sort by

108 publications mentioning rno-let-7b (showing top 100)

Open access articles that are associated with the species Rattus norvegicus and mention the gene name let-7b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 237
Let-7 can also inhibit LIN28B translation by binding to the 3′-untranslated region target sites, creating a double -negative feedback loop. [score:8]
Thus, five of the eight studied mature let-7 family members were significantly downregulated in the PFC, and the two of the remaining three showed a tendency to downregulation (let-7a: P=0.058; let-7e: P=0.080). [score:7]
[44] The let-7 family was previously shown to directly inhibit IL-6 expression in breast cancer cell lines, to be abundant in the adult brain and to be implicated in the regulation of neural stem cell proliferation, differentiation and synaptic plasticity. [score:7]
We showed that the exercise -induced upregulation of let-7 miRNAs in FSL was independent of Lin28b and Drosha changes, implying that other mechanisms are involved in regulating let-7 expression in response to physical activity. [score:7]
Third, we compared the total expression levels of pri-let-7b, pri-let-7c-1, pri-let-7f-1, pri-let-7i and pri-mir-98 between the FSL and FRL PFC; none of those pri-let-7 transcripts showed different expression between the rat strains (P>0.5, Figure 1d), indicating that reduction in mature let-7 expression in the FSL did not originate from decreased levels of pri-let-7 transcripts. [score:6]
Second, we examined whether the increased Il6 levels in the FSL associated with downregulation of let-7 expression. [score:6]
36, 37 Since the let-7 family is known to target Il6, the results suggest that the let-7 family dysregulation contributes to the overexpression of Il6 in the PFC of FSL. [score:6]
Increased Il6 levels are associated with downregulation of let-7 family expression in the prefrontal cortex of the FSL rats. [score:6]
21, 22, 23 A previous study showed that the let-7 family directly inhibited IL-6 expression in breast cancer cell lines, and thereby may act as an immunorepressor. [score:6]
24, 32, 33 Importantly, a recent study showed that LIN28B and LIN28A inhibited let-7 expression by different mechanisms, that is, LIN28B directly binds the primary let-7 (pri-let-7) transcripts and prevents DROSHA -mediated cleavage. [score:6]
Fourth, we assessed whether the expression levels of key enzymes (Drosha and Dicer) involved in miRNA biogenesis could potentially influence let-7 expression. [score:5]
43, 44 We hypothesized that Il6 expression was elevated in the prefrontal cortex (PFC) of the FSL strain compared with FRL, and that this elevation would associate with a downregulation of the let-7 family, in turn influenced by alterations in miRNA biogenesis. [score:5]
No differences were found for the mRNA levels of Lin28b and Drosha (P>0.8), suggesting that the physical activity increased expression of certain let-7 miRNAs expression independently of LIN28B and DROSHA. [score:5]
We also tested whether Hnrnpa1, a negative regulator of let-7 that is independent of LIN28 regulation, was associated with the decreased let-7 expression in the FSL. [score:5]
It is possible that let-7 dysregulation can lead to disturbances also in other pathophysiological processes because miRNAs often have multiple target genes. [score:4]
LIN28B elevation co-occurred with downregulation of the let-7 family in the FSL PFC. [score:4]
[58] Further, in blood samples from depressed patients, a number of let-7 family members were upregulated after a 3-month treatment with escitalopram. [score:4]
Let-7 expression showed the opposite expression changes over time, possibly dependent on the LIN28 dynamics. [score:4]
Second, we examined whether the Il6 reduction in the FSL runners associated with upregulation of let-7 miRNAs that showed a difference between naïve FSL and FRL (let-7b, let-7c, let-7f, let-7i and miR-98). [score:4]
Elevation of Il6 is associated with downregulation of let-7 miRNAs in the PFC of FSL, a rat mo del of depression. [score:4]
Increased Il6 levels are associated with downregulation of let-7 family expression in the prefrontal cortex of the FSL ratsFirst, we measured Il6 mRNA levels in the PFC from FSL and FRL rats. [score:4]
