sort by

38 publications mentioning hsa-mir-346

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-346. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 511
For instance, miR-10a interacts with the 5′UTR of mRNAs encoding ribosomal proteins to enhance their translation 35. miR-346 targets the 5′UTR of the receptor-interacting protein 140 (RIP140) mRNA to upregulate its expression 36. miR-1 has been also reported to represses translation in the cytoplasm, but positively enhances mitochondrial translation recently 37. [score:14]
Surprisingly, the miR-138/346-loop mimics upregulated hTERT expression compared to the downregulation observed in the presence of miR-138, and miR-138/miR-346-loop mut mimics abrogated the promotion of hTERT expression induced by the miR-138/346-loop mimics. [score:10]
In conclusion, miR-346 -mediated upregulation and miR-138 -mediated downregulation competitively coordinate the regulation of hTERT expression by binding to a common site in the hTERT 3′UTR, which promotes the growth of human cervical cancer cells. [score:10]
To validate that miR-346 promotes and miR-138 suppresses the growth of HeLa cells by directly upregulating hTERT, the “rescue” experiments were performed using an hTERT expression vector (pcDNA3/hTERT) containing the hTERT ORF without the 3′UTR (Fig. S4a,b and Fig. S10). [score:9]
In addition, depletion of hTERT suppressed the growth of HeLa cells in vitro and HeLa-derived tumors in vivo, which was similar to the phenotype of loss of miR-346, and ectopic expression of hTERT effectively rescued the suppression of HeLa cell growth caused by miR-346 inhibition. [score:9]
Similarly, co -expression of miR-346 and Flag-GRSF1 led to higher levels of hTERT expression than that the group co -expressing both the miR-346 loop mut and Flag-GRSF1 (Fig. 6c and Fig. S9), demonstrating that GRSF1 promotes hTERT translation in a miR-346 -dependent and sequence motif-specific manner. [score:9]
Restoration of hTERT expression abrogates the growth suppression of HeLa cells caused by miR-346 inhibition or miR-138 overexpression. [score:9]
Together, these results indicate that miR-346 promotes the recruitment of hTERT mRNA to ribosomes through GRSF1 to enhanced translation, while miR-138 may facilitate targeting hTERT mRNA to RISC to suppress translation (Fig. 7e). [score:9]
These findings indicate that miR-346 -mediated upregulation of hTERT occurs in an AGO2-independent manner through hTERT 3′UTR in human, although miR-346 has been also reported to upregulate RIP140 by targeting 5′UTR in an AGO2-independent manner in mice. [score:9]
To further confirm the role of miR-346 “CCGCAU” motif, TargetScanHuman 6.2 and RNAhybrid algorithm were used to predict target genes of miR-346 and analyze the secondary structures of miR-346/target gene mRNAs duplexes, as a result, ACVR2B and SMAD3 were chosed as two different types of target genes: with and without miR-346 loop (Fig. 5a). [score:9]
Similarly, AGO2 knockdown attenuated miR-138 -mediated downregulation of endogenous hTERT mRNA and protein expression (Fig. 4b,c, Fig. S9), but had no effects on the ability of either pri-miR-346 or ASO-miR-346 to modulate hTERT expression (Fig. 4d,e, Fig. S8). [score:9]
However, Overexpression of miR-138 resulted in a left shift of hTERT mRNA distribution curve in ribosomes (Fig. 7c), indicating that miR-346 inhibition and miR-138 overexpression reduced hTERT translation. [score:9]
As expected, the miR-138/346-loop mimics upregulated hTERT protein expression and the miR-138/miR-346-loop mut mimics reversed the promotion of translation (Fig. 5i and Fig. S9). [score:8]
Firstly, the EGFP reporter assay revealed that miR-346 also targeted and upregulated hTERT and pri-miR-346 loop mut abolished its upregulation (Fig. S7a,b and Fig. S10). [score:8]
miR-346 promotes the growth of human cervical cancer cells and upregulates hTERT expression by targeting its 3′UTR. [score:8]
These results indicate that miR-346 -mediated upregulation of hTERT does not require AGO2; in contrast, miR-138 -mediated suppression of hTERT expression is AGO2 -dependent. [score:8]
Co -expression of miR-346 and shR-GRSF1 attenuated the upregulation of ACVR2B protein levels induced by co -expression of miR-346 and pSilencer-NC (Fig. 6g and Fig. S10). [score:8]
Collectively, these data suggest that miR-346 may upregulate hTERT expression to largely exert its cell growth-promotion effect in cervical cancer by specifically targeting the 3′UTR of the hTERT transcript. [score:8]
When HeLa cells were cotransfected with ASO-miR-346 or pri-miR-138 and pcDNA3/hTERT, the inhibition of hTERT expression, cell viability and the colony formation rate were rescued by hTERT expression (Fig. 2e–g and Fig. S8). [score:7]
miR-346 and miR-138 competitively bind to a common site in the hTERT 3′UTR and facilitate the targeting of the hTERT mRNA to either the ribosome to promote translation by GRSF1 or to RISC to repress translation by AGO2, respectively. [score:7]
Overexpression of hTERT counteracts the cell viability (f) and growth inhibition (g) caused by ectopic miR-138 or ASO-miR-346 expression in HeLa cells. [score:7]
And pri-miR-346 promoted and ASO-miR-346 suppressed endogenous ACVR2B mRNA and protein expression, while the pri-miR-346 loop mut abolished the activation effects on their expression (Fig. 5c,d, Fig. S9). [score:7]
Next, we found that pri-miR-346 loop mut abolished the miR-346 -mediated activation of reporter expression, hTERT mRNA and protein expression (Fig. 4h,i, Fig. S9) as well as the promotion of cell viability and colony formation rate (Fig. 4j,k), indicating that the middle sequence motif (nt 8-13, CCGCAU) of miR-346 is crucial for enhancing hTERT expression. [score:7]
Simultaneously, pri-miR-346 promoted and ASO-miR-346 suppressed endogenous hTERT mRNA and protein expression, whereas pri-miR-346 loop mut abrogated the promoting effect of miR-346 on hTERT expression (Fig. S7c,d and Fig. S10). [score:7]
miR-346 was predicted to form a “bulge loop” when bound to the ACVR2B 3′UTR, which was upregulated depending on the miR-346 loop, and not predicted to form a miR-346 loop when bound to the SMAD3 3′UTR, which was downregulated whether the miR-346 loop was mutated or not. [score:7]
Together, our findings reveal a novel mo del where miR-346 enhances the expression of hTERT by binding to its 3′UTR and facilitating its recruitment to ribosomes in an AGO2-independent manner, while AGO2 -associated miR-138 concomitantly suppresses hTERT expression (Fig. 7a). [score:7]
Thus, our findings suggest that the miR-346 “CCGCAU” motif is a new GRSF1 binding motif and GRSF1 may be a universal mediator to upregulate gene expression. [score:6]
GRSF1 mediates the up-regulation of hTERT expression by miR-346 through recruiting hTERT transcripts to polyribosomes. [score:6]
miR-346 upregulates hTERT expression in an AGO2-independent manner, but requires the miR-346 middle sequence motif. [score:6]
miR-346 upregulates hTERT expression in an AGO2-independent manner and requires the miR-346 middle sequence motif. [score:6]
However, overexpression of the miR-346 loop mut abrogated the miR-346 -mediated recruitment of hTERT transcripts to polyribosomes, and led to an approximately 64% reduction in hTERT mRNA bound to the polyribosomes (Fig. 7d), probablely due to the seed sequence of the miR-346 loop mut leading to hTERT downregulation. [score:6]
So we predicted a putative miR-346 binding site within hTERT 3′UTR and identified that miR-346 enhanced hTERT expression through directly targeting the hTERT 3′UTR, which may be related with the increased stability of hTERT mRNA. [score:6]
As expected, mutation of the middle sequence abrogated the miR-346 -mediated promotion of hTERT expression in HeLa and C33A cell lines and HeLa cell growth, indicating that miR-346 promotes hTERT expression in a miR-346 “CCGCAU” motif -dependent manner. [score:6]
These data illustrated that the miR-346 loop has significant effects on miR-346 -mediated upregulation of target genes. [score:6]
Taken together, these data suggested that the miR-346 middle sequence motif is essential for mediating the upregulation of target genes, which may be universal. [score:6]
These results indicate that miR-346 may not influence hTERT transcription, but that it protects hTERT mRNA from degradation, potentially contributing to the upregulation of hTERT expression. [score:6]
As expected, the EGFP reporter assay showed that miR-346 targeted and positively regulated ACVR2B expression (Fig. 5b). [score:5]
Mutation of both binding sites (346- & 138-mut) abolished the regulation of EGFP expression by both miR-138 and miR-346 (Fig. 3c). [score:5]
Conversely, pri-miR-346 decreased and ASO-miR-346 increased the EGFP reporter intensities and endogenous SMAD3 mRNA and protein expression; however, the pri-miR-346 loop mut did not affect the miR-346 -mediated suppression (Fig. 5e–g and Fig. S9). [score:5]
Meanwhile, a positive correlation between the hTERT and miR-346 expression (Fig. 2j), but a negative correlation between the hTERT and miR-138 (Fig. 2k) was observed, indicating that enhanced hTERT expression correlate with increased miR-346 and decreased miR-138 in human cervical cancer tissues and cell lines. [score:5]
In the present study, we found miR-346 targeted and enhanced the expression of hTERT through binding its 3′UTR. [score:5]
In detail, miR-346 and miR-138 target a common target region of the hTERT 3′UTR, nucleotides 20 to 34, and that the binding sites for both miRNAs overlap by 9 bases (Fig. 3a). [score:5]
Thus, ectopic expression of miR-138 and inhibition of miR-346 using ASO were used for further studies. [score:5]
However, miR-138 was not obviously observed in the ribosomes, and the hTERT mRNA levels in ribosomes negatively correlated with miR-138 expression, which may shift the hTERT mRNA to RISC, indicating that miR-346 can promote the recruitment of hTERT mRNA to ribosomes for translation. [score:5]
Co -expression of Flag-GRSF1 and miR-138/miR-346-loop mut mimics abolished the translational enhancement induced by Flag-GRSF1 and miR-138/miR-346-loop mimics (Fig. 6j and Fig. S10). [score:5]
To determine the role of miR-346 in the growth of cervical cancer cells, the ectopic expression plasmid of miR-346 (pri-miR-346) and antisense oligomers (ASO-miR-346) were used to overexpress or block miR-346, respectively, in HeLa and C33A human cervical cancer cell lines (Fig. S1a,b). [score:5]
