and Negative inhibitors. [score:5]
The results are shown in Fig. 7. From the differentially expressed miRNAs, we found when db/db mice treated with resveratrol (db/db + RES), the expression of miR-383-5p caused the most obvious decrease relative to db/db mice. [score:5]
, miR-383-5p mimics/inhibitors or negative mimics/inhibitors were transfected into the cells by using Lipofectamine 2000. [score:5]
Resveratrol regulates autophagy and apoptosis in db/db mice and human podocytes through the suppression of miR-383-5p. [score:4]
We will explore miR-383-5p target gene(s) and its exact mode of action in the regulation of autophagy in future studies. [score:4]
As shown in Fig. 8c, overexpression of miR-383-5p significantly blocked the increase in autophagy and attenuation of HG -induced apoptosis induced by resveratrol. [score:3]
Importantly, our results suggested that the protective effects of resveratrol are mediated by the suppression of miR-383–5p. [score:3]
Transfection of miR-383-5p mimics and inhibitors. [score:3]
Further, overexpression of miR-383-5p significantly blocked the resveratrol -induced increase in autophagy and increased HG -induced apoptosis. [score:3]
miR-383-5p inhibitors. [score:3]
Interestingly, our findings suggested miR-383-5p might play a role in the regulation of autophagy by resveratrol; this discovery may explain the prime mechanism of resveratrol. [score:2]
The expression of miR-383 was measured by qRT-PCR with SYBR Green PCR Kit (Takara) on an Applied Biosystems StepOne-Plus real-time PCR system and human U6 RNA was amplified as an internal control. [score:1]
Real-time reverse transcriptase (qRT-)PCR for miR-383 quantification. [score:1]
Further investigation of miR-383-5p target genes and signaling pathways is necessary to reveal the specific mechanism of resveratrol in modulating autophagy and protecting against DN. [score:1]
In consistence, miR-383-5p was significantly decreased in podocytes after the addition of resveratrol with the dose of 10 μM and15 μM (Fig. 8b). [score:1]
The localisation of the expression of miR-383-5p in the kidney is not investigated, this needs to be further studied in vivo with a podocyte-specific method. [score:1]
The relative expression ratio of miR-383 was calculated by the 2 [−ΔΔCT] method. [score:1]
Next, we checked whether miR-383-5p had an effect on autophagy and apoptosis under HG plus resveratrol treatment. [score:1]
Thus, we propose miR-383-5p as a novel autophagy-related microRNA. [score:1]
[1 to 20 of 25 sentences]
4
[+] score: 21
Further, mir-491, a miRNA which is involved in neurosteroidogenesis and pathogenesis of multiple sclerosis [48], was found strongly upregulated by arsenite and downregulated by VPA, and mir-383, a miRNA expressed in the reproductive system and a negative regulator of proliferation, was highly expressed in control samples but significantly downregulated by both substances (4.2- and 2-fold by VPA and arsenite, respectively). [score:15]
In four independent differentiation procedures we could confirm the microarray data (Fig. 5A)–that is, a strong concentration -dependent induction of muscle-specific/abundant miRNA (mir-206, mir-10a, mir-214, mir-145, mir-143, mir-199a) and a significant downregulation of the expression of neuro-specific miRNAs (mir-124, mir-128, mir-137, mir-491, mir-383) in comparison to the solvent control. [score:6]
[1 to 20 of 2 sentences]
5
[+] score: 17
Elevated miR-224 can enhance TGF-β1 -induced mGC proliferation by targeting Smad4 and ovarian E [2] release [15], while the downregulation of miR-383 promotes steroidogenesis by targeting RBMS1 and can be transactivated by SF-1 through direct binding to the promoter of the miR-383 host gene SGCZ [16]. [score:9]
This pathway also regulates the expression of many miRNAs, including miR-224 and miR-383 [15, 16]. [score:4]