Elevation of Il6 is associated with downregulation of let-7 miRNAs in the PFC of FSL, a rat mo del of depressionElevation of peripheral proinflammatory cytokine IL-6 has been reported in clinical depression by a number of studies. [score:4]
Thus, the downregulation of let-7 family members in FSL PFC region was associated with increased LIN28B levels, increased LIN28B binding to pri-let-7 transcripts and reduced DROSHA levels. [score:4]
In cancer research, coordinated downregulation of multiple let-7 family members was found in many tumor types. [score:4]
The let-7 upregulation by physical activity appeared not to be associated with miRNA biogenesis processes but rather with epigenetic changes upstream pri-let-7 mRNA. [score:4]
[34] Besides, heteronuclear ribonucleoprotein A1 (hnRNPA1) was shown to negatively regulate let-7 biogenesis in cells lacking LIN28 expression. [score:4]
[54] In agreement, we found that Lin28b mRNA, but not Lin28a, was expressed at detectable levels in adult rat PFC, suggesting that LIN28B is the major paralog in regulating let-7 synthesis in the PFC. [score:4]
Physical activity rescued let-7 expression independent of LIN28B regulation. [score:4]
Second, we hypothesized that physical exercise would lower the elevated Il6 levels in the PFC of the FSL rats, by normalizing let-7 expression. [score:3]
Physical activity reduced Il6 levels and rescued let-7 expression in the FSL PFCFirst, we investigated where physical activity (voluntary wheel running) could normalize Il6 expression in the FSL PFC. [score:3]
[35] Next, we showed that LIN28B overexpression was associated with enrichment of LIN28B-pri-let-7 binding in FSL in vivo, which most likely led to excessive repression of mature let-7 synthesis, explaining the reduced mature let-7 levels. [score:3]
[59] Collectively, these results may suggest a role for let-7 as a therapeutic target in depression. [score:3]
Thus, physical activity reduced the elevated Il6 levels in PFC region of the FSL rats and increased expression of certain let-7 family members present already at primary transcript stage, possibly through epigenetic mechanisms. [score:3]
This Il6 decrease associated with an increased let-7 expression. [score:3]
The individual let-7 family members may compete with each other when exerting their repressive function since each member uses the same seed (5′-GAGGUA-3′ sequence of the let-7) as a template for recognizing complementary sites in the 3′-untranslated region of Il6 (5′-UACCUCA-3′). [score:3]
28, 50 However, other roles of let-7 family in the adult brain have been less investigated although let-7 is upregulated in later developmental stages and is one of the most abundant miRNA families in the adult brain. [score:3]
These results suggested that elevation of Il6 in the FSL PFC is associated with a deficiency of let-7 family expression, possibly linked with a disturbed let-7 biogenesis. [score:3]
[57] These results suggest that the antidepressant-like effect of physical activity may, in part, be due to brain let-7 expression. [score:3]
23, 29, 30, 31 This reduction was associated with an overexpression of LIN28 (including paralogous LIN28A and LIN28B in mammals), an RNA -binding protein that selectively represses let-7 maturation. [score:3]
Noteworthy, the let-7 deficiency in the FSL was not associated with changes in Hnrnpa1, which was a negative regulator of let-7 biogenesis when LIN28 regulation was absent. [score:3]
22, 23, 24, 25, 26 We showed that the Il6 elevation in PFC of FSL was associated with a reduced let-7 miRNAs expression. [score:3]
For example, let-7b and let-7d inhibit neural stem cell proliferation and promote differentiation in embryonic brains and adult neural stem cells. [score:3]
However, Il6 and let-7 are expressed throughout the central nervous system, including both neuron and glia cells. [score:3]
51, 52 We found that let-7 expression in the PFC of depressed FSL rats associated with elevated Il6. [score:3]
cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) followed by RT-PCR for pri-let-7 expression. [score:3]
In addition to LIN28B changes, we observed that FSL PFC had a decreased DROSHA expression, suggesting a disturbed miRNA biogenesis probably not only in let-7 but also in a variety of other miRNAs. [score:3]
In addition, we show that physical activity normalizes Il6 levels and could rescue let-7 expression. [score:3]