Here, GRSF1 was found to promote miR-346 -mediated upregulation of hTERT, which was sequence-specific and required wild type miR-346 loop. [score:4]
miR-346 and miR-138 bind a common site in the hTERT 3′UTR to coordinately regulate its expression. [score:4]
In order to address the above question, we first detected whether the miR-346 -mediated upregulation of hTERT is dependent on AGO2, the key component of RISC. [score:4]
miR-346 and miR-138 competitively regulate hTERT expression and function. [score:4]
miR-346 enhances the growth of human cervical cancer cells by directly targeting the 3′UTR of hTERT mRNA both in vitro and in vivo. [score:4]
To explore whether a sequence motif within miR-346 is involved in hTERT upregulation, we applied bioinformatics analysis (RNAhybrid) and found that nucleotides (nt) 1 to 7 and 14 to 18 of miR-346 are complementary to nt 35-29 and 23-19 of the hTERT 3′UTR, respectively. [score:4]
Next, we examined whether the GRSF1 -mediated upregulation was dependent upon the miR-346 loop motif. [score:4]
These results indicate that miR-346 and miR-138 compete for binding to a common region on the hTERT 3′UTR and competitively regulate hTERT expression and function, which depends on the ratio of miR-346 to miR-138. [score:4]
To determine if the recruitment of the hTERT mRNA to polysomes was GRSF1 -mediated and miR-346 -dependent, we used a ribosome footprinting assay that has been wi dely used to identify translating mRNAs and associated proteins 31 43, and found that hTERT mRNA levels in ribosomes positively correlated with miR-346 expression levels. [score:4]
As previously described, the “bulge loop” of miR-346 (CCGCAU) is crucial to hTERT upregulation. [score:4]
These results indicate that hTERT mRNA is a direct target of miR-346. [score:4]
Here, we found that knockdown of AGO2 did not influence the miR-346 -induced activation of the reporter or the endogenous hTERT mRNA and protein expression levels. [score:4]
This observation prompted us to explore whether miR-346 and miR-138 competitively regulate hTERT expression. [score:4]
The middle CCGCAU motif within miR-346 is essential for GRSF1 binding, which is involved in the miR-346 -mediated enhancement of hTERT expression. [score:3]
hTERT is a functional target of both miR-346 and miR-138. [score:3]
Accordingly, miR-346 competes with miR-138 for binding to sites within the hTERT 3′UTR, resulting in enhanced the stability of hTERT mRNA and translation of the hTERT protein. [score:3]
And there was a positive correlation between the EGFP expression levels and the ratio of pri-miR-346 to pri-miR-138 in the context of a fixed concentration of miR-346 or miR-138 (Fig. 3b). [score:3]
To determine whether the miR-346 loop (Fig. S1c) is involved in regulating hTERT expression, firstly, we confirmed that the mutant miR-346 was still capable of binding to hTERT 3′UTR through the dot blot hybridization assay (Fig. S6b). [score:3]
To determine whether miR-346-facilitated recruitment of hTERT transcripts to ribosomes depends on GRSF1, qRT-PCR showed that overexpression of miR-346 and knockdown of GRSF1 resulted in an approximately 35% decrease in the amount of hTERT mRNA in the polyribosome fractions compared with control group (Fig. 7d). [score:3]
These data further confirmed that the role of GRSF1 in miRNA-346 -mediated target genes is dependent upon the miR-346 “CCGCAU” motif. [score:3]
In contrast, the expression of the 3′UTR mutant reporter was not affected by the alteration of miR-346 level (Fig. 1f). [score:3]
To further investigate whether replacing the miR-138 motif with the miR-346 motif promotes hTERT expression, we detected endogenous hTERT protein expression by western blot in HeLa cells transfected with synthesized miR-138/346-loop mimics (with the wild type miR-346 “CCGCAU” sequence motif), miR-138/miR-346-loop mut mimics (with mutant sequences of the miR-346 motif) and NC. [score:3]
Because GRSF1 augments the translation of mRNA by recruiting bound mRNAs to ribosomes 24, we explored whether GRSF1 mediates the miR-346 -dependent recruitment of hTERT mRNA to ribosomes. [score:3]
Furthermore, the EGFP intensities in HeLa cells transfected with the 138-mut or 346-mut reporter vector were enhanced with increased miR-346 (Fig. 3d) or decreased miR-138 (Fig. 3e); however, mutation of both the miR-138 and miR-346 binding sites abolished regulation whatever the ratio of miR-346 to miR-138 was (Fig. 3f). [score:3]
We performed western blot to analyze the ACVR2B protein expression following the co-transfection of miR-346 or miR-346 loop mut and Flag-GRSF1 in HeLa cells. [score:3]
Overexpression of miR-346 reduced the abundance of hTERT mRNA associated with AGO2, probablely due to more hTERT mRNA bound to miR-346 (Fig. 4f). [score:3]
In this report, we showed that miR-346, upregulated in cervical cancer tissues compared with adjacent normal tussues, promoted HeLa cell growth in vitro and HeLa cell-derived tumors in vivo, inferring its oncomiR role in cervical cancer. [score:3]
The influences of miR-346 on another two target genes, ACVR2B and SMAD3. [score:3]
To identify the target genes of miR-346 that promote growth in cervical cancer cells, bioinformatics analysis showed that hTERT contains a putative miR-346 binding site in its 3′UTR (Fig. 1e). [score:3]
Moreover, a positive correlation between miR-346 and hTERT expression in cervical cancer tissues was also observed. [score:3]
The above results in Fig. 5 showed that miR-346 and miR-138/346-loop mimics depended on miR-346 “CCGCAU” motif to enhance the expression of ACVR2B and hTERT, respectively. [score:3]
Together, these data indicate that miR-346 alone and that a miR-346/hTERT 3′UTR fragment (annealed duplex) can bind the GRSF1 complex through the miR-346 “CCGCAU” motif, which is involved in miR-346 -mediated promotion of hTERT expression. [score:3]
Bioinformatics analysis showed that miR-138 and miR-346 target common regions in the hTERT 3′UTR that overlap by 15 nucleotides (nt 21–40 and 16–35, respectively). [score:3]
These results indicate that hTERT is a common mediator of miR-346-activated and miR-138 -suppressed cell growth in HeLa cells. [score:3]
These results indicate that miR-346 enhances hTERT expression and activity and may protect hTERT mRNA from degradation. [score:3]
Co-transfection of miR-346 and shR-GRSF1 led to an approximately 60% reduction in hTERT protein compared with the group co -transfected with miR-346 and the pSilencer-NC (Fig. 6b), indicating that GRSF1 appears to contribute to miR-346 -mediated upregulation of hTERT. [score:3]
Surprisingly, AGO2 depletion abolished the repression of the reporter by miR-138, but did not affect the reporter expression by the ASO-miR-346 compared with the control groups (Fig. 4a and Fig. S8). [score:2]
Since AGO2 is the core effector of RISC, we investigated whether AGO2 is involved in the miR-138- and miR-346 -mediated regulation of hTERT expression by RNA interference. [score:2]
Furthermore, miR-346 inhibition led to a left shift of hTERT mRNA distribution curve compared to the control group (Fig. 7c). [score:2]
The role of the motif was further confirmed by miR-346 -mediated regulation of ACVR2B and SMAD3. [score:2]
To further illustrate the positive regulation of miR-346 on hTERT by the middle sequence motif of miR-346, a series of experiments were conducted in another cervical cell line C33A. [score:2]
How to cite this article: Song, G. et al. miR-346 and miR-138 competitively regulate hTERT in GRSF1- and AGO2 -dependent manners, respectively. [score:2]
The miR-346 “CCGCAU” motif is crucial for GRSF1 binding. [score:1]
Furthermore, the binding to the hTERT 3′UTR with miR-138 or miR-346 mutant binding sites was weakened by increasing cold miR-346 or cold miR-138, not by itself (Fig. 3h, left panel bottom and right panel up). [score:1]
qRT-PCR showed significant enrichment of miR-346 and hTERT mRNA with the precipitated endogenous GRSF1 complexes (Fig. 6d). [score:1]
miR-346 was present in the ribosome fractions and had a similar distribution pattern as hTERT mRNA over the range of polyribosomes (Fig. 7b). [score:1]
As shown in Fig. 3g, increasing the levels of cold miR-138 decreased the binding of hot miR-346 to the hTERT 3′UTR fragment, and vice versa. [score:1]
And cold miR-16 did not decrease the binding of hot miR-346 or hot miR-138 to the hTERT 3′UTR fragment (Fig. 3h, left panel up). [score:1]
Next, we synthesized miR-138 mimics with the miR-346 mutant loop sequence (miR-138/miR-346-loop mut mimics) to determine whether GRSF1 plays a promoting role in a miR-346 sequence motif -dependent manner. [score:1]
In this study, we found that the middle nt 8 to 13 (CCGCAU, 6 nt) of miR-346 do not match nt 28 to 24 of the hTERT 3′UTR and forms a “bulge loop” (miR-346 loop) when bound to the hTERT 3′UTR with RNAhybrid algorithm. [score:1]
Furthermore, RIP and RNA EMSA assays demonstrated that GRSF1 interacted with miR-346 or the miR-346/hTERT 3′UTR duplex and that mutation of the miR-346 middle “CCGCAU” motif abrogated this interaction. [score:1]
The unconjugated miR-346 or unconjugated miR-346/hTERT 3′UTR fragment duplexes could compete with their labeled counterparts for binding (Fig. 6f, lane 5 and 9). [score:1]
A 200-fold excess of unconjugated miR-346 or miR-346/hTERT served as a competitor. [score:1]
It was found that pri-miR-346 promoted, whereas ASO-miR-346 suppressed cell viability and cell growth by MTT, colony formation and growth curve assays compared to the control groups in both cell lines (Fig. 1a–c and S2a–c). [score:1]
Taken together, these data consolidate the positive impacts of miR-346 on hTERT by its “CCGCAU” motif. [score:1]
GRSF1 also mediated the promotion of miR-346 and miR-138/346-loop mimics on ACVR2B and hTERT, respectively, in which the miR-346 “CCGCAU” motif is also essential. [score:1]
The distribution of miR-346 is similar to that of hTERT mRNA in the ribosomes. [score:1]
To determine whether GRSF1 forms a complex with miR-346 and hTERT mRNA, we performed a RIP experiment using an anti-GRSF1 antibody in mock HeLa cells. [score:1]
Additionally, the endogenous hTERT protein and colony formation rate both positively correlated with the ratio of pri-miR-346 to pri-miR-138 (Fig. 3i,j and Fig. S8). [score:1]