Studies examining miRNA-regulated E [2] biosynthesis determined that miR-224 [15] and miR-383 [16] play important roles in the TGF-β/Smads pathway by targeting Smad4 and RBMS1, respectively. [score:4]
[1 to 20 of 3 sentences]
6
[+] score: 15
Small RNA sequencing revealed several transcripts to be slightly regulated: miR-15 (log2 fold change 1.5), miR-383–5p (log2 fold change of 1.3) and miR-146b-5p (log2 fold change of 1.1) were top upregulated candidates, while Gm24706 (log2 fold change of 1.4), miR-7046–3p (log2 fold change of 1.1) and miR-203–5p (log2 fold change of 0.9) were top downregulated transcripts. [score:8]
Most highly downregulated candidates were Gm5878, aldehyde dehydrogenase 1 family member A3 and solute carrier family 14 (urea transporter), member 2. Small RNA sequencing revealed miR-15, miR-383-5p and miR-146b-5p as top upregulated candidates. [score:7]
[1 to 20 of 2 sentences]
7
[+] score: 9
Wang X. Ren Y. Wang Z. Xiong X. Han S. Pan W. Chen H. Zhou L. Zhou C. Yuan Q. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells FEBS Lett. [score:6]
Furthermore, it has been recently demonstrated that in esophageal squamous carcinoma cells, the depletion of 5S rRNA by miR-150 and miR-383 enhances the interaction between uL5 (rpL11) and c-Myc leading to the inhibition of Myc activity [55]. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 7
Other miRNAs from this paper: mmu-mir-155, mmu-mir-129-1, mmu-mir-129-2, mmu-mir-210, mmu-mir-129b
Expression of miR-210 (a) and miR-383 (b) in EPLC-32 M1 and NCI-H292 cells with (Msh3) and without (Luc) MCRS1 knockdown. [score:4]
In total, 26 known miRNAs and 29 novel miRNAs were differentially expressed after MCRS1 silencing (Additional file 5 and Additional file 6), with miR-155, miR-210, and miR-383 as the most affected. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 7
Other miRNAs from this paper: mmu-mir-184
For example, miRNA-122a reduces the expression of the post-transcriptionally regulated germ cell transition nuclear protein 2 (Tnp2) mRNA in the mammalian testis [6]; miR-372 and miR-373 have been implicated as oncogenes in testicular germ cell tumors [7]; miR-383 is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation by targeting interferon regulatory factor-1(Irf1) [8]. [score:7]
[1 to 20 of 1 sentences]
10
[+] score: 6
Conversely, 5 miRNAs showed decreased expression across multiple studies (miR-106b, miR-20b, miR-224, miR-30b, miR-383), of which 3 miRNAs showed some down-regulation in the TLDA dataset. [score:6]
[1 to 20 of 1 sentences]
11
[+] score: 5
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
For example, miRNA-503, miRNA-224 and miRNA-383 are expressed almost exclusively in mouse granulosa cells and oocytes [68], [72], whereas a large number of miRNAs are differentially expressed in bovine ovarian cortex, cumulus cells and corpus luteum [60]. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
It has been reported that miR-146, miR-221, miR-222 and miR-383 regulate gene expression during this process[18– 20]. [score:4]
As previously described, many novel miRNA molecules are required for spermatogenesis, and in fact some pivotal steps of spermatogenesis rely on a single miRNA molecule (e. g. miR-146, miR-221, miR-222 and miR-383). [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 4
In the order of the significance score by SAM, 15 up-regulated miRNAs are mmu-miR-127, mmu-miR-410, mmu-miR-433, mmu-miR-138, mmu-miR-181c, mmu-miR-382, mmu-miR-19b, mmu-miR-381, mmu-miR-666-3p, mmu-miR-376a, mmu-miR-873, mmu-miR-181a, mmu-miR-383, mmu-miR-181b, and mmu-miR-99b. [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 3
But the change of miR-383 expression was not statistically significant (Figure 1C). [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
47, 48 Steroidogenic factor-1 suppresses miR-383 transcription and then mediates oestradiol release in mGCs. [score:3]
[1 to 20 of 1 sentences]