[53] Notably, let-7 expression appeared to be more decreased by chronic than acute stress paradigm, [53] which may be in line with our data, as FSL is a genetic mo del that exhibits a persistent depression-like behavior. [score:3]
Pri-let-7 and mRNA expression data were normalized to two reference genes (Gapdh, glyceraldehyde-3-phosphate dehydrogenase; and Ppia, cyclophilin A). [score:3]
First, we tested the hypothesis that overexpression of LIN28A and LIN28B, acting as let-7 repressors, was associated with the let-7 family deficiency in the FSL. [score:3]
Physical activity reduced Il6 levels and rescued let-7 expression in the FSL PFC. [score:3]
We show that the low levels of let-7 may be a result of disturbed LIN28B -mediated miRNA biogenesis and DROSHA dysregulation. [score:2]
[27] Noteworthy, let-7 could also be regulated in an LIN28B-independent fashion, for example, through epigenetic mechanisms such as DNA methylation and histone modifications, 49, 55 which is supported by our data from FSL rats under physical exercise (discussed in the next section). [score:2]
Let-7 deficiency is associated with LIN28B overexpression in the PFC of FSL rats. [score:2]
Our results warrant further studies on let-7 regulation in depression. [score:2]
Second, to gain further support that LIN28B directly associated with pri-let-7 to block mature let-7 synthesis in vivo, we performed RIP analysis. [score:2]
The results also suggest that this decrease of let-7 miRNA levels is in part due to a disturbed LIN28B -mediated miRNA biogenesis, and possibly in part due to a dysregulated DROSHA. [score:2]
The let-7 family has an important role in early neurodevelopment. [score:2]
Physical activity was found to normalize the Il6 and let-7 levels through epigenetic regulations upstream primary miRNA transcription. [score:2]
[20] In human, the let-7 family consists of 12 genes encoding nine distinct miRNAs (let-7a to let-7i and miR-98). [score:1]
[16] Lethal-7 (let-7) is one of the most studied miRNA families and is highly conserved between species. [score:1]
Specifically, let-7b, let-7c, let-7f, let-7i and miR-98 were significantly reduced in FSL (P=0.011, P=0.024, P=0.021, P=0.004 and P=0.006, respectively, Figure 1b). [score:1]
Consistently, a recent study reported that physical exercise was able to induce let-7 in the mouse hippocampus. [score:1]
[42] (6) We did not have the possibility to analyze Il6 and let-7 in specific cell types in this experiment. [score:1]
LIN28 is an RNA -binding protein that selectively represses let-7 maturation. [score:1]
In agreement, let-7 miRNAs were also found to respond actively to antidepressant drug treatment. [score:1]
There is increasing evidence suggesting the involvement of the let-7 family in inflammation and immune response. [score:1]
In the present study, we demonstrate increased Il6 levels and in parallel decreased levels of let-7 miRNA family in the PFC of a well-established mo del of depression, the FSL rat. [score:1]
Thus we observed that Il6 correlated negatively with each of the let-7 family miRNAs, however, none with statistical significance. [score:1]
28, 68, 69 We provide results demonstrating for, we believe, the first time that elevated proinflammatory Il6 in the depressed brain is associated with let-7 deficiency. [score:1]
[1 to 20 of 70 sentences]
2
[+] score: 208
All in all, the above expression data from two rodent species strongly suggest a dynamic reciprocal regulation of Lin28a and let-7 (and related miRNAs) along the spermatogenic cycle, whereby high expression of Lin28a or Lin28b is associated with (and possibility caused by) low or absent expression of regulatory miRNAs in specific cell types of the seminiferous epithelium; this profile of reciprocal changes is depicted in Fig. 2-II. [score:9]
However, while this phenomenon might explain loss of expression of some transcripts (e. g., Lin28b), the arrest of spermatogenesis at early stages can hardly justify the observed increases in miRNAs, such as let-7b and mir-145, which are abundantly expressed in spermatocytes and early spermatids, therefore suggesting additional regulatory phenomena reciprocally linking Lin28 and let-7 expression in the testis. [score:8]