GRSF1 facilitates miR-346 -mediated recruitment of hTERT mRNA to polyribosomes in a “bulge loop” motif -dependent manner. [score:1]
Furthermore, a xenograft tumor mo del was used to determine whether miR-346 is involved in tumorigenesis in vivo in a loss-of-function manner. [score:1]
HeLa cells were transfected with this reporter vector along with pri-miR-346, a control vector, ASO-miR-346 or the ASO-NC. [score:1]
GRSF1 depletion abolished the shift of hTERT mRNA to the right that was caused by miR-346 (top panel) and reduced the level of hTERT mRNA in the polyribosome fractions (9–20) as shown by qRT-PCR (bottom panel). [score:1]
Whereas the hTERT 3′UTR with 346 & 138 mutant which mutated both miR-138 and miR-346 binding sites was totally abolished to bind to miR-138 and miR-346 (Fig. 3h, right panel bottom). [score:1]
As shown in Fig. 6h, co-transfection of miR-346 loop mut and Flag-GRSF1 abolished the miR-346 -mediated promotion. [score:1]
As shown in Fig. 1i, pri-miR-346 increased, whereas ASO-miR-346 decreased the stability of hTERT mRNA following treatment with ActD. [score:1]
Next, we synthesized a mutant miR-138 mimics whose middle sequence was replaced with that of wild type miR-346 (miR-138/346-loop mimics) and another mutant miR-138 mimics with the mutant loop sequence of miR-346 (miR-138/miR-346-loop mut mimics). [score:1]
However, detailed studies are needed to determine the specific domain of GRSF1 that is responsible for binding the miR-346 “CCGCAU” motif. [score:1]
hTERT mRNA levels correlate with the ratio of miR-346 to miR-138, and this ratio correlated with the rate of colony formation in HeLa cells. [score:1]
In addition, compared to the adjacent normal cervical tissues, the increased levels of hTERT mRNA as well as miR-346 and decreased levels of miR-138 were found by qRT-PCR in eighteen human cervical cancer tissues (Fig. 2h,i), and the aberrant expression of both miRNAs were futher confirmed by northern blot assays in both cervical cancer tissues and cervical cancer cell lines (Fig. 2l and S8). [score:1]
hTERT 3′UTR fragment containing either the predicted miR-346 binding site or a mutant binding site (Fig. 1e) was inserted downstream of the EGFP gene following a stop codon (pEGFP-hTERT 3′UTR, pEGFP-hTERT 3′UTR mut). [score:1]
Thus, the miR-346 middle sequence is indispensable for GRSF1 as the mediator of miR-346-facilitated recruitment of hTERT mRNA to the ribosome. [score:1]
We found that the miR-346 loop mutant abrogated the ability of miR-346 to promote the recruitment of hTERT mRNA to ribosomes. [score:1]
Moreover, overexpression of miR-346 led to an approximately 4-fold and 20-fold increase, whereas ASO-miR-346 led to a 60% and 40% decrease in the levels of hTERT mRNA and miR-346 associated with the GRSF1 complex, respectively, compared to their controls in transfected HeLa cells by RIP assays. [score:1]
Furthermore, RNA immunoprecipitation (RIP) analysis showed that miR-138 and hTERT mRNA, but least miR-346 were bound to the AGO2 complex. [score:1]
In addition, depletion of AGO2 reduced miR-138 and hTERT mRNA assembled to AGO2 complex and increased hTERT mRNA bound to miR-346 to GRSF1 complex (Fig. S6a). [score:1]
These results confirm that miR-346 facilitates cervical cancer cell growth. [score:1]
In EGFP-hTERT 3′UTR reporter assays, AGO2 depletion in HeLa cells abolished miR-138 -mediated repression but did not affect the regulation by ASO-miR-346 (bottom panel). [score:1]
HeLa cells were transfected with the wild type EGFP-hTERT 3′UTR (WT) or mutated EGFP-hTERT 3′UTR (mutant) reporter vectors and either ASO-miR-346, pri-miR-346, control ASO or the control vector. [score:1]
HeLa cells transfected with ASO-miR-346 or ASO-NC were injected into severe combined immunodeficiency (SCID) mice. [score:1]
Then an enhanced green fluorescence protein (EGFP) reporter assay was used to validate whether miR-346 directly binds the 3′UTR of hTERT mRNA. [score:1]
However, biotin-conjugated miR-346 and biotin-conjugated miR-346/hTERT 3′UTR fragment annealed duplex generated obviously shifted complexes (Fig. 6f, lane 2 and 7), while the biotin-miR-346 loop mutant (B-miR-346 mut) or B-miR-346 loop mutant /hTERT 3′UTR fragment duplex did not generate a shift band (Fig. 6f, lanes 3 and 8). [score:1]
The correlation between the expression levels of miR-346 or miR-138 and hTERT mRNA was calculated using the Pearson correlation coefficient with the software of GraphPad Prism 6.01. [score:1]
The miR-138 and miR-346 seed sequences are complementary to nt 34–40 and nt 29–35 of the hTERT 3′UTR, respectively; the 9 bases that mediate miR-346 binding are the same as those that mediate the miR-138 interaction (Fig. 3a-I). [score:1]
To address this question, an EGFP reporter vector containing an hTERT 3′UTR fragment with miR-346 and miR-138 binding sites was transfected along with various concentrations of pri-miR-346, pri-miR-138 or a control vector into HeLa cells (Fig. 3b, bottom panel). [score:1]
The sequences of the wild type (WT) and mutant miR-346 loops are shown. [score:1]
Next, we investigated whether the GRSF1 -mediated promotion of hTERT translation was dependent on the miR-346 “CCGCAU” motif. [score:1]
The middle sequence of miR-346, nt 8-13 (CCGCAU, 6 nt), does not match nt 28 to 24 (AGAGC, 5 nts) of the hTERT 3′UTR, which causes a “bulge loop” (termed miR-346 loop) (Fig. 4g). [score:1]
Likewise, telomere repeat amplification protocol (TRAP) analysis showed that pri-miR-346 significantly enhanced, but ASO-miR-346 reduced the telomerase activity (Fig. 1h, right panel and Fig. S8). [score:1]
Moreover, depletion of GRSF1, miR-346 reduced the enrichment of hTERT mRNA in polyribosomes. [score:1]
Thus, miR-346 may function as a decoy, while miR-138 may act as an inducer of decay to fine-tune hTERT levels by binding the common site in its 3′UTR. [score:1]
[1 to 20 of 137 sentences]
2
[+] score: 295
Our data reveals that the miR-346 -inhibited XPC facilitates the expression of Snail, which further suppresses the expression of E-Cadherin, leading to rescue cancer cells from E-Cadherin -mediated proliferation, migration and invasion inhibition, and apoptosis impetus. [score:11]
Results demonstrated both miR-346 mimic and si-XPC suppressed the protein expression of XPC, and then resulted in an increased phosphorylation of ERK1/2 in both A549 and SPC-A-1 cell lines (Fig. 10A–B), indicating that XPC is able to inhibit the ERK pathway in NSCLC cells, and miR-346 could activate ERK pathway by directly targeting XPC. [score:10]
Figure 10 Mo del of the mechanism by which miR-346 suppresses XPC then activating ERK/Snail pathway, which leads to down-regulation of E-Cadherin expression and facilitates cell proliferation and metastasis, and inhibits cell apoptosis in lung cancer. [score:10]
In addition, both miR-346 mimic and XPC knockdown -enhanced Snail expression could be blocked by the inhibition of the ERK pathway, accompanied by an increased expression of E-Cadherin (Fig. 10A–B). [score:8]
Moreover, we also revealed up-regulation of miR-346 facilitated NSCLC cell growth, migration and invasion, and promoted G1/S transition, as well as suppressing NSCLC apoptosis through targeting XPC. [score:8]
Expression of XPC is up-regulated in primary human lung cancer and negatively expressed related to miR-346. [score:8]
Figure 2Expression of XPC is up-regulated in primary human lung cancer and negatively expressed related to miR-346(A-B) Western-blot of XPC protein and qRT-PCR of XPC mRNA in lung cancer tissues and adjacent-normal lung cancers. [score:8]
Although there was no significant association between miR-346 expression and sex, differentiation, or histological tumor type smoking, up-regulated expression of miR-346 was commonly observed in NSCLC patients with elder age, bigger tumor sizes, smokers, positive lymph node metastasis, and advanced stage (P <0.05, Table 1). [score:8]
We show for the first time that miR-346 directly targets and regulates the full-length 3′-UTR of the human XPC mRNA, which is down-regulated lung cancer. [score:8]
We determined the effects of miR-346 over -expression or inhibition, and XPC inhibition on cell proliferation via. [score:7]
miR-346 directly targeting 3′-UTR of XPC mRNA, contributes to down-regulation of XPC protein. [score:7]
Expression of XPC is down-regulated in primary human NSCLC and negatively related to miR-346. [score:6]
Here, we reported that miR-346 is indeed up-regulated in NSCLC compared with the matching normal lung tissues, and found 3′-UTR of the human XPC mRNA is really a target of miR-346. [score:5]
Taken together, these results clearly demonstrated that miR-346 expression markedly promoted the migration and invasion motility of NSCLC cells through targeting XPC. [score:5]
MiR-346 mimic and mimic negative control, miR-346 inhibitor and inhibitor negative control were purchased from GenePharma Co. [score:5]
Here, we observed an increase of Snail expression at the protein levels and a concomi-tant decrease of E-cadherin expression after miR-346 mimic or si-XPC treatment in lung cancer cell lines. [score:5]
Ectopic expression of miR-346 suppresses apoptosis in A549 and SPC-A-1 cells. [score:5]
In conclusion, we reveal that miR-346 facilitates NSCLC cell growth and metastasis in by directly targeting 3′-UTR of XPC. [score:4]
Wang et al. also found that miR-346 regulates osteogenic differen-tiation of human bone marrow-derived mesenchymal stem cells by targeting the Wnt/β-catenin pathway [24]. [score:4]
miR-346 directly targeting XPC and then activating ERK/Snail pathway, which leads to decrease of E-cadherin. [score:4]
The oncogenic role of miR-346 in NSCLC is thus at least partly realized by downregulating XPC. [score:4]
Next, we examined miR-346 expression in NSCLC cell lines, and results demonstrated a higher expression of miR-346 in A549, SPC-A-1, H1299, 95-D, SK-MES-1, NCI-H520 and NCI-H460 cell lines, compared with that of in normal lung cells 16HBE (Fig. 1B). [score:4]
Whether XPC is the only direct target of miR-346 is still unknown. [score:4]
miR-346 up-regulation was detected in 108/114 (94.74%) of NSCLC tumors (Fig. 1A). [score:4]
Thus, it was concluded that the increased expression of miR-346 might make sense in initiation or development of NSCLC. [score:4]
