sort by

328 publications mentioning hsa-mir-133b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-133b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 413
Such as miR-133b with a high expression in HC, the miR-133b/PPP2R2D signaling pathway affects the effectiveness of cDDP chemotherapy [69], upregulation of miR-133b shortens the latency of cervical carcinoma [55, 111], miR-133b is directly up-regulated by AR in androgen -dependent PCa [24], overexpression of miR-133b as VHL-specific miRNAs in pheochromocytoma and paraganglioma [112], Overexpression of miR-133b in less aggressive LNCaP cells boosted cell proliferation and cell-cycle progression [25] and have decreased survival in progression bladder cancer [79], compared to primary colorectal tumors, the cases with liver metastases demonstrated increased expression of miR-210 and miR-133b and associated with lower survival [113]. [score:15]
Similarly, miR-133b dysregulation in colon cancer cells was allegedly due to the change of transcription activity caused by TAp63, miR-133b is a transcriptional target of TAp63 so that p63 can directly drives the miR-133b expression via the binding site, what is important is that TAp63 can inhibit cells migration and metastasis by indirectly regulating the expression of target gene of miR-133b (such as RhoA) and epithelial–mesenchymal markers in colon cancer in virtue of TAp63/miR-133b axis [119]. [score:15]
Histone methylation inhibitor DZNep or histone deacetylation (HDAC) inhibitor SAHA consistently increased the expression of miR-133b/a-3p in GC cell lines, and last but not least, decreased levels of H3 acetylation and increased levels of H3K27me3 were observed in the promoter region of miR-133b, all this indicating that both histone methylation and histone acetylation might be responsible for miR-133b/a-3p downregulation, but simultaneously discover showed DNA methylation inhibitor 5-Azacytidine't didn't increased the expression of miR-133b/a-3p in GC cell lines [30]. [score:14]
B55δ, encoded by the PPP2R2D gene, can increase the suppressive effect of cisplatin (cDDP) in Hepatocellular carcinoma (HC), miR-133b was up-regulated in HC cells and directly target PPP2R2D and suppress its expression and further disrupt its effect in improving chemotherapeutic sensitivity [69]. [score:13]
Because microRNA perform functions mainly depending on the way that miRNA suppresses the translation and stability of target genes by binding to the 3′-UTRs of target mRNAs, so first we focus on all target genes of miR-133b. [score:11]
Another study in HC [70], However, found that miR-133b showed downregulation and might act as tumour suppressor, then, the participants accepted transarterial chemoembolization (TACE) using chemotherapy agents-doxorubicin and cisplatin, miR-133b and othter 11 miRNAs were significantly upregulated in the patients group of nonresponders compared to responders, so research suggests 12 miRNAs might be cooperatively associated with the development of resistance to doxorubicin-cisplatin combined treatment, the underlying cause was that 3 miRNAs among theser miRNAs are directly linked to drug resistance in cancer, especially miR-27a and miR-130a can stimulate MDR1 -mediated drug resistance in HC cells, it had been identified that multidrug resistance protein 1(MDR1 or ABCB1) involved in doxorubicin and cisplatin resistance [71, 72]. [score:10]
In glioma and hepatocellular carcinoma, miR-133b inhibit its target gene silent information regulator 1 (Sirt1) and then suppress cell proliferation and invasion together with increasing apoptosis, the specific influence mechanism may be the miR-133b/Sirt1/GPC3/Wnt β-catenin pathway, by which a series of genes such as Bcl-2, Bcl-xL, Mcl-1 and E-cadherin were regulated [39, 40]. [score:9]
Figure 3(A) The histone modification, promoter DNA hypermethylation and transcription factor including androgen receptor (AR) and tumor protein p63(TAp63) directly mediate miR-133b expression; miR-145 and Long non-coding RNAs (lncRNAs) may directly and indirectly regulate the expression of miR-133b. [score:9]
they are “Roles of the canonical myomiRs miR-1, -133 and -206 in cell development and disease” [6], “microRNA-133: expression, function and therapeutic potential in muscle diseases and cancer” [7] and “microRNA-1/133a and microRNA-206/133b clusters:Dysregulation and functional roles in human cancers” [5], respectively. [score:9]
High expression of miR-185 and low expression of miR-133b were correlated with poor survival and metastasis in colorectal cancer [84], which suggest the potential prognostic values of these miRNAs for predicting clinical outcome after surgery, miR-1 and mir-133b have been significantly downregulated in recurrent PCa specimens and can serve as novel biomarkers for prediction of PCa progression [85]. [score:8]
In addition to changes of transcription activity of a transcription factor, microRNA expression can be also modulated as a consequence of potential synergy between noncoding RNAs, such as miRs themself and long non-coding RNA, a research that miRNA profiling and quantitative integrated omics analysis of a pancreatic cancer cell line found overexpression of miR-145 can increase other miRs including miR-124, miR-133b and miR-125a-3p, all of which are implicated in inhibition of tumors and are generally co-regulated with miR-145 in other cancers [120]. [score:8]
miR-133b control PKM expression (switching of PKM1 to PKM2) through targeting polypyrimidine tract -binding protein 1 (PTB1) or directly target PKM2 gene. [score:8]
But in a research of acute myeloid leukemia, Niederwieser C et al. [116] found that high DNMT3B expression seemingly an independent prognostic factor from mechanisms of DNA hypermethylation and/or microRNA -dependent gene repression, at the same time they attempted to explain why the miR-133b presented unique upregulation in high DNMT3B expressers. [score:8]
Using α-mangostin, which is a xanthone derivative, to treat TRAIL-resistant human colon cancer DLD-1 cell line and breast epithelial proliferating MCF10A and found that α-mangostin curb the expression of miR-133b and relieve inhibition of miR-133b on its target gene DR5, which canceled the resistance and effectively induced the translocation of DR5 to the cancer cell surface membrane in TRAIL-resistant DLD-1 cells [22]. [score:7]
At the same time, the study also shows that histone deacetylase (HDAC) inhibitor (PBA) can increase the expression of silenced miR-133b, which may imply histone modification also mediate miR-133b expression [115]. [score:7]
Notwithstanding the fact that EGFR gene are commonly present in cancer, while there is a significant decrease in the expression of EGFR in glioblastoma (GBM) microvasculature, for the platelet-derived growth factor receptor beta (PDGFRB), involved in GBM angiogenesis, occupy the primary position in microvascular proliferation, one of the reason is several elevated expression of miRs, including miR-133b, targeting and curbing EGFR [56]. [score:7]
Table 1. As discussed in the previous section, miR-133b performs functions mainly depending on target genes suppressed by it, so in the first place, all target genes of miR-133b involved in human cancer were reviewed above. [score:7]
miRNA microarray data and most individual experiments have demonstrated that miR-133b was frequently down-regulated in various cancers and have tumor-suppressive functions [93], such as firstly been detected in colorectal cancer [64, 94, 95], and subsequently in SCC of tongue [47, 96], bladder cancer [97, 98], urothelial carcinoma of the bladder [78, 99, 100], lung cancer [51, 77, 101], glioblastoma [34, 60], ovarian cancer [48], prostate cancer [23, 49], gastric cancer [31, 80, 99, 102, 103], head and neck cancer [104], GIST [62], osteosarcoma [38, 105], rhabdomyosarcomas [106], ESCC [61, 102, 103, 107], uterine sarcomas and mixed epithelial-mesenchymal uterine tumors [108], renal cell carcinoma [109], hepatocellular carcinoma [39], laryngeal cancer [110]. [score:6]
Moreover, the response rate of esophageal squamous cell carcinoma (ESCC) patients to paclitaxel -based chemotherapy was significantly higher in combined miR-133a/b downregulation group [74], miR-133b contributes to arsenic -induced apoptosis in glioma cells [34] and the joint utilization of miR-133b and cetuxima can enhance suppression effect on the growth and invasion of colorectal cancer cells by modulating EGFR [52]. [score:6]
miR-133 was downregulated in radioresistant lung cancer cells, but restoring the miR-133b can resensitizes radioresistant lung cancer cells through the inhibition of PKM2 -mediated glycolysis that interfere the sensitivity mechamism. [score:6]
MiR-133b consistently overexpressed in tolerogenic dendritic cells, which will provide possible therapeutic targets in the treatment of cancer and autoimmune diseases [92]. [score:6]
In all resected colon cancer tissue without patient's recurrence, the miR-133b expression was significantly upregulated [83]. [score:6]
Two members of the BCL-2 family of pro-survival molecules (MCL-1 and BCL2L2 (BCLw)) as predicted targets of miR-133b have been identified in lung cancer, osteosarcoma, bladder cancer and gastric cancer (Mcl-1 and Bcl-xL), in which over -expression of miR-133b can induce apoptosis though theses apoptosis regulator in tumor cells [27– 30]. [score:6]
Although not concerning the gene EGFR, upregulation of miR-133b in cervical carcinoma boosts tumorigenesis and metastasis by targeting mammalian sterile 20-like kinase 2 (MST2), cell division control protein 42 homolog (CDC42) and ras homolog gene family member A(RHOA), which subsequently bring about activation of the Akt and MARK signaling pathways [55]. [score:6]
But a lot of research only focuses on the altered expression of miR-133b itself in human cancer; these studies demonstrated important clinical significance but there are still a lot of great challenges or paradoxes for us to solve, especially the double expression level of miR-133b in different cancers and or even in single human cancer. [score:5]
The database OncoLnc was used to explore survival correlations of miR-133b in cancer, the database provided 9 cancer data between miR-133b and human cancer, the Cox coefficient and p-value are from the gene term in precomputed multivariate Cox regressions and the FDR correction is performed per cancer analysis per data type (left); the representative example of OncoLnc Kaplan-Meier results(right), in head and neck squamous cell carcinoma(HNSC), the low expression of miR-133b have a higher survival rate(upper right); in Cervical cancer (CESC), the high expression of miR-133b have a higher survival rate(lower right). [score:5]
What is particularly intriguing is that miR-133b can conspicuously suppress nucleoporin member Nup214 expression in serveral human cancer, and which increased mitotic indices and delayed degradation of mitotic marker proteins cyclinB1 and cyclinA and dephosphorylation of H3. [score:5]
Anti-apoptotic oncogene Bcl-2, Mcl-1 and cellular inhibitor of apoptosis-2 (c-IAP2) also can be modulated through miR-133b /S1PR1 /STAT3 signaling in nasopharyngeal carcinoma, sphingosine-1-phosphate receptor 1 (S1PR1) was predicted to be a target of miR-133b [41]. [score:5]
Some signaling pathway can be affected by miR-133b, such as c-Met engagement activates multiple oncogenic pathways (RAS, PI3K, STAT3, beta-catenin), which itself is the Immediate target gene of miR-133b in colorectal cancer (CC) and osteosarcoma, its suppression can affected tumor cell proliferation and apoptosis in vitro and in vivo [28, 37, 38]. [score:5]
In colorectal adenoma cancer miR-133b controlling PKM expression (switching of PKM1 to PKM2) through targeting polypyrimidine tract -binding protein 1 (PTB1), which is a splicer of the PKM gene and also known as hnRNPI [46]. [score:5]
In a study of seeking the optimal miRNA delivery systems to treat lung cancer, miR-133b was selected because it directly targets the MCL-1 thus regulating cell survival and chemotherapeutic sensitivity, the result from this research demonstrated cationic lipoplexes may be a promising carrier system for miRNA -based therapeutics in lung cancer treatment [90]. [score:5]
Figure 4The database OncoLnc was used to explore survival correlations of miR-133b in cancer, the database provided 9 cancer data between miR-133b and human cancer, the Cox coefficient and p-value are from the gene term in precomputed multivariate Cox regressions and the FDR correction is performed per cancer analysis per data type (left); the representative example of OncoLnc Kaplan-Meier results(right), in head and neck squamous cell carcinoma(HNSC), the low expression of miR-133b have a higher survival rate(upper right); in Cervical cancer (CESC), the high expression of miR-133b have a higher survival rate(lower right). [score:5]
In addition, miR-133b can mediate cancer metastasis via regulating the tumor microenvironment, previous study [66] have found a marked up-regulation of miR-1 and miR-133b in interleukin-6 (IL6)-(human prostate fibroblasts) HPFs and (cancer associated fibroblasts) CAFs, miR-133b not only is able per se to promote fibroblast activation by inducing phenotypic changes but can be secreted by activated fibroblasts and may intake further by prostate carcinoma cells, by which mesenchymal phenotype would be established, and then CAFs induce EMT in tumor cells. [score:5]
The difference is that miR-133b can caused exacerbated proapoptotic responses to TNF-related apoptosis-inducing ligand (TRAIL) in HeLa cells [23], what led to the phenomenon is miR-133b suppresses its immediate taget-antiapoptotic protein Fas apoptosis inhibitory molecule (FAIM) and antiapoptotic enzyme detoxifying protein glutathione-S-transferase pi (GSTP1) and promote TRAIL or αFas/CD95 -mediated apoptosis, what is important is that the mechanism similar to HeLa cells can also be found in androgen-independent prostate cancer [23]. [score:5]
In lung cancer cells, miR-133b suppresses glycolysis and improves radiotherapy by targeting PKM2 (pyruvate kinase isoform M2), which is an essential enzyme involved in glycolysis and promoted the Warburg effect [44]. [score:5]
The result showed 9 cancer data which uncovered similar results as above that different expression of miR-133b plays tumor suppressor and tumor promoter in various malignant tumors. [score:5]
But now more and more researches coming from our group and others indicated that miR-133b presented aberrant expression in various kinds of human cancer and might be closely associated with the occurrence and development of tumor. [score:4]
Serum and secretions are another important clinical specimens, circulating serum miR-133b can be identified as the most important diagnostic and prognosis markers in breast cancer [86], gastric cancer [87] as well as in osteosarcoma [88], and miR-133b were significantly downregulated in prostatic secretions of patients with prostate cancer and could be used as diagnostics markers [89]. [score:4]
These studies indicated that the downregulation of miR-133b was the independent factor and significantly associated with aggressive clinicopathologic features, tumor subtype, and poor survival rates. [score:4]
In summary, the epigenetics–miRNA regulatory circuit plays an important role in abnormal expression of miR-133b. [score:4]
Long non-coding RNAs (lncRNAs) have emerged in recent years engaging in numerous biological processes across species [121]; despite no researches about miR-133b-lncRNA regulatory network have been reported in human cancer, but the research evidence from out group (unpublished) and the fact that miR-133b is one of the earliest validated ceRNA regulators [122] make us believe that the mutual regulation and synergistic effects of miR-133b-lncRNA can be found in tumor. [score:4]
Regulation mechanism of miR-133b inhibiting cell migration and innovation. [score:4]
Tumor suppressive signatures of miR-133b involved in human cancer and its regulatory mechanism. [score:4]
Regulatory mechanisms leading to abnormal expression of miR-133b. [score:4]
Interesting, miR-133b, recognized as androgen receptor (AR)targets, can promoting cell survival and proliferation in the androgen -dependent PCa cells by represses CDC2L5, PTPRK, RB1CC1, and CPNE3 [24], RB1CC1, which regulate cell growth, cell proliferation, apoptosis, can be repressed by miR-133b in less aggressive LNCaP prostate cancer cells [25]. [score:4]
These studies, though present tissue specificity, clearly confirmed that the chemotherapy efficiency of cancer is more closely related to abnormal expression of miR-133b. [score:3]
With the latest deciphering of roles for miR-133b in the metastatic programme there are numerous such cancer gene have been identified, such as MMP14, MMP-9, the member of MMPs family, can be suppressed in GBM and renal cell carcinoma [59, 60], respectively. [score:3]
MiR-133b can participate in cancer cell proliferation; apoptosis and invasion through directly suppressing the gene including DR5, FAIM, GSTP1, CDC2L5, PTPRK, RB1CC1, CPNE3, MCL-1, BCL2L2, Mcl-1, Bcl-xL, FGFR1, Sp1, TBPL1, hERG, Kv11.1, KCNH2, CTGF, Nup214, c-Met, Sirt1 and S1PR1. [score:3]
In addition, another original intention for this review is that there has been individual review for each myomiRs but miR-133b, these independent reviews about miR-133 [7]/a [10], miR-1 [11– 13], miR-206 [14, 15] and miR-133b which we review in here is so particularly important for us to understand the jointly or independently role of myomiRs acting in human disease. [score:3]
To better understand the role of altered expression of miR-133b in human cancer, we use OncoLnc (http://www. [score:3]
Similarity, yet paradoxically, miR-133b was significantly lower in primary resistant ovarian carcinomas and cell lines and reduced ovarian cancer drug resistance by silencing the expression of the drug-resistance-related proteins, glutathione S-transferase(GST-π) and multidrug resistance protein 1 (MDR1) [73]. [score:3]
Equally attractive is combined treatment of miR-133b and cetuxima can intensify suppression effect on the growth and invasion of colorectal cancer cells by modulating EGFR [52]. [score:3]
The target genes of miR-133b involved in human cancer. [score:3]
Enrichment analysis of the target genes of miR-133b. [score:3]
In OC, miR-133b can reduce the phosphorylation of Erk1/2 and Akt by targeting EGFR [48]. [score:3]
Clinical implication of altered expression of miR-133b in human cancer. [score:3]
Existing studies have shown that miR-133b dysregulation in tumor is regulated by epigenetic modifications. [score:3]
Moreover, microenvironment associated with cancer also have high expression of miR-133b, such as miR-133b in cancer associated fibroblasts [66], in GBM microvasculature [56]. [score:3]
These researches about miR-133b as metastasis promoter and metastasis suppressor therefore represent a new approach that may enhance our understanding of the molecular mechanisms modulating the metastatic cascade. [score:3]
The dual expression of miR-133b in human cancer. [score:3]
Here, we describe miR-133b, one of the myomiRs, was involved in human cancer, stressing its individualistic roles as tumor activators and suppressors, and discusses the concrete mechanism playing in different hallmarks of cancer and possible use in the clinic as predictive markers and as therapeutic strategies for tumor patients. [score:3]
Firstly, we introduced the general situation of miR-133b, and then summarized the current understanding about functional significance and the aberrant expression of miR-133b acting in human cancer. [score:3]
Although these miRs have the same specificity of tissue expression, mature miRNA sequence present variant nucleotiedes (Figure 1A shows the representative gene structure of miR-133b/miR-206 clusters and each mature miRNA sequence), this also explains to a certain extent its function may be different. [score:3]
What matters, and become more particularly significant in all these studies, is the abnormally expressed miR-133b in human cancer and to illuminates the underlying mechanism resulting in alteration. [score:3]
In the sections that follow, the clinical implication of altered expression of miR-133b in human cancer and the possible problems or paradoxes were analyzed. [score:3]
The expression of miR-133b. [score:3]
For a more comprehensive understanding the latest updates and condition of miR-133b properties in cancer regulatory networks and tumor biology, Firstly, we performed an extremely simple mathematical analysis. [score:2]
Regulatory role of miR-133b in altered energy metabolism of cancer cells. [score:2]
AC: acetylation; A# Regulatory network of miR-133b involved in altered energy metabolism of cancer cells. [score:2]
Regulation mechanism of miR-133b in chemotherapy and radiotherapy. [score:2]
Besides the regulatory effects of miR-133b involved in chemosensitivity, some studies have also demonstrated its role playing in radiosensitivity. [score:2]
miR-133b belong to canonical muscle-specific microRNAs (myomiR) families(miR-1, −133 and -206s) and was initially considered muscle specific in that it was highly enriched in heart and skeletal muscle and played a critical regulator for muscle development and remo deling [5, 6]. [score:2]
Yet expect all the apoptotic pathways, miR-133b can regulate genes closely related to proliferation, such as fibroblast growth factor receptor 1 (FGFR1), and Sp1 and its downstream proteins Cyclin D1 in gastric cancer [31, 32], TATA-box binding protein like 1(TBPL1) in colorectal cancer [33], the human ether-a-go-go-related gene potassium channel (hERG, Kv11.1, KCNH2) in glioma [34]and connective tissue growth factor(CTGF) in hepatocellular carcinoma (HCC) [35]. [score:2]
Compared with it, a research conducted in colorectal cancer found the CpG islands of miR-133b promoter presents hypermethylation in CRC tissues and cells, functional analysis demonstrated that demethylation treatment with 5-aza-2'-deoxycytidine (5-Aza-CdR) can increased the expression of miR-133b and then reversed its anticancer effects. [score:2]
[24] introduced Response Score to identify AR target miRNAs and 15 miRNAs were theoretically identified as candidate in the end, based on GenMAPP and ChIP assay results they found a significant AR -binding to the chromatin of predicted AREs (in the upstream and downstream 15 kb of pre-miRNA's 5′-start site) in miR-19a, miR-27a and miR-133b in treated LNCaP cells, and AR driven transcription of these miRs. [score:2]
It's sure that dysregulated miR-133b plays a crucial role in the process—then, what is the concrete mechanism? [score:2]
To analyse and compare the pathological tissue by qPCR may be relatively commonly used in identifying promising tumor biomarkers, the overwhelming majority of the analyzed tumor entities showed significantly decreased intracellular miR-133b expression compared to matched non-malignant tissue, including lung cancer [77], urothelial carcinoma of bladder [78, 79], gastric cancer [63, 80], osteosarcoma [81]. [score:2]
miR-133b and miR-206, two isomers of miR-1 and miR-133a form different clusters located in on chromosomes 6p12.2, 20q13.33 and 18q11.2, respectively. [score:1]
The miR-133b and epidermal growth factor receptor. [score:1]
All indicated the fact that miR-133b regarded as much-anticipated biomarkers is gradually moving, though much is still to be done. [score:1]
Some cancers however show that elevation of miR-133b levels promotes cancer progression. [score:1]
Literature searches (Pubmed) in the Figure 1B have showed the research proportion of 4 different myomiRs in all literatures and in article on cancer, year distribution of miR-133b with cancer was presented in Figure 1C, which indicated the study of miR-133b is proportionately less and growing annually, remarkably, it seem that more research of miR-133b is about caner. [score:1]
org/) exploring survival correlations of miR-133b in cancer (OncoLnc is a database can provide survival data for 8,647 patients from 21 cancer studies performed by The Cancer Genome Atlas (TCGA)). [score:1]
However, discussions from these excellent reviews are mainly centered on the role of miR-133b in homologous cluster (miR-1, -133 and -206s) and sometimes its unique physiological functions are harder to distinguish and to be highlighted extremely well. [score:1]
miR-133b in papillary thyroid carcinoma (THCA) were listed in here. [score:1]
Comparison of all these studies concludes that miR-133b have played a dual role in androgen-independent PCa and androgen -dependent PCa. [score:1]
An extensive new research study [118] has found that flavin -dependent monoamine oxidase KDM1A can triggers androgen -induced miR-133b transcription via H3K4me2 demethylation and DNA oxidation. [score:1]
MicroRNA families miR-1 and miR-133, and single miR-206 are collectively known as the muscle-specific miRNAs (“myomiRs”) because of they are highly conserved in the musculatures across species [8]. [score:1]
The miRNA-mRNA interactions indicated miR-133b play a central role in human cancer. [score:1]
Therefore, in order to avoid ambiguous identification and highlight the unique pathological properties of miR-133b playing in human cancer, we made a review only for miR-133b. [score:1]
miR-133b in Colon and Rectal adenocarcinoma (CRC) and CLTA gene vs. [score:1]
As noted above, discrepancies present in miR-133b profiles detecting, even in same tissues. [score:1]
Also in lung cancer, the experiment in vivo showed alteration of serum miR-206 and miR-133b may have to do with lung carcinogenesis induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone [91]. [score:1]
Earlier finding also showed that miR-133b was significantly reduced in squamous cell carcinoma (SCC) of tongue which depress PKM2 and interfere with the efficiency of proliferation and apoptosis [47]. [score:1]
Figure 1(A) The representative gene structure of miR-133b/miR-206 clusters and the mature miRNA sequence of these two miRNAs; miR-133b/miR-206 clusters located in on chromosomes 6p12.2 and miR-133b gene transcript is located within the precursor of the long non-coding RNA linc-MD1. [score:1]
Until now, there are 3 available reviews about miR-133b in English bibliographic databases. [score:1]
The study of miR-133b is proportionately less and more research of it is about caner. [score:1]
Modulatory effect of miR-133b in cancer cell proliferation and apoptosis. [score:1]
The overview of miR-133b. [score:1]
At the same time, we also analyzed the proportion of miR-133b in various cancers, and research categories of miR-133b involved in tumor, the result indicated that the majority of the study about miR-133b focuses on pathomechanism and digestive tract neoplasms (Figure 1D and 1E). [score:1]
miR-133b may not only serve as both diagnostic and prognostic biomarkers but have great therapeutic potential in clinical practice. [score:1]
To avoid the repetition and encumbrance of related contents, and help focus on unique pathological role of miR-133b in cancer, more minute details about myomiRs can be found in these excellent review papers [5, 6, 9]. [score:1]
[1 to 20 of 102 sentences]
2
[+] score: 326
Other miRNAs from this paper: hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-145
The expression of Akt1 and Bcl-w proteins and Akt1 mRNA, in T24 cells was significantly down-regulated or up-regulated after transfection of miR-133b mimics or inhibitor, respectively; however, there was no significant difference in Bcl-w mRNA expression. [score:13]
The expression of Bcl-w protein in T24 cells was down-regulated and up-regulated after transfection of miR-133b mimics or inhibitor, respectively, but there was no significant difference in Bcl-w mRNA expression. [score:13]
We found the expression of Akt1 protein and mRNA in T24 cells was down-regulated and up-regulated, respectively, after transfection of miR-133b mimics or inhibitor. [score:11]
Bladder cancer specimens were divided into low expression (below average expression of 30.4) or high expression groups (expression levels higher than the average of 30.4) according to the relative expression of miR-133b, normalized to U6 RNA. [score:11]
Transfection of miR-133b-sense or miR-133b-antisense into T24 cells caused Akt1 mRNA expression to be significantly down-regulated or up-regulated (P < 0.05 for both), respectively (Figures  6b and d); however, there was no significant difference in Bcl-w mRNA expression (Figures  6a and c). [score:11]
Bcl-w was predicted to be a target of miR-133b by five miRNA target prediction algorithms (Diana-microT, miRanda, miRWalk, PICTAR, TargetScan), and Akt1 was predicted to be a target of miR-133b by PITA. [score:9]
Melissa et al. reported that MiR-133b down-regulated the expression of MCL-1 and Bcl-w in lung adenocarcinoma cells, and overexpression of miR-133b increased the sensitivity of lung adenocarcinoma cells to gemcitabine [38]. [score:8]
The expression of miR-133b in bladder cancer tissues from 41 patients was significantly down-regulated (P < 0.01); low expression of miR-133b was strongly associated with high-grade bladder cancer (P < 0.01). [score:8]
Transfection of miR-133b-antisense into T24 cells caused Bcl-w (Figures  6i and j) and Akt1 protein (Figures  6k and l) expression to be significantly up-regulated (P < 0.05 for both). [score:6]
In this study, we examined expression levels of miR-133b in bladder cancer tissues from 41 patients by RT-PCR and found miR-133b was significantly down-regulated in bladder cancer tissues, which was consistent with previous research. [score:6]
Transfection of miR-133-sense into T24 cells caused Bcl-w (Figures  6e and ) and Akt1 (Figures  6g and h) protein expression to be significantly down-regulated (P < 0.05 for both; Figures  6e and f). [score:6]
These results implied that down-regulation of miR-133b may be involved in human bladder cancer disease processes. [score:6]
In conclusion, in this paper we show that miR-133b expression is downregulated in bladder cancer tissues and is linked to high-grade bladder cancer. [score:6]
MiR-133b is a muscle-specific microRNA; it has a role in the formation of cardiocytes and the expression of myocardium ion channels by regulating target genes. [score:5]
The functional role of miR-133b in bladder cancer and its influence on Bcl-w and Akt1 protein and mRNA expression, and cell proliferation and apoptosis, was studied after transfection of miR-133b mimics or inhibitor into a transitional human bladder carcinoma cell line, T24. [score:5]
MiR-133b mimics significantly inhibited T24 cell proliferation, as well as increased T24 cell apoptosis (P < 0.05 and P < 0.01, respectively) while the miR-133b inhibitor increased and decreased these, respectively (P < 0.05 for both). [score:5]
Previous reports have shown that Akt1 is involved in the regulation of bladder cancer; however, it is unclear whether miR-133b can regulate the expression of Akt1 in T24 human bladder cancer cells. [score:5]
We found the expression of miR-133b were significantly increased and decreased after transfection of miR-133b mimics (P < 0.01) and an miR-133b inhibitor (P < 0.01), respectively, into T24 cells (Figure  2). [score:5]
We further analyzed the relationship between the expression of miR-133b and clinicopathological factors, and found that a lower expression level of miR-133b was strongly associated with high-grade bladder cancer. [score:5]
After transfection of miR-133b mimics or inhibitor into a T24 human bladder cancer cell line, Bcl-w and Akt1 protein and mRNA expression were examined by Western blot and RT-PCR, respectively. [score:5]
We show mi-R133b regulated Bcl-w and Akt1 in cultured T24 cells and we therefore speculated that miR-133b affects the biological behavior of bladder cancer by regulating the expression of Bcl-w and Akt1. [score:5]
Transfection of HEK-293 T cells with miR-133b significantly suppressed a luciferase-reporter containing the Bcl-w or Akt 1 3′-untranslated regions. [score:5]
Thus, we hypothesized that miR-133b may function as a tumor suppressor, and the abnormal expression of miR-133b might be an important factor in bladder cancer incidence. [score:5]
Masayuki et al. [30] found that the expression of miR-133b was significantly lower in esophageal squamous cell carcinoma; the proliferation and invasion of a carcinoma cell line could be inhibited after miR-133b transfection. [score:5]
Figure 1 MiR-133b expression is downregulated in bladder cancer tissue. [score:5]
We found that miR-133b overexpression caused T24 cell growth inhibition and apoptotic enhancement. [score:5]
The relative expression of miR-133b in cells transfected by miR-133b mimics (sense) and inhibitor (antisense) was determined by qRT-PCR. [score:5]
MiR-133b expression is downregulated in bladder cancer tissues. [score:5]
These results indicate that miR-133b expression in T24 cells inhibits their proliferation. [score:5]
MiR-133b is a type of muscle-specific microRNA; it takes part in the formation of cardiocytes and the expression of myocardium ion channels by regulating target genes. [score:5]
We found Bcl-w and Akt1 to be putative targets of miR-133b and show increased expression of these proteins in bladder cancer tissues. [score:5]
In addition, they also found that miR-133b could affect the biological behavior of the tumor through regulating gene expression of FSCN1. [score:4]
These results suggested miR-133b down-regulation in human bladder cancer is strongly linked to a high-grade pathology. [score:4]
These results indicate that miR-133b down-regulates Akt1 mRNA and protein, and Bcl-w protein, but not its mRNA. [score:4]
Our results suggested miR-133b might regulate certain oncogenes to inhibit tumorigenesis. [score:4]
Hu et al. [32] found that the expression of miR-133b was significantly decreased in colorectal cancer and in colorectal cancer cell lines SW-620 and HT-29; furthermore, it was found that miR-133b played an important role in vivo and in vitro by regulating the tyrosine kinase receptor, c-Met. [score:4]
The relative expression of miR-133b normalized to U6 RNA was determined by qRT-PCR. [score:3]
miRNA: microRNA miR133b: microRNA -133b UTRs: Untranslated regions NC: Negative control CCK-8: OD: Optical density The authors declare that they have no competing interests. [score:3]
A negative relationship between miR-133b expression and the pathological grading of bladder cancer. [score:3]
To gain a greater understanding of the role of miR-133b in the pathogenesis of human bladder cancer, we looked for its potential downstream targets. [score:3]
Figure 6 Effect of miR-133b mimics and inhibitor on Bcl-w and Akt1 mRNA and protein levels in a T24 human bladder carcinoma cell line. [score:3]
In this study, we detected the expression of miR-133b, Bcl-w and Akt1 in clinical bladder cancer tissues. [score:3]
Effect of miR-133b on Bcl-w and Akt1 mRNA and protein expression in T24 human bladder cancer cells. [score:3]
Expression levels of miR-133b were analyzed by using stem-loop RT-PCR. [score:3]