This is a complex event, regulated by a large number of factors, including miRNAs 30, which function mainly post-transcriptionally by controlling the stability or translation of their target mRNAs 7. Among the miRNAs described in rodent testis, the let-7 family displays prominent expression 53 55. [score:8]
Thus, let-7b was strongly expressed in pachytene spermatocytes, which are negative for Lin28a or Lin28b, and progressively declined at later stages of spermatogenesis, with weaker signal in round spermatids from stage I to stage VII and absence of expression in elongating spermatids, which display high expression levels of Lin28b protein in the mouse. [score:7]
Germ cells expressing both let-7b and mir-145 corresponded to pachytene spermatocytes (P in B, C), while a fainter expression was found in round spermatids (RS) from stage I to stage VII, and expression was absent in elongating spermatids (ES) from stage VIII onwards. [score:7]
Different mo dels of perturbed puberty and hormonal manipulation, targeting key endocrine axes with proven roles in the control of testicular function, were explored as a means to provide indirect evidence for the relevance of the Lin28 /let-7 system in the regulation of the rat testis and its modulation by key developmental and hormonal signals. [score:6]
The same applies to the dynamic changes reported in the seminiferous tubules, with absent expression of let-7b and mir-145 in cell types of the seminiferous epithelium with high expression of Lin28a (spermatogonia) or Lin28b (round/elongating spermatids) in the mouse. [score:5]
Interestingly, recent studies from our group assessing the dynamics in the hypothalamic expression of the Lin28/let-7 system documented that, as is the case for the testis, at central levels reciprocal changes between Lin28 and let-7 expression levels are detectable along postnatal maturation and in neonatally estrogenized rats. [score:5]
Pattern of cellular expression of let-7b and mir-145 expression in adult rat testis. [score:5]
Regulation of testicular expression of the Lin28/let-7 system by other pituitary hormonal axes was also explored using various approaches. [score:4]
How to cite this article: Sangiao-Alvarellos, S. et al. Testicular expression of the Lin28/let-7 system: Hormonal regulation and changes during postnatal maturation and after manipulations of puberty. [score:4]
However, whereas Lin28b mRNA was only marginally increased by FSH, the relative expression levels of let-7a, let-7b and mir-132 were more robustly increased by FSH and hCG, or their combination, which suggests a strong gonadotropic regulation that may take place at the tubular and/or interstitial compartment of the testis. [score:4]
Regulation of the expression of the Lin28/let-7 hub was explored in vivo in a number of mo dels of neuroendocrine manipulation, known to impact on testicular function. [score:4]
These findings suggest that the bidirectional regulatory loops between Lin28 and let-7 miRNAs might operate at different levels of the reproductive axis, but the nature and functional implications of this regulatory loop likely vary at different tissues. [score:4]
Thus, in Experiment 5, regulation of testicular Lin28/let-7 expression by pituitary gonadotropins was explored. [score:4]
Expression analyses of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs were conducted in testicular samples from rats at different stages of postnatal development. [score:4]
Hormonal regulation of testicular expression of the Lin28/let-7 system and related miRNAs. [score:4]
Testicular expression of the elements of the Lin28/let-7 system was also affected in mo dels of photoperiodic and nutritional manipulation, as well as after HPX, suggesting the convergence of multiple regulatory signals. [score:4]
In the lower panel, schematic representation, comparing the expression of Lin28a (green box) and Lin28b (red box) protein in mouse germ cells 53, and of let-7b and mir-145 in rat germ cells (current study) is shown. [score:3]
Our analyses revealed that let-7b miRNA expression in adult rat testis is restricted to germ cells in the seminiferous tubules, in a stage -dependent manner, and is absent in the interstitial areas (Fig. 2, upper panel, A). [score:3]
In turn, no expression of let-7b was detected by ISH in elongating spermatids (Fig. 2-I, upper panel, B,C). [score:3]
As mentioned above, compelling biochemical data suggest the existence of a double negative feedback loop whereby Lin28a/Lin28b redundantly represses the synthesis of mature let-7 miRNAs, which in turn suppress Lin28 levels. [score:3]