Here, we also revealed a direct link between miR-346 and XPC expression in NSCLC patients, and observed that XPC and miR-346 levels were inversely correlated in human NSCLC specimens (Fig. 2C). [score:4]
A549 and SPC-A-1 cells (which have high endogenous miR-346 expression) transfected with miR-346 mimics and si-XPC showed increased proliferation (P <0.05), which was rescued by ASO-346 treatment (Fig. 5A–B). [score:3]
Furthermore, multivariate Cox regression analysis revealed that high (>3.7 folds of increase, n=78) miR-346 expression, elder age, and advanced stage are independent predictors of overall survival in NSCLC patients (Table 2). [score:3]
Our study showed miR-346 was upregulated in NSCLC tumor samples as compared with corresponding adjacent normal tissues (Fig. 1). [score:3]
Our experimental data may provide a strategy that targeting XPC possibly administered by miR-346, might be a clinically effective anti-NSCLC therapeutic strategy. [score:3]
miR-346 was ectopically expressed in NSCLC cell lines. [score:3]
Figure 9(A- B) Expression of XPC, phospho-ERK1/2, ERK2, Snail, and E-cadherin were detected in A549 and spc-a-1 cells either transiently transfected with NC, miR-346, si-XPC, or ASO-346. [score:3]
Figure 4 XPC proto-oncogene is a target of miR-346 at specific 3′-UTR sites(A) The 3′-UTR of XPC harbors one miR-346 cognate site. [score:3]
However, the percentage of apoptotic cells induced by miR-346 was increased to the basal level when the cells were treated with the specific miR-346 inhibitor (Fig. 7A–B). [score:3]
MiR-346 targets human XPCTo clarify the relationship between miR-346 and XPC, basic information about hsa-miR-346 was collected from miRBase. [score:3]
However, when treated with ASO-346, migration in miR-346 -expression defected A549 and SPC-A-1 cells were significantly decreased by approximately 48% and 31% relative to blank A549 and SPC-A-1 cells (Fig. 6A–B) respectively. [score:3]
Kaplan-Meier analysis indicated that high miR-346 expression was associated with poorer overall survival (log-rank test, P <0.0001, Fig. 1C). [score:3]
In addition, our results of western-blot demonstrated that the decreased expression (48% or 55% of decrease) of XPC in tumors developed from miR-346 mimic or si-XPC treated nude mice relative to that of control tumors (Fig. 8D). [score:3]
However, loss of miR-346 suppressed cell proliferation in A549 and SPC-A-1 cells (Fig. 5A–B). [score:3]
MiR-346 facilitates cell proliferation and colony formation, and promotes G1/S transition through down-regulation of XPC in NSCLC. [score:3]
MiR-346 is up-regulated in primary human lung cancer and NSCLC cell lines, and predicts a worse prognosis. [score:3]
In the present study, restoration of E-Cadherin expression in miR-346 -induced XPC-silencing NSCLC cells can neutralize XPC deficiency -induced cell proliferation, migration and invasion both in vitro and in vivo. [score:3]
When the XPC 3′-UTR was attached to the luciferase gene, luciferase activity decreased significantly (P <0.05) in A549 and SPC-A-1 cells transfected with miR-346 mimics, demonstrating that XPC was the target of miR-346 (Fig. 4B). [score:3]
XPC proto-oncogene is a target of miR-346 at specific 3′-UTR sites. [score:3]
In addition, we demonstrated that miR-346 overexpression expedited tumor growth in vivo (Fig. 8). [score:3]
MiR-346 is down-regulated in primary NSCLC tissues and cell lines, and predicts a worse prognosis. [score:3]
MiR-346 (MIMAT0000773), a recognized oncogenic miRNA, has been shown to be played an important role in several diseases. [score:3]
The miR-346 expression was examined by qRT-PCR (Fig. 8C). [score:3]
Ectopic expression of miR-346 in A549 and SPC-A-1 cells reduces cell migration and invasion motility. [score:3]
To examine the effect of miR-346 on endogenous XPC expression, we treated A549 and SPC-A-1 cells with NC, miR-346, si-XPC or ASO-346 for indicated time. [score:3]
C. Scatter plots showing the inverse association between miR-346 level and XPC mRNA expression. [score:3]
We also showed that high miR-346 expression correlated with advanced clinical stage and lymph node metastasis. [score:3]
In our present study, we discovered that miR-346 and XPC were promising potential prognostic marker for NSCLC, and found miR-346 is dramatically upregulated in human NSCLC tissues compared with normal lung tissues. [score:3]
XPC levels were decreased by ectopic miR-346 expression in NSCLC cells (Fig. 4). [score:3]
However, when treated with ASO-346, invasion in miR-346 -expression defected A549 and SPC-A-1 cells were significantly decreased by approximately 58% and 49% relative to blank A549 and SPC-A-1 cells (Fig. 6C–D), separately. [score:3]
To verify XPC targeting by miR-346, reporter constructs in which the XPC 3′-UTR, either wild type or mutated in the miR-346 binding sites, was cloned downstream of the luciferase open reading frame (ORF) (Fig. 4A). [score:3]
Ectopic expression of miR-346 facilitates tumor growth in vivo. [score:3]
Average miR-346 expression was approximately 3.7-fold higher in NSCLC specimens as compared with corresponding adjacent normal tissues (P <0.05, Fig. 1A). [score:2]
MiR-346 suppresses tumor growth in vivo. [score:2]
Luciferase activity assay results verified that XPC was a target of miR-346. [score:2]
After 8 days, NC, miR-346 mimic, si-XPC or ASO-346 was directly injected into the implanted tumor every 4 days for seven times. [score:2]
Western blot assay revealed that both miR-346 and si-XPC treatment decreased the protein level of XPC in A549 and SPC-A-1 cells, while ASO-346 treatment showed an increase in the XPC protein expression than NC treated A549 and SPC-A-1 cells (Fig. 4C). [score:2]
MiR-346 targets human XPC. [score:2]
MiR-346 suppresses NSCLC cell apoptosis. [score:2]
In addition, we also tested the caspase-3 and caspase-7 activity after treatment of A549 and SPC-A-1 cells with NC, miR-346 mimic, si-XPC or ASO-346, and results showed that miR-346 mimic and si-XPC treatment significantly decreased the caspase-3 and caspase-7 activity in A549 and SPC-A-1 cell lysate, by approximately 74% and 79%, or 54% and 49% of decrease (caspase-3 activity), 83% and 92%, or 47% and 41% of decrease (caspase-7 activity), than that of in blank A549 and SPC-A-1 cells (Fig. 7C–F), respectively. [score:1]
Our results of flow cytocytometric analysis revealed that miR-346 mimic or si-XPC treatment contributed to a 62% and 70%, or 56% and 67% of decrease in apoptotic cell death of A549 and SPC-A-1 cells (Fig. 7A–B), respectively. [score:1]
Thus, miR-346 promotes the growth of established NSCLC xenografts. [score:1]
miR-346 mimic or mimic NC was transfected into A549 and SPC-A-1 cells. [score:1]
Previous studies indicated that miR-346 might be an oncogenic miRNA in some cancers, including cervical cancer [21, 22], cutaneous squamous cell carcinoma [23]. [score:1]
However, the functional role and mechanistic action of miR-346 in NSCLC remained largely unclear. [score:1]
The tumor volume and weight of mice treated with miR-346 mimic or si-XPC were significantly increased (0.56-fold or 0.38-fold of increase in tumor weight, respectively) relative to that of treated with NC (Fig. 8A–B). [score:1]
The cells were washed with 1× PBS (pH7.4) and then transiently transfected with 50 nM NC or miR-346, 100 nM ASO-346 or si-XPC, using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. [score:1]
Moreover, we evaluated the correlation between XPC mRNA and miR-346 expression in 114 NSCLC tissues, and results revealed expression of XPC mRNA and miR-346 exhibited a significantly inverse correlation as calculated by Pearson correlation (r=−0.51, P <0.0001) (Fig. 2C). [score:1]
Next, we examined the role of miR-346 on A549 and SPC-A-1 cells migration and invasion. [score:1]
To validate the oncogenic role of miR-346 in vivo, we established a BALB/c nude mouse xenograft mo del using A549 cells. [score:1]
The miR-346 affects cell proliferation and cell cycle. [score:1]
miR-346 expression was measured in 114 NSCLC samples and corresponding adjacent normal tissues by qRT-PCR. [score:1]
We examined the effects of miR-346 on NSCLC cells in vitro and in vivo. [score:1]
These results demonstrated that miR-346 indeed promoted apoptosis in A549 and SPC-A-1 cells. [score:1]
Figure 5(A- B)s of A549 and SPC-A-1 cells after transfected with NC, miR-346, si-XPC and ASO-346. [score:1]
The predicted miR-346 binding site was present in XPC 3′-UTRs. [score:1]
Importantly, high miR-346 (Fig. 1C) and low XPC levels (Fig. 3) were correlated with shorter overall NSCLC patient survival, indicating that miR-346 and XPC may serve as NSCLC biomarkers for clinical outcome prediction, optimal therapy selection and risk group assignment. [score:1]
This result demonstrates miR-346 significantly facilitates the tumorigenicity of A549 cells in the nude mouse xenograft mo del. [score:1]
Additionally, in A549 and SPC-A-1 cells transfected with miR-346 mimics or si-XPC, the number of cells in G1 phase of the cell cycle decreased and the number in S phase increased (P <0.05, Fig. 5C–D), and this was again rescued by ASO-346 treatment (P<0.05). [score:1]
Our results indicated that miR-346 facilitated NSCLC cell proliferation and promoted the G1/S transition (Fig. 5). [score:1]
To clarify the relationship between miR-346 and XPC, basic information about hsa-miR-346 was collected from miRBase. [score:1]
Influence of miR-346 expression and clinical characteristics on overall survival in NSCLC patients. [score:1]
We then explored the efficiency of miR-346 on A549 and SPC-A-1 cells apoptosis. [score:1]
Moreover, Semaan and his colleagues reported miR-346 controls release of TNF-α protein and stability of its mRNA in rheumatoid arthritis via tristetraprolin stabilization [25]. [score:1]
We used Transwell migration approache to assess the role of miR-346 on the ability of A549 and SPC-A-1 cells migration. [score:1]
Figure 1(A) miR-346 is significantly increased in primary human lung cancer tissues in comparison to adjacent-normal lung cancer tissues. [score:1]
As expected, invasion of miR-346 mimic or si-XPC treated cells was increased by 0.46-fold or 0.54-fold in A549 and 1.1-fold or 0.96-fold in SPC-A-1 cells, relative to the blank A549 and SPC-A-1 cells (Fig. 6C–D), respectively. [score:1]
[1 to 20 of 92 sentences]
3
[+] score: 251
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-204, hsa-mir-138-2, hsa-mir-138-1