MiR-133b may play a very important role in the proliferation and apoptosis of T24 cells by regulating the expression of Bcl-w and Akt1. [score:3]
The following oligonucleotides were purchased from GenePharma (Shanghai, China): double-stranded miR-133b sense (mimics) and miR-133b-sense -negative control (NC); miR-133b -antisense (inhibitor) and miR-133b-antisense -negative control (NC); and sequences are as follows: miR-133b, 5′- UUUGGUCCCCUUCAACCAGCUA-3′, 5′-GCUGGUUGAAGGGGACCAAAUU-3′ and its NC 5′-UUCUCCGAACGUGUCACGUTT-3′, 5′- ACGUGACACGUUCGGAGAATT-3′; miR-133b-antisense, 5′-UAGCUGGUUGAAGGGGACCAAA-3′ and its NC 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:3]
Bcl-w and Akt1 are putative targets of miR-133b according to bioinformatics results. [score:3]
U6 RNA was used as an endogenous normalizer and the relative combined expression levels of miR-133b are shown. [score:3]
Recent studies have shown that the expression of miR-133b is abnormal in many tumors. [score:3]
Many human malignant tumors, such as colorectal,lung, esophagus and bladder cancer [4]-[7], express low levels of miR-133b; however, the role of miR-133b in bladder cancer is still unclear. [score:3]
We show that miR-133b inhibits cell proliferation and induces apoptosis in a human bladder cancer cell line, T24. [score:3]
We also analyzed the relationship between miR-133b expression and clinicopathological factors of bladder cancer. [score:3]
Many human malignant tumors demonstrate a low expression of miR-133b, as noted in colorectal, lung, esophagus and bladder cancers, but the role of miR-133b in bladder cancer is unknown. [score:3]
The effects of miR-133b mimics or an inhibitor on levels of Bcl-w and Akt1 mRNA and protein in a human bladder cancer cell line, T24, were studied. [score:3]
Figure 3 Bcl-w and Akt1 as target genes of miR133b. [score:3]
miR-133b target gene prediction. [score:3]
Computer -based programs were used to predict potential miR-133 targets. [score:3]
However, there was no significant association between miR-133b expression and gender, clinical stage or neoplasm recurrence (Table  1). [score:3]
According to past bioinformatics prediction results, we speculated that Bcl-w and Akt1 might be target genes for miR-133b. [score:3]
The expression of miR-133b in clinical bladder cancer specimens and adjacent normal tissues was confirmed by stem-loop RT-PCR. [score:3]
We found low miR-133b expression and high pathological grading were significantly negatively correlated (P = 0.003; Table  1). [score:3]
These findings support the idea that miR-133b may be an important regulator in bladder cancer. [score:2]
Quantitative analysis indicated that miR-133b expression was significantly decreased in bladder cancer specimens compared to adjacent normal tissues (P < 0.01; Figure  1). [score:2]
MiR-133b inhibits cell proliferation of T24 cells. [score:2]
We therefore speculated that miR-133b, whose nucleotide sequences are similar to those of miR-133a, may also play an important regulatory role in bladder cancer. [score:2]
Figure 7 Effect of miR-133b on proliferation of T24 cells. [score:1]
T24 cells were seeded onto 6-well plates and transfected with miR-133b-sense or miR-133b-antisense at 80% confluency. [score:1]
MiR-133b-sense, miR-133b-sense-NC, miR-133b-antisense and miR-133b-antisense-NC transfections were carried out using Lipofectamine 2000 in accordance with the manufacturer’s gui delines (Invitrogen). [score:1]
U6 RNA was used as an internal control to normalize the relative abundance of miR-133b. [score:1]
Figure 2 Transfection of T24 cells with miR-133b sense and antisense. [score:1]
The optimum reaction time of CCK-8 was determined to be 2.5 h. When 80% confluent, T24 cells (100 μL/well) were seeded into 96-well plates, and were left untransfected or transfected with miR-133b-sense or miR-133b-antisense, and further incubated for 12, 24, 48, and 72 hours using three replicates. [score:1]
Figure 8 The effect of miR-133b on T24 cell apoptosis. [score:1]
T24 cells were untreated or treated with miR-133b sense or miR-133b sense normal control (NC) (a, b, e, f, g, h) or with miR-133b antisense or miR-133b antisense normal control (NC) (c, d, i, j, k, l). [score:1]
Expression levels of miR-133b were measured by stem-loop RT-PCR in bladder cancer specimens and corresponding, adjacent normal tissues. [score:1]
HEK-293Tcells were cotransfected with miR-NC or miR-133b mimics using Lipofectamine 2000 (Invitrogen). [score:1]
However, miR-133b and gender, clinical stage and neoplasm recurrence showed no significant correlation. [score:1]
Determination of miR-133b sense and antisense transfection efficiency. [score:1]
The expression levels of Bcl-w and Akt1 mRNA were measured in T24 cells transfected with miR-133b-sense, miR-133b-sense-NC, miR-133b-antisense and miR-133b-antisense-NC. [score:1]
This data indicates that miR-133b promotes apoptosis in T24 cells. [score:1]
showed that miR-133b significantly decreased the luciferase activity of the Bcl-w (Figures  3a and b) and Akt1 (Figures  3c and d) 3′-UTRs in HEK-293 T cells (P < 0.01 for both), but not mutant sequences of the 3′-UTR of Bcl-w and Akt1. [score:1]
Using “has-miR-133b” as a search term, we queried PicTar (http://pictar. [score:1]
The effect of miR-133b on T24 cell proliferation was studied. [score:1]
These results indicated that miR-133b bound specifically to the 3′-UTR of Bcl-w and Akt1 as predicted. [score:1]
Expression levels of miR-133b were measured by stem-loop RT-PCR in 41 bladder cancer specimens and their corresponding adjacent normal tissues. [score:1]
[1 to 20 of 84 sentences]
3
[+] score: 324
Other miRNAs from this paper: hsa-mir-139, hsa-mir-133a-1, hsa-mir-133a-2
Three bioinformatics algorithms, TargetScan [29], miRBase Target [30] and StarBase [31], were applied to search for the potential targets of miR-133b, and a number of potential targets were predicted. [score:9]
For instance, miR-133b was found to be downregulated in non-small cell lung cancer and modulate apoptosis and invasion [16], and overexpression of miR-133b has been shown to inhibit cell invasion activity in esophageal squamous cell carcinoma [19]. [score:8]
Intriguingly, the CXCR4 protein expression level in SW-620 was shown to be much higher than in SW-480 (Figure  3A) and was negatively coexpressed with the expression of miR-133b (Figure  3A). [score:7]
CXCR4 protein expression of CRC cells transfected with miR-133b mimic, miR-133 inhibitor, siCXCR4 or a negative control normalized to GAPDH expression. [score:7]
To further confirm that the CXCR4 protein is suppressed by miR-133b, we then overexpressed and knocked down miR-133b in colorectal cancer cell lines. [score:6]
A significant downregulation of miR-133b was observed in 93.55% of CRC tissues, and the expression of miR-133b was much lower in metastatic tumors (stage C and D, stratified by the Modified Dukes Staging System) than in primary tumors (stage A and B). [score:6]
Figure 1 Expression of miR-133b was downregulated in CRC. [score:6]
The results showed that their expressions were affected by the miR-133b mimics and inhibitor in the SW-480 and SW-620 cell lines (Figure  6), that miR-133b regulates CXCR4 to affect its classic underlying pathway. [score:6]
CXCR4 was a direct target of miR-133bTo gain insight into the biological role of miR-133b that underlies disease pathogenesis, we further investigated its downstream targets. [score:6]
Cells were seeded as 5 replicates at a density of 6000/well in 100 μl of full medium in 96-well plates and transfected with miR-133b mimics (100 nM), miR-NC (100 nM), miR-133b inhibitor (200 nM), inhibitor-NC (200 nM), siCXCR4 (120 nM) or si-NC (120 nM) as described above. [score:5]
Forced expression of exogenous miR-133b decreases CRC cell invasion and migration in vitroThe lower expression level of miR-133b in advanced CRC SW-620 cells implied that miR-133b might contribute to the metastatic features of CRC. [score:5]
Exogenous expression of miR-133b, which was induced by introducing the miR-133b duplex into HEK-293T cells using Lipofectamine 2000, suppressed the activity of a Renilla luciferase construct containing the miR-133b MRE (miRNA response region) of human CXCR4 at its 3′ end by approximately 42.7% (P < 0.01) (Figure  2B). [score:5]
Figure 6 qRT-PCR was used to detect the expression of the VEGF and MMP-9 genes in the SW-480 and SW-620 cell lines transfected with the miR-133b mimics, miR-133b inhibitor or CXCR4 siRNA. [score:5]
CXCR4 was shown to be a direct target of miR-133b by luciferase reporter assays, and transfection of miR-133b mimics inhibited invasion and stimulated apoptosis of SW-480 and SW-620 CRC cells. [score:5]
Our study demonstrated that downregulated miR-133b contributed to increased cell invasion and migration in CRC by negatively regulating CXCR4. [score:5]
Similarly, the activity of a luciferase construct containing the entire 3′UTR of CXCR4 was suppressed by approximately 51.6% of the Renilla luciferase activity (P < 0.01) by ectopic miR-133b expression (Figure  2C). [score:5]
As shown in Figure  1A, a significant downregulation of miR-133b was noted in 29 of the 31 tumor samples (93.55%) when compared to non-neoplastic tissues (p < 0.001), and the expression of miR-133b in metastatic tumor tissues was much lower than that in the primary tumors (p < 0.05, Figure  1B). [score:5]
The lower expression level of miR-133b in SW-620 than in SW-480 was consistent with the expression pattern in clinical samples. [score:5]
Wild-type and full-mutated miR-133b putative target segments comprising 59 bp of the 3′UTR (untranslated terminal region) of CXCR4 were synthesized by Invitrogen (Invitrogen, China) and cloned into the psiCHECK-2-CXCR4 vector (Promega, Madison, WI, USA) for miRNA functional analysis. [score:5]
To investigate whether the expression level of this muscle-specific miRNA was associated with disease progression, we first conducted qRT-PCR analyses to detect miR-133b expression in 31 human CRC tissues and their 19 counterparts from non-neoplastic adjacent tissues. [score:5]
Alternatively, when the cells were transfected with the miR-133b inhibitor, CXCR4 protein expression increased in SW-480. [score:5]
As shown in Figure  5A and 5B, inhibition of miR-133b significantly increased cell migration and invasion, especially in SW-480 cells, which had relatively higher endogenous miR-133b expression. [score:5]
Notably, the miR-133b expression level in SW-480 was considerably higher than in the other five cell lines, while the SW-620 cell line had the lowest level of expression (Figure  2D and Figure  3A). [score:5]
These results suggested that miR-133b could inhibit the growth of SW-480 and SW-620 cells through the targeting of CXCR4. [score:5]
Previous studies have shown that aberrant expression of miR-133b was found in CRC cancer tissues [14, 17] and that overexpression of miR-133b induced apoptosis and G1 cell-cycle arrest in CRC cells [17]. [score:5]
In this study, we found that CXCR4 was a direct target of miR-133b in colorectal cancer. [score:4]
Suppression of luciferase activity was abolished when a full mismatch mutation was introduced into the miR-133b–MRE within the CXCR4 3′UTR (Figure  2B). [score:4]
Our results suggest that miR-133b suppresses CRC metastasis by regulating the migratory and invasive abilities of CRC cells through CXCR4. [score:4]
CXCR4 was a direct target of miR-133b. [score:4]
We revealed the involvement of miR-133b in the progression of human CRC via the regulation of CXCR4 expression. [score:4]
Figure 2 CXCR4 is a direct target of miR-133b. [score:4]
These results implied that downregulation of miR-133b might be involved in human CRC initiation and progression. [score:4]
This finding implies that miR-133b regulates CXCR4 to affect its classic underlying pathway, which highlights the potential of this miRNA to be used as a CXCR4 inhibitor in CRC treatment. [score:4]
To investigate whether miR-133b functions as a tumor suppressor by promoting cell apoptosis and impairing proliferation, we performed overexpression and knockdown studies to characterize the effect of miR-133b on CRC proliferation using the miR-133b mimics, miR-133b inhibitor and siCXCR4 in SW-480 and SW-620 cells. [score:4]
miR-133b, which is a miRNA commonly recognized as a muscle-specific molecule, participates in myoblast differentiation [10, 11] and myogenic-related diseases [12, 13]. [score:3]
The miR-133b- and siCXCR4 -transfected cells formed fewer colonies than the control -transfected cells in SW-480 and SW-620 cells within 12 days, while the opposite effect was observed in cells transfected with the miR-133b inhibitor (Figure  4A and Additional file 4: Figure S4; p < 0.01). [score:3]
The following oligonucleotides were purchased from GenePharma (GenePharma, Shanghai, China): miR-133b mimics; miRNA negative control (designated as miR-NC); miR-139 mimic as a positive control; miR-133b antisense with a sequence complementary to the mature miR-133b; and miRNA antisense negative control (designated as inhibitor-NC), which is a negative control for miR-133b antisense. [score:3]
The introduction of miR-133b or knocking down CXCR4 with siCXCR4 caused a remarkable inhibition of cell proliferation in SW-480 and SW-620 cells when compared to the controls (p < 0.05 at 96 h) (Additional file 3: Figure S3A and B). [score:3]
A significant correlation was also found between miR-133b and CXCR4 protein expression in tumor samples. [score:3]
For example, Bandrés et al. [14] revealed the deregulation of miR-133b alongside 12 deregulated miRNAs in 15 CRC cell lines and 6 paired human CRC specimens. [score:3]
In the present study, we investigated the expression patterns of miR-133b in CRC clinical samples and identified low miR-133b expression as a valid factor associated with advanced tumor stages. [score:3]
Forced expression of exogenous miR-133b decreases CRC cell invasion and migration in vitro. [score:3]
The lower expression level of miR-133b in advanced CRC SW-620 cells implied that miR-133b might contribute to the metastatic features of CRC. [score:3]
CXC chemokine receptor-4 (CXCR4), which participates in multiple cell processes such as cell invasion-related signaling pathways, was predicted to be a potential target of miR-133b. [score:3]
We postulated that ectopic expression of miR-133b in CRC cells could impede the migratory and invasive abilities of CRC cells. [score:3]
These results indicated that CXCR4 is a bona fide target of miR-133b. [score:3]
Decreased expression of miR-133b in human CRC showed significant diagnostic potential. [score:3]
Expression of miR-133b and the CXCR4 protein level was inversely correlated. [score:3]
As observed in Figure  4C, the apoptotic rate in SW-480 cells transfected with the miR-133b inhibitor dropped from 18.77% to 10.67% (p < 0.01), and this apoptosis-promoting effect of siCXCR4 was corroborated in both cell lines. [score:3]
In contrast, when miR-133b activity was impeded by the miR-133b inhibitor, the cells presented strengthened proliferation ability (p < 0.05 at 96 h) (Additional file 3: Figure S3C and D). [score:3]
Hu et al. [17] uncovered receptor tyrosine kinase MET as one target of miR-133b in CRC and demonstrated its involvement in cell proliferation and apoptosis. [score:3]
Thus, in subsequent experiments, we primarily used these two cell lines for functional studies: SW-620 was used for the gain-of-function study due to its considerably lower endogenous miR-133b level, and SW-480 was used for the loss-of-function study due to its higher level of miR-133b expression. [score:3]
MicroRNA-133b (miR-133b), which is a muscle-specific microRNA, has been reported to be downregulated in human colorectal carcinoma (CRC) when compared to adjacent non-tumor tissue. [score:3]
To further validate the correlation between miR-133b and CXCR4, we then detected the expression levels of the CXCR4 protein in the six human CRC cell lines and in the clinical samples that were previously used for miR-133b detection. [score:3]
However, the relationship between miR-133b expression and cell metastases in CRC has yet to be demonstrated. [score:3]
These results indicate that overexpression of miR-133b induced an aggravated apoptosis rate and an impaired proliferation of CRC cells. [score:3]
We also transiently transfected miR-133b inhibitors into the cells. [score:3]
Recent studies showed that miR-133b also plays a crucial role in the malignant progression of non-muscle-related diseases [14- 16] such as cancer [14- 19]. [score:3]
Mature miR-133b and CXCR4 expression levels were detected in 31 tumor samples and their adjacent, non-tumor tissues from patients with CRC, as well as in 6 CRC cell lines, using real-time quantitative RT-PCR (qRT-PCR). [score:3]
As expected, exogenous expression of miR-133b and siCXCR4 substantially impeded the migratory ability of CRC cells, as indicated by the decreased number of migrated cells (Figure  5A). [score:3]
The converse effect was observed in cells transfected with miR-133b inhibitor (Figure  4C). [score:3]
Another study showed that the downregulation of miR-133b in CRC tissues, when compared to adjacent non-tumor tissues, was linked to poor survival [5]. [score:3]
In 10 of 19 patients, the expression of miR-133b in the tumors is higher than in the adjacent non-tumor tissues (signed by star). [score:3]
In contrast, when transfected with the miR-133b inhibitor, the speed of wound closure was increased. [score:3]
To gain insight into the biological role of miR-133b that underlies disease pathogenesis, we further investigated its downstream targets. [score:3]
These data provide the potential of miR-133b to serve as a molecular target for CRC therapy, especially for tumors with high degrees of metastasis. [score:3]
These results indicate that miR-133b may be a useful therapeutic target in CRC. [score:3]
Effects of miR-133b overexpression on cell proliferation and apoptosis by modulating CXCR4 levels. [score:3]
We also demonstrated that miR-133b contributed to increased cell invasion by negatively regulating CXCR4 activity in CRC carcinogenesis and progression. [score:2]
In conclusion, our current findings provide the first glimpse of the functional role of miR-133b in CRC carcinogenesis and progression through the negative regulation of CXCR4. [score:2]
Luciferase reporter assays and Western blots were used to validate CXCR4 as a putative target gene of miR-133b. [score:2]
Figure 5 miR-133b regulates motility of CRC cells. [score:2]
These data indicated that the predicted MRE was critical for the direct and specific binding of miR-133b to the CXCR4 mRNA. [score:2]
Treatment with the miR-133b mimic and siCXCR4 inhibited wound closure in both cell lines compared to the control (Figure  5C). [score:2]
The expression levels of miR-133b were significantly lower in CRC tumor tissues when compared to the NT group (Figure  1A). [score:2]
Regulation of CXCR4 expression by miR-133b was assessed using qRT-PCR and Western blot analysis, and the effects of exogenous miR-133b and CXCR4 on cell invasion and migration were evaluated in vitro using the SW-480 and SW-620 CRC cell lines. [score:2]
The expression of mature miR-133b was determined using the Hairpin-it™ Assay kit (GenePharma, Shanghai, China) and normalized to U6-snRNA. [score:2]
The psiCHECK-2-CXCR4 full-mutated vector introduced the full mutation into the miR-133b binding sites of the CXCR4 3′UTR. [score:2]
Furthermore, miR-133b has reportedly been shown to be involved in the invasion of several other cancers. [score:1]
Thus, a negative correlation exists between the level of miR-133b and the level of CXCR4 protein in CRC tumors. [score:1]
As shown in Figure  1C, the AUC of miR-133b reached 0.8081 [95% confidence interval (CI): 0.6857-0.9306, P < 0.001], with a cut-off point of 77.42% sensitivity and 78.95% specificity. [score:1]
A receiver operating characteristic (ROC) curve analysis was performed using the relative expression of miR-133b, and the associated area under the curve (AUC) was used to confirm the diagnostic potency of the miRNA. [score:1]
The inverse correlation between miR-133b and CXCR4 in CRC cell lines and clinical samples. [score:1]
To confirm this speculation, miR-133b mimics were transiently introduced into the cells for 36 hours. [score:1]
To further reveal the potential signaling pathway that underlies the miR-133b/CXCR4 interaction, we investigate the expression of the CXCR4 downstream genes vascular endothelial growth factor (VEGF) and matrix metalloproteinase-9 (MMP-9)[37, 38]. [score:1]
Our results demonstrated that the miR-133b/CXCR4 pair is involved in tumor growth and tumor cell apoptosis and controls cell migration and invasion. [score:1]
Figure 3 The inverse correlation between miR-133b and CXCR4 in CRC cells and clinical samples. [score:1]
Further functional analysis revealed the involvement of miR-133b in the progression of human CRC, and transfection of miR-133b into two CRC cell lines, SW-480 and SW-620, significantly decreased tumor cell migration and invasion in vitro. [score:1]
Once 70-80% confluent in 48-well plates, HEK-293T cells were cotransfected with 50 ng/well of each luciferase reporter plasmid and 10 nM/well of either miR-133b mimic, miR-139 mimic or miR-NC, as described above. [score:1]
These results supported the hypothesis that CXCR4 is repressed by miR-133b. [score:1]
However, it remains undetermined how miR-133b functions in CRC pathogenesis and progression, especially in CRC invasion and metastasis. [score:1]
Click here for file The effect of miR-133b on CRC proliferation. [score:1]
miR-133b was first detected in six CRC cell lines (SW-480, SW-620, HCT-116, HCT-15, R KO and Caco-2). [score:1]
Accordingly, fluorescence-activated cell sorting (FACS) analysis was used to assess whether miR-133b contributed to apoptosis in CRC cells. [score:1]
More importantly, we determined the downstream molecules of the miR-133b/CXCR4 interaction as was done in previous research on CXCR4 in CRC [37]. [score:1]
We then investigated the coexpression pattern between miR-133b and CXCR4 in the clinical samples. [score:1]
As shown in Figure  2E, when SW-620 cells were transfected with the miR-133b mimics, the CXCR4 protein was significantly reduced. [score:1]
Furthermore, we found that the miR-133b/CXCR4 interaction influenced CRC progression through modifying the VEGF and MMP-9 genes, both of which play significant roles in CRC, especially in migration and invasion [48, 49]. [score:1]
The effect of miR-133b on CRC proliferation. [score:1]
We then examined the sensitivity and specificity of miR-133b. [score:1]
The correlation between miR-133b and CXCR4 was determined by the Spearman rank correlation test. [score:1]
It is also worth noting that the outcome of CRC patients is highly relevant to the extent of local invasion; therefore, the metastases-related miR-133b might provide tumor progression and prognostic information in CRC patients who would need to be experimentally validated prospectively. [score:1]
These results suggest that miR-133b can discriminate between CCA tissues and their paired adjacent normal tissues. [score:1]
[1 to 20 of 103 sentences]
4
[+] score: 322
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-200a
The restoration of HOXA9 expression in cells expressing miR-133b mimic blocked the miR-133b -induced suppression of migration and invasion (Figure 6A) and knockdown of HOXA9 abolished migration and invasion elevation in miR-133b inhibited cells (Figure 6B), indicating that HOXA9 mediated the suppressive effects of miR-133b on CRC migration and invasion. [score:12]
Moreover, HOXA9 expression was inversely associated with miR-133b expression in CRC samples, which suggested that HOXA9 upregulation in CRC might be caused by miR-133b downregulation. [score:11]
Remarkably, re -expression of HOXA9 in cells expressing miR-133b reversed ZEB1 and E-cadherin expression levels alteration induced by miR-133b and knockdown of HOXA9 after miR-133b inhibitor transfection also abrogated protein change of ZEB1 and E-cadherin (Figure 6C, 6D). [score:10]
These results suggested that miR-133b might suppress ZEB1 and E-cadherin expression by targeting HOXA9 to suppress CRC cell migration and invasion. [score:9]
Furthermore, with regard to correspondent expression of miR-133b and HOXA9, we divided the specimens into 3 groups: group 1, tumors exhibiting higher expression of miR-133b and lower HOXA9 (miR-133b+/HOXA9-, 14 specimens); group 2, tumors with both higher or both lower expression of miR-133b and HOXA9 (miR-133b+/HOXA9+, or miR-133b-/HOXA9-, 19 specimens); and group 3, tumors with lower expression of miR-133b and higher HOXA9 (miR-133b-/HOXA9+, 33 specimens). [score:9]
The expression of E-cadherin, a downstream effector of ZEB1 [38], was upregulated by miR-133b and suppressed by HOXA9. [score:8]
Remarkably, ZEB1 expression decreased and E-cadherin expression increased following HOXA9 downregulation in miR-133b mimic -transfected cells (Figure 5G). [score:8]
Therefore, miR-133b inhibited CRC cell migration and invasion may by downregulating HOXA9 expression and inactivating the HOXA9/ZEB1 signaling pathway. [score:8]
We also found that miR-133b decreased ZEB1 expression by downregulating HOXA9 expression in CRC cells. [score:8]
CRC patients with higher miR-133b expression levels had better overall survival than the group with lower miR-133b expression levels (Figure 7A), while HOXA9 showed the opposite that high expression predicts worse outcome (Figure 7B). [score:7]
These data showed that miR-133b might be a tumor suppressor and that its over -expression in cancer might inhibit cell proliferation. [score:7]
Figure 2Recovery miR-133b expression in CRC tumor cells inhibits cell proliferation and migration in vitroMiR-133b was overexpressed in CRC cell lines by using miR-133b mimic (scramble or miR-133b). [score:7]
Figure 6 (A) Restoration of HOXA9 expression in cells expressing miR-133b mimic blocked the miR-133b -induced suppression of migration and invasion. [score:7]
MiR-133b suppresses CRC tumor proliferation and migration in vitroTo discover whether miR-133b inhibit the malignant phenotype of CRC cells, miR-133b mimic was transfected into HCT116 and HCT8 colon cancer cell lines to overexpress miR-133b (Figure 2A). [score:7]
Among these differentially expressed miRNAs, miR-133b was often downregulated in CRC. [score:6]
Among those differentially expressed miRNAs, miR-133b performed a highly important role in cancer, which is downregulated in CRC. [score:6]
To refine the molecular mechanisms by which miR-133b suppresses CRC development and metastasis, we searched for potential target genes of miR-133b that might be implicated in the pathogenesis of CRC. [score:6]
These results suggested that miR-133b might regulate ZEB1 and E-cadherin expression by targeting HOXA9. [score:6]
qPCR analysis of our 66 CRC samples showed that overexpression of HOXA9 was greatly correlated with the downregulation of miR-133b (Figure 4F). [score:6]
To examine the expression of miR-133b in CRC, TCGA data was analyzed, which showed that miR-133b was significantly downregulated in CRC tissues compared to adjacent normal tissues (Figure 1B). [score:5]
Univariate analyses using the Cox hazard regression mo del identified low miR-133b expression, high HOXA9 expression, AJCC stage, differentiation and metastasis as prognostic indicators of overall survival for CRC patients (Table 1). [score:5]
Given that the expression of miR-133b is negatively correlated with the metastatic feature of CRC, we wondered whether miR-133b suppressed CRC cell migration and metastasis. [score:5]
These results hinted that miR-133b is lower expressed in CRC and might inhibit CRC progression. [score:5]
We showed that miR-133b over -expression inhibited proliferation, migration and invasion in vitro and in vivo by binding to HOXA9 3′ UTR in CRC cells. [score:5]
Our findings showed that miR-133b/HOXA9 axis is an important regulator in the development and progression of CRC and may be a candidate target for CRC treatment. [score:5]
Recovery miR-133b expression in CRC tumor cells inhibits cell proliferation and migration in vitro. [score:5]
To discover whether miR-133b inhibit the malignant phenotype of CRC cells, miR-133b mimic was transfected into HCT116 and HCT8 colon cancer cell lines to overexpress miR-133b (Figure 2A). [score:5]
Among them, 231 patients have miR-133b expression data available and 278 patients have HOXA9 expression data available. [score:5]
Moreover, the overexpression of miR-133b led to a significant reduction in HOXA9 expression (Figure 4C). [score:5]
Figure 4 (A) miR-133b targeting genes and the corresponding mutations. [score:4]
MiR-133b decreased ZEB1 expression by targeting HOXA9 in CRC cells. [score:4]
It is recognized that miR-133b was usually downregulated in various types of human cancer, such as esophageal squamous cell carcinoma [20], glioma [21], bladder cancer [22], non-small cell lung cancer [23], prostate cancer [24, 25], gastric cancer [26] and even colon cancer [27]. [score:4]
The luciferase assays unveiled that the overexpression of miR-133b significantly decreased the luciferase reporter, which showed that miR-133b interfered the expression of HOXA9 by binding the 3′ UTR of HOXA9 (Figure 4B). [score:4]
Mechanistically, we distinguished HOXA9 as a direct and practical target of miR-133b. [score:4]
MiR-133b Suppresses CRC Development and Metastasis In VivoTo further investigate the role of miR-133b in CRC development and metastasis in vivo, HCT8/HCT116-miR-133b cells or control cells were injected into nude mice through the subcutaneous injection. [score:3]
These results revealed a significant contribution of higher miR-133b expression to better CRC patient outcomes and indicated that miR-133b was an independent and significant prognostic factor for CRC patients. [score:3]
We further examined miR-133b expression in a group of human CRC cell lines and a normal cell line. [score:3]
The overexpression of miR-133b significantly repressed the proliferation of CRC cells (Figure 2B, 2C). [score:3]
MiR-133b mimic, inhibitor and negative control (miR-NC) were designed and synthesized by RiboBio (Guangzhou, China). [score:3]
Besides, externally induced expression of miR-133b significantly hindered CRC cell proliferation and invasion in vitro and in vivo. [score:3]
Figure 3MiR-133b suppresses CRC tumorigenesis and metastasis in vivoHCT8 and HCT116 cells were transfected with miR-133b -mimic or scramble and then subcutaneously injected into nude mice. [score:3]
To illustrate the mechanism of metastasis for miR-133b and HOXA9, we checked the expression of several metastatic markers. [score:3]
We further found that decreased expression of miR-133b in CRC is crucial in the achievement of an advancing and poor prognostic phenotype. [score:3]
Interestingly, The HCT116 and HCT8 cells, which possess high metastatic capacities, expressed the lowest levels of miR-133b. [score:3]
HEK-293T cells were transfected with the reporter vector containing the WT or or mutant target site of the HOXA9 3′-UTR or a control reporter vector with Lipofectamine 2000 and then co -transfected with miRNA miR-133b -mimics or a Scramble control. [score:3]
HOXA9 was identified as miR-133b targets in CRC. [score:3]
MiR-133b was overexpressed in CRC cell lines by using miR-133b mimic (scramble or miR-133b). [score:3]
Multivariate analysis further demonstrated that, like AJCC stage, differentiation and metastasis, low miR-133b expression was an independent and significant risk factor of overall survival for CRC patients (hazard ratio, 2.977; 95% CI, 1.622-5.283; P < 0.001; Table 2). [score:3]
The bioinformatics algorithm TagetScan was applied to predict HOXA9 as a putative target for miR-133b, which might take part in the progress of in CRC (Figure 4A). [score:3]
The levels of miR-133b were inversely connected with the expression of HOXA9 in the CRC tissues. [score:3]
MiR-133b and HOXA9 might be useful indicators for CRC patient outcomes, and the miR-133b/HOXA9/ZEB1 pathway might be a promising therapeutic target for CRC treatment. [score:3]
MiR-133b Suppresses CRC Development and Metastasis In Vivo. [score:3]
A decrease of miR-133b in the 10 CRC tissues with metastasis was also remarked compared to primary tumors without metastasis (Figure 1C), which proposed that the down-regulation of miR-133b was strictly related to the progression of CRC metastasis. [score:3]
Our findings revealed the crucial roles of miR-133b and its target-HOXA9, in the administration of CRC progress and implemented new latent candidates for CRC therapy. [score:3]
MiR-133b directly targets HOXA9 in CRC cells. [score:3]
MiR-133b is downregulated in CRC tumor samples and cell lines. [score:3]
In summary, restoring miR-133b could inhibit the proliferation and migration of CRC cells in vitro. [score:3]
In this study, we announced that miR-133b is significantly downregulated in CRC samples and cell lines compared to normal controls. [score:3]
high) 2.573 1.323-5.423 0.015 Metastasis 3.675 2.035-5.269 0.000 MiR133b expression (low vs. [score:2]
The results revealed that miR-133b expression was significantly lower in CRC tumor tissues compared to adjacent normal tissues (Figure 1C). [score:2]
MiR-133b is lower expressed in CRC tissues. [score:2]
Like the data collected from the CRC clinical samples, miR-133b was lower expressed in all of the CRC cell lines compared to the normal cell line (Figure 1D). [score:2]
MiR-133b suppresses CRC tumor proliferation and migration in vitro. [score:2]
MiR-133b suppresses CRC tumorigenesis and metastasis in vivo. [score:2]
high) 1.257 1.029-4.269 0.042 Metastasis 3.922 1.273-6.672 0.000 MiR133b expression (low vs. [score:2]
HCT8 and HCT116 cells were transfected with miR-133b -mimic or scramble and then subcutaneously injected into nude mice. [score:1]
Prognostic significance of miR-133b and HOXA9 in CRC patients. [score:1]
Rescue experiments further proves the miR-133b - HOXA9 /ZEB1 pathway to reduce tumor metastasis. [score:1]
Low level of miR-133b and high level of HOXA9 predicted poor prognosis in colorectal cancer patients. [score:1]
To further evaluate the clinical significance of the miR-133b/HOXA9 axis in CRC, we determined miR-133b and HOXA9 expression levels in 66 CRC patients. [score:1]
Transwell assays implied that miR-133b dramatically suppressed the migration of HCT116 and HCT8 cells when compared to the control groups (Figure 2D). [score:1]
However, little is known about the role of miR-133b in mediating the proliferation and invasion of CRC and the underlying mechanism. [score:1]
Notably, there was a trend toward a better OS in the patient group with miR-133b+ and HOXA9- than that in the patient group with miR-133b- and HOXA9+ tumors (P<0.001) (Figure 7C). [score:1]
Rescue experiments validated the miR-133b - HOXA9 /ZEB1 pathway. [score:1]
The mRNA relationship between miR-133b and HOXA9 was analyzed by Pearson's correlation. [score:1]
In conclusion, we newly identified miR-133b/HOXA9/ZEB1 as an important signaling pathway that governed CRC metastasis. [score:1]