The impact of postnatal under-nourishing on testicular expression of the Lin28 /let-7 system was explored using rats reared in large litters (20 pups/litter), as mo del of delayed puberty 45. [score:3]
Changes in the profiles of testicular expression of Lin28/let-7 in mo dels of perturbed puberty. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in rat testis during postnatal maturation. [score:3]
Thus, both congenital elimination of Lin28a 36 and embryonic over -expression of let-7 24 have been shown to induce a reduction of the germ cell pool, with Lin28a KO mice displaying reduced fertility in adulthood 36. [score:3]
Changes in testis expression of the Lin28/let-7 system in mo dels of perturbed puberty. [score:3]
While additional mechanistic studies are needed to fully support these hypotheses, our present results, which characterize the profiles of developmental expression and hormonal regulation of the Lin28/let-7 system in the rodent testis, help to consolidate the view that the elements of this system are involved in the dynamic control of male gonadal maturation and function in mammals. [score:3]
Changes in testicular miRNA expression were less consistent; thus, while let-7b miRNA levels remained unchanged along postnatal maturation, let-7a decreased during the neonatal period. [score:3]
Thus, neonatally estrogenized rats, in which puberty was altered, showed decreased testicular Lin28a and Lin28b mRNA levels, while let-7a, let-7b and mir-145 miRNAs expression levels were enhanced. [score:3]
In Experiment 1, the expression profiles of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-9, mir-145 and mir-132 miRNAs were determined in the testis of rats at different age-points during postnatal maturation: neonatal (PND-1), infantile (PND-15), juvenile (PND-30), early pubertal (PND-38), pubertal (PND-45) and adult (>PND-75) ages, in keeping with previous references 38; size = 7–8 per group. [score:3]
Impact of growth hormone deficiency on the expression profiles of the components of the Lin28/ let-7 axis and related factors in adult rat testis. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in pubertal rat testis rats following neonatal estrogenization. [score:3]
Effects of HPX and gonadotropin replacement on testicular expression Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs. [score:3]
Expression profiles of the components of the Lin28/let-7 axis and related factors in rat testis following photoperiod manipulation (dark (10–15), constant darkness from postnatal day [PND] 10–15). [score:3]
For this reason, we studied testicular expression of Lin28a and Lin28b mRNAs and let-7a, let-7b, mir-145 and mir-132 miRNAs in mo dels of GH deficiency, hypothyroidism and in adrenalectomized rats. [score:3]
Expression of let-7b and mir-145 in adult rat testis. [score:3]
In order to complement our expression data, localization analyses were applied to adult testicular samples to address the pattern of cellular distribution of key elements of the Lin28/ let-7 system. [score:3]
For instance, during neonatal period, Lin28a/Lin28b mRNA expression was minimum and (especially for Lin28b) increased thereafter, whereas let-7 and also mir-132, mir-9 and mir-145 miRNAs abundance was maximal on PND1, decreasing progressively along postnatal maturation. [score:3]
Analyses in mo dels of perturbed puberty, with variable impact on pubertal timing, revealed that early manipulations of the hormonal and nutritional milieu, as well as photic cues, could influence the profiles of expression of different members of the Lin28/let-7 hub along postnatal testicular maturation. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in rat testis following postnatal undernutrition, caused by rearing in large litters (20 pups per litter). [score:3]
With regard to miRNA expression, HPX did not result in detectable alterations in relative let-7a, let-7b or mir-145 miRNA levels. [score:3]
Such distribution fits well with the pattern of cellular expression of two selected miRNAs, known to repress Lin28a/Lin28b, namely, let-7b and mir-145, as detected by ISH adult rat testis. [score:3]
In addition, in Experiment 6, testicular Lin28/let-7 expression levels were monitored in a rat mo del of GH deficiency, a dwarf rat strain derived from the Lewis rat (2–3 months old; Harlan, UK). [score:3]