Moreover, miR-346 overexpression in hBMSCs resulted in upregulation of GSK-3β protein level without changing its mRNA expression, confirming that miR-346 regulates GSK-3β expression at a post-transcription level. [score:11]
Our data indicate that miR-346 overexpression significantly down-regulates GSK-3β by directly targeting the 3′UTR of GSK-3β mRNA confirmed using luciferase-reporter-gene assays, and this effect was largely eliminated when the sites in GSK-3β 3′UTR targeted by miR-346 were mutated. [score:10]
Our data show that osteogenic differentiation of hBMSCs is suppressed by overexpression of GSK-3β inmiR-346 -overexpressing cells, while GSK-3β siRNA almost completely blockes the inhibitory role of anti-miR-346 on osteogenic differentiation, suggesting that miR-346-regulated osteogenic differentiation is GSK-3β -dependent. [score:10]
qRT-PCR analyses showed that the expression of osteoblastic marker genes, including RUNX2, ALP, and OPN, was suppressed by overexpression of GSK-3β in the miR-346 -overexpressing cells (Figure 4A). [score:9]
0072266.g004 Figure 4(A) GSK-3β overexpression inhibits the expression of osteoblastic marker genes in miR-346 -overexpressing cells. [score:9]
Much to our surprise, qRT-PCR showed that overexpression or inhibition of miR-346 had no effect on GSK-3β mRNA level (Figure 3C), suggesting that miR-346 specifically regulates GSK-3β expression at the posttranscriptional level. [score:8]
Thus, we wondered whether miR-346 could directly down-regulate GSK-3β expression. [score:7]
Overexpression of miR-346 in hBMSCs enhanced osteogenic differentiation, whereas inhibition of miR-346 suppressed their osteogenic potential. [score:7]
We found that overexpression of miR-346 significantly increased osteoblastic differentiation, which was indicated by higher expression of osteoblastic marker genes RUNX2, ALP, and OPN, increased ALP activity and matrix mineralization level in miR-346 -overexpressing hBMSCs compared to negative control (Figure 2B–2D). [score:6]
Subsequently, we found that inhibition of GSK-3β by GSK-3β siRNA significantly enhanced osteoblastic differentiation, indicated by increased ALP activity, and that anti-miR-346 significantly downregulated ALP activity in hBMSCs (Figure 4D). [score:6]
miR-346 downregulates GSK-3β through interaction with its 3′-untranslated region. [score:6]
Consistent with these findings, miR-346 overexpression was found to enhance the expression of several β-catenin downstream genes in hBMSCs. [score:5]
analysis showed that overexpression of miR-346 substantially decreased the expression of GSK-3β, while anti-miR-346 transfection increased GSK-3β protein levels (Figure 3B). [score:5]
Analysis by different computational methods (TargetScan and miRanda) indicated that GSK-3β is a candidate target of miR-346 (Figure 3A). [score:5]
We found that TCF/LEF transcriptional activity was significantly increased in miR-346 -overexpressing cells, whereas this effect could be inhibited by anti-miR-346 (Figure 5C), indicating that Wnt/β-catenin signaling is altered by miR-346. [score:5]
Given that GSK-3β mediates β-catenin degradation via phosphorylation of its serine (Ser33/37/45) and threonine (Thr41) residues, we examined the expression of total β-catenin and activated β-catenin (ABC) in hBMSCs with miR-346 overexpression. [score:5]
0072266.g005 Figure 5(A) miR-346 overexpression enhanced the expression of both total β-catenin and activated β-catenin (ABC) in hBMSCs. [score:5]
Firstly, miR-346 overexpression significantly increased total and activated β-catenin expression. [score:5]
We also found that miR-346 overexpression significantly increased the expression of Wnt/β-catenin downstream signaling molecules, such as c-Myc, CyclinD1, TCF-1, and LEF-1 (Figure 5F). [score:5]
In conclusion, this study identified miR-346 as a positive regulator of human osteogenesis, acting by targeting GSK-3β and activating Wnt/β-catenin signaling in hBMSCs. [score:4]
The results showed that endogenous miR-346 expression increased gradually during osteogenic induction differentiation of hBMSCs (Figure 1C), suggesting that miR-346 might be involved in regulating their osteogenic differentiation. [score:4]
We performed microarray analysis and identified miR-346 as a noncoding RNA that directly binds to the 3′-untranslated region (UTR) of GSK-3β mRNA. [score:4]
miR-346 downregulates GSK-3β by interacting with its 3′-UTR. [score:4]
In combination with bioinformatics analyses using Targetscan and miRanda, we identified miR-346 as a potential regulator binding to the 3′-UTR of GSK-3β mRNA. [score:4]
In addition, β-catenin knockdown in miR-346 -overexpressing cells almost completely blocked the positive effect of miR-346 on osteogenic differentiation. [score:4]
To further investigate the functional role of the increased β-catenin induced by miR-346 overexpression, we performed loss-of-function analyses by stable knockdown of β-catenin in miR-346 -overexpressing cells (Figure 5D). [score:4]
For GSK-3β 3′-UTR luciferase reporter activity assays, stable miR-346 -overexpressing HEK293T and hBMSCs were cultured in 24-well plates, and transfected with 100 ng luciferase reporter plasmid and 5 ng pRL-TK vector expressing Renilla luciferase (Promega) using Lipofectamine 2000 (Invitrogen). [score:4]
Here, we report that GSK-3β is a direct target of miR-346 in hBMSCs. [score:4]
Our data further demonstrate that miR-346 -mediated downregulation of GSK-3β leads to activation of Wnt/β-catenin signaling in hBMSCs. [score:4]
Taken together, these results suggest that GSK-3β is a direct target of miR-346. [score:4]
These results suggest that gene transfer of miR-346 obviously promotes osteogenic differentiation of hBMSCs, while loss of endogenous miR-346 is capable of inhibiting progression of hBMSCs to differentiated osteoblastic phenotypes. [score:3]
Our findings suggest that miR-346 may be a useful target in the treatment of pathological conditions of bone loss. [score:3]
The constructs containing the pre-miR-346 or GSK-3β siRNA sequence were cloned into the lentivirus -based expression plasmid pLenti-6.3 (Invitrogen). [score:3]
Thirdly, miR-346 overexpression increased TCF/LEF transcriptional activity, and this effect was blocked by anti-miR-346. [score:3]
The results showed that miR-346 -overexpressing cells had higher ALP activity compared to control cells, and that β-catenin knockdown in these cells almost completely blocked the positive role of miR-346 on the ALP activity (Figure 5E). [score:3]
In this study, we demonstrate that GSK-3β is a functional target of miR-346. [score:3]
Increased expression of miR-346 in hBMSCs was verified by qRT-PCR (Figure 2A). [score:3]
For analysis of TCF/LEF transcriptional activity, miR-346 -overexpressing hBMSCs were transfected with 200 ng TOPflash or FOPflash (Millipore, Billerica, MA, USA) and 5 ng pRL-TK (Promega) using Lipofectamine 2000 (Invitrogen). [score:3]
miR-346 represses GSK-3β expression to promote osteogenic differentiation. [score:3]
Subsequently, the expression of miR-346 was examined at different time points during osteoblast differentiation. [score:3]
Site-directed mutagenesis of the miR-346 seed sequence in the GSK-3β 3′-UTR (Mut) was performed using the QuikChange™ Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). [score:3]
Expression of miR-346 during osteogenic differentiation of hBMSCs. [score:3]
Taken together, these results suggest that GSK-3β is a functional target of miR-346. [score:3]
In addition, cotransfection of GSK-3β siRNA with anti-miR-346 almost completely blocked the inhibitory effect of anti-miR-346 on ALP activity (Figure 4D), and increased amounts of GSK-3β siRNA led to higher ALP activity, suggesting that the effect of miR-346 on ALP activity is GSK-3β -dependent. [score:3]
First we examined the effect of GSK-3β overexpression on miR-346 -induced osteogenic differentiation of hBMSCs. [score:3]
We found that miR-346 was highly expressed during the course of osteogenic differentiation. [score:3]
In contrast, expression of osteoblast marker genes, ALP activity and matrix mineralization level were all reduced in hBMSCs in which miR-346 was depleted using antisense oligonucleotides. [score:3]
Expression levels of miR-346 during osteogenic differentiation of hBMSCs. [score:3]
Consistently, immunofluorescence staining showed increased β-catenin nuclear accumulation in miR-346 -overexpressing cells compared to negative controls. [score:2]
In the present study, we identified miR-346 as a positive regulator of the osteogenic differentiation of hBMSCs. [score:2]
To knock down miR-346 in hBMSCs, cells were transfected with anti-miR-346 (at a final concentration of 100 nM) or anti-NC using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. [score:2]
Next we sought to determine whether miR-346 could regulate the Wnt/β-catenin pathway (Figure 5B). [score:2]
Secondly, immunofluorescence staining showed increased β-catenin nuclear accumulation in miR-346–overexpressing cells compared to miR-control cells. [score:2]
The positive regulatory effect of miR-346 on osteogenic differentiation is mediated by repression of GSK-3β. [score:2]
The miR-346, anti-miR-346 and GSK-3β siRNA were purchased from Ambion Qiagen (Valencia, CA, USA). [score:1]
0072266.g002 Figure 2. (A) qRT-PCR analysis of miR-346 in hBMSCs infected by miR-346-lentivirus or transfected with anti-miR346. [score:1]
To examine whether miR-346 is involved in osteogenic conversion, hBMSCs were cultured in osteogenic differentiation medium. [score:1]
miR-346 promotes activation of the Wnt/β-catenin pathway. [score:1]
Our findings suggest that miR-346 promotes osteogenic differentiation by repressing GSK-3β and activating the Wnt/β-catenin pathway. [score:1]
0072266.g003 Figure 3(A) Putative miR-346 binding sequence in the GSK-3β 3′-UTR. [score:1]
To investigate the role of miR-346 in osteogenic differentiation, we constructed a lentivirus vector harboring pre-miR-346 and established stably miR-346 -overexpressing hBMSCs. [score:1]
miR-346 promotes osteogenic differentiation of hBMSCs. [score:1]
To elucidate whether miR-346 -induced osteogenic differentiation is mediated by repression of GSK-3β, we performed gain-of-function and loss-of-function analyses. [score:1]
miR-346 activates the Wnt/β-catenin pathway. [score:1]