Figure 7 (A) overall survival (OS) rates of miR-133b in 66 patients by Kaplan–Meier analysis with log-rank test (**P < 0.001). [score:1]
The numbers of hepatic metastatic nodules were significantly lower in the miR-133b group than were those in the scramble group (Figure 3D, 3E). [score:1]
MiR-133b mimic or miR-NC was transfected into HCT8 and HCT116 cells using Lipofectamine 2000 (invitrogen) according to the manufacturer's protocol. [score:1]
Importantly, miR-133b was negatively associated with metastasis and poor prognosis and could be an independent indicator for CRC patient outcome. [score:1]
Co-transfection of a wildtype or a mutant HOXA9 3′UTR with miR-133b mimics into HEK 293 cells. [score:1]
To further determine the effect of miR-133b on metastasis in vivo, cells were inoculated via the portal circulation to assess metastatic activity upon hematogenous arrival in the liver. [score:1]
To validate the prediction, luciferase reporter constructs taking the 3′UTR miR-133b potential binding site or mutant binding sites of HOXA9 were constructed and co -transfected with miR-133b or a vector into HEK-293T cells. [score:1]
[1 to 20 of 83 sentences]
5
[+] score: 297
The average expression levels of miR-133a, miR-133b and miR-208b in osteosarcoma tissues were significantly down-regulated, while the average miR-645 expression was significantly up-regulated ([**], p≤0.01). [score:11]
In addition, miR-133b over -expression increased apoptosis of OS cells through down-regulation of anti-apoptotic molecules BCL2L2, MCL-1 expression. [score:8]
However, although studies including expression restoration and antisense specific knockdown of miR-133b have unraveled many aspects of its function and targets in muscle development, little evidence reveal its role in the development of sarcoma, especially in osteosarcoma. [score:8]
In addition, ectopic expression of miR-133b in colorectal cancer not only decreases MET expression, but also inhibits cell proliferation and induces apoptosis by G [1]-phase arrest in vitro and in vivo [36]. [score:7]
These findings indicate that miR-133b is down-regulated in several tumors including osteosarcoma, acting as a tumor suppressor gene in osteosarcoma by regulating survival, cell cycle, cell proliferation, invasion and migration. [score:7]
In addition, over -expression of miR-1 and miR-133b inhibits osteosarcoma cell proliferation and invasion through cell cycle arrest and decreasing MET expression [18]. [score:7]
We provide a new insight in molecular therapy of osteosarcoma by over -expressing miR-133b expression, since miR-133b exhibits potent tumor suppressive activities. [score:7]
We found that both invading and migrating miR-133b over-expressed U2-OS and MG-63 cells greatly decreased (Figure 5, left), and both percent invasion and percent migration of miR-133b over-expressed OS cells were also significantly decreased in comparison to those of miR -null over-expressed cells (p≤0.05) (Figure 5, right). [score:7]
Over -expression of miR-133b in osteosarcoma cell lines U2-OS and MG-63 led to the inhibition of cell proliferation, migration, invasion through decreasing the expression of IGF1R, MET, phospho-Akt and FAK. [score:7]
The miR-133b targets epidermal growth factor receptor (EGFR) and ectopic expression of miR-133b inhibits cell proliferation, migration and invasion in prostate cancer cell lines [13]. [score:7]
Compared with cells expressing miR -null, U2-OS cells with stable miR-133b expression exhibited decreased cell proliferation in 48, 72 and 96-hour incubation, while cell proliferation of MG-63 cells with stable miR-133b expression was decreased in 72 hours. [score:6]
These indicate that miR-133b play a role as a tumor suppressor gene in osteosarcoma through inhibiting PI3K/Akt signaling and down -regulating several anti-apoptotic molecules and oncogenes such as BCL2L2, MCL-1, IGF1R, MET, and FAK. [score:6]
0083571.g004 Figure 4(A) Over -expression of miR-133b in osteosarcoma cell lines U2-OS and MG-63 inhibited cell proliferation. [score:5]
Evidence shows that over -expression of miR-133b also reduces the expressions of both BCL2L2 and MCL-1 and induces apoptosis in lung cancer cell lines [12]. [score:5]
Over -expression of miR-133b in osteosarcoma cell lines U2-OS and MG-63 decreases the expression of BCL2L2, MCL-1, IGF1R, MET and FAK, leading to the inactivation of Akt. [score:5]
In summary, miR-133b expression is significantly decreased in human osteosarcoma samples and is a potential tumor suppressor gene. [score:5]
showed that compared with normal bones, miR-133a and miR-133b expression were significantly down-regulated in paraffin-embedded osteosarcomas (p≤0.01), being consistent with results in frozen osteosarcoma samples. [score:5]
31.81% of MG-63 cells with miR-133b over -expression displayed apoptosis, whereas only 0.26% of MG-63 cells with miR -null over -expression underwent apoptosis (p≤0.05). [score:5]
To investigate the effect of miR-133b over -expression on the expression of target genes in osteosarcoma cells, as well as to study the molecular mechanism how miR-133b influences the phenotype of osteosarcoma cell, we measured the expression of BCL2L2, MCL-1, IGF1R, MET, phospho-Akt, PTEN and FAK using. [score:5]
Furthermore, the expression of phospho-Akt and FAK was also reduced in miR-133b over-expressed cells (Figure 6B). [score:5]
In addition, miR-133b over -expression in OS cells also decreased the expression of IGF1R and MET, which are the members of receptor tyrosine kinases (RTKs), leading to the decreased phosphorylation of Akt. [score:5]
MiR-133b down-regulates the expression of BCL2L2, MCL-1, IGF1R, MET, phospho-Akt and FAK. [score:5]
The western blotting results showed that over -expression of miR-133b decreased the expression of BCL2L2, MCL-1, IGF1R and MET in osteosarcoma cells U2-OS and MG-63 (Figure 6B). [score:5]
BCL2L2, MCL-1, IGF1R and MET were predicted as the target genes of miR-133b through TargetScan database (Figure 6A). [score:5]
The decreased expression of miR-133a and miR-133b in paraffin-embedded osteosarcoma was consistent with those in frozen osteosarcoma samples ([**], p≤0.01), whereas the increased expression of miR-645 was not obviously observed (p≥0.05). [score:5]
Location of predicted 3′UTR target sites for miR-133b in BCL2L2, MCL-1, IGF1R and MET is presented based on TargetScan 6.2. [score:5]
After 48, 72 and 96-hour incubation, osteosarcoma cells U2-OS with stable miR-133b expression exhibited decreased cell proliferation (p≤0.05), whereas MG-63 cells over-expressed miR-133b displayed reduced cell proliferation in 72-hours incubation (p≤0.05) (Figure 4A). [score:5]
The top down-regulated miRNAs (miR-1, miR-30a, miR-133a, miR-133b, miR-208b and miR-378c) and up-regulated miRNAs (miR-338-5p, miR-663b, miR-645 and miR-3663-5p) are listed in Table 2 and 3. To confirm the results of miRNA microarray assay, SYBR Green qRT-PCR was performed using the RNAs from five human osteosarcoma and three normal muscle samples in miRNA microarray assay as templates. [score:5]
We found that miR-133a, miR-133b and miR-208b expressions significantly decreased in osteosarcomas (p≤0.01) while miR-645 expression significantly increased (p≤0.01) (Figure 2). [score:5]
The average relative expression level of miR-133b in paraffin-embedded normal bones was 19.29, whereas the average relative expression level of miR-133a in paraffin-embedded normal bones was only 0.07. [score:5]
showed that expression of BCL2L2, MCL-1, IGF1R, MET, phospho-Akt and FAK were significantly decreased in miR-133b over-expressed osteosarcoma cell lines U2-OS and MG-63. [score:5]
We found that over -expression of miR-133b in osteosarcoma cell lines U2-OS and MG-63 suppressed cell proliferation, migration and invasion, and induced apoptosis. [score:5]
0083571.g005 Figure 5(A) and (B), over -expression of miR-133b suppressed cell invasion and migration in U2-OS and MG-63 cells. [score:5]
Compared to non -treated U2-OS cells or cells with miR -null expression, both percent invasion and percent migration of miR-133b over-expressed U2-OS and MG-63 cells were significantly decreased ([*], p≤0.05; [**], p≤0.01). [score:4]
Further, to better understand the mechanisms how miR-133b regulates cellular phenotypes of osteosarcoma cells, we first measured the expression of BCL2L2, MCL-1, IGF1R and MET, which are identified as the target genes of miR-133b in several cancers [12], [36], [37]. [score:4]
Studies also show that miR-133b is significantly down-regulated in several cancers such as gastric cancer, colorectal cancer, bladder cancer, prostate cancer and lung cancer [9]– [13], [35]. [score:4]
Evidence reveals that miR-133b is specifically expressed in muscle tissues and plays an important role in muscle development, myocardial differentiation and cardiac hypertrophy [7], [31]– [34]. [score:4]
The qRT-PCR results showed that compared with non -treated OS cells and OS cells transfected with control vector miR -null, miR-133b was significantly over-expressed in U2-OS and MG-63 cells with stable pre-miR-133b expression (Figure S1 in File S1). [score:4]
In addition, miR-133b expression is decreased in gastric cancer, colorectal cancer, bladder cancer, prostate cancer and lung cancer, indicating that miR-133b plays an important role in tumorigenesis and cancer progression [9]– [13]. [score:3]
In addition, no correlation between the histological subtypes of osteosarcoma and the expression of miR-133a or miR-133b was found in our study. [score:3]
To determine the phenotype of miR-133b over -expression in the growth and survival of osteosarcoma cell lines U2-OS and MG-63, cell proliferation and apoptosis were evaluated among miR-133b stably-expressed cells, non -treated cells and cells transfected with control vector. [score:3]
Although miR-133a and miR-133b locate on the different chromosomal regions of human genomes, they share several target genes such as BCL2L2, IGF1R MCL-1 and MET, since they are only distinguished by a single nucleotide at the 3′-end. [score:3]
Over -expression of miR-133b in osteosarcoma cell lines U2-OS and MG-63. [score:3]
U2-OS or MG-63 cells were transfected with either miR-133b precursor expression vector or pEGP-miR -null control vector, and stable clones were selected with puromycin. [score:3]
Cells with positive miR-133b expression were visualized and examined by the fluorescence microscope after 48-hour incubation (Left; A, magnification: ×40; B, magnification: ×100). [score:3]
We also found that the expression level of miR-133b in paraffin-embedded normal bones was higher than those of miR-133a (Figure 3). [score:3]
In this study, the expression levels of miR-133a and miR-133b were confirmed to be reduced significantly in both frozen and paraffin-embedded osteosarcoma samples. [score:3]
Similar results are also reported in Novello's study, which demonstrates the decreased miR-1 and miR-133b expression in osteosarcoma cell lines and clinical samples [18]. [score:3]
A study also identifies that miR-1/miR-133a and miR-206/miR-133b clusters are down-regulated in several osteosarcoma cell lines compared with normal bones, which is consistent with our findings [17]. [score:3]
We firstly over-expressed the miR-133b in U2-OS and MG-63 cells, and stable tranfectants were selected by puromycin. [score:3]
Among the 43 differentially expressed miRNAs, a part of miRNAs such as miR-1, miR-26a, miR-30a, miR-30b miR-133a, miR-133b and miR-224, are found to play a key role in cancers, whereas some miRNAs are not reported [20]– [26]. [score:3]
Construction and transfection of miR-133b precursor expression vector. [score:3]
0083571.g006 Figure 6 (A) BCL2L2, MCL-1, IGF1R and MET are predicted as the target genes of miR-133b. [score:3]
In addition, U2-OS and MG-63 cells with stable miR-133b expression displayed higher early apoptosis (Figure 4B). [score:3]
Validated by quantitative real-time PCR (qRT-PCR), miR-133b expression was confirmed to be significantly decreased in both frozen and paraffin-embedded osteosarcoma samples. [score:3]
Novello et al. found that 12 miRNAs including miR-1, miR-133b and miR-378 were differentially expressed in high-grade and low-grade OS [18]. [score:3]
Confirmation of miR-133a, miR-133b and miR-645 expression in paraffin-embedded human osteosarcoma samples (P-OS) using SYBR Green qRT-PCR. [score:3]
However, the expression and functional roles of miR-133b in osteosarcoma are unknown yet. [score:3]
MiR-133b may be regarded as a promising biomarker and gene therapy target for osteosarcoma treatment. [score:2]
As described above, compared with miR-133a, miR-133b is a more promising candidate to develop novel targets of osteosarcoma therapy. [score:2]
MiR-133b suppresses osteosarcoma cells invasion and migration. [score:2]
MiR-133b decreases the expression of BCL2L2, MCL-1, IGF1R, MET, phospho-Akt and FAK. [score:2]
MiR-133b expression is decreased in paraffin-embedded osteosarcoma samples. [score:2]
MiR-133b inhibits osteosarcoma cell proliferation and induces apoptosis. [score:2]
Therefore, to increase the chance to get the meaningful results in functional studies, we focused on miR-133b in the following studies. [score:1]
Confluent monolayer OS cells with positive green fluorescence were observed in stable transfectants of either pre-miR-133b vector or control vector (Figure S1 in File S1). [score:1]
MiR-133b is a member of miR-133 family and known as a muscle-specific miRNA, mediating myoblasts proliferation and differentiation [7]. [score:1]
The pEGP-miR-133b vector and pEGP-miR -null control vector were transfected to osteosarcoma cells and stable clones were selected by puromycin. [score:1]
The miR-133b precursor (pre-miR-133b) was inserted into an enzyme site of the vector. [score:1]
Roles of miR-133b in invasion and migration of osteosarcoma cell lines. [score:1]
However, results showed that the miR-133a mimic did not significantly decrease cell proliferation and migration of OS cells as miR-133b (Figure S3 in File S1). [score:1]
Recently, miR-133b is also identified in muscle-derived sarcomas [8]. [score:1]
For further validation of our microarray results, eighteen paraffin-embedded human osteosarcoma samples and two normal bones obtained from patients P-OS-4 and P-OS-10 were employed to evaluate the expression level of miR-133a, miR-133b and miR-645 by qRT-PCR. [score:1]
However, the biological roles of miR-133b in osteosarcoma growth and invasion are not clear yet. [score:1]
Roles of miR-133b in cell proliferation and apoptosis of osteosarcoma cell lines. [score:1]
Relative expression of miR-133b in osteosarcoma cells U2-OS and MG-63 was evaluated by qRT-PCR with total RNAs isolated from the indicated cells (n = 3; [**], p≤0.01). [score:1]
[1 to 20 of 76 sentences]
6
[+] score: 263
Other miRNAs from this paper: hsa-mir-17, hsa-mir-125b-1, hsa-mir-125b-2
Briefly, expression status of potential miR-133b target genes were determined by Oncomine database analysis and those which were reported to be upregulated in HNSCC (inverse to miR-133b underexpression) were selected. [score:10]
miR-133b remains downregulated in head and neck, bladder, colorectal, gastric, lung and prostate cancers while it is upregulated in cervical cancer [26]. [score:7]
Overall, these results prove that miR-133b binds to the NUP214 3′UTR and specifically downregulates its expression. [score:6]
Nucleoporin Nup214 miR-133b Mitosis Apoptosis Cell cycle MicroRNA Cancer Head and neck cancer Chromosomal abnormality MicroRNAs (miRNA) are endogenous, non-coding RNAs that direct gene repression by inhibiting the mRNA stability or translation [1]. [score:6]
Of these, NUP214 was observed to be a potential target of hsa-miR-133b, a downregulated miRNA in HNSCC. [score:6]
In summary, (1) the nucleoporin gene NUP214 is a novel target of miR-133b, (2) Nup214 downregulation brings about early mitotic delay and (3) this delay gives rise to chromosomal segregational defects and eventual cell death. [score:6]
Our results hence attempt to explain why miR-133b is generally downregulated in tumours and lay out the potential for Nup214 as a therapeutic target in the treatment of cancer. [score:6]
Figure 1 miR-133b targets NUP214 and their expressions are inversely related. [score:5]
Notably, because Nup214 lacks its 3′UTR in the expression-vector, co -expression with miR-133b did not alter Nup214’s ability to change the cellular phenotype. [score:5]
The relative expression table reveals a median ~300 fold decrease in miR-133b and ~7 fold increase in Nup214 expressions (Additional file 3). [score:5]
In vitro, Nup214 was significantly downregulated by ectopic miR-133b. [score:4]
Similarly, our study too, has shown chromosome defects upon Nup214 downregulation by miR-133b- particularly some which appear like “flower cells” with greatly lobulated nuclei (Figure  5a, 2 [nd] row, 12 h time-point) as described by the same authors [30]. [score:4]
We also show that downregulation of Nup214 by miR-133b perturbs the normal mitotic progression. [score:4]
miR-133b binds to the NUP214 3′UTR and negatively regulates its expression. [score:4]
Figure 3 miR-133b perturbs mitotic timing by downregulating Nup214. [score:4]
miR-133b has been reported to be downregulated in several SCC cell lines [25]. [score:4]
The present study further illustrates that the miR-133b -mediated Nup214 downregulation delays cells in the early mitotic phase and thus leads to aberrant chromosome segregation and cell death. [score:4]
Further, specificity of this mitotic regulation mediated by miR-133b was proved by the observation that rapid degradation of cyclinB1 could be reconstituted by ectopic Nup214 expression even in the presence of miR-133b (Figure  3c, right panel and d). [score:4]
However, it is crucial to bear in mind that miR-133b has other known and unknown targets across the cell cycle whereas NUP214 regulation could also be controlled by hitherto un-validated miRNAs. [score:4]
In fact, given that miR-133b is downregulated in HNSCC (and many other cancers), our study has significant therapeutic implications- (1) miR-133b mimics could potentially be used to alleviate the oncogenic effects of endogenous Nup214 that lead to malignancies, (2) molecules other than miRNA mimics such as small molecules, nanoparticles or other silencing RNAs could also be used against Nup214. [score:4]
In our attempt to uncover the downstream functional effects of Nup214 downregulation by miR-133b, we also observed a similar G2-M arrest in cells overproducing miR-133b by flow cytometric analysis. [score:4]
Data represents three independent experiments and shown as average ± S. D. Finally, we examined the phenotypic consequence of the miR-133b -mediated Nup214 downregulation and the following mitotic disturbances by studying its effect on the clonogenicity of UPCI:SCC084 cells. [score:4]
It should be mentioned though that in colorectal cancer, miR-133b has been shown to block cell proliferation by directly targeting the c-MET protein [34]. [score:4]
Hence, these results further bolstered our hypothesis that miR-133b arrests cells in early mitosis probably by disturbing the import/export of some crucial mitotic factor through the downregulation of Nup214. [score:4]
Importantly, incidence of both chromosomal defects as well as apoptosis was greatly reduced upon co -expression of Nup214 along with miR-133b or the siRNA. [score:3]
Moreover, similar to the observations with cyclinB1, here too, ectopic expression of Nup214 along with miR-133b was able to reconstitute the cyclic pattern of cyclinA (Figure  3c, right panel and f). [score:3]
Additional file 1: NUP214 is a putative target of miR-133b. [score:3]
The pathological history of the tumours is provided in Additional file 4. Target prediction of miR-133b was done by miRBase (version 17). [score:3]
GraphPad Prism 5 was used to perform Mann Whitney t-test in order to determine significant differences in miR-133b and NUP214 expressions between individual groups (normal and tumour). [score:3]
To further fortify these findings, we also co -transfected UPCI:SCC084 cells with an anti-sense inhibitor against miR-133b along with the miRNA and pSB-NUP214/3′UTRLuc. [score:3]
In contrast, upon ectopic miR-133b expression cyclinB1 did not degrade even at 12 h post-release implying that the cells were yet to exit from mitosis (Figure  3c, middle panel and d). [score:3]
miR-133b and NUP214 expressions were validated in cancer cell lines and tissues by Real-Time PCR. [score:3]
Additional file 5: miR-133b targets NUP214 specifically. [score:3]
Similarly, the pooled data from ten HNSCC tissue samples demonstrated that indeed, miR-133b and Nup214 expressions are inversely related in these samples (Figure  1c). [score:3]
Besides, ectopic expression of Nup214 along with miR-133b was also able to revoke the rise in chromosomal aberrations that was observed in presence of miR-133b alone, thus establishing the specificity of our results (Figure  5a, 3 [rd] row and b). [score:3]
Examination of head and neck tumour tissues and cancer cell lines revealed that Nup214 and miR-133b expressions are negatively correlated. [score:3]
This also indicates that other known targets of miR-133b (like CXCR4 [29]) might not play any role in the NUP214 -mediated phenotype observed here. [score:3]
These results together demonstrate that excess miR-133b arrests the cells in mitosis by suppressing the Nup214 levels. [score:3]
miR-133b and Nup214 expression levels are negatively correlated in cancer cell lines and primary HNSCC tissue samples. [score:3]
Databases/bioinformatic tools such as miRBase, Oncomine and RNAhybrid predicted Nup214 as a miR-133b target. [score:3]
Pathological details of these samples can be found in Additional file 4. In order to establish NUP214 as a bona fide target of miR-133b, we transfected UPCI:SCC084 cells with different doses of miR-133b expression-plasmid and measured NUP214 both at the mRNA and protein levels. [score:3]
Interestingly, Nup214 co -expression was able to prevent apoptosis by miR-133b alone in both the above experiments (Figure  6c-e). [score:3]
Through an in silico prediction for a number of miRNAs by miRBase, we had shown that NUP214 is a putative target of miR-133b [20]. [score:3]
As expected, miR-133b was not available to bind to its target site on the NUP214 3′UTR and for this reason, was unable to restrain the luciferase activity (Figure  2e). [score:3]
Furthermore, miR-133b has been shown to target anti-apoptotic genes to mediate death-receptor -induced apoptosis [28]. [score:3]
Preliminarily, we began with testing and reconfirming that miR-133b expression is indeed low in two SCC cell lines UPCI:SCC084 and SCC25 than in normal oral epithelial cells (Figure  1a). [score:3]
In the current study, we present NUP214 as a novel target of miR-133b. [score:3]
Similarly, Nup214 also declined at the protein level upon ectopic miR-133b expression (Figure  1e and Additional file 5B). [score:3]
We have identified NUP214, a member of the massive nuclear pore complex, as a novel miR-133b target. [score:3]
At this point, it is worth mentioning that owing to the absence of the 3′UTR recognition site for miR-133b in the Nup214 expression-plasmid, Nup214 is able restore the original phenotype even in presence of the miRNA. [score:3]
Importantly, from our observations we make an intriguing hypothesis that the import of one or more mitotic proteins (that is/are cell cycle regulated) may be dependent on the levels of Nup214 and hence, on the levels of miR-133b. [score:2]
A strong corroboration for these results was achieved when on one hand, specific knockdown of Nup214 in UPCI:SCC084 cells with a pool of siRNAs (Figure  7a and b) gave the same phenotype for cell death as was seen with miR-133b (Figure  7c-f). [score:2]
We thus selected the UPCI:SCC084 and HCT116 cell lines to study the possible role of miR-133b in NUP214 regulation. [score:2]
Figure 7 NUP214 knockdown by siRNAs attests miR-133b -induced phenotypes. [score:2]
We observed that the NUP214 transcript levels decreased in consonance with the increasing doses of the miRNA indicating that miR-133b regulates NUP214 at the post-transcriptional level (Figure  1d and Additional file 5A). [score:2]
Collectively, these data confirm that miR-133b induces chromosomal abnormalities in a Nup214-specific manner. [score:1]
Figure 4 miR-133b modulates mitotic timing. [score:1]
Figure 2 Binding of miR-133b to NUP214 is specific. [score:1]
The above results fostered the idea that some mitotic factor essential to cell cycle progression may be unable to enter the nucleus in presence of ectopic miR-133b and consequent absence of or low Nup214. [score:1]
Additionally, this pattern of cyclinA degradation, stabilization by miR-133b and rescue by Nup214 was reproduced in HCT116 cells once again (Figure  3g and j). [score:1]
Anti miR-133b (Ambion, Austin, TX, USA) was used at a final concentration of 20 nM. [score:1]
The accumulation of cyclinA in miR-133b treated synchronised cells was also able to prove an early mitotic arrest. [score:1]
In comparison, 48.44% of cells over-producing miR-133b were in G2/M at 8 h from release, and remained insignificantly changed (39.7%) even at 10 h post-release (Figure  3a and b, lower panels). [score:1]
UPCI:SCC084 cells were transiently transfected with 0, 0.25, 0.5, 1 and 2 μg of pSB-miR-133b. [score:1]
105 HEK293 cells were transiently transfected with 0 and 1 μg of pSB-miR-133b. [score:1]
UPCI:SCC084 cells were transiently transfected with 0 and 1 μg pSB-miR-133b. [score:1]
UPCI:SCC084 cells were transiently transfected with only pSB-NUP214/3′UTRLuc (0.5 μg), or with pSB-NUP214/3′UTRLuc (0.5 μg) and pSB-miR-133b (1 μg), or with pSB-NUP214/3′UTRLuc (0.5 μg), pSB-miR-133b (1 μg) and anti-miR-133b (20 nM). [score:1]
Additional file 7: Excess miR-133b does not modulate cell fate of non-tumoral cells. [score:1]
According to our observations, the former seems to be more plausible, stemming from the fact that cyclinA, cyclinB1 and p-H3 are stabilized upon Nup214 repression by miR-133b. [score:1]
In accord, a dose -dependent decrease in luciferase activity was observed for the 3′UTR containing the wild type miR-133b recognition site (Figure  2b). [score:1]
Collectively, these results confirm our view that cells are rendered non-viable by miR-133b in a Nup214-specific manner. [score:1]
We next hypothesised that miR-133b might give birth to chromosomal abnormalities as a consequence of the mitotic arrest. [score:1]
This indicated that miR-133b might reduce cell viability, probably in part, due to the enhancement of chromosomal abnormalities following the mitotic progression defects shown before. [score:1]
Toward this, we used three different strategies to examine the effect of ectopic miR-133b on the cell cycle progression of UPCI:SCC084 cells synchronized by thymidine treatment and released from G1 block. [score:1]
All these cellular effects of miR-133b appear to be Nup214-specific. [score:1]
We have validated here that the human miR-133b can specifically repress the nucleoporin proto-oncogene NUP214. [score:1]
The results illustrated that in cells treated with miR-133b, mitosis remained blocked (Figure  4c, middle row and Additional file 6B) even as vector -treated (Figure  4c, top row and Additional file 6A) and Nup214-reconstituted cells (Figure  4c, bottom row and Additional file 6C) proceeded to anaphase and further, within 1 h of monitoring. [score:1]
Flow cytometry and immuno-blots of mitotic markers were used to analyse cell cycle pattern upon thymidine synchronization and miR-133b treatment. [score:1]
UPCI:SCC084 (c) and HCT116 (g) cells were transiently transfected with empty vector (1 μg), pSB-miR-133b (1 μg), or pSB-miR-133b (1 μg) and pCMV-Myc-CAN/Nup214 (1 μg), and synchronized. [score:1]
In silico analysis predicts miR-133b binding site on NUP214 3′UTR. [score:1]
In view of the fact that we were interested in identifying miRNA -mediated regulatory pathways in mitosis, and also because the regulation of mitotic proteins at the import/export level is crucial, we initially investigated whether Nup214 repression by miR-133b could affect the cell cycle/mitotic progression. [score:1]
Indeed, we found that while for vector -transfected UPCI:SCC084 cells cyclinA levels peaked at 4 h post-release (Figure  3c, left panel and f), ectopic miR-133b seemed to bring about the stabilization of the protein till around the 10 h time-point (Figure  3c, middle panel and f). [score:1]
P-H3 immuno-staining in these abnormal chromosomes gave further credence that it is the miR-133b -mediated mitotic perturbation that induces chromosomal aberrations. [score:1]
UPCI:SCC084 cells were transiently transfected with 0, 0.25, 0.5, 1 and 2 μg pSB-miR-133b. [score:1]
UPCI:SCC084 cells were transiently co -transfected with 0.5 μg pSB-NUP214/3′UTRLuc and 0, 0.25, 0.5, 1 or 2 μg of pSB-miR-133b. [score:1]
More importantly, the preliminary observation that ectopic miR-133b does not alter the fate of non-tumoral cells also makes it a good therapeutic candidate. [score:1]
We too, observed ectopic miR-133b as well as Nup214 siRNA -mediated induction of apoptotic cell death in UPCI:SCC084 cells. [score:1]
UPCI:SCC084 cells were seeded at a density of 10 [3] and transiently transfected with 0, 0.25, 0.5, 1 and 2 μg pSB-miR-133b. [score:1]
HEK293 cells were seeded at a density of 103 and transiently transfected with 0 and 1 μg of pSB-miR-133b. [score:1]
The RNA strand in green represents miR-133b and the RNA strand in red represents position 9-36 of NUP214 3′UTR. [score:1]
Figure 5 Excess miR-133b enhances chromosomal abnormalities. [score:1]
miR-133b is reported in death-receptor -induced apoptosis in HeLa cells and ex vivo mo dels of pancreatic cancer [28]. [score:1]
According to our results, after a week, the miR-133b overproducing cells gave rise to significantly less number of colonies than those formed by vector -transfected cells (Figure  6a and b). [score:1]
We also supplemented our results with time-lapse monitoring of live Hela-H4-pEGFP cells transfected with miR-133b. [score:1]
Indeed, RNAhybrid analysis revealed that the 3′UTR of NUP214 has a miR-133b recognition site at position 9 to 36 (Additional file 1A and B). [score:1]
Third, we scored the mitotic indices (MI) of HCT116 cells treated with miR-133b based on the p-H3-FITC positive signal. [score:1]
UPCI:SCC084 cells were transiently transfected with 1 μg pSB-miR-133b or empty vector, synchronized and harvested at 0, 4, 6, 8 and 10 h from second thymidine release. [score:1]
Tsuchiya H, Wang L. MIR133B (microRNA 133b). [score:1]
Complementarity between NUP214-3′UTR and the seed sequence of miR-133b was obtained from RNAhybrid (version 2.1) [36] (http://bibiserv. [score:1]
Moreover, the observation that the levels of another unrelated Nup, Nup98 that does not carry a recognition site for miR-133b, remained unaffected by miR-133b confirmed the specificity of this interaction (Additional file 5C). [score:1]
Additionally, the mitotic gene BUB1 (does not have a recognition-site for miR-133b) also remained unchanged upon miR-133b transfection which further strengthened this specificity (Additional file 5D-F). [score:1]
10 [5] UPCI:SCC084 cells were transiently transfected with empty vector (1 μg), pSB-miR-133b (1 μg), or pSB-miR-133b (1 μg) and pCMV-Myc-CAN/Nup214 (1 μg). [score:1]
To find out whether this possible mitotic cargo of Nup214 functions in the early or late mitotic phase, we followed the levels of cyclinA (whose degradation is an early mitotic marker) in synchronized UPCI:SCC084 as well as HCT116 cells transfected with miR-133b. [score:1]
miR-133b -mediated mitotic defects leads to cell death via apoptosis. [score:1]
Similarly, cyclinB1 and p-H3 were found to be stabilized by miR-133b and their degradation and dephosphorylation, respectively, were rescued by Nup214 in HCT116 cells as well (Figure  3g, h and i). [score:1]
UPCI:SCC084 cells were co -transfected with either 0.5 μg pSB-NUP214/3′UTRLuc, or pSB-NUP214/3′UTRMutLuc along-with 0 or 1 μg pSB-miR-133b. [score:1]
Nup214 repression by ectopic miR-133b retards mitotic progression. [score:1]
Our results indicate that there is an elevation in caspase3 activation about 72 h post miR-133b transfection in comparison to vector -treated cells at the same time point (Figure  6e). [score:1]
Additional file 6: miR-133b -mediated Nup214 repression lengthens mitotic duration. [score:1]
Figure 6 miR-133b -mediated mitotic delay leads to cell death. [score:1]
miR-133b -induced disturbance in mitotic progression causes chromosomal abnormalities. [score:1]
The cloning of pSB-miR-133b (human precursor miR-133b; chromosome 6: 52011721–52015839, + strand) is described by Bhattacharjya et al. [20]. [score:1]
[1 to 20 of 112 sentences]
7
[+] score: 231
D. The relative expression of PCNA in human Sertoli cells at day 3 after transfection of miR-133b mimics to miRNA mimics control and miR-133b inhibitor to miRNA inhibitor control after normalization to the signals of their loading control. [score:7]
revealed that the expression of PCNA was obviously increased by miR-133b mimics (1.285±0.159) compared to miRNA mimic control (designed as 1.0) in human Sertoli cells whereas its expression was significantly decreased by miR-133b inhibitor (0.822±0.055) when compared with miRNA inhibitor control (designed as 1.0) in human Sertoli cells (Figure 5C-5D). [score:7]
The relative expression of Cyclin B1 and Cyclin D1 in human Sertoli cells at 72 hours after transfection of miR-133b mimics to miRNA mimics control and miR-133b inhibitor to miRNA inhibitor control after normalization to the signals of their loading control (middle and low panels). [score:7]
C. revealed that PCNA expression in human Sertoli cells at day 3 after transfection of miRNA mimics control, miR-133b mimics, miRNA inhibitor control, and miR-133b inhibitor. [score:7]
D. demonstrated GLI3 expression in human Sertoli cells at 72 hours after transfection of miRNA mimics control (lane 1), miR-133b mimics (lane 2), miRNA inhibitor control (lane 3), and miR-133b inhibitor (lane 4) (upper panel). [score:7]
C. Real-time PCR revealed GLI3 expression changes in human Sertoli cells at 48 hours after transfection of miRNA mimics control, miR-133b mimics, miRNA inhibitor control, and miR-133b inhibitor. [score:7]
The relative expression of GLI3 in human Sertoli cells at 72 hours after transfection of miR-133b mimics to miRNA mimics control and miR-133b inhibitor to miRNA inhibitor control after normalization to the signals of their loading control (low panel). [score:7]
E. revealed expression changes of Cyclin B1 and Cyclin D1 in human Sertoli cells at 72 hours after transfection of miRNA mimics control (lane 1), miR-133b mimics (lane 2), miRNA inhibitor control (lane 3), and miR-133b inhibitor (lane 4) (upper panel). [score:7]
displayed that expression of Cyclin B1 (1.377±0.067) and Cyclin D1 (1.293±0.166) was elevated by miR-133b mimics, whereas the expression of these proteins was decreased by miR-133b inhibitor (Cyclin B1, 0.556±0.136; Cyclin D1, 0.827±0.100) (Figure 7E), indicating that Cyclin B1 and Cyclin D1 are activated by miR-133b in human Sertoli cells. [score:7]