For instance, on the basis of previous findings and our current data, it is arguable that the concomitant increase in Lin28a/Lin28b and decrease of let-7 expression during post-natal maturation might favour completion of spermatogenesis during puberty, while reversion of the Lin28/let-7 ratio might contribute to perturbation of spermatogenesis in mo dels such as neonatal estrogenization. [score:3]
Expression of Lin28/let-7 and related miRNAs in the testis during postnatal maturation. [score:3]
Expression analyses included Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132 and mir-145 miRNAs. [score:3]
Expression of Lin28/let-7 system and related miRNAs in the testis during postnatal maturation. [score:3]
Notably, comparison of expression analyses of Lin28a/Lin28b transcripts (and let-7 miRNAs) in the testis of rats (present results) and mice 53 reveals a strikingly similar profile between these two rodent species, suggesting a notable degree of conservation of the Lin28 system in the testis. [score:3]
Assessment of hormonal regulation of testicular Lin28/let-7 expression was first evaluated using HPX rats, with or without gonadotropin replacement, as experimental mo del. [score:2]
The Lin28/let-7 tandem is subjected to a dual negative feedback regulatory loop. [score:2]
In contrast, ISH assays successfully detected the expression of two selected miRNAs of the system, namely, let-7b and the related miRNA, mir-145, in testicular sections from adult rats. [score:2]
Hormonal regulation of the Lin28/let-7 system in the testis. [score:2]
Our current findings complement those previous observations and help to provide educated hypotheses in the testicular roles of the Lin28/let-7 system in the postnatal testis in normal and pathophysiological conditions. [score:1]
Let-7a, let-7b, mir-132, and mir-145 (Fig. 1), as well as mir-9 (Suppl. [score:1]
Double digoxigenin (DIG)-labeled miRCURY LNA™ Let-7b, mir-145 and RNU6 detection probes (Exiqon, Denmark) were employed in this study. [score:1]
The same profiles of inverse relationship was found in mo dels of altered puberty due to neonatal estrogenization, where Lin28a/Lin28b mRNA levels were consistently reduced while let-7 levels were increased, and in the dwarf GH -deficient rat mo del, which displayed opposite profiles. [score:1]
However, while let-7a, mir-132 and mir-9 decreased sharply after PND1, let-7b increased between the neonatal and infantile age, to decline thereafter until puberty, whereas mir-145 levels remained elevated during infantile period and dropped during the juvenile transition. [score:1]
In contrast, CD males displayed a consistent decline in let-7b, mir-132 and mir-145 miRNA abundance at PND-15, but these changes in miRNA levels were transient and were not detected at PND-45, the expected time of puberty (Fig. 4). [score:1]
Finally, in Experiment 7, the involvement of other neurohormonal axes in the control of testicular Lin28/let-7 expression was assessed by measuring changes in mRNA/miRNA levels in mo dels of surgical deprivation of adrenal hormones, by adrenalectomy (ADX), and chemically -induced hypothyroidism by administration of 0.1% aminotriazole in drinking water for three weeks in keeping with previous references 49 50. [score:1]
Recent works suggest a role for Lin28/ let-7 axis in fertility and spermatogenesis. [score:1]
However, the trends of such changes were diametrically opposite between the hypothalamus and the testis, so that the hypothalamic Lin28/let-7 ratio decreased during maturation and increased after neonatal estrogenization 16, whereas the contrary applies to the testis. [score:1]
This protocol of neonatal estrogenization resulted also in detectable changes in the Lin28/ let-7 axis at the expected time of puberty (PND-45). [score:1]
In contrast, let-7a, let-7b and mir-145 miRNA levels (Fig. 3) were significantly higher than in controls, while mir-132 (Fig. 3) and mir-9 (Suppl. [score:1]
[1 to 20 of 64 sentences]
3
[+] score: 135
Transfection of let-7b mimics significantly decreased the expression of caspase-3 (Fig.   2c) and the luciferase activity of cells transfected with luciferase vector containing the 3′ UTR of human caspase-3 (Fig.   2d), indicating that let-7b directly targeted caspase-3. Fig. 2Effect of let-7b on the expression of caspase-3 and design of a molecular beacon (MB) for detecting let-7b. [score:8]