Fragments of GSK-3β 3′-UTR containing wild-type (WT) or mutated (Mut) miR-346 binding sites were cloned into pGL3-control vector to obtain GSK-3β 3′-UTR luciferase reporter plasmids. [score:1]
For this purpose, miR-346-overexressing cells were transiently transfected with the Wnt signaling reporter TOPFlash or the negative control FOPFlash. [score:1]
[1 to 20 of 66 sentences]
4
[+] score: 200
Target mRNA Accession number Forward primer (5′-3′) Reverse primer (5′-3′) Reference sXBP1 NM_001079539 CTGAGTCCGCAGCAGGT TGTCCAGAATGCCCAACAGG Galluzzi et al., 2016 RFX1 NM_002918 CTCCCTGAACCCCCTGGA CCAGCCGCCAGTGAGATG TAP1 NM_000593 CCCAGAAGCCAACTATGGAGG AGCCTCGTCTACCTCTGTGT IL18 NM_001562 TGACTGTAGAGATAATGCACCCC AGTTACAGCCATACCTCTAGGC BCAP31 NM_001139457 TGCTGTCCTTCCTGCTTAGA CACTAGCACTCTCCGCCTG B2M NM_004048 ACTGAATTCACCCCCACTGA CCTCCATGATGCTGCTTACA Zhang et al., 2005 GUSB NM_000181 GCTACTACTTGAAGATGGTGATCG AGTTAGAGTTGCTCACAAAGGTC Galluzzi et al., 2016 In Silico Analysis of miRNA TargetsThe miRWalk 2.0 (Dweep and Gretz, 2015) and miRTarBase (Chou et al., 2018) databases for experimentally validated microRNA-target interactions were used for miR-346 target identification. [score:7]
FIGURE 5Expression of predicted miR-346 target genes in infected THP-1-derived macrophages transfected with miR-346 inhibitor. [score:7]
It is noteworthy that upregulation of sXBP1 and miR-346, and downregulation of IL18 and RFX1 were observed in infected cells regardless of Leishmania subgenus, pointing to a possible common pathogenic mechanism in the L. (Leishmania) and L. (Viannia) parasites. [score:7]
We found that TAP1 was about three times more expressed in THP-1-derived macrophages, making this transcript less susceptible to downregulation by miR-346 (Supplementary Figure S3). [score:6]
The unfolded protein response (UPR)-activated transcription factor X-box -binding protein 1 (XBP1) induces microRNA-346 expression that targets the human antigen peptide transporter 1 (TAP1) mRNA and governs immune regulatory genes. [score:6]
To monitor the possible effects of miR-346 upregulation, we selected four genes (TAP1, BCAP31, RFX1, IL18) associated with MHC and interferon gamma production from the 76 identified genes, and their expression was monitored by qPCR in cells infected with Leishmania parasites. [score:6]
Moreover, an increase in TAP1 and BCAP31 mRNA was also partly observed in infected cells treated with miR-346 inhibitor, suggesting a role of miR-346 in counteracting the upregulation of these genes during infection. [score:6]
It is noteworthy that the basal expression of RFX1 in THP-1-derived macrophages was lower than that of other genes (Supplementary Figure S2), making this gene more prone to be regulated by the low expressed miR-346. [score:6]
Before infection, cells were transfected with the miR-346 inhibitor (dark gray bars) or with the miRNA inhibitor negative control (light gray bars) (n = 4). [score:5]
The miR-346 target genes were inputted as the “target set,” and human genes with NCBI gene ID downloaded from the Ensembl database were inputted as “background set. [score:5]
As an ER stress positive control, cells were treated with 0.5 μg/ml tunicamycin for 4 h or 1mM dithiothreitol (DTT) for 1 h. To test the impact of hsa-miR-346 on expression of predicted target genes following Leishmania spp. [score:5]
TAP1 has been shown to be regulated by miR-346 in other cellular mo dels, including HeLa cells (Bartoszewski et al., 2011), but it was not found downregulated in our infection mo del. [score:5]
infection, THP-1 derived macrophages were transfected with the miR-346 inhibitor and the miRNA inhibitor negative control (Integrated DNA Technologies) at 50 nM final concentration. [score:5]
In Silico Identification of miR-346 TargetsIn order to identify the transcripts targeted by miR-346 in infected macrophages, we used the validated module of miRWalk 2.0 and miRTarBase. [score:5]
Target mRNA Accession number Forward primer (5′-3′) Reverse primer (5′-3′) Reference sXBP1 NM_001079539 CTGAGTCCGCAGCAGGT TGTCCAGAATGCCCAACAGG Galluzzi et al., 2016 RFX1 NM_002918 CTCCCTGAACCCCCTGGA CCAGCCGCCAGTGAGATG TAP1 NM_000593 CCCAGAAGCCAACTATGGAGG AGCCTCGTCTACCTCTGTGT IL18 NM_001562 TGACTGTAGAGATAATGCACCCC AGTTACAGCCATACCTCTAGGC BCAP31 NM_001139457 TGCTGTCCTTCCTGCTTAGA CACTAGCACTCTCCGCCTG B2M NM_004048 ACTGAATTCACCCCCACTGA CCTCCATGATGCTGCTTACA Zhang et al., 2005 GUSB NM_000181 GCTACTACTTGAAGATGGTGATCG AGTTAGAGTTGCTCACAAAGGTC Galluzzi et al., 2016 The miRWalk 2.0 (Dweep and Gretz, 2015) and miRTarBase (Chou et al., 2018) databases for experimentally validated microRNA-target interactions were used for miR-346 target identification. [score:5]
miR-346 is Upregulated in U937 and THP-1-Derived Macrophages Infected With L. (L. ) infantum and L. (V. ) sp. [score:4]
[∗] p < 0.05; [∗∗] p < 0.01. miR-346 is Upregulated in U937 and THP-1-Derived Macrophages Infected With L. (L. ) infantum and L. (V. ) sp. [score:4]
ER Stress Induces Upregulation of miR-346 in Human Monocytic Cell Line. [score:4]
The transfection with the miR-346 inhibitor resulted in a significant increase in relative amount of RFX1 mRNA, compared to cells transfected with miRNA inhibitor negative control (Figure 5A). [score:4]
However, a significant upregulation of miR-346 was detected after 24 h infection with L. (L. ) infantum (Figure 2A). [score:4]
However, experiments with the miR-346 inhibitor indicated that miR-346 has a role in the regulation of RFX1 mRNA, but not in IL18 mRNA. [score:4]
Importantly, miR-346 (Figure 4B), as well as sXBP1 (not shown), still appeared significantly upregulated after 48 h infection. [score:4]
To further investigate whether miR-346 is involved in post-transcriptional regulation of its predicted target genes in Leishmania infection, we transfected THP-1 derived macrophages with a miR-346 inhibitor. [score:4]
A significant upregulation of miR-346 was detected, along with the induction of sXBP1, in both U937 and THP-1-derived macrophages infected with four L. (L. ) infantum strains and/or one L. (V. ) sp. [score:4]
In summary, miR-346 was found to be upregulated in two human cell line-derived macrophages infected with four different strains/isolates of L. (L. ) infantum, as well as one L. (V. ) sp. [score:4]
We hypothesized that this downregulation could be mediated by miR-346. [score:4]
It has been shown that miR-346 is induced in response to ER stress in different cell types (Calu-3, HeLa, primary glioblastoma, and primary astrocytoma cells) and that its expression is induced by sXBP1 (Bartoszewski et al., 2011). [score:3]
The expression of miR-346 and sXBP1 significantly increased in treated cells in response to all tested ER stressor molecules (Figure 1). [score:3]
To assess the potential effects of infection -induced miR-346, four genes (TAP1, IL18, BCAP31, RFX1) were selected among the predicted targets of miR-346 based on information in the literature and on their function in relation to the immune response. [score:3]
If the role of miR-346 in the modulation of the immune response is confirmed, this molecule could be an attractive anti- Leishmania drug target. [score:3]
RFX1 mRNA Is a Target of miR-346 in Infected THP-1-Derived Macrophages. [score:3]
These results were consistent with data reported in the literature using other cell types and established a rational basis for the assessment of miR-346 expression in our infection mo del. [score:3]
strainsFirst, the expression of miR-346, as well as miR-146a and miR-126, was monitored in U937-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1 as described in methods. [score:3]
Indeed, several miR-346 targets are associated with immune functions (e. g., MHC- or interferon -associated genes) (Supplementary Table S2). [score:3]
THP-1 Transfection With miR-346 Inhibitor. [score:3]
The fact that BCAP31 and TAP1 expression were not affected might be explained by the low amount of miR-346 in cell line-derived macrophages. [score:3]
In particular, the expression of miR-346, involved in the modulation of the immune response, was shown to be mediated by sXBP1 (Bartoszewski et al., 2011). [score:3]
The expression of miR-346 was then further investigated in THP-1-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1, as well as human clinical isolate 31U and canine clinical isolates 1 and 2. All strains induced miR-346 and sXBP1 expression (Figures 3A,B). [score:3]
In order to identify the transcripts targeted by miR-346 in infected macrophages, we used the validated module of miRWalk 2.0 and miRTarBase. [score:3]
First, the expression of miR-346, as well as miR-146a and miR-126, was monitored in U937-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1 as described in methods. [score:3]
THP-1 cells were treated with tunicamycin and DTT as ER stressors and sXBP1 and miR-346 expression were monitored as described in methods. [score:3]
In Silico Identification of miR-346 Targets. [score:3]
A significant dysregulation of miR-346 has never been reported in Leishmania infection. [score:2]
MiR-346 plays a role in the modulation of the immune response by targeting MHC -associated genes or interferon-inducible genes (Bartoszewski et al., 2011). [score:2]
It is also noteworthy that miR-346 was poorly expressed (C [t] > 32) in monocytic cell lines compared to miR-146a and miR-126. [score:2]
Alternatively, it could reflect a more complex regulation of miR-346 transcription, in which some other factors may be involved. [score:2]
Therefore, IL18 and RFX1 were more likely to be regulated by the poorly represented miR-346 in our infection mo del. [score:2]
Since miR-346 has been shown to have a role in both the modulation of the immune response and in cell survival under ER stress, antisense strategy against this target could be considered for anti- Leishmania approaches. [score:2]
Moreover, miR-346 has been shown to act as a pro-survival factor under ER stress in HeLa cells, by promoting autophagy. [score:1]
The cDNA synthesis for three microRNAs (miR-126, miR-146a, and miR-346) was performed by TaqMan [TM] MicroRNA Reverse Transcription Kit (Applied Biosystems) using 12.5 ng of total RNA. [score:1]
TAP1 is one of the best characterized miR-346 target and it is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where MHC class I molecules assemble. [score:1]
miR-346 functions as a pro-survival factor under ER stress by activating mitophagy. [score:1]