Since hsa-miR-133b was statistically upregulated in human Sertoli cells of SCOS patients compared to OA patients, as shown by our miRNA microarrays and real-time PCR, we further explored the function of miR-133b in the regulation of human Sertoli cells using miR-133b mimics and inhibitors. [score:6]
To gain a deeper understanding of molecular mechanisms by which miR-133b regulates the fate determinations of human Sertoli cells, we identified two cell cycle regulators, including Cyclin B1 and Cyclin D1, as the indirect targets for miR-133b. [score:6]
We highlight that miR-133b, which was upregulated in Sertoli cells of SCOS patients, promoted the propagation of human Sertoli cells by targeting GLI3 and activating Cyclin B1 and Cyclin D1. [score:6]
We further examined whether miR-133b changed the expression of cell cycle regulators, including Cyclin B1 and Cyclin D1, in human Sertoli cells after transfection of miR-133b mimics and inhibitor. [score:6]
The transfection efficiency of miRNA-133b mimics or inhibitors in human Sertoli cells was around 75%, as assessed by transfection of FAM-labeled miRNA mimic control (Figure 4A-4B) and FAM-labeled miRNA inhibitor control (Figure 4C-4D). [score:5]
In this study, we found, using miRNA microarray and real-time PCR, that miR-133b was upregulated in human Sertoli cells of SCOS patients compared to OA patients with normal spermatogenesis, suggesting that abnormal expression of miR-133b may be associated with pathogenesis of the SCOS. [score:5]
Using miRNA predict software, namely TargetScan, we predicted that transcription factor GLI3 was a binding target of miR-133b. [score:5]
As example, miR-133b has been shown to stimulate the tumorgenesis and metastasis of human cervical carcinoma [23], and thus gene targeting for miR-133b and its target GLI3 might be used to treat cervical carcinoma and other tumors in the future. [score:5]
No statistical difference was observed in cell number of human SSC line between the miR-133b mimics and miRNA mimics control (Supplementary Figurere 2A) or the miR-133b inhibitor and miRNA inhibitor control (Supplementary Figurere 2B), thus verifying a specific role of miR-133b in human Sertoli cells. [score:5]
Real-time PCR showed that GLI3 was expressed at a lower level in human Sertoli cell of SCOS patients than in these cells of OA patients (Figure 7B), which is contrast to the expression of miR-133b in human Sertoli cells of SCOS patients and OA patients. [score:5]
The expression changes of GLI3, Cyclin B1, and Cyclin D1 in human Sertoli cells treated with miR-133b mimic or inhibitor. [score:5]
C. - D. Phase-contrast microscope C. and fluorescence microscope D. displayed the transfection efficiency of miR-133b inhibitor using the FAM-labeled miRNA inhibitor control oligonucleotides. [score:5]
Sertoli cells were classified into four groups in term of transfecting different miRNAs: i) miRNA mimics control, ii) miR-133b mimics, iii) miRNA inhibitor control, and iv) miR-133b inhibitor. [score:5]
Additionally, further revealed that GLI3 protein was obviously reduced by miR-133b mimics (0.528±0.194) in human Sertoli cells (Figure 7D); on the contrary, GLI3 translation was significantly elevated by miR-133b inhibitor (1.376±0.236) in human Sertoli cells (Figure 7D). [score:5]
Human Sertoli cells and a human SSC line [28] were seeded at a density of 1,000 cells/well in 96-well microtiter plates in DMEM/F12 supplemented with 1% FBS, and they were transfected with miRNA mimics control, miR-133b mimics, miRNA inhibitor control, miR-133b inhibitor, or GLI3 siRNA-3 or control siRNA. [score:5]
RNA was extracted from human Sertoli cells of patients with OA and SCOS patients, or Sertoli cells with miR-133b mimics, miR-133b inhibitor, miRNA mimics control, miRNA inhibitor control, using Trizol reagent (Invitrogen). [score:5]
Different concentrations of miR-133b mimics, inhibitor and GLI3 siRNAs were utilized to optimize the transfection efficiency, and we found that 40 μM of miR-133b mimics, inhibitor and GLI3 siRNAs were sufficient for their long-term biological effect. [score:5]
Figure 5 A. - B. CCK-8 assay showed the growth curve of human Sertoli cells treated with miRNA mimics control and miR-133b mimics for 5 days A. or miRNA inhibitor control and miR-133b inhibitor for 5 days B.. [score:4]
In contrast, miR-133b inhibitor statistically reduced cell number of human Sertoli cells compared with miRNA inhibitor control (Figure 5B). [score:4]
A. - B. CCK-8 assay showed the growth curve of human Sertoli cells treated with miRNA mimics control and miR-133b mimics for 5 days A. or miRNA inhibitor control and miR-133b inhibitor for 5 days B.. [score:4]
Taken together, these data imply that GLI3 is a direct target of miR-133b in human Sertoli cells. [score:4]
To gain novel insights into molecular mechanisms underlying the function of miR-133b in regulating human Sertoli cells, we identified the targets of miR-133b. [score:4]
GLI3 was a direct target of miR-133b in human Sertoli cells. [score:4]
However, the function and targets of miR-133b in regulating male reproduction are still unclear. [score:4]
In this study, we identified that GLI3 is indeed a direct target of miR-133b in human Sertoli cells. [score:4]
Real-time PCR revealed that hsa-miR-133b, hsa-miR-204-5p, hsa-miR-30e-5p, hsa-miR-4270, hsa-miR-129-2-3p, hsa-miR-202-3p, hsa-miR-195-5p, hsa-miR-664b-3p, hsa-miR-497-5p, hsa-miR-34b-5p, hsa-miR-513a-5p, and hsa-miR-101-3p were statistically upregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3A). [score:3]
Using bioinformatics algorithms, we predicted that GLI3 was a binding target of miR-133b. [score:3]
Figure 3 A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
were conducted at 24 hours to 120 hours in human Sertoli cells after transfection of miR-133b mimics or miR-133b inhibitor. [score:3]
A. GLI3 is a predicted target and binding site of miR-133b in human Sertoli cells. [score:3]
We found that miR-133b was upregulated in human Sertoli cells of SCOS patients compared to OA patients. [score:3]
Figure 7 A. GLI3 is a predicted target and binding site of miR-133b in human Sertoli cells. [score:3]
Human Sertoli cells with miR-133b mimics or inhibitor treatment were lysed with RIPA buffer (Santa Cruz) for 30 min on ice. [score:3]
We finally probed the role of miR-133b target GLI3 in human Sertoli cells. [score:3]
A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
Furthermore, the transcripts of GLI3 were remarkably decreased by miR-133b mimics (0.144±0.027) but significantly enhanced by miR-133b inhibitor (1.910±0.234) in human Sertoli cells (Figure 7C). [score:3]
Transfection efficiency of miR-133b mimics and inhibitor in human Sertoli cells. [score:3]
It has been reported that miR-133b plays a vital role in regulating the proliferation of the cancer cells [23] and it is involved in the oocyte growth and maturation [24]. [score:2]
Cell proliferation assays were conducted at 24 hours to 120 hours in human Sertoli cells after transfection of miR-133b mimics or miR-133b inhibitor. [score:2]
Cellular and molecular assays demonstrated that miR-133b promoted the proliferation of human Sertoli cells via targeting transcription factor GLI3 (GLI family zinc finger 3) and activating Cyclin B1 and Cyclin D1. [score:2]
A. and fluorescence microscope B. showed the transfection efficiency of miR-133b mimics using the FAM-labeled miRNA mimics control oligonucleotides. [score:1]
The effect of miR-133b on the proliferation of human Sertoli cells. [score:1]
To test whether miR-133b has general effect on cell proliferation, we examined its influence on human SSC line [28]. [score:1]
As shown in Figure 7A, the 2 [nd]-8 [th] nucleotides (the seed region) of miR-133b were base-pared with the 3′UTR sequence of GLI3. [score:1]
In our view, miR-133b might be involved in the etiology of NOA including SCOS, since we found that miR-133b promoted the proliferation of human Sertoli cells. [score:1]
[1 to 20 of 54 sentences]
8
[+] score: 170
In addition to classical roles of miRNAs, namely gene-regulation by targeting 3′-UTRs of mRNA, it is thus conceivable that expression of the miRNAs miR-133b and miR-206 is involved in the regulation of Il17a and Il17f locus accessibility comparable to the involvement of miRNA in DNA methylation in plants [39]. [score:7]
In accordance with a less stringent correlation of CD27 expression and IL-17A expression, expression levels of miR-133b and miR-206 were only slightly elevated (2-fold and 2.5-fold, respectively) in CD27 -negative versus CD27 -positive γδ T cells (Fig. 3C, left panel). [score:7]
miRNAs miR-133b and miR-206 are syntenic to the Il17a/f locus and are specifically expressed in Th17 cells polarized in vitro Many miRNAs have been found to be clustered and are likely to be co-expressed when less than 50 kb apart [21]. [score:5]
Polarization towards Th17 resulted in a 13-fold increase of miR-133b expression when compared to Th0 cells, whereas polarization into other CD4 [+] T cell lineages did not alter miR-133b expression (Fig. 1D). [score:4]
Likewise, the gene for two miRNAs miR-133b and miR-206, which are probably expressed from a bicistronic pri-miRNA [18], is located directly upstream of the Il17a and Il17f (Il17a/f) gene locus. [score:4]
Several targets of miR-133b and miR-206 such as DNA pol α, connexin43, histone deacetylase 4 (HDAC4) and the transcription factor Pitx3 have been reported to play a role in muscle development, regeneration of neuro-muscular synapses as well as osteoblast function [22], [42], [43], [44]. [score:4]
Figure S4 No regulation of the predicted target gene Ets1 by miR-133b or miR-206. [score:4]
Nevertheless, both miR-133b and miR-206 expression was elevated 7-fold and 8-fold, respectively, in cells enriched for RORγt (GFP) expression when compared to RORγt (GFP) -negative cells (Fig. 2B left panel). [score:4]
So far, miR-206 and miR-133b have been reported to be specifically important for muscle regeneration and development [18], [19], [20] and their expression has been suggested to be largely restricted to skeletal muscle and osteoblasts. [score:4]
0020171.g002 Figure 2IL-17 producing in vivo polarized CD4 [+] Th17 cells express elevated amounts of miR-133b and miR-206. [score:3]
Figure S2 The activation status of CD4 [+] T cells and γδ T cells does not influence miR-133b and miR-206 expression. [score:3]
Since miR-133b and, especially, miR-206 are important for muscle cell proliferation and differentiation [24], we sought to exclude the possibility that cell activation and proliferation correlated with heightened expression of these miRNAs. [score:3]
This is consistent with the observation that combination of all four cytokines generally used for Th17 polarization, namely IL-23, TGF-β, IL-6 and IL-1β or the additional use of IL-21 and TNF-α resulted in a profound synergistic effect with respect to miR-133b and miR-206 upregulation when compared to IL-23 alone or a combination of two cytokines (Fig. 4A, B). [score:3]
Therefore, we isolated GFP -positive and GFP -negative γδ T cells from RORγt reporter mice as described for Figure 2B (Fig. 3B, right panels) and assessed the expression of miR-133b and miR-206. [score:3]
Therefore, we assessed miR-133b and miR-206 expression levels in freshly isolated T cells. [score:3]
In fact, experiments, in which miR-206 or miR-133b or both were over-expressed in T cells showed no significant changes in the capacity of naive αβ T cells to become polarized towards Th17 or other Th lineages as well as iTreg. [score:3]
miRNAs miR-133b and miR-206 are syntenic to the IL-17A/IL-17F locus and are specifically expressed in Th17 cells polarized in vitro. [score:3]
Expression of miR-133b and miR-206 was assessed using qRT-PCR. [score:3]
Th17 cells express elevated amounts of miR-133b and miR-206 in vivo Although in vitro polarization recapitulates the phenotypes of various Th lineages, in vitro and in vivo polarized cells may not necessarily be identical. [score:3]
Primary human Th17 cells, but not Th1 cells, express miR-133b and miR-206. [score:3]
Expression levels of miR-133b (A) and miR-206 (B) were analyzed by qRT-PCR. [score:3]
Thus, of all cytokines tested IL-23 appears to be the most important for expression of miR-133b and miR-206 under standard conditions of in vitro polarization. [score:3]
0020171.g003 Figure 3(A) γδ T cells from Tcrd-H2BeGFP mice were sorted into a CCR6 [+] and CCR6 [−] populations and analyzed for expression of miR-133b and miR-206 by qRT-PCR. [score:3]
However, we could not confirm an effect of miR-133b or miR-206 overexpression on constructs containing the 3′-UTR of the Ets1 gene in the context of the BW5147α-β- thymoma cell line (Fig. S4). [score:3]
CD27 -positive and CD27 -negative γδ T cells were sorted from Tcrd-H2BeGFP reporter mice (Fig. 3C, right panels) and expression levels of miR-133b and miR-206 were assessed by qRT-PCR. [score:3]
Expression levels of miR-133b (D) and miR-206 (E) were analyzed by qRT-PCR. [score:3]
IL-17 producing in vivo polarized CD4 [+] Th17 cells express elevated amounts of miR-133b and miR-206. [score:3]
Thus, in CD4 [+] T cells miR-133b and miR-206 are co-expressed with IL-17A in vivo. [score:3]
Functional outcome of ectopically expressed miR-133b and miR-206 in vitro and in vivo. [score:3]
0020171.g001 Figure 1miRNAs miR-133b and miR-206 are syntenic to the IL-17A/IL-17F locus and are specifically expressed in Th17 cells polarized in vitro. [score:3]
Furthermore, we show that amongst multiple Th17 polarizing cytokines, IL-23 was the most important one for miR-133b and miR-206 expression. [score:3]
Expression levels of miR-133b and miR-206 were analyzed by qRT-PCR. [score:3]
Figure S1 Mitogenic stimulation of in vitro Th17 polarized cells does not change the expression level of miR-133b or miR-206. [score:3]
However, additional stimulation of Th17-polarized cells with PMA/ionomycin did not influence the expression of miR-133b and miR-206 (Fig. S1). [score:3]
miRNAs miR-133b and miR-206 are syntenic to the Il17a/f locus and are specifically expressed in Th17 cells polarized in vitro. [score:3]
Similarly, over -expression of miR-206 or miR-133b in bone marrow chimeras did not reveal striking changes in the frequency of IL-17 producing CD4 [+] Th or CD4 [−] cells. [score:3]
Interestingly, the gene coding for the transcription factor Ets1 was predicted to be a target of both miR-133b (one predicted recognition site) and miR-206 (four predicted recognition sites). [score:3]
Th17 cells express elevated amounts of miR-133b and miR-206 in vivo. [score:3]
0020171.g007 Figure 7Functional outcome of ectopically expressed miR-133b and miR-206 in vitro and in vivo. [score:3]
It was thus instrumental to test whether co -expression of miR-133b and miR-206 is restricted to CD4 [+] Th17 cells or whether it is a more general phenomenon. [score:3]
However, overall expression levels of miR-133b in lymphocytes were much lower when compared to samples of skin and muscle tissue. [score:2]
Expression levels for miR-133b and miR-206 were compared by qRT-PCR relative to Th0 (control). [score:2]
KI mice were compared for their miR-133b and miR-206 expression in (A) and (B). [score:2]
KI mice were compared for their miR-133b and miR-206 expression in (C) and (D). [score:2]
Taken together, we discovered co-regulation of miR-133b and miR-206 with the Il17a/f locus as a novel feature of T cell differentiation that is shared between mouse αβ and γδ T cells and also extended to human Th17 cells. [score:2]
Consistent with data obtained from in vitro polarized cells, IL-17A secreting cells expressed 16-fold higher levels of miR-133b and 26-fold higher levels of miR-206 when compared to IL-17A negative CD4 [+] T cells (Fig. 2A, left panel). [score:2]
qRT-PCR revealed that CCR6 -positive γδ T cells expressed 15-fold and 21-fold higher levels of miR-133b and miR-206, respectively, when compared to CCR6 -negative γδ T cells (Fig. 3A, left panel). [score:2]
The validity of the qRT-PCR assays for miR-133b and miR-206 was assessed by overexpression and subsequent detection of these in BWα [−]β [−] cells (Fig. S5). [score:2]
Although a certain degree of donor variability was observed, expression levels of miR-133b and miR-206 were consistently higher in IL-17A secreting human T cells (2 to 4-fold and 15 to 60-fold, respectively) when compared to Th0 cells (Fig. 6). [score:2]
Furthermore, to test a potential role of miR-133b and miR-206 in the development of IL-17 producing cells in vivo, we retrovirally transduced bone marrow derived hematopoietic precursors and generated bone marrow chimeras that contained transduced GFP [+] and non-transduced GFP [−] T cells. [score:2]
Lineage negative bone marrow was transduced with miR-133b or miR-206 or with the empty vector MDH1-PGK-GFP2.0 and served to reconstitute lethally irradiated C57BL/6 wild type mice. [score:1]
Furthermore, the mature miRNA sequences of miR-133b and miR-206 are identical between mouse, human, rat and chimpanzee (Fig. 1C). [score:1]
By nucleofection with the Amaxa-nucleofection reagent the psiCHECK-2-Ets1 vector was introduced into the BW5147 α-β- cell line that was stably transduced with either the empty MDH1-PGK-GFP2.0 (Addgene) plasmid, the latter plasmid with miR-133b or with miR-206. [score:1]
IL-23R signalling is not essential for the induction of miR-133b and mir-206. [score:1]
To this end, we employed retroviral vectors for miRNAs miR-133b and miR-206 based on MDH1-PGK-GFP_2.0 [35]. [score:1]
11.10 mice were retrovirally transduced with miR-133b or miR-206 or with both and stimulated under Th17 polarization inducing conditions. [score:1]
Notably, under these conditions, addition of IL-23 alone was able to induce low levels of miR-133b and miR-206 (Fig. 4A, B) as well as IL-17A as assessed by (Fig. 4C). [score:1]
The two miRNAs miR-133b and miR-206 are located in close proximity upstream to the Il17a/f locus. [score:1]
Although statistically not significant, we observed a trend pointing to a higher frequency of IL-17 producing cells among the CD4 [+] Th and CD4 [−] cells in chimeras from bone marrow transduced with either miR-133b or miR-206 but not the empty vector (Fig. 7B, C). [score:1]
In order to more quantitatively assess the correlation between induction of miR-133b and miR-206 versus secretion of IL-17A dependent on the different cytokine cocktails used for polarization, we determined the respective correlation coefficients. [score:1]
miR-133b and miR-206 form such a cluster with a distance of approximately 4 kb between the coding sequences of the two mature miRNAs. [score:1]
The retroviral constructs encoding mmu-miR-133b and mmu-miR-206 were generated by inserting the respective pre-miRNA sequences flanked by approximately 125 bp into the 3′LTR of the vector MDH-PGK1-GFP_2.0 (Addgene, [35]). [score:1]
Both miR-133b induction (Fig. 4D) as well as miR-206 induction (Fig. 4E) correlated strongly with secretion of IL-17A with correlation coefficients R [2] of 0.97 and 0.95, respectively. [score:1]
This qualifies transcription of miR-133b and miR-206 as a novel marker for T cells of an IL-17-producing phenotype. [score:1]
[1 to 20 of 64 sentences]
9
[+] score: 137
Consequently, our findings suggest that PP2A-B55δ might be a potential therapeutic target for increasing the sensitivity of HCC to chemotherapy and that inhibition regulation of miR-133b may be an important aspect of using this target. [score:8]
In summary, cDDP might up-regulate PPP2R2D through decreasing the promotion of its degradation or the inhibition of its translation by miR-133b acting on the 3’UTR. [score:8]
In this study, miR-133b was up-regulated in HCC cell lines, with a corresponding down-regulation of PPP2R2D. [score:7]
Furthermore, the expression level of miR-133b was significantly up-regulated in all HCC cell lines compared with normal hepatic cell lines (Fig.   6c), and it was inversely related to the expression of PPP2R2D shown in Fig.   1c. [score:7]
e WB was performed to detect B55δ, Cyclin B1, Cyclin E1, PCNA, Bcl-2, Bax, and cleaved Caspase-3 protein levels in 12 representative tumor tissues (n = 3 in each group) miR-133b regulates the expression of PPP2R2D by binding to its 3’UTRIn order to explore the epigenetic mechanisms of B55δ up-regulation induced by cDDP, microRNA. [score:7]
miR-133b was shown to regulate PPP2R2D expression by binding to the 3’-untranslated region of PPP2R2D mRNA. [score:6]
We confirmed for the first time that miR-133b regulates PPP2R2D post-transcriptional expression and translation by binding to complementary sequences of the 3’UTR of PPP2R2D mRNA. [score:6]
miR-133b has been revealed to be down-regulated in Parkinson disease, human non-small cell lung, bladder, gastric, and colorectal cancers [35– 39]. [score:6]
Based on these data, we hypothesized that decreased miR-133b might take part in cDDP -induced up-regulation of B55δ by targeting its mRNA transcripts. [score:6]
Also, inhibitor negative control (inNC) or miR-133b inhibitor (133in) was given to further confirm our results shown above. [score:5]
As a whole, our findings provided a potential molecular mechanism leading to the up-regulation of B55δ by cDDP chemotherapy, involving the decrease of miR-133b. [score:4]
Fig. 6 PPP2R2D is a direct downstream target gene of miR-133b. [score:4]
miR-133b mimic and inhibitor were used to elucidate the regulatory mechanism. [score:4]
miR-133b participates in cell cycle regulation by targeting PPP2R2D. [score:4]
f Luciferase activity of pGL3c- 2R2D-3’UTR reporter gene in HepG2 cells treated with or without 2.5 μg/ml cDDP for 6 h. The data shown are the mean ± SD of three parallel samples, * P < 0.01. g miR-133b and PPP2R2D mRNA levels in HepG2 cells treated with 2.5 μg/ml cDDP for 0, 3, 6, or 12 h or treated with 0, 1, 2.5, or 4 μg/ml cDDP for 12 h. * P < 0.01 as compared with cDDP-untreated group (Ctrl) miR-133b participates in cell cycle regulation by targeting PPP2R2DTo further verify the regulatory mechanism of miR-133b towards PPP2R2D, HepG2 cells were transfected with mimic negative control (miNC) or miR-133b mimic (133mi). [score:4]
miR-133b regulates the expression of PPP2R2D by binding to its 3’UTR. [score:4]
We concluded that PP2A-B55δ, under the regulation of miR-133b, could serve as a promising target for increasing chemotherapy sensitivity of HCC. [score:4]
Bioinformatics prediction, luciferase reporter assays, qRT-PCR, WB, and cell cycle analyses were used to reveal the regulatory relationship between microRNA-133b (miR-133b) and PPP2R2D expression. [score:3]
For each well, 50 nM miR-133b mimic or 100 nM inhibitor in ribo FECT™ CP Buffer (Ribobio) was mixed gently with ribo FECT™ CP Reagent and added to the cells for 12 h. Statistical analyses were carried out using the Statistical Package for Social Sciences (SPSS) version 16.0 (SPSS, IL, USA). [score:3]
Correlation analyses showed that the expression of miR-133b was negatively correlated with PPP2R2D and B55δ in vitro and in vivo (Fig.   6d–e, Additional file 4: Figure S3). [score:3]
By mimicking or inhibiting miR-133b, our study elucidated the miR-133b/ PPP2R2D signaling pathway involved in cDDP chemotherapy. [score:3]
The miR-133b mimic or inhibitor mo dels were verified by qRT-PCR and WB. [score:3]
c The miR-133b expression in normal hepatic cell lines and HCC cell lines. [score:3]
Correlation analyses of miR-133b and B55δ protein expression in vitro and in vivo. [score:3]
Fig. 8 Schematic representation depicting the regulation of PP2A-B55δ by miR-133b and its role in promoting chemotherapy sensitivity of HCC Additional file 1: Table S1. [score:2]
PP2A-B55δ, under the regulation of miR-133b, modulates cell cycle progression by counteracting the activation of CDK1, and influences cell migration, colony formation, apoptosis, and proliferation both in vitro and in vivo, thus affecting the therapeutic response to cDDP (Fig.   8). [score:2]
PP2A-B55δ, regulated by miR-133b, enhances the sensitivity of HCC to cDDP chemotherapy. [score:2]
Quantitative analysis of miRNA expression was performed with the Bulge-Loop™ hsa-miR-133b qRT-PCR primer set (Ribobio, Guangzhou, China). [score:2]
B Spearman’s correlation analysis of miR-133b and B55δ in HCC xenograft tumors. [score:1]
b Predicted structure and free energy of binding between miR-133b (green) and 2R2D-3’UTR (red). [score:1]
PP2A B55δ Hepatocellular carcinoma Chemotherapy sensitivity microRNA-133b Cisplatin According to global cancer statistics, about 782,500 new liver cancer cases occurred worldwide in 2012, together with about 745,500 deaths [1]. [score:1]
a- c After transfection with miNC or 133mi, HepG2 cells were treated with or without 2.5 μg/ml cDDP for 12 h. a miR-133b and PPP2R2D mRNA levels. [score:1]
Moreover, there was an apparent depletion of miR-133b, with a parallel elevation of PPP2R2D, induced by cDDP in a concentration- and time -dependent manner in HepG2 cells (Fig.   6g). [score:1]
The miR-133b/ PPP2R2D signaling pathway affects the effectiveness of cDDP chemotherapy. [score:1]
e Spearman’s correlation analysis of miR-133b and PPP2R2D mRNA levels in HCC xenograft tumors. [score:1]
Taken together, these results suggest that miR-133b may serve as a gene-specific biomarker for estimating the prognosis of HCC. [score:1]
d Pearson’s correlation analysis of miR-133b and PPP2R2D mRNA levels among HCC cell lines. [score:1]
As shown in Fig.   6a, miR-133b was found to bind to the 3’UTR of PPP2R2D. [score:1]
A Pearson’s correlation analysis of miR-133b and B55δ among HCC cell lines. [score:1]
Thus, we speculate miR-133b might act as an oncogenic miRNA (oncomiR) in HCC. [score:1]
a The schematic diagram shows the PPP2R2D 3’UTR (2R2D-3’UTR) regions containing the binding site for miR-133b. [score:1]
f Luciferase activity of pGL3c- 2R2D-3’UTR reporter gene in HepG2 cells treated with or without 2.5 μg/ml cDDP for 6 h. The data shown are the mean ± SD of three parallel samples, * P < 0.01. g miR-133b and PPP2R2D mRNA levels in HepG2 cells treated with 2.5 μg/ml cDDP for 0, 3, 6, or 12 h or treated with 0, 1, 2.5, or 4 μg/ml cDDP for 12 h. * P < 0.01 as compared with cDDP-untreated group (Ctrl) To further verify the regulatory mechanism of miR-133b towards PPP2R2D, HepG2 cells were transfected with mimic negative control (miNC) or miR-133b mimic (133mi). [score:1]
[1 to 20 of 42 sentences]
10
[+] score: 135
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
While there is little known about a direct role of mir133b on the development of the craniofacial cartilage, these results suggest that it is involved in both muscle and neuronal development, both of which can influence, either directly or indirectly, formation of the craniofacial complex. [score:6]
Potential Mir23b and Mir133b functions and targetsHere we have shown that Mir23b is expressed in the developing face of mouse embryos and in the head of zebrafish embryos and that its overexpression in zebrafish embryos results in ectopic cartilage structures in the viscerocranium. [score:6]
To examine whether the pattern of expression of mir23b and mir133b was also conserved between mouse and zebrafish embryos, we examined expression of both miRNAs in 30–72 hpf embryos. [score:5]
mir133b has the potential to target the same set of myogenic targets in zebrafish, but only Histone Deacetylase 4 contains a seed sequence for mir133b. [score:5]
In these abnormal contexts, MIR133b in human cervical carcinoma targets EGFR and FGFR1, similarly acting as a tumor suppressor (Namløs et al., 2012). [score:5]
Expression of MiR133b was not observed in the maxilla or palatal shelves, suggesting that the expression observed by miRNA-seq might reflect presence of other tissue in dissected samples. [score:5]
From our expression analysis, it is plausible that overexpression of Mir133b may lead to changes in facial muscle which affects subsequent viscerocranium development. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
At 30 hpf, mir133b expression was also observed in the head region (around the eye and portions of the brain; Figure 6A), though expression was weaker than that of mir23b. [score:5]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafishTwo potential methods for assessing function of genes in zebrafish are over -expression and gene inactivation. [score:5]
Other groups have performed miRNA expression profiling of the developing mouse orofacial region using microarrays (Mukhopadhyay et al., 2010) and have found similar differential expression across time for miRNAs that included Mir133a and Mir133b. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
Mir133b is strongly expressed in facial muscles, including the masseter (ma), and in the muscles of the eye (em; D) and tongue muscle (t; E–I) Expression is not observed in the palatal shelves (ps; E,F). [score:4]
While we have not determined the numbers of dopaminergic neurons in zebrafish in which mir133b is over-expressed, we do see specific defects in cartilage differentiation, including hypoplasia of the ethmoid plate and specific gaps or missing cartilage in the viscerocranium, suggesting that mir133b may act non-cell autonomously to regulate cartilage differentiation. [score:4]
Expression of mir23b and mir133b is conserved in zebrafish facial structuresBased on analysis of mir140 action, miRNA function during facial development is also present in zebrafish embryos. [score:4]
Further, like the comparison between MiR23b and MiR24.1, expression of MiR206 was much weaker than the expression observed for MiR133b. [score:4]
Our in situ hybridization and overexpression analyses provide evidence that Mir23b and Mir133b are important regulators of craniofacial development. [score:4]
Zebrafish mir133b is expressed in the midbrain at low levels and regulates pitx3 to control dopaminergic neuron differentiation (Sanchez-Simon et al., 2010). [score:4]
Figure 6Expression of mir133b in zebrafish embryos. [score:3]
In addition, we have shown that over -expression of mir23b and mir133b results in changes in craniofacial cartilage morphogenesis. [score:3]
As in 30 hpf embryos, mir133b was strongly expressed in the somites (Figure 6E). [score:3]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafish. [score:3]
By 72 hpf, mir133b expression was observed in trunk muscles (Figure 6F), otic vesicle and heart (Figure 6C). [score:3]
Expression of mir23b and mir133b is conserved in zebrafish facial structures. [score:3]
More roles have been ascribed for FGF signaling in craniofacial development, with FGFR1 specifically linked to skeletal dysplasias and craniosynostosis in both humans and mice, suggesting a mechanism by which Mir133b may regulate craniofacial development (Moosa and Wollnik, 2016). [score:3]
In addition, Mir133b is down-regulated in several cancers, including muscle rhabdomyosarcoma, osteosarcoma, and prostate, colorectal and gastric cancers (Namløs et al., 2012; Qin et al., 2012; Mo et al., 2013). [score:3]
Morphine regulates dopaminergic neuron differentiation via miR-133b. [score:2]
Expression of MiR23b and MiR133b in mouse facial structures at E12.5. [score:2]
Figure 4Expression of Mir133b in mouse facial muscles at E12.5. [score:2]
In contrast, mice in which Mir133b has been inactivated have normal dopaminergic neuron numbers and normal PITX3 protein levels (Heyer et al., 2012) even though Mir133b can target the Pitx3 message. [score:2]
Mir133b is clustered in the genome with Mir 206.1, which does not have the same seed sequence but is predicted to bind some of the same targets in mouse including Histone Deacetylase 4, DNA Polymerase α, and Connexin43 (Anderson et al., 2006; Chen et al., 2006; Kim et al., 2006; Goljanek-Whysall et al., 2012). [score:2]
Normal midbrain dopaminergic neuron development and function in miR-133b mutant mice. [score:2]
When using LNA probes against Mir23b and Mir133b, robust expression was present in a variety of facial structures, though overall background staining on the sections was high (Supplemental Figure 2). [score:2]
Potential Mir23b and Mir133b functions and targets. [score:2]
Like MiR23b, MiR133b was also strongly expressed in the craniofacial region at E12.5. [score:2]
Like Mir23b, Mir133b exists in a cluster with Mir206, which had a similar pattern of expression to that of Mir133b. [score:2]
Thirty-three micrometers of MiR23b duplex (5′—3′), 6.25 μM of MiR133b (5′—3′), and 33 μM of standard control miRNA (5′- CTTACCTCAGTTACAATTTATA -3 duplexed with 5′- TAAATTGTAACTGAGGTAAGAG-3′) were injected into single cell zebrafish embryos and allowed to grow for 6 dpf. [score:1]
While Crispr-Cas9 -mediated gene inactivation is underway, we began our analysis of potential function by injecting 1–2 cell zebrafish embryos with duplex RNA for MiR23b and MiR133b examining cartilage development at 6 dpf. [score:1]
Whole-mount in situ hybridization analysis with a digoxigenin-labeled probe against mir133b at 30–72 hpf. [score:1]
MicroRNA-133b is a key promoter of cervical carcinoma development through the activation of the ERK and AKT1 pathways. [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 41 sentences]
11
[+] score: 134
Of extreme relevance, WB analysis showed that the combination of miRNA499 plus miRNA133 upregulated the protein expression of both Cx43 and cTnT (Fig. 6B). [score:6]
Gene and protein expression analysis showed that miRNA499 and miRNA133 are able to induce the differentiation of AMSC into cells expressing typical cardiac markers such as Nkx2.5, GATA4, cTnT, Cx43, Ryr2, and Cav1.2. [score:5]
At the 14 days time point, WB showed that miRNA1 alone had no effect on both Cx43 and cTnT, miRNA133 increased only the expression of cTnT, while miRNA499 was able to markedly increase the expression of both Cx43 and cTnT (Fig. 3A). [score:5]
The coexpression of miRNA499 and miRNA133 further increased the expression of the atrial marker Mlc. [score:5]
Expression of cardiac cytoskeletal protein (α-sarcomeric actinin) and of other important proteins involved in cardiac excitation/contraction (EC)-coupling (Cav1.2, SERCA2a, and RyR2) was analyzed by ICC on EB coexpressing miRNA499 and miRNA133, selected from the same batch of EB showing caffeine-responsiveness. [score:5]
ICC further confirmed that miRNA499 and miRNA133 coexpression was able to induce the expression of cardiac-specific proteins like cTnT, Cx43, Serca2a, and Cav1.2 (Fig. 6C) even in the absence of DMSO. [score:5]
When miRNA499 and miRNA133 were coexpressed, we documented a significant increase in both GATA4 and Nkx2.5 expression compared with all other conditions tested (Fig. 2A, 2B). [score:4]
However, the coexpression of miRNA499 and miRNA133 resulted in a significantly higher expression of both cardiac markers compared with the other conditions tested (Fig. 7A). [score:4]
Recently, it has been suggested that certain miRNA are powerful regulators of cardiac differentiation processes [32], and it has been shown that miRNA1, miRNA133, and miRNA499 are highly expressed in muscle cells [32]. [score:4]
Most importantly, by simultaneously over -expressing miRNA499 and miRNA133 the number of P19 cells expressing cTnI was 30-fold greater compared with the standard differentiation protocol. [score:4]
Real-time PCR analysis showed that also in P19 cells not exposed to DMSO, treatment with miRNA499 and miRNA133 upregulated GATA4 (+4.9-fold, p < . [score:4]
However, when we coexpressed miRNA499 together with miRNA133 the results were significantly and strikingly superior compared with the over -expression of miRNA499 alone. [score:4]
The Combination of miRNA499 and miRNA133 Increases the Expression of Cardiac-Specific Genes. [score:3]
ICC experiments confirmed that Cx43 and cTnT were convincingly turned on upon over -expression of miRNA449 alone and even more so in combination with miRNA133 (Fig. 3B). [score:3]
In particular, untreated EB showed responses compatible with Ca [2+] -dependent electrical activity, typical of immature CMC, while Na [+] -dependent excitability was recorded in EB over -expressing miRNA499 and miRNA133. [score:3]
CMC derived from P19 cells over -expressing miRNA499 and miRNA133 develop EC-coupling properties typical of mature CMC. [score:3]
miRNA133 increased the expression of Nkx2.5 (+1.3-fold vs. [score:3]
Coexpression of miRNA499 and miRNA133 sharply increased the proportion of caffeine-responsive cells. [score:3]
Importantly for translational purposes, we have also shown that the same combination miRNA499 and miRNA133 is a powerful inducer of cardiac differentiation for human MSC. [score:3]
WB (Fig. 7B) and ICC (Fig. 7C,D) analysis confirmed that AMSC treated with miRNA499 and miRNA133 differentiated in cells expressing Cx43 and cTnT (Fig. 7B, 7C) but also Cav1.2 and Ryr2 (Fig. 7D). [score:3]
Coexpression of miRNA499 and miRNA133 induced a 3.5-fold increase in the number of responsive cells with respect to cells exposed to DMSO (p < . [score:3]
WB and ICC analysis confirmed that cardiac proteins are indeed expressed at higher levels when P19 cells are cotransfected with miRNA499 plus miRNA133. [score:3]
Cardiac-Specific Proteins Are Highly Expressed in P19 Cells Treated with miRNA499 and miRNA133. [score:3]
As already observed in P19 cells, the combination of miRNA499 with miRNA133 triggered the over -expression of both the nuclear transcription factor GATA4 (+13-fold, p < . [score:3]
In addition, the expression of genes encoding for cardiac-specific transcription factors, such as GATA4 and Nkx2.5, and cardiac-specific proteins, such as Cx43 and cTnT, was enhanced in cells treated with miRNA499 plus miRNA133. [score:3]
It is currently unknown whether the concomitant over -expression of miRNA1, miRNA133, and miRNA499 or if the combination of two of these miRNA would result in a synergistic action, further increasing the efficiency of cardiac differentiation. [score:3]
After 14 days, Cx43 was significantly over-expressed in cells treated with miRNA133 or miRNA499 and cTnT was significantly higher in the miRNA499 group compared with naïve cells (Fig. 7A). [score:2]
At day 14, the over -expression of miRNA1 or miRNA133 alone or their combination did not increase the number of beating clusters compared with DMSO treatment (Fig. 1A). [score:2]
It has been shown that miRNA1 and miRNA133 are important regulators of embryonic stem cell (ESC) differentiation into CMC. [score:2]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
To strengthen our observation, we aimed to test whether treatment with miRNA499 plus miRNA133 in the absence of DMSO exposure was sufficient to trigger cardiac differentiation. [score:1]
The treatment of EB with both pre-miRNA499 and pre-miRNA133 resulted in the strongest activation of the cTnI promoter (Fig. 1B). [score:1]
001), 4.1-fold versus miRNA133 alone (p < . [score:1]
Figure 7Amniotic mesenchymal stromal cells (AMSC) differentiation using miRNA499 and miRNA133 precursors. [score:1]
Figure 5MEA and twitch recordings of embryoid bodies treated with pre-miRNA499 together with pre-miRNA133. [score:1]
001), and miRNA133 (+2.7-fold; p < . [score:1]
It was impossible to document the same results using different combination of miRNAs, confirming that only the couple miRNA499/miRNA133 triggers the differentiation of MSC toward a cardiac-like phenotype. [score:1]
naïve, scramble miRNA, miRNA133, miRNA1 + 499 and p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1, and p < . [score:1]
These data strongly suggest a synergistic effect of miRNA499 and miRNA133. [score:1]
In particular, miRNA133 seems more crucial in controlling cell proliferation by repressing serum response factor and cyclin D2 [17, 24]. [score:1]
In summary, we demonstrated that miRNA499 and miRNA133 act in a synergic manner inducing P19 differentiation into CMC even in the absence of DMSO. [score:1]
Therefore, the effect of miRNA499 and miRNA133 synergism on cardiogenic differentiation was further tested based on the notion that mature excitation-contraction coupling relies on the presence of Ryrs-operated intracellular Ca [2+] stores. [score:1]
Finally, functional analysis showed that the percentage of responsive EB grown without DMSO but transfected with pre-miRNA499 and pre-miRNA133 did not significantly differ from the percentage of EB grown in the presence of 0.5% DMSO (Fig. 6D). [score:1]
After 14 days, quantification of late cardiac-specific genes confirmed the synergistic effect exerted by miRNA499 and miRNA133 (Fig. 2C, 2D). [score:1]
DMSO and miRNA133; *, p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
The Synergic Effect of miRNA499 and miRNA133 on AMSC. [score:1]
To verify whether miRNA499 and miRNA133 exert their effects also on other cell types, we tested our protocol on AMSC. [score:1]
DMSO, miRNA1 and miRNA133; ‡, p < . [score:1]
In particular, it has been clearly shown that miRNA133 and miRNA1 promote myoblast proliferation and differentiation, respectively, and that miRNA499 enhances the differentiation of cardiac progenitor cells into CMC [17– 20]. [score:1]
Although miRNA1 and miRNA133 are cotranscribed, the function of miRNA133 is different from miRNA1. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA1 + 499; #, p < . [score:1]
After 4 days, the EB were transferred to plastic culture dishes in the presence of differentiation medium, and transfected with precursor molecules (pre-miRNA) for miRNA499 (PM11352, 10 nM), miRNA1 (PM10617, 10 nM), and miRNA133 (PM10413, 5 nM) in different combinations or with scrambled miRNA used as a negative CTRL (AM17110, 5 nM) (Supporting Information Table S1). [score:1]
Our results clearly showed that miRNA499 is a powerful activator of cardiac differentiation, particularly in comparison with miRNA1 and miRNA133. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, miRNA1 + 499 and p < . [score:1]
Furthermore, the spontaneous mechanical activity response of miRNA499 and miRNA133 transfected cells to modulators of Ca [2+] handling effectors (CaV, RyRs, and IP3R) is consistent with that expected for cardiac but not skeletal muscle. [score:1]
miRNA precursors were diluted in Opti-MEM I medium at the following concentration: miRNA1 and miRNA499 precursors 10 nM, miRNA133 precursor and scrambled miRNA 5 nM. [score:1]
In order to confirm the synergic action of miRNA499 with miRNA133, we tested this combination also in AMSC. [score:1]
The synergistic effect exerted by the combination of miRNA133 and miRNA499 was confirmed by activation of the cTnI cardiac-specific promoter (Fig. 1B). [score:1]
[1 to 20 of 60 sentences]
12
[+] score: 114
Other miRNAs from this paper: hsa-mir-21, hsa-mir-143
Furthermore, we examined the cancelling effect of miR-133b on the up-regulated expression of DR5 after the treatment with α-mangostin to validate the relationship between the up-regulation of DR5 by α-mangostin and the down-regulation by miR-133b. [score:12]
Also, the gene silencing of DR5 suppressed apoptosis significantly, which would have considerably contributed to the TRAIL -induced apoptosis by α-mangostin (Fig. 4), indicating that the apoptosis was at least in part due to the up-regulation of DR5 by the down-regulation of miR-133b. [score:9]
We demonstrated that the level of intracellular miR-133b was down-regulated after the treatment with α-mangostin (Fig. 5B); whereas DR5, a target gene of miR-133b, was clearly up-regulated (Figs. 2 and 5A). [score:9]
Up-regulation of DR5 by α-mangostin was due to down-regulation of miR-133b. [score:7]
Notably, α-mangostin cancelled the 2 resistance machineries by increasing the expression level of DR5 through down-regulation of miR-133b and efficient recruitment of DR5 in DLD-1 and their TRAIL-resistant cells (Figs. 2, 3, and 5B), but not in the non-cancerous TRAIL-resistant MCF10A cells. [score:6]
All of these results taken indicated that α-mangostin cancelled the resistance to TRAIL by increasing the expression level of DR5 through down-regulation of miR-133b. [score:6]
Interestingly, α-mangostin canceled the resistance by increasing the expression level of DR5 through down-regulation of miR-133b and effectively induced the translocation of DR5 to the cell surface in DLD-1 cells. [score:6]
α-Mangostin, a xanthone derivative, cancelled this resistance by increasing the expression level of DR5 through down-regulation of miR-133b and effectively inducing the transfer of DR5 from the cytoplasm to the tumour cell surface membrane (Fig. 11E). [score:6]
α-Mangostin cased a decrease in the expression level of miR-133b, which targets DR5. [score:5]
More recently, protumorigenic role of miR-133b was evidenced in cervical cancer: miR-133b directly regulated anti-apoptotic gene Fas apoptosis inhibitory molecule (FAIM) [14]. [score:5]
The 3- to 4-fold decrease in the miR-133b level by α-mangostin actually up-regulated DR5 (Fig. 5B). [score:4]
When we examined the intracellular level of miR-133b at 48 h after the treatment with α-mangostin (Fig. 5B), we found that α-mangostin significantly down-regulated the level of miR-133b in both TRAIL-sensitive DLD-1 and DLD-1/TRAIL cell lines. [score:4]
As shown in Fig. 5D, 10 nM miR-133b clearly reversed the up-regulation of DR5 induced by α-mangostin. [score:4]
The co-transfection with miR-133b and the pMIR sensor vector, which included the candidate target region bound by miR-133b, resulted in significant inhibition of the luciferase activity compared with the co-transfection with control miRNA, but not in the case of the pMIR sensor vector that include the region without the binding site. [score:4]
According to the in-silico prediction tools TargetScan, DR5 (TNFRSF10B) displays a single miR-133b binding site in its 3′-UTR. [score:3]
4271–4650) with a luciferase reporter pMIR-control vector (Ambion, Foster City, CA, USA) to examine the target sequence of miR-133b. [score:3]
DLD-1 cells transfected with the control miRNA or miR-133b were treated with α-mangostin (7 μM) and/or rTRAIL (5 ng/ml) for 48 h. As shown in the Fig. 5C, transfection of the cells with miR-133b resulted in a significant cancellation of the growth suppression induced by the combination of α-mangostin and rTRAIL. [score:3]
In order to validate the target gene of miR-133b as being DR5, we performed a luciferase reporter assay (Fig. 5A). [score:2]
In order to examine the expression level of mature miR-133b in detail, we performed TaqMan [®] MicroRNA Assays (Applied Biosystems, Foster City, CA) using real-time PCR [21]. [score:2]
Furthermore, mutations of the DR5 3′-UTR binding site significantly abolished the ability of miR-133b to decrease the luciferase activity. [score:2]
The results of this assay demonstrated that miR-133b targets DR5. [score:2]
C. DLD-1 cells were transfected with control or miR-133b (10 nM) for 48 h, and then exposed to α-mangostin (7 μM) and/or rTRAIL (5 ng/ml) for 24 h. The cell viability was estimated at 48 h after the treatment. [score:1]
D. Control and miR-133b (10 nM) were transfected into DLD-1 cells for 48 h, and the cells were then exposed to α-mangostin (5, 7 μM). [score:1]
B. Expression level of miR-133b in TRAIL-sensitive and -resistant DLD-1 cells treated with α-mangostin (5, 7 μM), as evaluated by RT-qPCR. [score:1]
4455–4463) for miR-133b, we mutated seed regions from GG ACCAAA to GG CATGAA (mt- DR5, PrimeSTAR [®] Mutagenesis Basal Kit; TaKaRa). [score:1]
The sequence of miR-133b was 5′-UUUGGUCCCCUUCAACCAGCUA-3′; and that of siRNA for DR5, 5′-GAAGACGGTAGAGAT TGCATCTCCT-3′ (siR-DR5). [score:1]
The sensor vector (concentration; 0.5 μg/well) and 10 nM miR-133b or nonspecific control miRNA (Dharmacon) were used for the co-transfection of the cells by using Lipofectamine RNAiMAX (Invitrogen). [score:1]
Furthermore, the activation of caspase-8 was impaired in the miR-133b -transfected cells. [score:1]
A. The vector with the binding site for miR-133b is indicated as Wild (+) type; and that without it, as Mutant. [score:1]
We further examined whether miR-133b was associated with TRAIL -induced apoptosis. [score:1]
Figure 5 A. The vector with the binding site for miR-133b is indicated as Wild (+) type; and that without it, as Mutant. [score:1]
[1 to 20 of 31 sentences]
13
[+] score: 113
org/), has revealed, interestingly, that the miR-1 targets; FOXP1 and HDAC4 have putative target sites for miR-133a or miR-133b, whereas miR-133b target; BCL2L2 also has putative miR-1 or miR-206 target sites. [score:9]
Common targets of miR-1 or miR-206 and miR-133a or miR-133b are 538 genes, which is 21.5% of miR-1 or miR-206 targets and 30.6% of miR-133a or miR-133b targets (Additional Table 1). [score:7]
Figure 5A total of 3716 genes were identified by the TargetScan program as predicted targets of miR-1, miR-133a, miR-133b and miR-206. [score:5]
A total of 3716 genes were identified by the TargetScan program as predicted targets of miR-1, miR-133a, miR-133b and miR-206. [score:5]
With regard to expression levels in tumor tissues, high expression levels of miR-133b were found to be associated with poor prognosis for progression free survival in 106 patients with bladder cancer (BC) [44]. [score:5]
Putative miR-1 or miR-206 targets exist in 2498 genes, and putative miR-133a or miR-133b targets are found in 1756 genes. [score:5]
Overexpression of miR-133b has been shown to induce apoptosis and G1 cell cycle arrest in CRC cells [70], whereas cell invasion activity was inhibited by miR-133b in ESCC cells [69]. [score:5]
Recently, studies from our group and others have shown that downregulation of the miR-1/miR-133a and miR-206/ miR-133b clusters are frequent events in various types of cancer. [score:4]
To identify the biological processes or pathways potentially regulated by the miR-1/miR-133a and miR-206/miR-133b clusters, we performed GENECODIS analysis [81, 82] with our predicted target list. [score:4]
Except for one report about multiple myeloma [37], studies on miR-1, miR-133a, miR-133b and miR-206 have found them all to be downregulated in many types of cancer (Table 1). [score:4]
As mentioned above, although the sequence of each seed region is different, some targets, such as MET, TAGLN2, PNP and LASP1, are commonly regulated by the miR-1/miR-133a and/or miR-206/miR-133b clusters. [score:4]
The total number of genes targeted by miR-1 or miR-206 and miR-133a or miR-133b is 3716. [score:3]
Altered expression of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:3]
Several cancers, including PCa, pancreatic cancer, lung cancer, AML, RCC, CRC, BC and thyroid cancer, are among the statistically enriched categories (Additional Table 2), and it is worth mentioning that miR-1, miR-133a, miR-133b and miR-206 are differentially expressed in these types of human malignancies. [score:3]
Workflow for the bioinformatic analysis of target genes of miR-1, miR-133a, miR-133b and miR-206. [score:3]
Aberrant expression of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:3]
These targets potentially contribute to specific functional readouts of miR-1, miR-133a, miR-133b and miR-206. [score:3]
miR-133b targets MET in CRC cells [70]; PKM2 in tongue SCC [68]; FSCN1 in ESCC [69] and myeloid cell leukemia sequence 1 (MCL1); and BCL2-like 2 (BCL2L2) in lung cancer [79]. [score:3]
The predicted target genes of miR-1 are the same as those of miR-206, and those of miR-133a are the same as those of miR-133b, due to the identical sequences of their seed regions. [score:3]
Validated oncogene targets of miR-1, miR-133 and miR-206 in cancers. [score:3]
In contrast, low expression levels of miR-133b in tumor tissues were found to be associated with poor prognosis for overall survival (n=43) and positive lymph node metastasis (n=45) in CRC [45]. [score:3]
miR-133b, a homologue of miR-133a, also inhibited tumor growth in tongue SCC [68], ESCC [69], and CRC cells [70]. [score:3]
In vivo, a tumor suppressive function for miR-133b was shown in CRC in xenotransplanted mice [70]. [score:3]
Computational analysis of miR-1-, miR-133a-, miR-133b- and miR-206-regulated molecular networks. [score:2]
miR-1-, miR-133a-, miR-133b- and miR-206-regulated molecular networks in cancers. [score:2]
This bioinformatic analysis indicates that the miR-1/miR-133a and miR-206/miR-133b clusters might supplement each other to regulate several cancer pathways, such as cell growth, cell apoptosis, cell cycle, invasion and angiogenesis (Additional Figure 1). [score:2]
As miR-1, miR-133a, miR-133b and miR-206 are mostly downregulated in cancers, gain-of-function experiments are a feasible way to evaluate the functional significance of these miRNAs in various cancers. [score:2]
Conducting qPCR, western blotting, and reporter assays and using bioinformatic prediction programs, recent research has identified several targets of miR-1, miR-133a, miR-133b and miR-206 (Table 2). [score:2]
These high-throughput analyses have found miR-1, miR-133a, miR-133b and miR-206 to be altered in various types of cancers. [score:1]
Circulating miR-1, miR-133a, miR-133b and miR-206 as potential diagnostic markers. [score:1]
Genes of the miR-1/miR-133a and miR-206/miR-133b clusters. [score:1]
The structures of precursor miR-133a-1, miR-133a-2 and miR-133b as constructed by the Mfold program [92] (http://mfold. [score:1]
miR-1-1/miR-133a-2, miR-1-2/miR-133a-1, and miR-206/miR-133b form clusters in three different chromosomal regions in the human genome – 20q13.33, 18q11.2, and 6p12.2, respectively. [score:1]
Figure 4The structures of precursor miR-133a-1, miR-133a-2 and miR-133b as constructed by the Mfold program [92] (http://mfold. [score:1]
Functional significance of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:1]
Alignment of miR-133a-1, miR-133a-2 and miR-133b. [score:1]
miR-133b differs from miR-133a by a single nucleotide at the 3' end [26] (Figure 4). [score:1]
These facts suggest that miR-1/miR-133a and miR-206/miR-133b clusters might coordinately affect downstream pathways. [score:1]
[1 to 20 of 38 sentences]
14
[+] score: 97
The four downregulated miRNAs miR-133a, miR-133b, miR-331-3p, and miR-204 had 1,836 potential target genes, 222 of which were significantly upregulated in our prior mRNA microarray study (Additional file 4: Table S4) [9], consistent with the proposed regulatory action of the miRNAs. [score:10]
Predicted targets for miR-133a, miR-133b, miR-331-3p, and miR-204 were retrieved from the miRNA–mRNA target databases TargetScan, Pictar, and MirTarget2 with the R package RmiR. [score:9]
Bioinformatic analysis predicted 222 genes (see Additional file 4: Table S4) with upregulated expression in AAA based on a prior microarray study [9] were targets of miR-133a, miR-133b, miR-331, or miR-204. [score:8]
A list of predicted target genes for miR-133a/miR-133b, miR-204, and miR-331-3p that were also upregulated in our prior microarray study. [score:6]
We searched the literature for information on miR-133b, miR-133a, miR-204, miR-331-3p, and miR-30c-2*, the five miRNAs with confirmed downregulated expression between AAA and control abdominal aorta. [score:6]
Green molecules are the four down regulated miRNAs (miR-133a/miR-133b, miR-204, and miR-331-3p), yellow molecules are experimentally verified target genes of the four miRNAs, and grey molecules are predicted targets of the four miRNAs. [score:6]
KLF15 is also a target of miR-133a/miR-133b [23], and its expression is reduced in both mouse aneurysm mo dels and human AAA [9, 55]. [score:5]
Since IPA combines the targets of mature miRNAs with similar sequences (2–3 nucleotide difference) to miRNA families, experimentally validated targets of miR-133a/miR-133b, miR-211/204, and miR-331-3p were retrieved. [score:5]
The three upregulated miRNAs were miR-181a* (MIMAT0000270), miR-146a (MIMAT0000449), and miR-21 (MIMA0000076), while five miRNAs, miR-133b (MIMAT0000770), miR-133a (MIMA000427), miR-331-3p (MIMAT0000760), miR-30c-2* (MIMAT0004550), and miR-204 (MIMA0000265), were significantly down regulated (Figure 1). [score:5]
Targets were predicted for qRT-PCR validated miRNAs (miR-133a, miR-133b, miR-331-3p, and miR-204), which were all down regulated in AAA. [score:4]
Two tumor necrosis factor receptors, TNFRSF10B and TNFRSF8, were predicted targets of miR-133a/miR-133b and miR-204, respectively. [score:3]
There was a redundancy between the predicted targets of miR-133a and miR-133b due to the similarity in their sequences; however, the two base pair difference had an impact on the calculated minimum free energies, suggesting that they may have different affinities for individual target silencing [19]. [score:3]
Eight genes (DNM2, DNAJB1, TGFBR1, TGOLN2, BCL11A, EDEM1, SFXN2, YTHDF3) were predicted targets of miR-204 and miR-133a/miR-133b. [score:3]
Bioinformatic analysis indicated that miR-133a, miR-133b, miR-331-3p, and miR-204 target apoptotic genes, which may play a role in the loss of vascular smooth muscle cells in AAA. [score:3]
Four genes (CSRNP1, SLC7AB, PLK3, and FURIN) were predicted targets of miR-133a/miR-133b and miR-331-3p. [score:3]
In the combined qRT-PCR analysis including all the 36 AAA tissue samples and seven controls, the differences in expression levels of the five miRNAs, miR-133b, miR-133a, miR-331-3p, miR-30c-2*, and miR-204, between AAA and control groups were highly significant (Figure 2). [score:3]
Figure 3 A network of miRNAs miR-133a, miR-133b, miR-331-3p, miR-204, and their target genes. [score:3]
CD28, CD86, and ICOS, which are important co-stimulatory molecules, were predicted to be targets of miR-204, miR-133a/miR-133b, and miR-331-3p, respectively [40]. [score:3]
Of the validated miRNAs in the current study only miR-133a and miR-133b differed in expression also in thoracic aortic dissections compared to controls [29]. [score:2]
Ingenuity Systems® Pathway Analysis tool was used to generate a network from 45 experimentally verified interactions of the four biologically active, validated, down regulated miRNAs (miR-133a, miR-133b, miR-331-3p, and miR-204) (Figure 5). [score:2]
For example, in cell culture experiments, miR-133a/miR-133b down regulation is associated with a switch in vascular smooth muscle cells to a proliferative phenotype [27]. [score:2]
The functions of miR-133b, miR-133a, and miR-204 have been thoroughly examined in a cardiovascular context [22- 28], but nothing was known about their role in AAA. [score:1]
Eight miRNAs (miR-133a, miR-133b, miR-146 a, miR-181a*, miR-204, miR-21, miR-30c-2*, miR-331-3p) which showed significant differences in their levels with an adjusted p < 0.05 in the microarray experiment were selected for qRT-PCR validation. [score:1]
Ingenuity Pathway Analysis® tool was used to generate the network from experimentally observed miRNA–mRNA interactions of miR-133a/miR-133b, miR-204, and miR-331-3p. [score:1]
[1 to 20 of 24 sentences]
15
[+] score: 92
miR-1, miR-133a and miR-133b expression is upregulated with aging in men. [score:6]
An ordinary Two-Way ANOVA revealed a markedly effect of both gender and age on miR-133a and miR-133b expression (P < 0.01), where both factors are associated with an overall higher expression of both mature miRNA transcripts. [score:5]
An overall effect of LHRH-agonist treatment was observed for miR-133a and miR-133b expression (P < 0.05), but not in miR-1 or miR-206 expression (P > 0.05). [score:5]
An ordinary Two-Way ANOVA revealed an overall effect of both gender and age on miR-133a and miR-133b expression (B,C) ([**] P < 0.01) and a significant interaction for miR-1 expression ([**] P < 0.01). [score:5]
5α-dihydrotestosterone regulates miR-133a, miR-133b, and miR-206 expression in human primary myocytes. [score:4]
When using Bonferroni multiple comparison post-hoc test it was demonstrated that miR-1 (A), miR-133a (B), and miR-133b (C) expression levels were higher in elderly compared to younger men ([*] P = 0.02, [*] P = 0.03, [***] P = 0.008, respectively) There was no effect of age or gender on mir-206 expression (D) (P > 0.05). [score:4]
miR-133a and miR-133b are down-regulated in castrated mice. [score:4]
miR-133a and miR-133b are down-regulated in testosterone blocked participants. [score:4]
Regardless of pre-exercise intervention level, training equalized the expression of miR-133a and miR-133b between healthy and LHR -treated participants to a lower level. [score:3]
In addition, miR-133a (F) and miR-133b (G) expression were negatively correlated with testosterone levels in men (n = 18) (P < 0.05, R [2] = 0.33 and P < 0.05, R [2] = 0.26). [score:3]
Bonferroni multiple comparison post-hoc tests revealed a significant lower expression of mir-133a (B) ([*] P = 0.02) and mir-133b (C) ([*] P = 0.03), but not mir-1 (A) or miR-206 (D) in testosterone blocked patients at rest before training. [score:3]
Gender and age affects miR-133a and miR-133b expression. [score:3]
In the current study, we found that the expression of miR-1, miR-133a, and miR-133b was higher in the skeletal muscle of elderly compared to younger men and that miR-133a/b was higher expressed in women compared to men. [score:3]
An unpaired t-test demonstrated a significant lower expression of mir-133a ([*] P < 0.05) and mir-133b ([***] P < 0.001) in the skeletal muscle of castrated mice. [score:3]
Drummond found that 18 miRNAs, including miR-133a and miR-133b, were differentially expressed. [score:3]
Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. [score:3]
Consistent with our findings in the LHRH-agonist treated men with low circulating testosterone, castrated mice had a lower expression of mir-133a (P < 0.05) and mir-133b (P < 0.001) (Figure 4A). [score:3]
Partly in line with our previous results (Nielsen et al., 2010), a Two-Way ANOVA (RM) demonstrated a main effect of training in terms of decreased expression in all four myomiRs (miR-1, P < 0.0001. miR-133a, P < 0.01. miR-133b, P < 0.0001, miR-206 P < 0.05). [score:3]
The observed effects of testosterone and age as inducers of miR-133a and miR-133b expression are seemingly in opposition. [score:3]
Surprisingly, a bonferroni multiple comparison test revealed reduced miR-133a/b expression (miR-133a, P = 0.02. miR-133b, P = 0.03. ) [score:3]
miR-1, miR-133a, miR-133b, and miR-206 belong to a group of muscle specific miRNAs (myomiRs) crucial for the regulation of skeletal muscle development and function (Chen et al., 2006; van Rooij et al., 2008). [score:3]
Interestingly, the women had a markedly increase in miR-133a and miR-133b expression compared to men. [score:2]
Consistent with the in vivo experiments suggesting a role for testosterone in regulating miR-133a/b, 5α-DHT incubation in culture increased miR-133a and miR-133b (P < 0.05) (Figure 5A). [score:2]
Insulin-like growth factor-1 receptor is regulated by microRNA-133 during skeletal myogenesis. [score:2]
We found an increased expression of miR-1 (P = 0.02), miR-133a (P = 0.03) and miR-133b (P = 0.008) in elderly men compared to younger men (Figures 1A–C). [score:2]
We thus show a physiological role of testosterone in the regulation of miR-133a and miR-133b in human and murine skeletal muscle. [score:2]
Five active ARE motifs have been experimentally identified and verified in the promoter region near the co-transcribed miR-206/miR-133b locus (Wyce et al., 2010). [score:1]
To address a potential involvement of miR-1, miR-133a, and miR-133b in the age-related decline in muscle function for both genders, we used a bonferroni multiple comparison post-hoc test. [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
In line with our previous findings (Nielsen et al., 2010) aerobic fitness in all subjects was negatively correlated with miR-1 and miR-133a and miR-133b (Figures 2A–C) (P < 0.05, 0.01 and 0.001, r [2] = 0.11, 0.24, and 0.33, respectively). [score:1]
miR-1, miR-133a, and miR-133b (A–C) were inversely correlated with maximal oxygen uptake in women and men (n = 36) (P < 0.05, 0.01 and 0.001, R [2] = 0.11, 0.24, and 0.33). [score:1]
A Two-Way ANOVA (RM) (miR-1, [****] P < 0.0001. miR-133a, [**] P < 0.01. miR-133b, [***] P < 0.001, miR-206 [*] P < 0.05). [score:1]
[1 to 20 of 32 sentences]
16
[+] score: 90
In our findings, the downregulation of miRs-133a and b started at 24 h and peaked at 2–3 days post the surgery, whereas miR-1 peaked already at 24 h. Thus, we suggest that the early expression of is necessary to contrast the caspase protein translation in all injured hearts (due to miR-133 downregulation). [score:11]
The miR-133 expression is regulated by extracellular signal-regulated kinase 1/2 activation and is inversely correlated with vascular growth [23], since it is strongly related to FGF-receptor expression [24]. [score:7]
a Expression of miR-1; b expression of miR-133a; c expression of miR-133b. [score:7]
Most of these genes were demonstrated to be, directly or indirectly, a target of miR-1 and miR-133a and miR-133b (ref. [score:5]
At 7 days after amputation (dpa), the level of miR-133 expression in the ventricle of the heart was lower than control individuals and suggested that miR-133 is an endogenous inhibitor of EC proliferation [25]. [score:5]
miR-133b is instead involved in the transition from endothelial to mesenchymal cells by blocking directly the expression of connective tissue growth factor (CTGF) In accordance with this finding, we have explored the possibility that the activation could be already between the 1 and 2 dpa. [score:4]
In endothelial cells, and thus also in endocardial cells, it was recently proven that the miR-133b is directly responsible for the repression of the connective tissue growth factor (CTGF) translation [51]. [score:4]
Particularly, miR-1, miR-133a and miR-133b have been detected in 1 dpa in different data sets of down-regulated transcripts. [score:4]
In zebrafish, transgenic-inducing elevation of miR-133 levels after injury provoked an inhibition of myocardial regeneration, while the knockout of miR-133 showed increased CM proliferation [30]. [score:4]
In particular, miR-1 and miR-133b have undergone a significant downregulation at 1 dpa. [score:4]
Xu C The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, and caspase-9 in cardiomyocytesJ. [score:3]
In zebrafish, miR-133 antagonism that occurred during FGF-receptor inhibition has accelerated the regeneration of appendage or heart damage through increased proliferation within the regeneration blastema [25]. [score:3]
Hearts were harvested from 24 h to 30 dpa, and analysed for miRs (miR-1 and miR-133a/miR-133b) by qPCR to know how their expression levels vary at different stages of regeneration. [score:3]
Also miR-133b has downregulated significantly already at 24 hpa (EPCs, 0.62 ± 0,096; RC 0.530 ± 0.010; P < 0.001) as compared to controls (EPCs, 1 ± 0.535; RC, 1.024 ± 0.062). [score:3]
Yang L Hou J Cui XH Suo LN Lv YW MiR-133b regulates the expression of CTGF in epithelial-mesenchymal transition of ovarian cancerEur. [score:3]
For example, among the target genes of miR-133, the genes for fibroblast growth factor receptor 1 (FGFR1) and protein phosphatase-2A-catalytic subunit (PP2AC, including Ppp2ca and Ppp2cb) seem to be promising to understand the possible induction. [score:3]
Again, the miR-133b could be a key miR because of its direct control on the CTGF protein, necessary to regulate the transition in endocardial cells from epithelial to mesenchymal elements. [score:3]
miR-1 is the most conserved miRNA during evolution [16], whereas a gene duplication probably has formed the miR-133 gene, which in fact is positioned in the same genetic locus of the miR-1 [31] and, in mammals, it regulates transcription of myoD [19]. [score:2]
Feng Y A feedback circuit between miR-133 and the ERK1/2 pathway involving an exquisite mechanism for regulating myoblast proliferation and differentiationCell Death Dis. [score:2]
Previous studies indicated that during myogenesis, the signalling pathway of MyoD are regulated by both miR-133a and miR-133b [24]. [score:2]
Even at 7 days, the expression of miR-133b is less than approximately 50% when compared to the control (0.574 ± 0.068) and it starts to grow until the regenertion is complete. [score:2]
Fig. 7 A proposed schematic mo del of miR-1 and miR-133 actions in blocking the FGF -dependent transduction pathway in the cells involved in cardiac regeneration: CMs, fibroblast, EPCs and endocardial cells. [score:1]
There are two members in the miR-133 family: miR-133a and miR-133b. [score:1]
Particularly, miR-133 has two isoforms, miR-133a and miR-133b, and their activity seems to be similar at the moment [23]. [score:1]
miR-133b (Fig.   1c) decreases by about 42% at 1 dpa (0.657 ± 0.00). [score:1]
miR-1/miR-133 are mainly implicated in post lesion in mammals as well as in zebrafish 14, 17, 22, 23. [score:1]
Recently, an involvement of miRs has been shown by the array analysis at 7 days post operation dpa [25], and in particular of miR-133 [31]. [score:1]
[1 to 20 of 27 sentences]
17
[+] score: 72
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm) In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm)In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
We also found that expression levels of ssc-miR-103 and ssc-miR-107 were slightly lower in Dpm than in other types of teeth, ssc-miR-133 a and ssc-miR-133b expression levels were much higher in Dpm than in other types of teeth, and ssc-miR-127 expression increased in Di, Dc, Dpm, and Dm, in that order. [score:7]
Of the five differentially expressed miRNAs that we identified, miR-133 (miR-133a and miR-133b), which is specifically expressed in muscles, is classified as a myomiRNA and is necessary for proper skeletal and cardiac muscle development and function [18]. [score:6]
In our study, they were also broadly expressed in all types of teeth at nearly every stage, but the complete lack of expression of ssc-miR-103 and ssc-miR-107 in Dpm during E40 and E50 is worthy of attention, as this could indicate that they exist in bidirectional antagonism with ssc-miR-133a and ssc-miR-133b during premolar morphogenesis in large animal species. [score:6]
Both ssc-miR-133a (Fig.   6G1–I4) and ssc-miR-133b (Additional file 6D1–F4) were strongly expressed in the epithelium and mesenchyme of Dpm, in contrast with the other three potentially differentially expressed miRNAs. [score:5]