Indeed, its silencing could lead to a more efficient immune response and/or to early death of infected macrophages, since miR-346 was also shown to protect cells from death under ER stress. [score:1]
In other words, the magnitude of the induction of sXBP1 did not appear to be proportionally related to the induction of miR-346. [score:1]
To explore the potential role of miR-346 in Leishmania infection, we first determined whether miR-346 could be induced following ER stress in a monocytic cell line. [score:1]
Interestingly, it has been shown that miR-346 is induced by sXBP1 during ER stress in various cell types (Bartoszewski et al., 2011). [score:1]
In light of these findings, and considering that Leishmania infection elicited sXBP1, we investigated miR-346 expression in human cell line-derived macrophages infected with Leishmania parasites. [score:1]
In particular, miR-346 was shown to promote mitophagy, thus reducing the ROS level in the cell (Guo et al., 2018). [score:1]
[1 to 20 of 58 sentences]
5
[+] score: 73
Notably, miR-346 and miR-582-3p expression levels in the maternal plasma of patients with adverse obstetric events were all upregulated compared with healthy controls, whereas their expression levels were all downregulated in the placenta and/or fetal cord blood of patients with adverse obstetric outcomes. [score:10]
Our results showed that miR-346 and miR-582-3p inhibit trophoblast cell invasion and migration through targeting the 3’UTR of EG-VEGF to downregulate gene expression [15]. [score:10]
In this study, we analyzed the miRNA expression from fetal cord blood from its vein route, and the miR-346 levels in cord plasma were all significantly downregulated in the patient groups with preeclampsia, preterm labor, and SGA, suggesting its possible roles in these complicated pregnancies; however, the functional impact of fetal cord miRNAs in each gestational disorder and their underlying mechanism require further exploration. [score:6]
Although miR-346 expression levels in fetal cord blood and placenta are also wi dely variable, their expression levels were both lower in these two specimen types for all groups with obstetric complications (Table 2 and Figure 1B,C). [score:5]
The similar expression trends of miR-346 and miR-582-3p in maternal plasma and in the placenta, and their association with these two disorders (preeclampsia and SGA), suggests that these two miRNAs may be involved in the disease pathophysiologies and further supports that these two pregnancy-related disorders may share similar mechanisms. [score:5]
Whether the roles of miR-346 and miR-582-3p in disease formation during human pregnancy are through regulating EG-VEGF or interacting with a group of associated genes, further experimental and clinical studies are required to validate the effects of miRNAs in EG-VEGF -associated obstetric disorders. [score:4]
Our previous in vitro result showed that miR-346 and miR-582-3p regulated trophoblast cell motility through inhibiting endocrine gland-derived vascular endothelial growth factor (EG-VEGF) [15]. [score:4]
Aberrant miR-346 and miR-582-3p expression profiles in maternal plasma, fetal cord plasma and placenta samples were shown to be associated with preeclampsia, preterm delivery, and SGA. [score:3]
The miR-346 expression levels in maternal plasma in the third trimester were variable, but its levels in all groups with obstetric complications (preeclampsia, preterm delivery and SGA) were higher than those of healthy controls (Table 2 and Figure 1A). [score:3]
Before miR-346 and miR-582-3p being a non-invasive biomarker for adverse obstetric outcomes and a potential therapeutic target for preventing or treating compromised pregnancy, future studies with larger sample size in different population were needed to replicate our findings. [score:3]
The miR-582-3p expression levels of maternal and fetal cord plasma were lower and much more variable than those of miR-346, and the differences in concentration ranged from 10- to 1000-fold in each group. [score:3]
The Expression of miR-346 in Maternal Peripheral Blood, Fetal Cord Blood and Placenta. [score:3]
For miR-346 expression in placenta, we found a 1.9-fold decrease in miR-346 in the preeclampsia group (median: preeclampsia, 0.54, vs. [score:3]
The miR-346 expression levels in placental tissue were less variable than those of maternal and fetal cord plasma. [score:3]
After adjusting for maternal age and gestational age at delivery, the miR-346 expression in three specimens still significantly associated with multiple adverse pregnancy outcomes (Table 3). [score:3]
Apart from our previous publication, the roles of miR-346 and miR-582-3p in human pregnancy have never been explored [15]. [score:1]
Considering that some miRNA levels may change as pregnancy progresses, we adjusted this factor and the results gave the same conclusion, which suggests that miR-346 and miR-582-3p are not affected by gestational age in the late third trimester. [score:1]
However, the clinical roles of miR-346 and miR-582-3p in human pregnancy have never been explored. [score:1]
In this study, miR-346 and miR-582-3p in maternal plasma or/and in the placenta were associated with preeclampsia and SGA. [score:1]
Moreover, miR-346 and miR-582-3p were shown to be associated with every adverse obstetric outcome explored in this study (preeclampsia, preterm delivery and SGA). [score:1]
[1 to 20 of 20 sentences]
6
[+] score: 61
As previous observations have revealed that TNFα -induced miR-346 plays a down-regulated role in VDR in colon [24], this time we further demonstrate miR-346 is able to reduce VDR expression in HaCat cells and the inhibitory function of TNFα is reversed by miR-346 inhibitor, suggesting VDR decrease in keratinocytes is caused by LPS-TNFα-miR-346 signaling pathway. [score:10]
In conclusion, we provide convictive evidence that LPS down-regulates VDR expression in oral mucosal epithelia dependent on TNFα-miR346 signaling, and we further suggest that vitamin D/VDR can suppress LPS -induced keratinocytes apoptosis by regulating NF-κB pathway. [score:9]
At the same time, miR-346 attenuated the expression of VDR by targets it compared with that of LPS which served as a positive control (Fig.   2C and D), and miR-346 inhibitor counteracted the decrease of VDR in the presence of TNFα (Fig.   2E and F). [score:6]
Figure 2TNFα -dependent LPS suppresses VDR expression via miR-346 regulation. [score:6]
Furthermore, TNFα -induced miR-346 is recognized to target VDR directly [24]. [score:4]
As expected, levels of miR-346 were substantially up-regulated by TNFα in keratinocytes (Fig.   2B). [score:4]
Our findings show that epithelial VDR decrease is driven by LPS -induced miR-346, exaggerating epithelial cell apoptosis through inducing pro-apoptotic factor p53 -upregulated modulator of apoptosis (PUMA) further. [score:4]
As expected, levels of miR-346 in diseased regions were up-regulated by 350%, evaluated by qPCR (Fig.   3D). [score:4]
We then asked whether miR-346 modulates VDR expressions in oral epithelial cells. [score:3]
In separate experiments, cells were stimulated with TNF (100 ng/ml) for 24 hours after a 24-hour transfected treatment of miR-346-specific hairpin inhibitor. [score:3]
Thus, VDR expression is reversely connected with TNFα activity and miR-346 in human patients, consistent with the results in vitro mentioned above. [score:3]
As shown, miR-346 and LPS markedly impeded 1,25(OH) [2]D [3] -induced luciferase activity in keratinocytes (Fig.   2G), reflecting miR-346 did block the transactivating activity of VDR. [score:1]
To investigate whether miR-346 embraces the ability of suppressing the VDR’s transactivating activity, we transfected p3xVDR element (VDRE)-Luc reporter plasmid into HaCat cells with control miRNA oligo mimic, LPS and hsa-miR-346 oligo mimic in the presence or absence of 1,25(OH) [2]D [3]. [score:1]
VDR decrease in OLP patient biopsies is correlated with increase of TNFα and miR-346. [score:1]
Indeed, the decrease of VDR is due to TNFα -induced miR346 mediation, but the source of this kind of cytokine attracts numerous attentions. [score:1]
LPS -induced decrease of VDR is mediated by TNF -dependent miR-346. [score:1]
[1 to 20 of 16 sentences]
7
[+] score: 20
We identified six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, overexpressed in ALDH1 (+) cells, and they were significantly upregulated in chemoresistant ovarian cancer cells (1.4 ~ 3.5-fold) and tumor samples (2.8 ~ 5.5-fold) compared with chemosensitive group. [score:5]
As a result, miR-424 (1.62-fold), miR-346 (3.25-fold), miR-503 (1.66-fold), miR-27a (2.08-fold), miR-23b (1.98-fold), and miR-27b (3.09-fold) were upregulated in ALDH1 (+) cells relative to ALDH1 (−) cells (Figure  4B). [score:4]
We found that six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, were significantly overexpressed in CSC-enriched ALDH1(+) cells using and qRT-PCR. [score:3]
Six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503 were overexpressed in ALDH1(+) cells, and significantly implicated in chemoresistance in ovarian cancers. [score:3]
Among the miRNAs examined, the expression levels of miR-23b (2.8-fold, p = 0.039), miR-27b (3.5-fold, p = 0.007), miR-346 (2.7-fold, p = 0.02), and miR-503 (2.2-fold, p = 0.049) were significantly higher than those in S KOV3 cells (Figure  5A). [score:3]
As a result, six miRNAs were differentially overexpressed more than 1.5-fold in ALDH1 (+) cells compared with that in ALDH1 (−) cells (Table  4, Figure  4A) (miR-424 [1.98-fold], miR-346 [1.95-fold], miR-503 [1.86-fold], miR-27a [1.66-fold], miR-23b [1.53-fold], and miR-27b [1.50-fold]). [score:2]
[1 to 20 of 6 sentences]
8
[+] score: 11
Another study by Su et al. [12] searched, in a cohort of placentas, the miRNAs that regulate endocrine gland derived vascular endothelial growth factor (EG-VEGF) expression: they concluded that miR-346 and miR-582-3p regulate EG-VEGF -induced trophoblast invasion through repressing metalloproteinases 2 and 9. In addition, FGR placental tissues show an aberrant high expression level of miR-141, suggesting that this miRNA might play important roles in the pathogenesis of the disease by suppressing E2F transcription factor 3 and pleomorphic adenoma gene 1 [13]. [score:11]
[1 to 20 of 1 sentences]
9
[+] score: 10