Combined with the results of our current study, which showed that these two isomiRs are distinctly expressed in Dpm during E60 (late bell stage), we have reason to believe that ssc-miR-133a and ssc-miR-133b may be differentially expressed miRNAs in multiple pathways involved in bicuspid teeth morphogenesis. [score:5]
The present study indicated that these five miRNAs, including ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127, may play key regulatory roles in different types of teeth during different stages and thus may play critical roles in tooth morphogenesis during early development in miniature pigs. [score:3]
We then predicted that the miR-103, and miR-107, miR-133a, and miR-133b isomiRs would be differentially expressed miRNAs. [score:3]
Expression levels of five miRNAs (ssc-miR-103, ssc-miR-107, ssc-miR-127, ssc-miR-133a, and ssc-miR-133b) were detected by real-time RT-PCR and microarray chip. [score:3]
At E50, miR-133b expression in all four types of teeth stayed the same, but with a lower signal in the incisor (E1–E4). [score:3]
In another study, mmu-miR-133a and mmu-miR-133b were found to be highly expressed at E13.5 in the mouse molar [3]. [score:3]
Microarray, real-time RT-PCR, and in situ hybridization experiments revealed that ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127 may play more important roles in Di and Dc, Dpm, and Dm, respectively, during different developmental stages. [score:2]
We also suggested in a previous study that ssc-miR-133 may play key roles in miniature pigs’s tooth development [7]. [score:2]
By clustering analysis, we predicted 11 unique miRNA sequences that belong to mir-103 and mir-107, mir-133a and mir-133b, and mir-127 isomiR families. [score:1]
MiR-133 is one of tissue-specific miRNAs in tooth germ [4], and in Michon’s miRTooth1.0 Database (http://bite-it. [score:1]
This suggests that ssc-miR-133a and ssc-miR-133b may play more important roles in the early morphogenesis of premolar. [score:1]
For ssc-miR-133a and ssc-miR-133b, we chose the second deciduous premolar to contrast with the three kinds of tissues. [score:1]
[1 to 20 of 18 sentences]
18
[+] score: 70
Cell culture experiments have shown that miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 promotes cell proliferation by down-regulation of different target genes [10, 11]. [score:6]
These data are consistent with previous findings that miR-1 and miR-133 are expressed in very small amounts in the developing heart and skeletal muscle of embryonic day 13.5 (E13.5) and E16.5 in mice and their expression increases in neonatal heart and skeletal muscle [10]. [score:5]
Although miR-1, miR-133a, miR-133b and miR-206 genes have similar expression patterns, they have different targets and biological functions [4, 10]. [score:5]
Although miR-1, miR-133 and miR-206 are related in terms of expression, they have different targets, biological functions and transcriptional activation [4, 10, 14- 17]. [score:5]
miR-1 and miR-133 are highly expressed both in skeletal and cardiac muscles, whereas miR-206 is specifically expressed only in skeletal muscle [10, 11]. [score:5]
Restoration of decreased MyoD levels promotes muscle cell differentiation in vitro and increases miR-1, miR-133a, miR-133b and miR-206 gene expression in human foetal myoblastsForced expression of MyoD in non-muscle cells in culture can induce myogenic differentiation, whereas MyoD -null primary myoblasts exhibited reduced differentiation [26, 27]. [score:5]
There is currently no existing evidence about the expression of miR-1, miR-133a, miR-133b and miR-206 genes during the stages of human muscle development. [score:4]
Although miR-1, miR-133a, miR-133b and miR-206 have been extensively studied, there is no information about their expression during the development of human skeletal muscle. [score:4]
Although miR-1, miR-133a, miR-133b and miR-206 are well-studied in muscle, there is no information about their expression and function during human development. [score:4]
miR-1, miR-133a, miR-133b and miR-206 are expressed in muscle tissue and induced during muscle cell differentiation, a process that directs myoblasts to differentiate into mature myotubes, which are organized into myofibers. [score:4]
Restoration of decreased MyoD levels promotes muscle cell differentiation in vitro and increases miR-1, miR-133a, miR-133b and miR-206 gene expression in human foetal myoblasts. [score:3]
miR-1, miR-133a, miR-133b and miR-206 levels were low in undifferentiated myoblasts, signifying that they are not highly expressed during the stages before differentiation (Figure 2). [score:3]
Ectopic MyoD expression caused an induction of muscle cell differentiation in vitro, accompanied by an increase in the levels of miR-1, miR-133a, miR-133b and miR-206. [score:3]
miR-1, miR-133a, miR-133b and miR-206 were found to be expressed during muscle cell differentiation both in adult primary human myoblasts and adult mouse cell lines [10- 12]. [score:3]
miR-1, miR-133a, miR-133b and miR-206 levels are proportional to the stage of muscle development. [score:2]
We examined the levels of miR-1, miR-133a, miR-133b and miR-206 during the development of human foetus. [score:2]
presented in this study show that miR-1, miR-133a, miR-133b and miR-206 are induced during human muscle cell differentiation and their levels are increased proportionally to the stage of muscle foetal development. [score:2]
These results suggest a mechanism by which MyoD induces in vitro muscle cell differentiation in human foetal cells, accompanied by the induction of miR-1, miR-133a, miR-133b and miR-206 levels in vitro. [score:1]
Of these, the most extensively studied are miR-1, miR-133 and miR-206. [score:1]
In human and mouse, these miRNAs are encoded by three loci, each of which produces a bicistronic transcript, containing one miRNA from the miR-1/206 family and one from the miR-133 family (miR-133a, miR-133b) [10]. [score:1]
It can be therefore assumed that miR-1, miR-133a, miR-133b and miR-206 levels correlate with the induced in vitro differentiation of myoblasts to myotubes. [score:1]
The purpose of this study was to investigate the expression of miR-1, miR-133a, miR-133b and miR-206 at different stages of the human developing muscle and during differentiation in myoblast cell lines. [score:1]
[1 to 20 of 22 sentences]
19
[+] score: 53
Interestingly, we found that miR-21 (up-regulated) and miR-133b (down-regulated) are similarly deregulated in GC, suggesting that these miRNAs are possibly involved in regulating molecular targets commonly involved in UGCs irrespective of the site and etiology. [score:11]
The qRT-PCR analysis indicated that 2 miRNAs (miR-21 and miR-133b) were deregulated in both EAC and GC, and 6 miRNAs (up-regulated: miR-194, miR-31, miR-192, and miR-200a; down-regulated: miR-203 and miR-205) in EAC, as compared to BE but not in GC, indicating their potential unique role in EAC. [score:7]
We showed the up-regulation of miR-194, miR-192, miR-21, miR-31, and miR-200a (Figure 2, Table 3) and the down-regulation of miR-133b, miR-203, and miR-205 in EAC as compared to BE (Figure 3, Table 3). [score:6]
Our validation confirmed the up-regulation of miR-194, miR-192, miR-21, and miR-200a, and the down-regulation of miR-203, miR-205, miR-133b, and miR-31 in EAC as compared to NS. [score:6]
Although this is the first time showing deregulation of miR-133b in EAC, its down-regulation was reported in lung cancers. [score:5]
Two miRNAs (miR-21 and miR-133b) were significantly and similarly deregulated in both EAC and GC (Table 4, Figure 6), suggesting that these miRNAs regulate common pathways in UGCs. [score:3]
On the other hand, miR-133b, miR-200a, miR-205, and miR-203 did not display any significant differential expression between isolated BE and BE adjacent to HGD (Figure 8, Table 5). [score:3]
The log10 values of fold expression of the 8 miRNAs (miR-192, miR-200a, miR-194, miR-21, miR-203, miR-205, miR-31, and miR-133b) were used for hierarchical clustering. [score:3]
The reconstitution of miR-133b is correlated with reduced expression of MCL1 and BCL2L2, as well as enhanced apoptotic response upon exposure to gemcitabine [24]. [score:3]
miR-194, miR-192, miR-200a, miR-21, miR-203, miR-205, miR-133b, and miR-31 were selected for validation using 46 normal squamous (NS), 23 Barrett’s esophagus (BE), 17 Barrett’s high grade dysplasia (HGD), 34 EAC, 33 gastric adenocarcinoma (GC), and 45 normal gastric (NG) tissues. [score:1]
0064463.g003 Figure 3 The expression of 4 miRNAs (miR-205, miR-133b, miR-203, and miR-31) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
In addition, miR-133b sensitizes resistant HeLa and PC3 cells to tumor necrosis factor alpha (TNFα) and to TNF-related apoptosis-inducing ligand (TRAIL) [27]. [score:1]
The expression levels of the 2 miRNAs (miR-21, and miR-133b) were measured by means of qRT-PCR in 13 BE, 34 EAC, 45 NG, and 33 GC tissue samples. [score:1]
0064463.g006 Figure 6The expression levels of the 2 miRNAs (miR-21, and miR-133b) were measured by means of qRT-PCR in 13 BE, 34 EAC, 45 NG, and 33 GC tissue samples. [score:1]
The expression of 4 miRNAs (miR-205, miR-133b, miR-203, and miR-31) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
[1 to 20 of 15 sentences]
20
[+] score: 50
Among 154 coexpressed miRNAs, five mature miRNAs (dme-miR-1008-5p, dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p, dme-miR-932-5p) were differentially expressed between PD and control groups (p<0.05) (Table 2 and S5 Table). [score:5]
Midbrain dopamine neuron (DA) specific miR-133b was found to target paired-like homeodomain transcription factor (Pitx3) and regulate DA neurons differentiation and activity [55]. [score:4]
As four of the dysregulated miRNAs in PD flies including dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p and dme-miR-932-5p were brain enriched, we predicted targets of them and then submit to DAVID for Gene Ontology analysis (Fig 6 and S7 Table). [score:4]
Among the dysregulated miRNAs, miR-13b, miR-133 and miR-137 were highly conserved from Drosophila to H. sapiens and their expression was validated by qRT-PCR. [score:4]
By targeting Pitx3, miR-133b was found to regulate the maturation and function of midbrain dopaminergic neurons, contributing to PD pathogenesis [55]. [score:4]
Our study using high throughput sequencing of miRNAs identified miR-13b, miR-133, miR-137, miR-932 and miR-1008 consistently upregulated in early stage PD flies. [score:4]
We found that five miRNAs (dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p, dme-miR-932-5p, dme-miR-1008-5p) were upregulated in PD flies. [score:4]
0137432.g005 Fig 5 qRT-PCR were performed to validate the expression of dme-miR-13b-3p, dme-miR-133-3p and dme-miR-137-3p in control and PD flies. [score:3]
qRT-PCR were performed to validate the expression of dme-miR-13b-3p, dme-miR-133-3p and dme-miR-137-3p in control and PD flies. [score:3]
Lgr3 (Relaxin receptor) and AR2 (Galanin receptor) were predicted to be targeted by miR133-3p and miR-13b-3p respectively. [score:3]
Morphine regulates dopaminergic neuron differentiation via miR-133b [61]. [score:2]
Morphine regulates dopaminergic neuron differentiation via miR-133b. [score:2]
Exosomes containing miR-133b from mesenchymal stem cells (MSCs) regulate neurite outgrowth of neural cells [60]. [score:2]
Using high throughput small RNA sequenceing technology, we measured miRNA expression profiles of early stage PD flies and identified five dysregulated mature miRNAs (miR-13b, dme-miR-133, dme-miR-137, miR-932 and miR-1008). [score:2]
Among them, miR-13b, miR-133, miR-137 are brain enriched and highly conserved from Drosophila to Homo sapiens. [score:1]
Among them, dme-miR-133-3p, dme-miR-137-3p and dme-miR-13b-3p (the mature sequence both for dme-mir-13b-1 and dme-mir-13b-2) were highly conserved from flies to humans and enriched in nervous system. [score:1]
In addition to its physical functions, miR-133b is essential for functional recovery after spinal cord injury in adult zebrafish [62]. [score:1]
MiR-133a and miR-133b are human orthologs of dme-miR-133 and enriched in human brain. [score:1]
[1 to 20 of 18 sentences]
21
[+] score: 47
miR-30b could be a potential biomarker of ACVIM stage B heart failure in Dachshunds and miR-133b could be a potential biomarker of ACVIM stage C. The lack of expression of miR-208a and 208b in healthy dogs and dogs with heart disease and lack of significant changes in expression in the remaining 5 miRNAs which are potential biomarkers of heart diseases in humans proves that the findings in human medicine are not always directly reflected in veterinary medicine. [score:10]
miR-30b was downregulated in ACVIM stage B dogs when compared to ACVIM stage A dogs (this miRNA also showed a downregulatory trend in ACVIM stage C dogs) and miR-133b was downregulated in ACVIM stage C dogs. [score:9]
miR-30b could be a potential biomarker of ACVIM stage B heart failure in Dachshunds with endocardiosis and miR-133b could be a potential biomarker of ACVIM stage C. The lack of expression or lack of significant changes in expression in 7 miRNAs which are potential biomarkers of heart diseases in humans proves that findings from human medicine are not always directly reflected in veterinary medicine. [score:8]
miR-30 and miR-133 are cardiomyocyte-enriched miRNAs which regulate connective tissue growth factor (CTGF)–a key molecule in the process of fibrosis and therefore an attractive therapeutic target of heart diseases. [score:6]
Thus we concluded that the cause of the changed expression of miR-30b and miR-133b in our study was the stage of the disease, not the age of the animals. [score:5]
The second miRNA with decreased levels in our study–miR-133 was also downregulated in human infarcted heart tissue [28]. [score:4]
1: The expression of miR-21, miR-29, miR-30b, miR-133b, miR-126, miR-423 and miR-125 in dogs with heart failure divided into groups based on age (fold changes relative to youngest group; mean ± SEM). [score:3]
Another study showed that the level of miR-133 in the plasma of patients with acute coronary syndrome was associated with high-sensitivity troponin T levels [35]. [score:1]
The biggest differences were observed in case of miR-133b. [score:1]
[1 to 20 of 9 sentences]
22
[+] score: 43
Furthermore, miRNA-1 and miRNA-133 genes are direct transcriptional targets of muscle differentiation regulators including serum response factor, MyoD or Mef2, suggesting a common set of regulatory elements that control cardiac and skeletal muscle development [41, 42]. [score:7]
Interestingly, in a rabbit mo del of diabetes, miRNA-133 was shown to be up-regulated in the heart in association with increased expression of serum response factor, which is known to be a transactivator of miRNA-133 [89]. [score:6]
Muscle-specific miRNAs, miRNA-1 and miRNA-133 in addition to their role in cardiac development have been shown to be significantly up-regulated in ischaemic injury in the heart in both rodents and humans [75, 80, 81]. [score:5]
A recent study has shown that hyperglycemia augmented expression of miRNA-1 and miRNA-133 in human cardiac progenitor cells associated with suppressed KCNE1 and KCNQ1 and significant reduction in the functional I [Ks] current [91]. [score:5]
Xiao J. Luo X. Lin H. Zhang Y. Lu Y. Wang N. Zhang Y. Yang B. Wang Z. MicroRNA miR-133 represses HERG K [+] channel expression contributing to QT prolongation in diabetic hearts J. Biol. [score:3]
Furthermore, addition of miRNA-1 and miRNA-133 antagomirs diminished the inhibitory effect of high glucose on KCNE1 and KCNQ1 and restored the potassium current I [Ks] [92]. [score:3]
In another study, Duisters et al. (2009) [79] has demonstrated that miRNA-133 and miRNA-30, both consistently down regulated in several mo dels of pathological hypertrophy and heart failure, regulate connective tissue growth factor (CTGF), a key molecule involved in fibrosis. [score:3]
These studies indicate that miRNAs, miRNA-208, miRNA-23a, miRNA-24, miRNA-125, miRNA-21, miRNA-129, miRNA-195, miRNA-199, and miRNA-212 are frequently increased in response to cardiac hypertrophy, whereas, miRNA-29, miRNA-1, miRNA-30, miRNA-133, and miRNA-150 expression are often found to be decreased. [score:3]
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
Duisters R. F. Tijsen A. J. Schroen B. Leenders J. J. Lentink V. van der Made I. Herias V. van Leeuwen R. E. Schellings M. W. Barenbrug P. miR-133 and miR-30 regulate connective tissue growth factor: Implications for a role of microRNAs in myocardial matrix remo deling Circ. [score:2]
Yin V. P. Lepilina A. Smith A. Poss K. D. Regulation of zebrafish heart regeneration by miR-133 Dev. [score:2]
The authors further show that miRNA-133 represses ERG (ether-a-go-go-related gene) leading to depressed I [Kr], slow repolarization and QT prolongation associated with arrhythmias in diabetic hearts. [score:1]
[1 to 20 of 12 sentences]
23
[+] score: 38
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 MiRNAs are small, 19–23 nucleotide non-coding RNAs that function as post-transcriptional repressors of gene expression, either through messenger RNA (mRNA) degradation or translational repression (Bartel, 2009). [score:14]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 Using microarray analysis, the expression profile of murine miRNAs in the developing lip and PS were analyzed from E10 to E14 (Mukhopadhyay et al., 2010; Warner et al., 2014). [score:12]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 CS, CC, JV: Conception of the work, drafting of the manuscipt, revision of the manuscript, final approval of the manuscript. [score:10]
However, several additional miRNAs were identified including miR-23b and miR-133b. [score:1]
MicroRNA profiling during craniofacial development: potential roles for Mir23b and Mir133b. [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 38
miR-133 also inhibits the translation of polypyrimidine tract -binding protein (nPTB), which controls differential transcript splicing during skeletal-muscle differentiation [20]. [score:5]
We have previously reported that the expression of muscle-specific miR-1 and miR-133 is induced during skeletal muscle differentiation and miR-1 and miR-133 play central regulatory roles in myoblast proliferation and differentiation in vitro. [score:4]
Furthermore, miR-1 and miR-133 are also important regulators of cardiomyocyte differentiation and heart development [22- 24]. [score:3]
We found that the expression levels of miR-1, miR-133 and miR-206 were higher in the skeletal muscle of one month-old mdx mice (Figure 1A). [score:3]
A subset of miRNAs, miR-1, miR-133, miR-206 and miR-208, are either specifically or highly expressed in cardiac and skeletal muscle and are called myomiRs [6, 7, 13]. [score:3]
Among them, miR-133 was shown to promote the proliferation of myoblasts and inhibits their differentiation in cultured skeletal muscle myoblasts. [score:3]
Additionally, embryonic stem (ES) cell differentiation towards cardiomyocytes is promoted by miR-1 and inhibited by miR-133 [22]. [score:3]
Recently, miR-133 genes (miR-133a-1 and miR-133a-2) were knocked out from the mouse genome. [score:2]
Paradoxically, miR-1 and miR-133 exert opposing effects to skeletal-muscle development despite originating from the same miRNA polycistronic transcript. [score:2]
Normal skeletal muscle development in miR-133 transgenic mice. [score:2]
miR-133 enhances myocyte proliferation, at least in part, by reducing protein levels of SRF, a crucial regulator for muscle differentiation [18, 19]. [score:2]
In order to further investigate the function of miR-133 in vivo, we took a gain-of-function approach and generated transgenic mice to overexpress miR-133a-1 in skeletal muscle. [score:1]
Our results are consistent with a recent report in which miR-133 loss-of-function mice did not induce overt defects in skeletal muscle [24]. [score:1]
Among them, miR-1, miR-133, miR-206, miR-208 and miR-499 have been described as muscle specific miRNAs, or myomiRs [6, 13]. [score:1]
In this study, we attempted to determine the function of miR-133 in skeletal muscle. [score:1]
Interestingly, miR-1 and miR-133 also produce opposing effects on apoptosis [21]. [score:1]
Hematoxylin and eosin (H&E) staining for skeletal muscle tissue sections of diaphragm from 6 month old wild type (Wt) and miR-133a transgenic mice (MCK-miR-133). [score:1]
[1 to 20 of 17 sentences]
25
[+] score: 36
Since miR-133 has been recently implicated in the regulation of brown adipose differentiation by directly targeting PRDM16, a master transcription factor for brown adipogenesis [53], and there are common Myf5 positive progenitor cells for brown fat and skeletal muscle during embryonic development, miR-133 likely participates in regulating the adipogenic/myogenic fate determination in such progenitor cells [54]. [score:7]
Interestingly, although miR-133 is also upregulated during C2C12 differentiation and muscle regeneration, it promotes myoblast proliferation by inhibiting serum responding factor (SRF) [26]. [score:6]
In contrast, miR-133 inhibits myogenic differentiation and sustains myoblast proliferation by inhibiting SRF, as mentioned above. [score:5]
Interestingly, HuR, an RNA binding protein that stabilizes the mRNAs of several myogenic factors during muscle differentiation, is a target of miR-133. [score:3]
Since SRF is directly involved in the regulation of miR-1/miR-133a transcription [26, 28, 42], miR-133 and SRF form a negative feedback circuit that balances myoblast proliferation and differentiation. [score:3]
While both the miR-1/miR-206 family and miR-133 family of miRNAs become enriched in myocytes during differentiation, likely via MyoD- and/or myogenin -dependent transcriptional regulation, their effects and mode of action on myogenesis are different. [score:2]
Therefore, there is a delicate and complex regulatory circuit between linc-MD1, miR-133, and HuR, which is critical for appropriate muscle differentiation. [score:2]
Linc-MD1 is required for appropriate muscle differentiation, at least in part because it regulates the levels of Myocyte Enhancer Factor 2C (MEF2C) and Mastermind-like protein 1 (MAML1), via the mechanism of sponging endogenous miR-133 and miR-135 in cytoplasm [165]. [score:2]
Studies using mice lacking both miR-133a-1 and miR-133a-2 (miR-133 d KO) reveal an important role of miR-133a in muscle pathophysiology [101]. [score:1]
Similar to H19, linc-MD1 can also serve as a pre-miRNA transcript, as it encodes miR-133b [165]. [score:1]
Many MyomiRs and muscle-enriched miRNAs, such as miR-1, miR-133, and miR-206, are all increased in the serum of DMD patients and/or in muscle tissues of mdx mice [89– 96]. [score:1]
The miR-1/206 family is transcribed from three different chromosomal loci in the form of bicistronic transcripts with miRNAs in the miR-133 family (miR-133a-1, miR-133a-2, and miR-133b) [28, 33, 36]. [score:1]
Linc-MD1 is encoded by a genomic locus that overlaps with the bicistronic miR-206 and miR-133b transcript-coding region [165]. [score:1]
In fact, miR-133 was recently found to control the brown adipose fate determination of satellite cells [55]. [score:1]
[1 to 20 of 14 sentences]
26
[+] score: 34
miR-133a/miR-133b have a dual role being essential for myogenesis and suppressing osteogenesis through targeting of runt-related transcription factor 2 (RUNX2), and are downregulated in BMP2 -induced osteogenesis of premyoblast mesenchymal cells [44]. [score:8]
miR-133b was expressed at low or undetectable level in most of the clinical samples, and was the strongest downregulated miRNA compared to bone. [score:5]
All of the miRNAs that were confirmed downregulated in clinical samples compared to bone are known to act as tumor suppressors in other types of cancers, that is miR-1, miR-126/miR-126*, miR-133b, miR-144, miR-195, miR-223 and miR-497 [38], [39], [40], [41], [42], [43]. [score:5]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
RUNX2 does not seem to be reduced at the mRNA level by miR-133 in our study, which may be explained by the high amplification frequency (68%) of RUNX2 observed in our cell lines, as previously reported [46]. [score:1]
These 13 miRNAs include all the above seven miRNAs (omitting miR-31*) previously described in osteoblasts [8] as well as miR-1, miR-18a, miR-18b, miR-19b, miR-133b and miR-144. [score:1]
The level of change was significant for nine of these miRNAs; miR-1, miR-9, miR-18a, miR-18b, miR-126, miR-133b, miR-144, miR-195 and miR-223. [score:1]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
miR-133b showed a trend towards being significantly decreased, being undetected in two clinical samples and all osteoblasts. [score:1]
miR-133b was not detected in the osteoblasts. [score:1]
[1 to 20 of 12 sentences]
27
[+] score: 34
The results showed that 5 miRNAs (miR-130b-5p (formerly designated as miR-130b*), miR-196a, miR-455-3p, miR-455-5p, and miR-801) or 2 miRNAs (miR-133b and miR-145) were significantly up-regulated or down-regulated, respectively in laryngeal cancers (Figure 1A). [score:7]
Down-regulation of miR-133b was reported in colorectal [36], bladder [34], and tongue [51] cancer. [score:4]
The potential target of the miR-133b has been reported to be oncogenic KRAS [36]. [score:3]
Statistically significant differences of the expression levels of miR-196a, miR-455-5p, and miR-133b were observed between matched pairs. [score:3]
Furthermore, expression levels of miR-196a and miR-455-5p were significantly higher in cancer tissues when compared with neighboring controls (miR-196a, p = 0.0460; miR-455-5p, p = 0.0286) (Figure 2A), while expression level of miR-133b was significantly lower in cancer samples compared with controls (p = 0.0274) (Figure 2B). [score:3]
Furthermore, the proto-oncogene YES1 and the transduction protein MAP3K3 were reported to be common potential targets of miR-133b and miR-145 [36]. [score:3]
Significant expressional differences between matched pairs were reproduced in miR-133b, miR-455-5p, and miR-196a, among which miR-196a being the most promising cancer biomarker as validated by qRT-PCR analyses on additional 84 tissue samples. [score:3]
Although miR-133b showed significantly lower expression levels when cancer samples were compared with matched noncancerous laryngeal tissues (Figure 2B), expression level of this miRNA was not significantly lower in cancer samples when compared with noncancerous other tissues (noncancerous counterparts and benign laryngeal tissues, p = 0.8353; dysplasias, p = 0.2185) in the study using multiple samples (Figure 3B). [score:3]
Compared with previous studies in HNSCC, we found similar trend of deregulation in miR-133b [51], while 3 other miRNAs found to be deregulated in laryngeal cancer were not reported before. [score:2]
Thus, of these 4 miRNAs, 3 miRNAs (i. e., miR-196a, miR-455-5p and miR-133b) showed significantly different expression levels in cancer tissues when compared with their matched control tissues and further quantification of miRNAs was performed using 48 laryngeal samples. [score:2]
Thus, qRT-PCR analysis was performed on residual 4 miRNAs (i. e., miR-130b-5p, miR-196a, miR-455-5p, and miR-133b). [score:1]
[1 to 20 of 11 sentences]
28
[+] score: 33
Previous reports have demonstrated that β-adrenergic stimulation suppresses microRNA-133 (miR-133) expression in a myocyte enhancer factor 2 (Mef2c) -dependent manner, which results in direct de-repression of PRDM16 expression in brown adipose tissue (BAT) [42– 45]. [score:8]
β-adrenergic stimulation after cold exposure is reported to suppress myocyte enhancer factor 2 (Mef2) expression, which results in remarkable downregulation of microRNA-133 (miR-133) in BAT [42, 44]. [score:8]
The downregulation of mir-133 directly de-repression of PRDM16 expression [43, 45]. [score:7]
EPO upregulates PRDM16 via β-adrenergic receptor/Mef2c/ miR-133 cascade of interscapular brown adipose tissue (iBAT) in high-fat diet induced obese mice. [score:4]
These data suggest that EPO upregulates PRDM16 through EpoR/STAT3 and β-adrenergic receptor/Mef2/miR-133 signaling pathway, which results in the enlargement of iBAT mass. [score:4]
Effect of erythropoietin (EPO) on the β-adrenergic receptor/Mef2/miR-133 pathway in interscapular BAT. [score:1]
In summary, we found that: 1) EPO facilitates energy expenditure by increasing classical BAT mass; 2) EPO stimulates EpoR/STAT3 and β-adrenergic receptor/Mef2c/miR-133 pathways, resulting in enhancement of PRDM16 of classical BAT; 3) EPO promoted secretion of classical BAT’s derived-FGF21; and 4) EPO ameliorated obesity and glucose homeostasis in high-fat diet -induced obese mice. [score:1]
[1 to 20 of 7 sentences]
29
[+] score: 32
Two of them, miR-133b and miR-145 were down-regulated and the remaining four, miR-31, miR-96, miR-135b and miR-183, were up-regulated, suggesting that they may potentially act as tumor suppressor genes or oncogenes, respectively. [score:9]
For both down-regulated miRNAs (miR-145 and miR-133b), it may be expected that potential targets could include oncogenes or genes encoding proteins with potential oncogenic functions. [score:6]
Among putative targets of miR-133b, the most notable oncogenic target is KRAS. [score:5]
Among the differentially expressed miRNAs, miR-31, miR-96, miR-133b, miR-135b, miR-145 and miR-183 as the most consistently deregulated in CRC. [score:4]
Other important down-regulated miRNA in our study was miR-133b. [score:4]
Interestingly, the proto-oncogen YES1 and the transduction protein MAP3K3 were potential targets of both miR-145 and miR-133b. [score:3]
Mean fold-change (log [10] RQ) CRC patients samplesMean fold-change (log [10]RQ) CRC cell lines Chromosome localization Correlation with cancer hsa-miR-133b -1.01 -3.38 6p12.2 hsa-miR-145 -0.84 -4.95 5q32 ↓ CRC, lung, breast cancer. [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 32
While it cannot be totally excluded that the age-related or age-limited changes are due to disease status per se, the changes in the expression of these miRNAs with age seem not to be simply due to the disease status for the following two considerations: (a) the heat maps of the differentially expressed miRNAs (Figs 2 and 3) show that the age effect is much stronger than disease effect; and (b) in view of the direction of gene expression changes, except miR-652, miR-28-5p, miR-133b, and miR-7, the age effect on the expressions of other 12 disease-related miRNAs would be under-estimated rather than over-estimated. [score:18]
For example, among the 23 miRNAs with age-limited expression and 101 differentially expressed miRNAs, one (miR-652) was up-regulated in schizophrenia (Lai et al., 2011), and three others were either down-regulated (miR-152) or up-regulated (miR-133b and miR-7) in bronchopulmonary dysplasia (Wu et al., 2013), all in peripheral blood. [score:14]
[1 to 20 of 2 sentences]
31
[+] score: 30
Only 26 (6%) of the total 402 TGGTCCC human miR-133a-3p isomiR targets overlapped with the predicted targets for the abundant human miR-133a-5p, and similarly, 30 (6%) of the total 502 TTGGTCC isomiR targets overlapped with those predicted for human miR-133-5p. [score:7]
Verified mRNA targets of miR-1 and miR-133 include those encoding proteins that are involved in cardiac development, ion channel function, hypertrophy, and fibrosis [11- 16]. [score:4]
In human and murine atrial tissues, miR-133 was the most highly expressed miRNA, comprising approximately 20% of all miRNA sequences. [score:3]
Altered expression of miR-133 itself has been observed in cardiac tissues from patients with AF [18, 19], and conditions that predispose to AF, such as atrial dilation, ventricular hypertrophy, and myocardial ischemia [12, 31]. [score:3]
Altered levels of miR-1 and miR-133 have been observed in atrial tissue samples from patients with AF in several studies [17- 19]. [score:1]
MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B were re-sequenced in DNA samples from family probands. [score:1]
MIR133B is on chromosome 6 and is paired with another muscle-specific miRNA gene, MIR206. [score:1]
We re-sequenced the MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B genes, that encode the cardiac-enriched miRNAs, miR-1 and miR-133, in 120 individuals with familial atrial fibrillation and identified 10 variants, including a novel 79T > C MIR133A2 substitution. [score:1]
MiR-1 and miR-133 sequence variants. [score:1]
The muscle-enriched miRNAs, miR-1 and miR-133, are amongst the most abundant of the miRNAs present in the normal heart [9, 10]. [score:1]
Two genes, MIR1-1 and MIR1-2, encode miR-1-1 and miR-1-2, while three genes, MIR133A1, MIR133A2, and MIR133B, encode miR-133a-1, miR-133a-2, and miR-133b, respectively. [score:1]
MiR-133a-1 and miR-133a-2 have identical mature sequences, with miR-133b differing only by a single nt at the 3 [′] end. [score:1]
In this study, we hypothesized that genetic variation could alter the functional effects of miR-1 and miR-133 and contribute to AF pathogenesis. [score:1]
Amplification was carried out using FastStart Taq DNA Polymerase with the same cycling condictions as described for MIR1-1, MIR133A2 and MIR133B above. [score:1]
The 5 loci encoding miR-1 and miR-133 precursor transcripts were re-sequenced in 120 probands with a family history of AF. [score:1]
Cycling conditions for MIR1-1, MIR133A2 and MIR133B are as follows: 94°C (3 min), then 35 cycles of 94°C (20 s), 55°C (30 s), 72°C (60 s) and finally 72°C (8 min). [score:1]
To test this hypothesis, we performed genetic screening of the MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B genes in a cohort of probands with suspected familial AF. [score:1]
[1 to 20 of 17 sentences]
32
[+] score: 30
In particular, a muscle-specific lncRNA, linc-MD1, sponges miR-133 to regulate the expression of MAML1 and MEF2C, transcription factors that activate muscle-specific gene expression. [score:6]
Conversely, overexpression of miR-133 and miR-30c repressed the production of collagens, which was accompanied with a decrease in CTGF expression levels. [score:5]
For instance, it has been reported that miR-1 and miR-133, two most commonly expressed miRNAs in striated muscle, target several ion channel and gap-junction associated genes, such as HCN2, HCN4, KCNJ2, ERG and GJA1 (Cx43) [42]. [score:5]
Both miR-133 and miR-30 were found consistently down-regulated in several mo dels of heart failure and pathological hypertrophy. [score:4]
Duisters R. F. Tijsen A. J. Schroen B. Leenders J. J. Lentink V. van der Made I. Herias V. van Leeuwen R. E. Schellings M. W. Barenbrug P. miR-133 and miR-30 regulate connective tissue growth factor: Implications for a role of microRNAs in myocardial matrix remo deling Circ. [score:2]
Duisters et al. showed that miR-133 and miR-30 were involved in myocardial matrix remo deling through regulating CTGF [33]. [score:2]
However, it was reported in a separated study that a combination of miR-1, miR-133, miR-208, and miR-499 was able to directly induce the cellular reprogramming of fibroblasts into cardiomyocyte-like cells in vitro [18]. [score:2]