There was little overlap between the targets identified with the two different databases and only 7 targets (FAM44B, BACH1, BCL6, HMGA2, CALU, FGF2, and TNKS2) for 7 miRNAs (let-7 family, miR-98, miR-155, miR-195, miR-346, miR-206, miR-335) were shared between these two databases when the top 3 targets were examined. [score:7]
Other miRNAs found differentially expressed in both tissues and cell lines are miR-146b, miR-508, miR-106b, miR-134, miR-155, miR-346, miR-422a, miR-424, miR-519a, miR-648, miR-662. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
MicroRNA mir-346 targets the 5′-untranslated region of receptor-interacting protein 140 (RIP140) mRNA and up-regulates its protein expression. [score:10]
[1 to 20 of 1 sentences]
11
[+] score: 9
Leukemia inhibitor factor (LIF) mRNA was found to be a direct target of two, miR-199 and miR-346. [score:6]
A luciferase reporter construct containing the 3’UTR of LIF showed miR-199 and miR-346 could both bind putative target sites in LIF [75]. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 8
Out of 12 miRNA families that were predicted to target the PRKAG1 sense promoter in both human and mouse, nine (miR-718, miR-1224, miR-188, miR-346, miR-296, miR-671, miR-221, miR-1306, miR-506) can form highly stable duplex structures with their target sites (MFE ≤ −30 kcal/mol) in both organisms. [score:5]
In addition, six families (miR-34, miR-718, miR-346, miR-671, miR-340, miR-1306) target upstream sequences that contain previously reported AGO binding sites in both organisms. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 7
For instance, miR-346, which is upregulated during the osteoblast differentiation of hBMSCs, promotes osteogenic differentiation by targeting GSK-3β and regulating the Wnt/β-catenin differentiation signaling pathway 21. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 6
Among these nine miRNAs, miR-615, miR-193b and miR-346 were upregulated after inhibition of uc. [score:6]
[1 to 20 of 1 sentences]
15
[+] score: 6
In this study, five miRNAs (miR-29a, miR-29b, miR-126*, miR-127-3p, miR324-3p) were found upregulated and four (miR-188-5p, miR-25, miR-320a, miR-346) downregulated in both quiescent and active UC compared to healthy controls (Fasseu et al., 2010). [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 5
Thirty-three microRNAs in the array were found to be highly expressed (including let7a, miR-16, miR-21, and miR-205) and 22 showed low levels of expression (including miR-342, miR-346, and miR-373*) in all cell lines. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
Our group previously showed that blocking miR-346 decreases TTP expression and re-established mature TNF-α intracellular expression in LPS-activated RAFLS [40], [41]. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 4
For example, miRNA346 has 72 predicted targets [miRBase, 2011]. [score:3]
in this report has a large 7.8 Mb duplication at 10q22.3-q23.2 which is between LCR 3 and 4. It is interesting to note that the hsa-miRNA346 gene (human microRNA) lies within this duplicated region (base position: 88,022,451-88,026,545). [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 4
2 −2.03(52) hsa-miR-134 14q32.2 −2.03(12, 29) hsa-miR-346 10q23.2 −2.01(12, 13) hsa-miR-324-5p 17p13.1 −2.00(12, 50) UPREGULATED hsa-miR-199b-3p 9q33.3 4.56(12) hsa-miR-199a-3p 19p13.2/1q24.1 4.49 hsa-miR-199a-5p 19p13.2/1q24.1 4.14(28) hsa-miR-21 17q22 3.70(12– 14, 29, 31) hsa-miR-214 1q24.2 3.59 hsa-miR-19a 13q31.3 3.11(12– 14) hsa-miR-92a-1* 13q31.3/Xq26.2 3.06 hsa-miR-214* 1q24.2 2.93 hsa-miR-34a 1p36.23 2.78(13, 30, 53) hsa-miR-18b Xq26.2 2.74 hsa-miR-422a 15q22.2 2.72(14) hsa-miR-34a* 1p36. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 4
Other miRNAs upregulated in RASF and implicated with the production of MMP-1 and IL-6 are miR-346, miR-203, miR-22, and miR-18a [14]. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 4
Three miRNAs (including hsa-miR-346, hsa-miR-652-5p and hsa-miR-548d-3p) were found to regulate GAS5-001 expression specially (Fig 5B). [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 4
The xeroderma pigmentosum complementation group C (XPC) gene is involved in nucleoside excision repair and is a target for miR-346 [172]. [score:3]
miR-346 is an oncomir for NSCLC. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 4
Other miRNAs from this paper: hsa-mir-141, hsa-mir-200a, hsa-mir-548d-1, hsa-mir-548d-2
Moreover, miR-346 positively regulates hBMSCs osteogenic differentiation by targeting GSK-3β and activating the Wnt/β-catenin pathway [27]. [score:4]
[1 to 20 of 1 sentences]
24
[+] score: 3
83 *** hsa-mir-346 7.13 *** 69.13 *** hsa-mir-361-3p 4.51 *** 9.6 *** hsa-mir-483-3p 3.56 *** 68.61 *** hsa-mir-486-5p 2.85 *** 34.48 *** hsa-mir-574-3p 2.61 *** 43.22 *** hsa-mir-629* 16.62 *** 67.23 *** hsa-mir-885-5p 4.75 *** 43.73 *** Inhibited differentiation & high cell count hsa-mir-193b 38.04 *** 102.74 * Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-369-3p 61.75 *** 103.6 * hsa-mir-381 61.75 *** 105.31 * hsa-mir-886-5p 38.04 *** 112.86 *** hsa-mir-940 21.37 *** 112.35 *** Enhanced differentiation hsa-mir-98 104.51 * 87.82 *** High cell count hsa-mir-631 92.63 ** 103.43 *** 1see Material and Methods; 2 *: p<0.05; **: p<0.01; *** p<0.005; − = not significant. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
The first study addressing this aspect on the basis of a limited set of human microRNAs (235 distinct human microRNAs) revealed four microRNAs (miR-346, -328, -192, -197) moderately upregulated by 1.34-1.82 fold in FTCs when compared to FTAs [21]. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Lerman et al. observed the expression of the following miRNAs in psoriatic lesion skin: hsa-miR-149, hsa-miR-150, hsa-miR-210, hsa-miR-220, hsa-miR-326, has-miR-324-5p, hsa-miR-342, hsa-miR-326, hsa-miR-328, hsa-miR-345, hsa-miR-346, and hsamiR-197 [20]. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
miRNA Fold change at 3 dpi Fold change at 5 dpi mmu-miR-466h-3p NS (Not significant) 14.311053 mmu-miR-346-5p NS 3.4766614 mmu-miR-877-3p NS 3.416667 mmu-miR-7a-5p NS 2.1413074 mmu-miR-5107-5p NS −2.047792 mmu-miR-3473a −2.2872427 −2.1317267 mmu-miR-150-5p NS −2.1770155 mmu-miR-3473b −3.2475147 −2.282881 mmu-miR-721 NS −2.6864858 mmu-miR-669b-5p NS −2.9408455 mmu-miR-709 NS −3.0065749 mmu-miR-669n NS −3.0094464 mmu-miR-468-3p NS −3.40051 mmu-miR-466m-5p NS −4.33538 mmu-miR-32-3p NS −4.5324426 mmu-miR-466h-5p NS −4.9673104 mmu-miR-3082-5p NS −6.01648 mmu-miR-466i-5p NS −7.6776285 mmu-miR-1187 NS −8.772696 mmu-miR-574-5p NS −9.259378 To confirm the validity of the differentially expressed miRNAs that had been identified by microarray analysis, we performed real-time PCR on all 20 of these miRNAs using the polyA tailing technique. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Mir-136 and mir-718 were not detectable in the adipocyte cultures using the Taqman assays-on-demand, while mir-346, mir-298, mir-330 and mir-501 were expressed at low levels (Ct levels above 33), see Table 1. This suggests that currently there is no gold standard method (when RNA is limiting) to validate miRNA data profiles. [score:2]
5 miR-298 33.2 ±0.2 33.8 ±0.2 33.5 ±0.6 33.5 ±0.4 miR-346 35.7 ±1.1 36.4 ±0.8 35.7 ±0.6 34.7 ±0.4 miR-501 34.5 ±0.9 34.4 ±0.9 34.6 ±0.1 34.4 ±0.4 miR-718 ND ND ND ND miR-720 22.5 ±0.3 22.9 ±0.1 23.4 ±0.4 22.9 ±0. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Some of the deregulated miRNAs identified in our study are also reported as de-regulated in other cancer entities, e. g. hsa-miR-346 in gastritic cancer, hsa-miR-145 in bladder cancer, and hsa-miR-19a in hepatocellular carcinoma and B-cell leukemia [38- 42]. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
These genes and their putative functions are shown in Table 3. The gene encoding the cell adhesion molecule SD47 is the target of miR-34a, miR-155, and miR-346. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
Examples of such miRNAs include those that show enriched expression in brain tissue such as miR-451 and miR-488 (see [32]) and miRNAs that have been implicated in the etiology of other tumor types, such as miR-346 in follicular thyroid carcinoma [36]. [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 3
Other miRNAs from this paper: hsa-mir-188, hsa-mir-362, hsa-mir-300
The expression profile of three miRNAs, miR-300, miR-188, and miR-362, was validated by RT-qPCR, but miR-346 was not confirmed (Figure 1d). [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
Also, several “nexus” genes in complex networks, including components of the multi-subunit enzyme complex involved in the terminal stages of cholesterol synthesis, microRNAs (miR-203, miR-511, miR-590-3p, miR-346*/miR- 1207-5p/miR-4763-3p), GPCR proteins (GPR1, GPR64, GPRC5A, GPR171, GPR176, GPR32, GPR25, GPR124) and signal transduction pathways, were found to be regulated. [score:2]
We found that certain miRNAs (miR-203, miR-511, miR-590-3p, miR-346*/miR-1207-5p/miR-4763-3p) serve as organizational hubs of several signal transduction pathways in one of our IPA networks (Figure 5D). [score:1]
[1 to 20 of 2 sentences]
35
[+] score: 2
Other miRNAs from this paper: hsa-mir-27b, hsa-mir-379, gga-mir-27b, hsa-mir-590
Alsaleh G. Suffert G. Semaan N. Juncker T. Frenzel L. Gottenberg J. E. Sibilia J. Pfeffer S. Wachsmann D. Bruton’s tyrosine kinase is involved in miR-346-related regulation of IL-18 release by lipopolysaccharide-activated rheumatoid fibroblast-like synoviocytesJ. [score:2]
[1 to 20 of 1 sentences]
36
[+] score: 2
Other miRNAs from this paper: mmu-mir-346
Moreover, ER-stress induced miR-346 negatively regulates mRNA for the antigen peptide transporter 1 (TAP1), which might explain the reduced MHC class I presentation during ER-stress [51]. [score:2]
[1 to 20 of 1 sentences]
37
[+] score: 1
Four additional biological repeats (total of 6 repeats) were subjected to miRNA real-time (RT)-PCR using specific TaqMan [®] Small RNA probe sets for mmu-miR-16*, mmu-miR-709, mmu-miR-1195, endogenous siRNA-1196 (endo-siRNA, custom made, sequence: AAAUCUACCUGCCUCUGCCU), mmu-miR-346, and mmu-miR-669c (Applied Biosystems). [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
miR-346 controls release of TNF-alpha protein and stability of its mRNA in rheumatoid arthritis via tristetraprolin stabilization. [score:1]
[1 to 20 of 1 sentences]