It was found that HuR, which is under the repressive control of miR-133, is derepressed due to the sponging activity of linc-MD1 on miR-133. [score:1]
Furthermore, it has been reported that several circulating miRNAs, such as miR-133, miR-1291, miR-663b, miR-328, and miR-134, exhibit clinical impact on human myocardial infarction [47, 48]. [score:1]
Peng L. Chun-guang Q. Bei-fang L. Xue-zhi D. Zi-hao W. Yun-fu L. Yan-ping D. Yang-gui L. Wei-guo L. Tian-yong H. Clinical impact ofcirculating miR-133, miR-1291 and miR-663b in plasma of patients with acute myocardial infarction Diagn. [score:1]
They treated human fibroblasts with four transcriptional factors, GATA-4, Hand2, Tbx5 and Myocardin [20], together with two miRNAs, miR-1 and miR-133. [score:1]
[1 to 20 of 11 sentences]
33
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
A few notable exceptions are miR-499, an miRNA abundantly expressed in the heart (Figure 2A), which is represented by only one read (Table 2), and the miR-133 family, which is preferentially and abundantly expressed in the heart (Figure 2), and represented by only 7 reads (Table 1). [score:5]
The expression patterns of miR-1 and miR-133 largely overlapped in many tissues examined in this study (Figure 2). [score:3]
These two miRNA genes – miR-1 and miR-133 – exist as a cluster and thus are always expressed together in mouse [42]. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
Like miR-1, miR-133 is a muscle-specific miRNA (Figure 2) because of its abundant expression in many other muscular tissues such as heart and skeletal muscle [45, 46]. [score:3]
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
For instance, miR-133 is represented only by 4 clones (two reads each for 133a and 133b) in our sequences, which indicates a 100-fold lower expression level compared with that of miR-1 family, if cloning frequency taken as a measure of expression. [score:2]
The discrepancies between the cloning frequency and small RNA blot results for miRNA-1 and miR-133 could not be attributed to the RNA source because the same RNA samples were used for both experiments (cloning and small RNA blot analysis). [score:1]
We also used approximately a similar amount (activity) of [32]P -labelled probe for detection of miR-1 and miR-133. [score:1]
However, our small RNA blot analysis indicated a different picture as miR-133 was detected as abundantly as miR-1 in the heart (Figure 2). [score:1]
[1 to 20 of 11 sentences]
34
[+] score: 25
Investigation of cardiac miRNA differentially expressed in HF and HF-R by miRNA array analysis followed by qPCR validation identified 10 miRNAs significantly up-regulated in HF, namely miR-133b-3p, -208b-3p, -125a-5p, -125b-5p, -126-3p, -21-5p, -210-3p, -29a-3p, -320a and -494-3p, all of which returned towards normal levels following HF-R. NGS is a powerful technique in the discovery of novel miRNAs. [score:4]
Of these, miR-208b-3p and miR-133b-were significantly up-regulated in HF and returned towards normal levels in HF-R (Fig.   5A). [score:4]
Validation of a selected few by qPCR identified 10 miRNAs - miR-133b-3p, miR-208b-3p, miR-21-5p, miR-125a-5p, miR-125b-5p, miR-126-3p, miR-210-3p, miR-29a-3p, miR-494-3p and miR-320a, that were significantly up-regulated in HF myocardium compared to normal controls. [score:3]
Four myocardial-enriched miRNAs, miR-1, miR-133, miR-499 and miR-208, were confirmed to be highly expressed in ovine heart tissue. [score:3]
For the first time we report that not only are the four cardiac-enriched miR-1, miR-133, miR-499 and miR-208 highly expressed in sheep LV, but also provide information on their isomiRs. [score:3]
In this study, NGS detected high counts of oar-miR-133, while array yielded high expression of hsa-/mmu-/rno-miR-133a-3p, which is one nt longer at the 5′ end compared to oar-miR-133. [score:2]
Oar-miR-133 is currently the only cardiac specific miRNA listed in miRBase 21. [score:1]
Oar-miR-133 was the main form in sheep heart, while hsa-/mmu-/rno-miR-133a-3p and-5p and hsa-/mmu-/rno-miR-133b were detected at much lower counts. [score:1]
Of these, oar-miRNA-133 is the only one presently recorded in miRBase (v21). [score:1]
MiR-1, miR-133, miR-499 and miR-208 are highly enriched myocardial miRNAs 27, 28 and are highly conserved across multiple species including human [29], mouse [30] rat [31] and porcine [32]. [score:1]
Cardiac-enriched miR-1-3p, miR-133a-3p, miR-133b-3p, miR-208b-3p and miR-499-3p were screened. [score:1]
The most abundant cardiac-specific miRNA-133 in the sheep heart was oar-miR-133 which has one nt different from hsa-/mmu-/rno-miR-133a-3p (previously hsa-miRNA-133). [score:1]
[1 to 20 of 12 sentences]
35
[+] score: 25
Comparison of female patients with female controls resulted in significant 5.4 fold upregulation of miR-206 (p = 0.02), 2-fold upregulation of miR-133b (p = 0.03) and 1.4 fold upregulation of miR-145 (p = 0.04) (Figure S5B). [score:10]
Here, however, miR-206 upregulation in SOD1-G93A mice was not associated with miR-133b upregulation at any stage. [score:7]
Increase in circulating myomirs miR-1, miR-133a, miR-133b and miR-206 have been demonstrated in various mo dels of striated muscle pathologies [41], [53], [57] whereas they are frequently downregulated in cancer [58]. [score:4]
miR-206 and miR-133b are clustered, and their co -expression as bicistronic transcript in myogenic conversion in vitro and in denervation in vivo has been documented [44], [50]. [score:3]
Additionally, miR-133b that was not altered in the arrays was selected for its known function in muscle biology. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 24
A. Expression of miR-21 and miR-23a, B. Expression of miR-30b and miR-130a, C. Expression of miR-133b and miR-191, D. Expression of miR-204 and miR-208b. [score:9]
Our data also revealed another set of miRNAs that include miR-133b, miR-204 and miR-208b which were significantly upregulated in all moderate PH subjects but, showed further increment in severe PH subjects. [score:4]
The expression of miR-130a, miR-133b and miR-191 were increased significantly in all PH subjects and, showed further pronounced in severe PH subjects. [score:3]
It is of note that the expression of miR-133b, miR-191 and miR-204 were not significant in severe PH subjects, compared to their moderate counterparts. [score:2]
In moderate PH subjects, the expression of miR-133b was 2.70±1.07-fold and 3.96±1.63-fold (p = ns) in moderate and severe PH subjects, compared to the control subjects. [score:2]
In contrast, miR-21, miR-133b, miR-191and miR-208b showed enhanced expression in the female subjects, compared to the male counterpart (Fig. 5). [score:2]
From this study, we present evidence that a set of increased plasma miRNA level that include miR-21, miR-130a, miR-133b, miR-191, miR-204 and miR-208b, can be used as biomarker for assessment of PH. [score:1]
Mi-130a, mir-133b, miR-191, miR-204 and miR-208b are highly elevated in PH subjects. [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 22
This causes increased expression of miR-133 target genes such as cx43 (Yin et al., 2012; Banerji et al., 2016). [score:5]
Although rescue using Tg(hsp70:miR-133sp [pd48]) supports our mo del that cx43 is functionally activated downstream of Esco2 and Smc3, because miR-133 has multiple targets (Yin et al., 2008), we cannot rule out the possibility that a different target gene is responsible for the rescue. [score:5]
In this line, heat shock induces expression of the miR-133 target sequence fused to EGFP and therefore sequesters the miR-133. [score:5]
Knocking down miR-133 (which targets cx43 for degradation) via the ‘sponge’ transgene (three miR-133 binding sites) results in the increase of cx43 levels (Yin et al., 2012). [score:4]
Regulation of zebrafish heart regeneration by miR-133. [score:2]
Fgf -dependent depletion of microRNA-133 promotes appendage regeneration in zebrafish. [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 22
Interestingly, whereas these 4 miRNAs are dramatically up-regulated during myoblasts differentiation [24], they do not have the same expression profile during human muscle development: miR-1 progressively increased during development, miR-133a/miR-133b were highly expressed from 16 weeks of development until birth and miR-206 was expressed at a similar level at all development stages studied (Fig. 1). [score:14]
Our results therefore seem to suggest a different function for miR-133 during human muscle development, as opposed to previous studies in animal mo dels, reinforcing the concept of species-specific miRNA signatures during skeletal muscle development. [score:3]
Since we analyzed whole human biopsies isolated after myotube formation, a high expression of miR-133 was not expected. [score:3]
The best-studied myomiRs are the miR-1/miR-206 and miR-133a/miR133-b families. [score:1]
In muscle cell cultures, miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 promotes myoblast proliferation [25]. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 21
Over -expression of miR-1 [55] or miR-206 [86] in mouse myoblasts accelerates differentiation into myotubes whereas over -expression of miR-133 promotes proliferation [55]. [score:5]
CDC42 and PTBP1 were selected for study because they ranked highly as targets of miR-133/miR-206 in the TargetScan database and both proteins are relevant for muscle cell differentiation and metabolism [57, 58]. [score:5]
ANOVA indicated that miR-133a (F = 11.8, P < 0.0001) was significantly different between the three groups, miR-206 expression more modestly altered (F = 4.5, P = 0.02) and miR-1 and miR-133b were unchanged (Figure 2c). [score:3]
The steady state level of pre-miR-133 was very low in human skeletal muscle compared with the signal from the mature miR-133a/b expression transcript (Figure S3 in Additional file 1). [score:2]
Interestingly, reduction in miR-133a using an antagomir (Figure S4A in Additional file 1) had an indirect effect on the other myomirs, such that miR-133b (expected due to sequence similarity) and miR-206 (unexpected) were substantially reduced. [score:2]
Northern analysis was used to document differences in precursor miR-133 and mature miR-133 abundance. [score:1]
This confirms that along with the much lower (>100 times) amplification efficiency [45], miR-133 pre-miRNA cannot contribute to the TaqMan signal. [score:1]
Most studied are miR-133, miR-206 and miR-1, which are all induced during differentiation of myoblasts into myotubes [28]. [score:1]
The Northern probe detects both miR-133a and miR-133b due to sequence similarity. [score:1]
[1 to 20 of 9 sentences]
40
[+] score: 21
The miR-1 can directly target and inhibit insulin-like growth factor 1 (IGF-I) and Akt -mediated signaling while miR-133 can enhance muscle cell proliferation (Kovanda et al., 2014) indicating putative regulatory roles for these miRNAs in muscle growth/ anabolic responses. [score:7]
A primary regulator of exercise -induced SIRT1 expression is NAD [+] availability through AMPK (White and Schenk, 2012) and it seems plausible that AMPK, rather than miR-133b or miR-181, may be the primary regulator of post-exercise changes in SIRT1 expression. [score:7]
The expression of miR-133b also increased post-exercise only with PRO (~75%, P < 0.05, Figure 1D). [score:3]
The array contained 13 common miRNAs previously shown in the literature to be regulated following resistance or endurance exercise, and amino acid ingestion in human skeletal muscle including hsa-miR-1, hsa-miR-9-3p, hsa-miR-16-5p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-31-5p, hsa-miR-133a-3p, hsa-miR-133b, hsa-miR-181a-5p, hsa-miR-378a-5p, has-miR-451a, hsa-miR-486-5p, and hsa-miR-494-3p. [score:2]
We also found greater miR-133b and miR-181 abundance with post-exercise protein ingestion. [score:1]
Figure 1(A) mir-9-3p, (B) miR-23a-3p, (C) miR-23b-3p, and (D) miR-133b abundance at rest and at 4 h post-exercise recovery following a concurrent exercise session of resistance (8 sets of 5 leg extension at 80% 1-RM) and endurance (30 min cycling at 70% VO [2peak]) exercise and ingestion of either 500-mL PLA or PRO beverage immediately after exercise. [score:1]
[1 to 20 of 6 sentences]
41
[+] score: 21
Only two miRNAs (hsa-miR-1 and hsa-miR-133b) were shared by both TRU- and non-TRU-type adenocarcinoma; two others—hsa-miR-494 and ebv-miR-BART19—were upregulated by > 5-fold whereas hsa-miR-551b was downregulated by > 5-fold in the non-TRU type relative to the TRU type, confirming that they are histologically and molecularly dissimilar. [score:7]
In addition to the three miRNAs that were differentially expressed between TRU-type and non-TRU-type adenocarcinomas, we found two miRNAs—miR-1 and miR-133b—that were downregulated in both subtypes. [score:6]
MiR-133b expression was found to be reduced in lung cancer tissue [25, 26], and was shown to regulate cell growth, invasion, and apoptosis via regulation of EGFR expression [26]. [score:6]
Only two miRNAs (hsa-miR-1 and hsa-miR-133b) were down regulated in both adenocarcinoma subtypes relative to normal tissue. [score:2]
[1 to 20 of 4 sentences]
42
[+] score: 21
Other miRNAs from this paper: hsa-mir-133a-1, hsa-mir-133a-2
MicroRNA-133 (miRNA-133), an important member in miRNA family, is specifically expressed in adult cardiac and skeletal muscle tissues [6], and its expression has been shown to be down-regulated during cardiac hypertrophy. [score:8]
E) In the presence of perfectly complementary target short RNA (say miRNA-133), reporter-STV-QDs complex is replaced by target RNA eventually. [score:5]
Good linearity demonstrates the possibility of using this method to accurately detect the decreased expression of miRNA-133 in cardiac hypertrophy and skeletal myoblast proliferation, and even other types of miRNA. [score:3]
In addition, multiple lines of evidence suggest that miRNA-133 acts as a key player in proliferation and differentiation of skeletal myoblasts [5], [6]. [score:1]
In the presence of perfectly complementary synthesized miRNA-133, 4-base “toe-hold” region (purple box) would firstly be hybridized to initiate migration, and reporter-STV-QDs complexes would be totally displaced so that light dots on motifs would disappear in the end [26]. [score:1]
In this study, we performed a quantitative exploration of the relationship between miRNA-133 concentration and the percentage of probe-STV-QDs complex displacement. [score:1]
However, thus far, no details have been reported about the efficiency of single strand-displacement as described by Zhang Z et al. In this study, we demonstrate a linear relationship between miRNA-133 concentration and the percentage of streptavidin and quantum dots binding complex (STV-QDs) displacement in both symmetrical and asymmetrical origami motif. [score:1]
Second, given fixed origami structure concentration, we observed a strong linear relationship between the miRNA-133 concentration and %STV-QDs bound. [score:1]
[1 to 20 of 8 sentences]
43
[+] score: 20
Developmental stage of O. felineus miRNAs AdultNoEggs & Adult+Eggs & Metacercaria let-7, miR-1, miR-2(a,b,c,d,e), miR-36, miR-71(a,b), miR-124, miR-125, miR-133, miR-190 AdultNoEggs & Adult+Eggs bantam, miR-281(miR-46 family) AdultNoEggs & Metacercaria miR-7 Metacercaria miR-10Candidate sequences for novel miRNAs (S4 Table) were selected from reads without matches to miRBase sequences after mapping them to the C. sinensis genome and processing the genomic fragments encompassing the resultant hits through the secondary structure filter (see ). [score:2]
Developmental stage of O. felineus miRNAs AdultNoEggs & Adult+Eggs & Metacercaria let-7, miR-1, miR-2(a,b,c,d,e), miR-36, miR-71(a,b), miR-124, miR-125, miR-133, miR-190 AdultNoEggs & Adult+Eggs bantam, miR-281(miR-46 family) AdultNoEggs & Metacercaria miR-7 Metacercaria miR-10 Candidate sequences for novel miRNAs (S4 Table) were selected from reads without matches to miRBase sequences after mapping them to the C. sinensis genome and processing the genomic fragments encompassing the resultant hits through the secondary structure filter (see ). [score:2]
It should be mentioned that miR-133 were not annotated for S. mansoni in previous reports [36, 37, 71]. [score:1]
We found that miR-133 is located near a gene encoding one of several Mind bomb proteins in all five genomes. [score:1]
Genes around miR-1 and miR-133 in the flatworms genomes. [score:1]
In previous papers, the combination of the miR-1/miR-133 miRNA genes was described also as a miRNA cluster for many animal species (see data in miRBase) [74] including flatworms [45]. [score:1]
Hence, we referred to the regions as “cluster-like regions miR-1/miR-133”. [score:1]
Upon analysis by Jin et al. [45], the genomic regions with matches for miR-1 and miR-133 were designated as orthologous miRNA gene clusters in three flatworms, namely the cestodes E. granulosus, E. multilocularis and H. microstoma. [score:1]
The alignments of some miRNAs (two miR-71/ miR-2 clusters, miR-1, miR-133, and miR-190) with sequences of these miRNAs orthologs (obtained from S. mediterranea, G. salaris, S. mansoni, S. japonicum, E. granulosus, E. multilocularis, H. microstoma and T. solium genomes) were performed using the program CLUSTALW [68]; miRNA sequences of T. solium, namely miR-1, miR-2b, miR-2c, miR-71, miR-133, miR-190, were obtained by homology search of these miRNAs in T. solium genome (http://www. [score:1]
Hence, due to the distance between the sites corresponding to the miRNAs in flatworms, as well as the capability to predict protein-coding genes in between these sites, we suggest referring to these regions as “cluster-like regions miR-1/miR-133”, which form a putative synteny group. [score:1]
The ortholog search for the miRNAs of the three opisthorchiids yielded 19 conserved miRNAs belonging to 13 families (bantam, let-7, miR-1, miR-2, mir-7, miR-10, miR-36, miR-46, miR-71, miR-124, miR-125, miR-133, and miR-190) (Fig 2A, Table 1, S3 Table). [score:1]
Cluster-like regions miR-1/miR-133. [score:1]
The UNAFold secondary structure prediction for the precursors of the conserved miRNAs showed no canonical structure for the putative S. mansoni pre-miR-133, which could possibly explain the delay in sma-miR-133 annotation (S6 Table). [score:1]
We then explored the genomic context beyond the cluster-like regions miR-1/miR-133 in the five flatworm species using information from the C. sinensis database (http://fluke. [score:1]
miR-1, miR-133 and putative miR-1, miR-133. [score:1]
Gene prediction in region between miR-1 and miR-133. [score:1]
miRNA Genomes C. sinensis S. mansoni S. japonicum bantam + + + let-7 + + + miR-1 + + − miR-2a + + + miR-2b + + + miR-2c + + + miR-2d + + + miR-2e + + + miR-7 + + + miR-10 + + + miR-36a + + + miR-36b + − − miR-281 + + + miR-71a + + + miR-71b + + + miR-124 + + + miR-125 − + + miR-133 + + + miR-190 + + + Mapped miRNA is designated by plus; unmapped—by minus. [score:1]
Genomic organization scheme of cluster-like regions miR-1/miR-133 in five flatworms. [score:1]
[1 to 20 of 18 sentences]
44
[+] score: 20
ceRNAs are important regulators in cell cycle control and tumor suppression (e. g. PTEN-P1 blocking miR-19b and miR-20a from binding to PTEN tumor suppressor [17]– [19]), modulating self-regulation in hepatocellular carcinoma (HCC) (HULC lncRNA acts as ceRNA of the protein coding gene PRKACB that induces activation of CREB which in turn is involved in upregulation of HULC [20]) as well as in developmental stages (e. g. linc-MD1 blocking miR-133 from binding to transcription factors involved in myogenic differentiation [21] and H19 blocking the miRNA let-7 to affect muscle differentiation in vitro [22]). [score:11]
lncRNA acting as ceRNA Competing protein coding gene Shared miRNA ceRNA score Reference HULC (Highly Upregulated in Liver Cancer) PRKACB miR-372 0.026 (p-value = 0.001) [20] lincRNA MD1 MAML1 miR-133 0.022 (p-value = 0.02) [21] H19 Targets of hsa-let-7 Let-7 - [22] Linc-RoR (Regulator of Reprogramming) SOX2 and NANOG miR-145 0.038 (p-value = 0.008) [36] PTCSC3 Targets of miR-574-5p in thyroid cancer cell line miR-574-5p - [37] Users can browse for ceRNA candidates for a protein coding gene (by gene symbol, gene id or refseq accession) and/or lncRNA gene (by gene name, ensemble gene id or ensemble transcript id) and/or miRNA name. [score:9]
[1 to 20 of 2 sentences]
45
[+] score: 20
Among these: 3 miRNAs (i. e. miR-26a-5p, miR-143-3p, and miR-4454) were expressed in both RAA and LAA; 6 miRNAs (i. e. miR-30c-5p, miR-125b-5p, miR-133b, miR- 145-5p, miR-451a, and miR-4484) were expressed in only RAA; and 3 miRNAs (i. e. miR-1, miR-23b-3p, and miR-494) were expressed in only LAA. [score:7]
For example, miR-208 and miR-499 are cardiac-specific miRNAs exclusively expressed in cardiac tissues, while miR-1 and miR-133 are muscle-specific miRNAs preferentially expressed in cardiac and skeletal muscle [37, 38]. [score:5]
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (i. e. miR-1, miR-26, and miR-328) or structural remo deling (i. e. miR-30, miR-133, and mir-590). [score:3]
To determine the probable biological function of the AF -associated miRNAs, we predicted the putative targets and pathways of 10 validated miRNAs (i. e. miR-1, miR-23b-3p, miR-26a-5p, miR-30c-5p, miR-125b-5p, miR-133b, miR-143-3p, miR-145-5p, miR-4454, and miR-4484) using the miRFocus database. [score:3]
According to the qRT-PCR data, miR-26a-5p, miR-143-3p, miR-4454 were AF -associated miRNAs found in both RAA and LAA tissues, while miR-30c-5p, miR-125b-5p, miR-133b, miR-145-5p, miR-4484 were AF -associated miRNAs found in only RAA tissues and miR-1, miR-23b-3p were found only in LAA tissues (Figure  5). [score:1]
Li et al. [12] reported that miR-133 and miR-30, as anti-fibrotic miRNAs [33, 34], may play an important role in the control of structural changes in chronic AF. [score:1]
[1 to 20 of 6 sentences]
46
[+] score: 20
It is noteworthy that miR-1, miR-133, miR-30, miR-208a, miR-208b, mir-499, miR-23a, miR-9 and miR-199a have previously been shown to be functionally involved in cardiovascular diseases such as heart failure and hypertrophy [40], [41], [42], [43], [44], and have been proposed as therapeutic- or disease-related drug targets [45], [46]. [score:7]
In particular, miR-1 and miR-133, which are abundant microRNAs in the heart, are implicated in cardiovascular development and myocardial lineage differentiation, as they tightly control expression of muscle genes and repress ”unwanted” gene transcription through a network of target transcription factors [36], [37], [38], [39]. [score:6]
In particular, several microRNAs that are preferentially expressed in different types of muscles (e. g. miR-1, miR-133, and the myomiRs miR-208, miR-208b and miR-499) play a pivotal role in maintenance of cardiac function [17], [18], and the ablation of microRNAs-RISC machinery can have dramatic effects on cardiac development [19], [20], [21]. [score:4]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
Furthermore, ventricular microRNAs (miR-1, miR-133, miR-208b and miR-499) have been found to be increased in the plasma of patients with myocardial infarction, and might represent a useful alternative to the classical cardiac troponin (cTnI) biomarker [57], [58], [59], [60], [61]. [score:1]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 19
This pattern included the two created target sites for ssc-miR-34a and ssc-miR-34c, both predicted by TargetScan and PACMIT in SLA-1 (Figure 3 A); the disrupted target site for ssc-miR-148a in HSPA1A predicted by PACMIT and TargetSpy (Figure 3 B); the ssc-miR-133b (TargetScan and PACMIT), ssc-miR-133a-3p (TargetScan) and ssc-miR-323 (TargetSpy) created target sites in RNF5 (Figure 3 C); and the disrupted site for ssc-miR-2320 predicted by TargetSpy in SLA-1 (Figure 3D). [score:19]
[1 to 20 of 1 sentences]
48
[+] score: 18
Specifically, miRNA-seq analysis identified 5 up-regulated cardiac specific miRNAs (miR-29a, miR-29b, miR-133, miR-193 and miR-223) previously identified for being regulators of cardiac development and homeostasis (Fig.   2). [score:6]
Targetscan software [50] predicted about 51 common targets for miR-29a, miR-29b, miR-133, miR-193 and miR-223 (Fig.   2C, middle panel). [score:5]
Table  2, miR-29a, miR-29b, miR-133, miR-193 and miR-223 were selected among the 10 most up-regulated miRNAs associated to the aging heart 43, 47– 49. [score:4]
Venn diagrams depicting the distribution of miR-133, miR-193, miR-29a/b, miR-223 predicted targets (middle panel). [score:3]
[1 to 20 of 4 sentences]
49
[+] score: 17
In conclusion, our results confirm that miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a expression levels were downregulated in CRC and that miR-138-5p and miR-422a were found to potentially interact with hTERT. [score:6]
The results revealed that the expression level in CRC tissues of miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a (P<0.0001 for all) were statistically significantly downregulated when compared with the corresponding normal tissues. [score:5]
Our results suggested that hTERT protein showed a significant negative correlation with the expression levels of miR-138-5p (r=−0.362, P=0.001) and miR422a (−0.306, P=0.005), while the correlation between hTERT and other miRNAs (miR-124-3p, miR-133a-3p, miR-133b, miR-150-5p and miR-378a-3p) revealed no significant negative correlation (Table IV). [score:3]
The expression levels of the 7 miRNAs (miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p and miR-378a-3p, miR-422a) were found to be significantly decreased in 84 pairs of the CRC tissues when compared with their matched corresponding normal tissues using RT-qPCR. [score:2]
Eight miRNAs with the potential to interact with hTERT were predicted: miR-29c-3p, miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a, respectively. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 17
miR-133 and miR-208 converge around structures pertaining to myocardial tissue albeit with opposite effects on cardiac hypertrophy, as miR-133 yields both anti-fibrotic and anti-hypertrophic effects [14], whereas overexpression of miR-208 is pro-hypertrophic [15]. [score:3]
The other miR that showed a significantly elevated gradient, miR-133, is thought to be protective and anti-fibrotic in smooth muscle [14] and is elevated in patients with coronary atherosclerosis [22]. [score:1]
Based on these data circulating levels miR-92a and miR-133 could serve as surrogate markers for early coronary atherosclerosis. [score:1]
A significant inverse correlation between percent change in CBF and transcoronary gradient of miR-133 (r [2] = 0.11, p = 0.03; Figure 2) indicated that the gradient reduced with improving endothelial function. [score:1]
While Fichtlscherer et al. initially showed significant reductions in most absolute and relative endothelial-related miR levels (miR-17, miR-92a, and miR-126) with increases in myocardial and inflammatory-related miRs (miR-133, miR-145, and miR-155) in patients with stable CHD [22], De Rosa et al. showed little to no change in miR levels with stable CAD, but marked increases and decreases in some miR levels with ACS [23]. [score:1]
Transcoronary gradient of miR-133 versus the percent change in microcirculatory blood flow showing an inverse correlation (r [2] = 0.11, p = 0.03). [score:1]
Multivariate analysis (Spearman's correlation) revealed a few moderate correlations between certain miRs aortic (Table 3), coronary sinus (Table 4), and transcoronary gradients and surrogate markers for CHD found in serum blood draws such as hemoglobin, leukocytes, platelets, total cholesterol, LDL-cholesterol, triglycerides, hs-CRP, and vitamin B12 (miR-21 (p = 0.02), miR-92a (p = 0.02), miR-126 (p = 0.02), miR-133 (p = 0.03), and miR-155 (p = 0.003); (Table 5). [score:1]
Thus, it is likely that the positive transcoronary gradient of endothelial and anti-fibrotic miRs (miR-92a and miR-133), which may potentially become negative during ACS [23], could reflect a protective retention during ACS. [score:1]
Mean aortic miR levels were significantly reduced, after normalization using the delta-CP method, in miR-92a (p = 0.02), miR-126 (p = 0.03), miR-133 (p = 0.03), and miR-155 (p = 0.003). [score:1]
It may be speculated that in patients with myocardial injury and continual low-grade ischemia, there is a compensatory anti-fibrotic and myocardial protective process ongoing as the overabundance of miR-133 spills into the coronary circulation; alternatively miR-133 may serve a signal to the anti-ischemic process [40] secondary to the impaired tissue perfusion. [score:1]
In summary, we report significantly elevated transcoronary gradients of miR-92a and miR-133 in patients without early coronary atherosclerosis and demonstrated coronary microvascular endothelial dysfunction. [score:1]
Similar to our results, a study in patients with ACS has found a positive transcoronary gradient of miR-133 [18]. [score:1]
On the other hand, in patients with active acute coronary syndromes (ACS) miR-133a and miR-208a (myocardial miRs), miR-126 and miR-92a (endothelial), and miR-155 (inflammatory cell) levels were all found to be increased in aortic blood samples (miR-133a, miR-208a also increased in coronary sinus samples), with increased transcoronary gradient of miR-133 and trends toward negative gradients of miR-92a and miR-126 [23]. [score:1]
0109650.g002 Figure 2Transcoronary gradient of miR-133 versus the percent change in microcirculatory blood flow showing an inverse correlation (r [2] = 0.11, p = 0.03). [score:1]
Our current study, furthermore, demonstrates a correlation between transcoronary gradient of miR-133 and the percent change in CBF with implications for myocardial ischemia dynamics. [score:1]
[1 to 20 of 15 sentences]
51
[+] score: 17
Given the requisite role of miR-1 and miR-133 in cell survival and development, it is convincing to believe that the redundant transcription complexes directing miR-1 and miR-133a expression are elegantly developed to ensure cells to survive under evolutionary pressure. [score:5]
MiR-1 and miR-133 are muscle-enriched microRNAs, and they have been demonstrated as critical factors involved in both cardiac and skeletal muscle development and diseases [20- 25]. [score:4]
Given the importance of miR-1 and miR-133 in various cardiomyopathy developments, such as cardiac hypertrophy, understanding the precise control of SRF -mediated microRNA gene regulation in the heart will provide an additional perspective for the treatment of SRF dysfunction -mediated cardiomyopathy. [score:3]
Given that individual microRNAs regulate potentially dozens of genes, functions of miR-1 and miR-133 in cardiac muscle and skeletal muscle can be quite distinct [23, 26, 27]. [score:2]
Both miR-1 and miR-133 also participate in cardiomyopathy development including cardiac hypertrophy [25, 28], cardiac fibrosis [29, 30], and arrhythmia [30, 31]. [score:2]
For skeletal muscle, miR-1 facilitates myogenesis, and miR-133 promotes myoblast proliferation [20]. [score:1]
[1 to 20 of 6 sentences]
52
[+] score: 17
Wang DS, Zhang HQ, Zhang B et al (2016) miR-133 inhibits pituitary tumor cell migration and invasion via down -regulating FOXC1 expression. [score:6]
Wang et al. reported that downregulated miR-133 promoted the expression of FOXC1 and promoted migration, invasion, and epithelial-to-mesenchymal transition in PAs [21]. [score:6]
Therefore, we present the bold assumption that decreased miR-133 in PA facilitates FOXC1 expression and results in the high expression of CCND1, which in turn promote G [1]–S phase transition in PAs. [score:5]
[1 to 20 of 3 sentences]
53
[+] score: 17
The present findings revealed that miRNA-21 and miRNA-208 are highly expressed in patients with AF, though there were no significant differences between AF and SR patients regarding miRNA-133 and miRNA-590 expressions. [score:5]
Nat Med 212: 358- 367; 16 Shan H, Zhang Y, Lu Y, Zhang Y, Pan Z et al. (2009) Downregulation of miR-133 and miR-590 contributes to nicotine induced atrial remo deling in canines. [score:4]
One study revealed that down-regulation of miRNA-133 promotes AF through a mechanism favoring atrial structural remo deling [16]. [score:4]
They concluded that the pro-fibrotic response to nicotine in the canine atrium is critically dependent upon down-regulation of the anti-fibrotic miRNA-133 and miRNA-590. [score:4]
[1 to 20 of 4 sentences]
54
[+] score: 16
Upregulation of miR-133b in CAF was found to travel via gap junction proteins into breast cancer epithelia, where it has anti-apoptotic and pro-growth molecule with oncomiRs properties (Katakowski et al. 2010, Xin et al. 2012). [score:4]
Interestingly, miR-133b transfer could be limited by the use a gap junction inhibitor (Xin et al. 2012), revealing a novel way of countering the miRs identified in primary tumors to prevent future metastatic progression. [score:3]
But the same miR-133b expressed by breast cancer CAF suggests that an individual miR can have a role in the cancer and its microenvironment regardless of its source. [score:3]
In this study, miR-133b emerged as a common mediator of CAF activation, as determined by the expression of markers such as, ACTA2, FAP, S100A4 and COL4A2 (Doldi et al. 2015). [score:3]
For prostate cancer, miR-133b was of epithelial origin. [score:1]
Incidentally, miR-133b was also identified to be a poor prognostic indicator in prostate cancer, in causing further aggressive behavior (Li et al. 2014). [score:1]
2014.2583) 25242314 Xin H Li Y Buller B Katakowski M Zhang Y Wang X Shang X Zhang ZG Chopp M 2012 Exosome -mediated transfer of miR-133b from multipotent mesenchymal stromal cells to neural cells contributes to neurite outgrowth. [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 16
By contrast, downregulation of miR-133b and in human cancers (Wen et al., 2013; Wang et al., 2013b) and that of miR-424 and miR-503 in pulmonary artery epithelial cells of patients with pulmonary arterial hypertension (Kim et al., 2013b) de-repress FGFR1 and promote proliferation of tumor cells and endothelial cells, respectively, through FGF signaling activation. [score:4]
miR-133b acts as a tumor suppressor and negatively regulates FGFR1 in gastric cancer. [score:4]
FGFR1 is a direct target of miR-16 (Chamorro-Jorganes et al., 2011), miR-133b (Wen et al., 2013), miR-198 (Yang et al., 2014), (Wang et al., 2013b), miR-382 (Mor et al., 2013), miR-424 (Chamorro-Jorganes et al., 2011), and miR-503 (Kim et al., 2013b). [score:4]
FGFR1 is a direct target of miR-16, miR-133b, miR-198,, miR-382, miR-424, and miR-503. [score:4]
[1 to 20 of 4 sentences]
56
[+] score: 16
Eleven microRNAs were differentially expressed between the regenerating tail tip and base during maximum outgrowth (25 days post autotomy), including miR-133a, miR-133b, and miR-206, which have been reported to regulate regeneration and stem cell proliferation in other mo del systems. [score:4]
Nine of these microRNAs have elevated expression in the tail base, including miR-1, miR-133a, miR-133b, and miR-206, which have been shown to play key roles in regulating skeletal muscle differentiation and function [37, 44– 48]. [score:4]
For example, the small RNA miR-133 is downregulated during heart regeneration and in the tip of the regenerating tail in zebrafish [49]. [score:4]
In zebrafish, the miR-133 precursor family regulates regeneration in the tail fin [21], the heart [49], and spinal cord [22]. [score:2]
Importantly, we were able to also detect these positional changes in a small subset of putative novel miRNAs (5_10675 and GL343237.1_6814) and putative novel Anolis-specific miR-133b ortholog (1_16347), detected by our sequencing results (Fig.   3). [score:1]
Folding structure and read alignment for putative novel, Anolis-specific miR-133b ortholog 1_16347. [score:1]
[1 to 20 of 6 sentences]
57
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In addition, the authors have demonstrated that miR-133b expression in medial longitudinal fascicle, superior reticular formation, and intermediate reticular formation neurons is essential for full locomotor recovery after a spinal cord injury. [score:3]
Huang et al. (2011) have reported a negative feedback circuit in which insulin-like growth factor 1 (IGF-1) promotes miR-133 expression, which, in turn, represses IGF-1 receptor (IGF-1R) affecting skeletal myogenesis. [score:3]
Repressive action of miR-133b toward rhoA mRNA, which inhibits axon regrowth, has been demonstrated during spinal cord regeneration (Yu et al. 2011). [score:3]
Given that miR-133 has regulatory role in skeletal muscle proliferation (Chen et al. 2006), the repression of miR-133 during heart regeneration may indicate reprogramming. [score:2]
In gain- and loss-of-function experiments, Yin et al. (2008) showed that the regulated depletion of miR-133 resulted in effective fin regeneration. [score:2]
Further evaluation of miR-133 in this study indicated that miR-133 had several targets, among them mps1 and cx43, which are essential for the regeneration process. [score:1]
Soares et al. (2009) let-7i, miR-15b, miR-17a-3p, miR-21, miR-92b, miR-128, miR-133, miR-146a,b, miR-150, miR-194a, miR-204, miR-210-3p, miR-301a, miR-429, miR-730, miR-733, miR-738, Zebrafish Microarray, northern blot, qRT-PCR, ISH Yin, Lepilina, et al. (2012) Muscle miR-1, miR-21, miR-133a,b,c, miR-203b Zebrafish NGS, qRT–PCR ? [score:1]
In zebrafish embryos, miR-1 and miR-133 were implicated in shaping sarcomeric actin organization (Mishima et al. 2009). [score:1]
[1 to 20 of 8 sentences]
58
[+] score: 16
In hypertrophic adult rat VCMs, down-regulation of miR-1/miR-133 levels promotes automaticity via up-regulation of HCN2/HCN4, but this defect can be reversed by forced expression of miR-1/miR-133 [10], [11]. [score:9]
This observation was consistent with the upregulation of NKX2.5 seen in EBs differentiated from LV-miR-1-transduced, but not LV-miR-133-transduced or WT, H7 hESCs that Srivastava and colleagues reported [8]. [score:4]
Indeed, miR-133 has been implicated in early cardiac differentiation of murine and human ESCs by repressing the non-mesoderm lineages, rather than by directly promoting cardiogenesis per se [8]. [score:2]
Consistently, miR-133 exerts no effects on Ca [2+]-handling and contractile proteins when cardiovascular progenitors of later stages were transduced. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 15
Sybr Green technology was used to validate: miR-122, which was specifically expressed on present microarrays compared to our previous study [11] and it showed the highest up-regulation; miR-21 and miR-126, which are in addition to muscle-specific miR-1 and miR-133 the most common miRNAs involved in heart diseases; miR-125a/b, which are according to TAM tool involved in myocardial remo delling after MI. [score:7]
Using; the miR-1 and miR-133 were used to compare present study to our-previous research [33] and confirmed up-regulation of miR-1 in remote myocardium. [score:4]
Free-energy of binding and flanking regions (RNA22, RNAfold) was calculated for 10 up-regulated miRNAs from microarray analysis (miR-122, miR-320a/b/c/d, miR-574-3p/-5p, miR-199a, miR-140, and miR-483), and nine miRNAs deregulated from microarray analysis were used for validation with qPCR (miR -21, miR-122, miR-126, miR-1, miR-133, miR-125a/b, and miR-98). [score:3]
MicroRNAs, miR-1, miR-133a, miR-133b, and miR-98 were tested relatively to RNU6B, RNU48 and miR-26b. [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 15
mRNA, messenger RNA Table 1circRNA-miRNA-mRNA network elements for those circRNA-miRNA interactions predicted by both miRanda and RNAHybrid, with a miRanda match score > = 180 and mRNA targets that are differentially expressed (uncorrected P < 0.05) with log2(fold change) >= 2 or =< − 2 (high stringency network) Circular RNA microRNA target Number of binding sites predicted Target genes (differentially expressed) X:47,431,299–48,327,824 hsa-miR-139-5p 6 NOTCH1, STAMBP, TPD52 8:144,989,320–145,838,888 hsa-miR-320a 2 METTL7A, PBX3, PLS1, SEC14L1, VCL, VIM, VOPP1, YPEL2 8:144,989,320–145,838,888 hsa-miR-320b 2 RTKN, VCL, VOPP1 X:47,431,299–48,327,824 hsa-miR-449a 1 BAZ2A, MFSD8, NOTCH1, TSN, ZNF551 8:144,989,320–145,838,888 hsa-miR-125a-3p 1 ANKRD62, C15orf40, COL18A1, MFSD11, MPEG1, MUL1, TTC31, WDR12, ZNF641 X:47,431,299–48,327,824 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 8:144,989,320–145,838,888 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 X:47,431,299–48,327,824 hsa-miR-324-5p 1 FOXO1, MEMO1, PSMD4, SMARCD2 14:23,815,526–24,037,279 hsa-miR-142-3p 1 BTBD7, CLDN12, CPEB2, CSRP2, DAG1, KIF5B, PTPN23, WHAMM 4:88,394,487–89,061,166 hsa-miR-133b 1 FAM160B1 4:88,394,487–89,061,166 hsa-miR-448 1 DDIT4, PURG 4:88,394,487–89,061,166 hsa-miR-339-5p 1 AXL, HLA-E, METTL7A, ZNF285, ZNRF3 MetaCore pathway analysis on the 255 filtered differentially expressed target genes from the previous analysis revealed 112 perturbed pathways (corrected P < 0.01; Table  2, Additional file  8: Table S5). [score:15]
[1 to 20 of 1 sentences]
61
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Three of the 107 genes are previously identified targets of the downregulated miRNAs, including mmp14, a known target of miR-133 [64], mmp9 (targeted by miR-204 and miR-338) and timp2 (targeted by miR-24 and miR-204). [score:12]
Recently, zebrafish appendage regeneration studies have revealed two differentially regulated miRNAs, miR-133 [27] and miR-203 [28], as essential regulators of caudal fin regeneration. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 14
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Bladder cancer-specific expression of TRAIL genes was achieved by employing MREs of miR-1, miR-133 and miR-218. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Application of MREs of miR-1, miR-133 and miR-218 restrained exogenous gene expression within bladder cancer cells. [score:3]
Ad-TRAIL-MRE-1-133-218 contained MREs of miR-1, miR-133 and miR-218 that were inserted immediately following TRAIL gene. [score:1]
AACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACC AAGCACAAACAAACACC AAGCACAA-3′), which contained two copies of miR-1 MREs, two copies of miR-133 MREs and two copies of miR-218 MREs. [score:1]
[1 to 20 of 6 sentences]
63
[+] score: 14
As indicated, lncRNA linc- MD1 “sponges” miR-133 and miR-135, antagonizing the miRNA -mediated translation suppression Another example of involvement of lncRNA in AS is sno- lncRNA, a class of nuclear-enriched intron-derived lncRNAs transcribed from a critical region of chromosome 15 (15q11-q13). [score:5]
As indicated, lncRNA linc- MD1 “sponges” miR-133 and miR-135, antagonizing the miRNA -mediated translation suppression Another example of involvement of lncRNA in AS is sno- lncRNA, a class of nuclear-enriched intron-derived lncRNAs transcribed from a critical region of chromosome 15 (15q11-q13). [score:5]
Linc- MD1 “sponges” miR-133 and miR-135 to regulate the mRNA translation of mastermind-like-1 (MAML1) and myocyte-specific enhancer factor 2C (MEF2C), respectively (Fig.   2f). [score:4]
[1 to 20 of 3 sentences]
64
[+] score: 14
Ectopic expression of miR-133 inhibited cell proliferation, migration and invasion in these cells by targeting EGFR. [score:7]
MiR-133 has long been recognized as a muscle-specific miRNA which may regulate myoblast differentiation and participate in many myogenic diseases. [score:4]
Recently, miR-133a and miR-133b were shown to be weakly expressed in two hormone-insensitive prostate cancer cell lines, PC3 and DU145 [33]. [score:3]
[1 to 20 of 3 sentences]
65
[+] score: 14
Hence, miR-210 when inhibited increases the level of apoptosis in HeLa cells [46]; miR-22 promotes cell survival in UV irradiated cells through a tumor suppressor gene down-regulation [74]; down-regulation of miR-25 in ovarian cancer cells induces apoptosis [75]; miR-155 was described as having anti-apoptotic effects in murine macrophages during Helicobacter pylori infection [76]; and miR-133b is known to inhibit pro-survival molecules MCL-1 and Bcl-w proteins, two members of the BCL-2 family [47]. [score:13]
Among the miRNAs for which levels were modulated during L. major infection, several were described as playing a possible role in apoptosis e. g., miR-210, [46] miR-22, miR-155 and miR-133b [47]. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
67
[+] score: 14
For example, miR-129 was the most commonly up-regulated and its up-regulation was associated with poor outcome [19]; the expression of miR-96 and miR-183 in urine was significantly correlated with tumor stage and grade, and their expressions were significantly decreased after radical surgery [20]; miR-133b and miR-518c were also strongly up-regulated in bladder cancer tissues [19]. [score:14]
[1 to 20 of 1 sentences]
68
[+] score: 14
miRNA-133 is important in orchestrating cardiac development, gene expression, growth, and function [34]. [score:4]
A 10-fold increase in miRNA -mediated murine cardiac fibroblast reprogramming was observed when miRNA-1, miRNA-133, miRNA-208, and miRNA-499 were combined with JAK inhibitor I [30]. [score:3]
miRNA-1, miRNA-133, miRNA-208, and miRNA-499 have been shown to be cardiac- and muscle-specific and play important roles in cardiac development and function. [score:2]
Moreover, the activating H3K4me2 histone mark has been shown to be increased at the regulatory regions of miRNA-1 and miRNA-133 [29]. [score:2]
Similarly, when miRNA-133 was used in conjunction with GMT, Mesp1, and Myocd or GHT, Myocd, and miRNA-1, the reprogramming efficiency was increased in both human and mouse fibroblasts by repressing Snai1 and silencing fibroblast gene signatures [35, 37]. [score:1]
Zhao et al. used a combination of GMHT, miRNA-1, miRNA-133, miRNA-208, miRNA-499, Y-27632, and A83-01 in MEFs and mouse adult fibroblasts to achieve ~60% cardiac troponin T+ and 60% α-actinin+ iCMs [29]. [score:1]
A combination of miRNA-1, miRNA-133, miRNA-208, and miRNA-499 was reported to be sufficient to convert mouse cardiac fibroblasts into iCMs without the addition of other factors in vivo [36]. [score:1]
[1 to 20 of 7 sentences]
69
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
Recently, miRNAs expression signatures analysis revealed that miR-133 expression levels are significantly reduced in squamous cell carcinomas (SqCC), and it was demonstrated that its restoration causes the inhibition of cancer cell proliferation [151]. [score:7]
MiR-133 and miR-206 have been termed “muscle specific” miRNAs since they are highly expressed in cardiac and smooth muscle tissues [149- 150]. [score:3]
Multiple targets of miR-133 were identified, and two of them were confirmed in lung cancer cells, ARPC5 and GSTP1 [151]. [score:3]
miR-133, miR-206. [score:1]
[1 to 20 of 4 sentences]
70
[+] score: 13
In bone, particularly, miR-133 and 133a have been found to regulate osteoblastogenesis by targeting and regulating Runx2 expression [6], [48]. [score:7]
Interestingly, miR-133b is marginally unregulated in the low vs. [score:2]
Many studies demonstrated that miR-133 and 133a are important in the development of muscle, such as skeletal muscle [39]– [43], and heart/cardiovascular muscle [44]– [47]. [score:2]
In humans, there are two types of miR-133 miRNA isoforms, miR-133a and miR-133b, with one base difference (g-a) in the last nucleotide at the 3′ end (miRBase: http://www. [score:1]
The ABI miRNA array used in this study includes both miR-133a and miR-133b probes. [score:1]
[1 to 20 of 5 sentences]
71
[+] score: 13
The miRNAs, and as shown specifically for the transfer of miR-133b, regulate their downstream targets, and thereby impact brain plasticity, and neurovascular remo deling to promote neurological recovery (Xin et al., 2013). [score:4]
Manipulation the expression of miR-133b in BMSCs and thus, in their exosomes, regulates neurological recovery after stroke (Xin et al., 2013). [score:4]
Exposure to ipsilateral ischemic tissue extracts obtained from MCAo rats elevates miR-133b expression in BMSCs and in exosomes derived from BMSCs (Juranek et al., 2013). [score:3]
Neurite outgrowth also can be promoted by delivery of miR-133b to neurons and astrocytes by transfer from BMSCs via exosomes (Juranek et al., 2013). [score:1]
miR-133b transfer from BMSCs to neurons and astrocytes results in an increased miR-133b level, and when exposed to post-MCAo brain extracts for 72h, a significant increase in neurite branch number and total neurite length is observed. [score:1]
[1 to 20 of 5 sentences]
72
[+] score: 13
Upregulation of both miR-133 and myogenin under IGF-1 influence has also been described [34]. [score:4]
MiR-133, another myomiR, has been confirmed to increase myoblast proliferation and regulate differentiation by targeting SRF, MAML1, nPTB, and UCP2 proteins [10, 32]. [score:4]
A few high-throughput studies have confirmed some of the identified miRNAs (miR-1, miR-128, miR-133a, miR-133b, miR-206, miR-222, and miR-503) as common for skeletal muscle development in mouse, human, pig, common carp [11], and cattle [25]. [score:2]
Cell culture experiments have shown that miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 enhances cell proliferation. [score:1]
The combined action of miR-133 and myomiRs (miR-1 and -206) induces MYOD1, PAX7, and myogenin causing myoblast differentiation [33]. [score:1]
It is plausible that in HER/LIM cells, the differentiation progression is accelerated via similar mechanisms involving miR-1, miR-133, miR-206, and myogenin, resulting possibly in enhanced myotube formation observed in the primary cultures of the skeletal muscle with a HER/LIM origin (Fig. 1). [score:1]
[1 to 20 of 6 sentences]
73
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
miR-145, miR-133a and miR-133b: tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. [score:5]
For example, miR-133b is downregulated in esophageal, lung and colon cancers (Bandrés et al., 2006; Crawford et al., 2009; Hu et al., 2010; Kano et al., 2010) and, through different pathways, may play a role in PD (Kim et al., 2007). [score:4]
miR-133b regulates the MET proto-oncogene and inhibits the growth of colorectal cancer cells in vitro and in vivo. [score:4]
[1 to 20 of 3 sentences]
74
[+] score: 13
MiR-1 and miR-133a are expressed in both skeletal and cardiac muscles [7, 10], while miR-133b and miR-206 are expressed solely in skeletal muscles [10]. [score:5]
[26] ↑ muscle development [30]↑ C2C12 diff [8, 10, 33] ↑ pMyo diff [33]↑ muscle development [31]↑ muscle development [32]27 miR-133b↑↑↑enriched in sk. [score:4]
Human immortalized myoblasts were differentiated in vitro and then transfected separately with anti-miRs targeting miR-1, miR-133a, miR-133b and miR-206. [score:3]
miR-133a and miR-133b. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
miR-128 was reported to participate in the regulation of adipogenesis, osteogenesis and myogenesis [36] and herein, together with ssc-miR-411, up regulated at 35 to 77 dpc and fluctuated at 77 dpc to 180 dpn (Figure 5C), might behave in a similar manner as ssc-miR-133b during porcine muscle development. [score:4]
It’s worth noting that many miRNAs are expressed in a tissue-specific or stage-specific manner [10], and the best-characterized muscle-specific miRNAs (myomiRs [11]) are miR-1, miR-206 and miR-133 families which specifically expressed in cardiac and skeletal muscles. [score:3]
Similarly, two other myomiRs, miR-133 [21] and miR-206 [23], were highly expressed and ranked the 4 [th] and 6 [th] respectively, while two other miRNAs (miR-378 [24, 25] and miR-143 [25]) ranked the 2 [nd] and 3 [rd] have been identified to participate in the proliferation and differentiation of muscle cells. [score:3]
However, Cluster 5 illustrated that ssc-miR-206 and other four muscle-related miRNAs (ssc-miR-126, -148a/b and -15b) continued to decline while ssc-miR-133b and eleven other muscle-related miRNAs (ssc-miR-125b, -128,-181a/b, -199a, -214, -23a, -24, -424, -503 and -7) in Cluster 4 presented a down and then up trend from 77 dpc to 180 dpn, suggesting their different roles played in adult fiber maturation. [score:1]
Notably, there were 53, 57 and 97 DE miRNAs identified from every two data sets, among which 41 DE miRNAs (22% of 183 DE miRNAs) were common, including the above mentioned ssc-miR-133 family. [score:1]
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 6 sentences]
76
[+] score: 12
Furthermore, upregulation of FGFR1 expression was found to negatively correlate with miR-133b expression in several GC lines and GC tissues. [score:8]
Therefore, miR-133b reduced the protein expression of FGFR1. [score:3]
The 3′UTR of FGFR1 mRNA contains two putative binding sites of miR-133b [53]. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 12
In a study on cardiac hypertrophy [29], overexpression of miR-133 by adenovirus -mediated delivery of a miRNA expression cassette protected animals from agonist -induced cardiac hypertrophy, whereas reciprocally reduction of miR-133 in wild-type mice by antagomirs caused an increase in hypertrophic markers. [score:5]
This suppression of miR-133 by these ‘decoy’ sequences induced cardiac hypertrophy, which was more pronounced than that induced with conventional inducers of hypertrophy. [score:3]
In this study, mice were infected with an adenoviral vector in which a 3′ UTR with tandem sequences complementary to mouse miR-133 and linked to the enhanced green fluorescent protein (EGFP) reporter gene. [score:1]
Previously, an mRNA decoy under the same principle has been designed and applied in the research of miR-133 in the pathogenesis of cardiac hypertrophy [29]. [score:1]
The complementary sequences act as a decoy, sequestering endogenous miR-133. [score:1]
The most extensively studied such critical miRNAs are miR-1 and miR-133. [score:1]
[1 to 20 of 6 sentences]
78
[+] score: 12
To test whether the observed cardiac or muscle miRNA expression profiles changes are temporal, we compared the miRNA expression profiles of mice hearts at postnatal days 0, 3, 8, and 14 by using qRT-PCR and found miR-1a-3p, miR-133b-3p, miR-208b-3p, and miR-206-3p were significantly decreased while miR-208a-3p was upregulated (Figure 1). [score:7]
Previous studies showed that miR-1 and miR-133 are highly correlated with heart development, and miR-1 was the first miRNA to be implicated in heart development [22]. [score:3]
An increasing number of miRNAs with different functions in heart development have also been identified, including miR-1, miR-208, miR-133, miR-206, miR-126, miR-143, miR-145, and miR-499; from this group, we analyzed the 7 miRNAs most relevant to postnatal heart growth. [score:2]
[1 to 20 of 3 sentences]
79
[+] score: 12
Pahl et al. examined the miRNA expression pattern in human AAA tissues and revealed that miR-133a, miR-133b and miR-331-3p were significantly downregulated in AAAs [24]. [score:6]
Dysregulated expression of miR-133a and miR-133b has been found in some types of cancer [44]. [score:4]
Similar to miR-133, miR-331-3p is also involved in regulating growth of certain cancer cells [47]. [score:2]
[1 to 20 of 3 sentences]
80
[+] score: 12
Upon maturation, we identified 4 miRNAs (miR-7, miR-9, miR-155, and miR-182) consistently upregulated in aDCs and 4 other miRNAs (miR-17, miR-133b, miR-203, and miR-23b) in tDCs. [score:4]
On the other hand, 4 different upregulated miRNAs (miR-17, miR-133b, miR-203, and miR-23b) are more important for tDCs induction than aDCs and iDCs after 6 h of maturation. [score:4]
miR-133b function in immunocompetent cells is still very limited and the only reference deals with miR-133b expression in correlation with Th17 cell differentiation [40]. [score:3]
Our results also showed an elevated miR-133b level in tDCs. [score:1]
[1 to 20 of 4 sentences]
81
[+] score: 12
We recently reported that the miR133 microRNA family, which is induced in murine AEC in the setting of hyperoxia, suppresses GM-CSF expression through direct interaction with sequences in this 3′-untranslated region to decrease mRNA stability (Sturrock et al. 2014). [score:8]
Decreased expression of GM-CSF by murine AEC during oxidative stress in vitro is at least in part a consequence of accelerated turnover of GM-CSF mRNA (Sturrock et al. 2010) as a result of the action of a specific microRNA family, miR133, directly affecting its stability (Sturrock et al. 2014). [score:4]
[1 to 20 of 2 sentences]
82
[+] score: 12
In fact, extracellular GTP up-regulated the miR-133a and miR133b expression. [score:6]
miR-133a and miR-133b were significantly up-regulated after 24 h of 500 μM GTP stimulation of myoblasts (GTP-undiff) compared to control (CTR-undiff). [score:3]
The graphs show the relative expression of miR-133a, miR-133b, miR-1, and miR-206 both in myoblasts (CTR-undiff), in cells differentiated for 24 h in DM (CTR-diff) and in 500 μM GTP-stimulated myoblasts and differentiating cells (GTP-undiff and GTP-diff, respectively). [score:3]
[1 to 20 of 3 sentences]
83
[+] score: 12
Similar to miRNA-1, the co-expressed miRNA-133 has also been shown to be necessary for atrioventricular canal development in zebrafish [13]. [score:4]
This expression profile was not observed for a group of well-known cardiac or muscle specific miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-499-5p and miR-499-3p). [score:3]
Expression profile of (A) miRNA-940; (B) miR-1; (C) miR-133a; (D) miR-133b; (E) miR-499-3p; (F) miR-499-5p; (G) miR-208a; (H) miR-208b in different part of human hearts. [score:3]
Furthermore, compared to well-known cardiac or muscle specific miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-499-5p and miR-499-3p), miRNA-940 was the only one which is most highly expressed in the normal human right ventricular out-flow tract comparing to other chambers within the heart (Fig. 3). [score:2]
[1 to 20 of 4 sentences]
84
[+] score: 12
In other works, the downregulation of miRNAs was also observed in cardiac disease mo dels including reductions in miR-133, miR-590, miR-30, miR155, miR-22, miR-29, and miR101 (van Rooij et al., 2008; Duisters et al., 2009; Shan et al., 2009; Pan et al., 2012; Kishore et al., 2013; Hong et al., 2016). [score:6]
Downregulation of miR-133 and miR-590 contributes to nicotine -induced atrial remo delling in canines. [score:4]
miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
[1 to 20 of 3 sentences]
85
[+] score: 12
The PP2A regulatory subunit B56α is another target of miR-1 and miR-133, and the inhibition of PP2A’s function via miR-1 overexpression induces hyperphosphorylation and activation of RyR2, which subsequently promotes Ca [2+] release from the SR, leading to abnormal Ca [2+] cycling, and increased cardiac arrhythmogenesis [67, 68]. [score:8]
Shan H. Zhang Y. Cai B. Chen X. Fan Y. Yang L. Chen X. Liang H. Zhang Y. Song X. Upregulation of microRNA-1 and microRNA-133 contributes to arsenic -induced cardiac electrical remo deling Int. [score:4]
[1 to 20 of 2 sentences]
86
[+] score: 12
Expression of mastermind-like-1 (MAML1) is controlled by miR-133, and myocyte-specific enhancer factor 2C (MEF2C) is the target of miR-135 [64]. [score:5]
HuR also recruits miR-133 onto linc-MD1 in the cytoplasm, thereby reinforcing this regulatory circuitry. [score:2]
There is an inverse correlation between levels of HuR and miR-133b. [score:1]
linc-MD1 acts as a natural decoy for two muscle-specific miRNAs, miR-133 and miR-135 (Figure1 C) [64]. [score:1]
However, linc-MD1 primary transcript also harbors the pri-miR-133b sequence. [score:1]
HuR binds the base of the pri-miR-133b stem loop, and physically interferes with microprocessor activity [90]. [score:1]
HuR binds to and favors linc-MD1 accumulation at the expense of miR-133 biogenesis. [score:1]
[1 to 20 of 7 sentences]
87
[+] score: 12
MicroRNA-133b is a small non-coding RNA which targets Sirt1s, suppressing its expression in hepatocellular carcinoma cells, increasing the proliferation and invasion of hepatocellular carcinoma cells through the activation of E-cadherin expression, and repressing expression of GPC3 and the anti-apoptotic proteins (Bcl-2, Bcl-xL, and Mcl-1) [26]. [score:10]
It is questioned whether the GPC3/Wnt β-catenin signal pathway is miR-133b/Sirt1-specific regulation or is the hepatocellular carcinoma cell-specific and/or dominated mechanism. [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 12
Fusion index was calculated by expressing the number of nuclei within MyHC -positive cells with ≥2 nuclei as a percentage of the total nuclei; n = 4. c SNAIL silencing in RH30 cells upregulates expression of myomiRs, such as miR-1, miR-133b, miR-378a-3p and miR-206. [score:6]
Muscle-specific microRNAs, such as miR-1, miR-133b, miR-378a-3p, and miR-206 were also upregulated in RH30 shSNAIL cells (Fig.   7c). [score:4]
U6 snRNA: 5′-CGCAAGGATGACACGCAAATTC-3′ miR-1: 5′-GCTGGAATGTAAAGAAGTATGTATAA 3' miR-133b: 5′-TTTGGTCCCCTTCAACCAGCTA-3′ miR-206: 5′-TGGAATGTAAGGAAGTGTGTGG-3′ miR-378a-3p: 5′-ACTGGACTTGGAGTCAGAAGG-3′ Protein (either nuclear and cytoplasmic fractions or total extracts) was isolated using the Nuclear Extract Kit (Active Motif, La Hulpe Belgium) according to the manufacturer’s protocol. [score:1]
U6 snRNA: 5′-CGCAAGGATGACACGCAAATTC-3′ miR-1: 5′-GCTGGAATGTAAAGAAGTATGTATAA 3' miR-133b: 5′-TTTGGTCCCCTTCAACCAGCTA-3′ miR-206: 5′-TGGAATGTAAGGAAGTGTGTGG-3′ miR-378a-3p: 5′-ACTGGACTTGGAGTCAGAAGG-3′ Protein (either nuclear and cytoplasmic fractions or total extracts) was isolated using the Nuclear Extract Kit (Active Motif, La Hulpe Belgium) according to the manufacturer’s protocol. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 12
It has recently been demonstrated that the RBP human antigen R (HuR), which expression is inhibited by miR-133, intersects the linc-MD1-miRNAs network creating a regulative loop with linc-MD1 [70]. [score:6]
Similar to linc-RoR, but with a pro-differentiation role, linc-MD1 functions as a ceRNA by binding miR-133 and miR-135, which target and inhibit the factors involved in myoblast differentiation [25]. [score:5]
HuR binds linc-MD1 promoting its sponging activity and linc-MD1, in turn, attenuates this effect by sequestering miR-133 [70]. [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The proof was given that miR-133b downregulates FOXL2 expression by directly targeting the 3′UTR and inhibiting the FOXL2 -mediated transcriptional repression of StAR and CYP19A1 to promote estradiol production in the mouse granulosa cells [45]. [score:11]
[1 to 20 of 1 sentences]
91
[+] score: 11
For example, skeletal muscle-specific expression TF, serum response factor (SRF), regulates miR-1 cluster (miR-1 and miR-133) which is well known to express specifically in skeletal muscle; this signaling pathway has been certified to play a critical role in modulating skeletal muscle proliferation and differentiation 37. [score:6]
Twelve of 116 TS miRNAs (miR-1, miR-126, miR-208, miR-128a, miR-133a, miR-133b, miR-134, miR-146a, miR-377, miR-483, miR-92a and miR-95) were specifically expressed in two tissues; whereas, the remaining TS miRNAs were specifically expressed in only one tissue. [score:5]
[1 to 20 of 2 sentences]
92
[+] score: 11
miR-133b negatively regulates the expression of transcription factor, Pitx3[42], which activates the dopamine receptor (DRD1), a mediator of nicotine addiction in smokers [43]. [score:4]
Five miRNAs (miR-34c, miR-34b, miR-149, miR-133a and miR-133b) were significantly down-regulated in lung from patients with moderate compared to mild emphysema as defined by gas transfer (p < 0.01). [score:3]
Class comparison identified five miRNAs (miR-34c, miR-34b, miR-149, miR-133a and miR-133b) that were significantly differentially expressed between mild and moderate emphysema (p < 0.01, Additional file 1: Figure S2 & Table  2). [score:3]
In this cohort, expression of three of these miRNAs (miR-149, miR-133a and miR-133b) correlated with functional measurement of emphysema severity (KCO, Figure  1). [score:1]
[1 to 20 of 4 sentences]
93
[+] score: 11
Muscle specific myomiR miR-1 and miR-133 and the ubiquitous miR-29c and miR-30c are down-regulated in mdx mice. [score:4]
linc-MD1 acts as a natural decoy for miR-133 and -135, thus interfering with miRNA repressing activity on the important targets involved in myogenic differentiation MAML1 (Mastermind-like 1) and MEF2, respectively [90]. [score:3]
An up-to-date list of the identified targets of miR-1, miR-133 and miR-206, together with a plethora of specific muscular pathways they are involved in, is reported in a recent review [40] and some of these will be also discussed in the next paragraph to highlight how these important families of miRNAs contribute to determine typical deficiencies occurring in a pathological muscular context. [score:3]
It is possible to functionally define miR-133 as enhancer of myoblast proliferation while miR-1 and miR-206 as enhancers of skeletal muscle differentiation [37– 40]. [score:1]
[1 to 20 of 4 sentences]
94
[+] score: 11
Thus, miR-182 and miR-183 are overexpressed and miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in both cell lines containing integrated HPV16 or HPV18 DNA [30]. [score:5]
HPV18 positive HeLa cell line has overexpression of miR-182 and miR-183, while miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in this cell line as compared with normal cervical tissue. [score:4]
In contrast, miR-1, miR-126, miR-133b, miR-143, miR-145, miR-195, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in these cell lines as compared with normal cervical tissue. [score:2]
[1 to 20 of 3 sentences]
95
[+] score: 11
In order to validate PCR-array results, we evaluated the expression of some target genes belonging to the most differentially expressed miRNAs (VEGF-A, PKCε, MMP9 and NOD2 as targets of miR-205-3p, miR-1, miR-133b and miR-122-5p, respectively). [score:7]
When compared to the control group, five differentially expressed miRNAs (adjusted P < 0.05) were identified in cells IR with 0.6 Gy, of which three were augmented (miR-205-3p, miR-1 and miR-133b) and two diminished (miR-122-5p and miR-134-5p) (Figure 5A and Table 1). [score:2]
mRNAs targeted by: (A) MiR-205-3p (VEGFA), (B) miR-1 (PKCε), (C) miR-133b (MMP9) and (D) miR-1225p (NOD2), were evaluated by RTqPCR in DLD-1 cells, 48 h after irradiation with 0 (Control), 0.6 and 12 Gy. [score:1]
Figure 6mRNAs targeted by: (A) MiR-205-3p (VEGFA), (B) miR-1 (PKCε), (C) miR-133b (MMP9) and (D) miR-1225p (NOD2), were evaluated by RTqPCR in DLD-1 cells, 48 h after irradiation with 0 (Control), 0.6 and 12 Gy. [score:1]
[1 to 20 of 4 sentences]
96
[+] score: 11
For instance, miR-21 targets the mRNA for the tropomyosin (Zhu et al., 2007); both miRNA-143 and miR-145 regulate podosome formation in smooth muscle cells (Xin et al., 2009); and miR-145, miR-133a, and miR133b target the fascin homolog 1 (Kano et al., 2010). [score:6]
miR-145, miR-133a and miR-133b: tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. [score:5]
[1 to 20 of 2 sentences]
97
[+] score: 11
Shan et al. reported a decreased miR-133 and miR-590 expression in smoking individuals with atrial fibrosis and showed that an ectopic over -expression of miR-133 and miR-590 resulted in a post-transcriptional suppression of TGF-β 1 and TGF-β RII in cultured canine atrial fibroblasts (Shan et al., 2009). [score:7]
Downregulation of miR-133 and miR-590 contributes to nicotine -induced atrial remo delling in canines. [score:4]
[1 to 20 of 2 sentences]
98
[+] score: 11
While miR-133a downregulation in HNOC has been reported by Wong et al. [25], downregulation of miR-133b has been consistently observed by both Wong and Kozaki studies [25, 27]. [score:7]
The downregulation of miR-133b has also been observed in colorectal cancer [59]. [score:4]
[1 to 20 of 2 sentences]
99
[+] score: 11
Interventional cardiologists have already provided evidence that cardiac expressed miRs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, and miR-499) increase in the blood acutely following a myocardial infarction (MI) and some of these studies have additionally scrutinized the diagnostic potential of miRs by comparisons with cTns[15– 17]. [score:3]
As shown in Fig 3 and Table A in S4 Table, the concentrations of miR-1, miR-133a and miR-133b increased in the whole plasma at 24h post-surgery. [score:1]
In detail, concentrations of exosomal miR-1, miR-24, miR-133a and miR-133b all increased at both 24h and 48h post-surgery, while some of these changes were not detected in the whole plasma (see above). [score:1]
This suggests the possibility that after CABG miR-24 and miR-210 are predominantly released via exosomes, while miR-1 and miR-133 are released via exosomes and exosome-independent mechanisms in similar proportions. [score:1]
In ARCADIA, a selection of the aforementioned miRs (miR-1, miR-24, miR-133a, miR-133b, miR-210) together with the negative control (for cardiac expression) liver-specific-miR-122 were measured both in whole plasma and its exosomal fraction. [score:1]
The concentration of total exosomes was positively correlated with the concentration of exosomal miR-1, miR-133a, miR-24, miR-210 and miR-133b (Fig 7). [score:1]
Finally, the exosomal concentrations of miR-1, miR-133a, miR-24, miR-210 and miR-133b were strongly positively correlated with cTn-I (Fig 8). [score:1]
miR-133b) in the plasma exosome cargo and in the fact that abundance of exosomal cardiac miRs increased after CABG. [score:1]
In contrast, the exosome/whole plasma concentration ratios of miR-1, miR-133a and miR-133b were mostly unchanged. [score:1]
[1 to 20 of 9 sentences]
100
[+] score: 11
Several miRNAs modulate osteogenic differentiation: miR-125b negatively regulates osteoblastic differentiation through targeting VDR, ErbB2, and Osterix [28, 29]; miR-133 (targeting RUNX2) and miR-135 (recognizing SMAD5) inhibit differentiation of mouse osteoprogenitors [30]; miR-26a and miR-29b facilitate osteogenic differentiation of human adipose tissue-derived stem cells (hADSCs), and positively modulate mouse osteoblast differentiation [31, 32]. [score:8]
In USSC, miR-133a and miR-133b as well as miR-135b are only weakly expressed even in native cells and virtually unchanged during osteogenic differentiation (see Additional file 1). [score:3]
[1 to 20 of 2 sentences]