Using a rat mo del of acute myocardial infarction, we found that intramyocardial injection of let-7b-MSCs markedly enhanced left ventricular (LV) function and microvessel density, in accordance with a reduced infarct size and the expression of caspase-3. Taken together, these data indicate that let-7b may protect MSCs implanted into infarcted myocardium from apoptosis and autophagy by directly targeting caspase-3 signaling. [score:6]
ATG Autophagy related BHQ1 Black hole quencher dye 1 bp Base pairs Ct Threshold cycle DAB 3,3′-Diaminobenzidine DAPI 4′,6-Diamidino-2-phenylindole DMEM Dulbecco's modified Eagle's medium EKR Extracellular signal regulated kinase FBS Fetal bovine serum FITC Fluorescein isothiocyanateH [2]O [2] Hydrogen peroxide hMSC Human bone marrow-derived mesenchymal stem cell I/R Ischemia/reperfusion LC3A/B Light chain 3 A/B let-7b-MSC let-7b -overexpressing MSC MB Molecular beacon MEK Mitogen-activated protein kinase MSC Mesenchymal stem cell miRNA MicroRNA NC Negative control miRNA PARP Poly(ADP-ribose) polymerase PBS Phosphate-buffered saline PI Propidium iodide ROS Reactive oxygen species TBS-T Tris-buffered saline–0.1 % Tween 20 TUNEL Terminal deoxynucleotidyltransferase -mediated dUTP nick-end labeling UTR Untranslated region This study was supported by a Korea Science and Engineering Foundation grant funded by the Korean government (MEST) (NRF-2011-0019243 and NRF-2011-0019254) and a grant from the Korea Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (A120478). [score:6]
Although additional studies are required to further elucidate the underlying mechanisms, our study also demonstrated that modulation of caspase-3 using let-7b can be an effective means to enhance post-transplantation survival of MSCs and subsequent functional recovery of the damaged heart by upregulating survival signals such as MEK and ERK, while suppressing apoptotic signaling activation. [score:6]
Screening of candidate miRNAs targeting caspase-3. Inhibition of caspase-3 by let-7b. [score:5]
When the cells were treated with 500 μM H [2]O [2], the expression of caspase-3 increased while let-7b expression decreased. [score:5]
To determine the effect of let-7b on survival-related signaling, we examined the phosphorylation of MEK and ERK and the expression of anti-apoptotic protein Bcl-2. H [2]O [2] decreased phosphorylation of both MEK and ERK and the expression of Bcl-2. However, this H [2]O [2] -induced decrease was attenuated by let-7b transfection prior to H [2]O [2] treatment (Fig.   3b). [score:5]
Anti-apoptotic effect of let-7b on H [2]O [2] -treated MSCsWhen the cells were treated with 500 μM H [2]O [2], the expression of caspase-3 increased while let-7b expression decreased. [score:5]
These results indicated that let-7b regulates the expression of autophagy-related genes at both the mRNA and protein levels. [score:4]
Furthermore, increased caspase-3 activity by H [2]O [2] treatment was also attenuated by let-7b transfection (Fig.   3c), and cell survival was also recovered by let-7b transfection (Fig.   3d), indicating that let-7b -mediated downregulation of caspase-3 attenuated H [2]O [2] -induced cell death. [score:4]
Taken together, these data suggest that the let-7b -mediated downregulation of caspase-3 is a viable therapeutic strategy for the treatment of ischemic myocardium. [score:4]
Here, we report that let-7b targets caspase-3 to regulate apoptosis and autophagy in MSCs exposed to ROS. [score:4]
Moreover, autophagy-related genes, including Atg5, Atg7, Atg12 and beclin-1, were significantly downregulated in let-7b-MSCs. [score:4]
Six candidate miRNAs that are predicted to target caspase-3 (let-7, miR-138, miR-30b, miR-129, miR-203, and miR-219-5p) and have an aggregate Pct greater than 0.2 were selected (Fig.   1c). [score:3]
Additionally, the expression of autophagy-related genes, such as ATG5, ATG7, ATG12, and BECN1, was attenuated in the MSCs transfected with let-7b (Fig.   3i). [score:3]
Since we did not examine the effect of other let-7 family members on caspase-3 expression in the present study, it is difficult to draw any conclusion on the specificity of let-7b in MSCs. [score:3]
Additionally, H [2]O [2] treatment significantly decreased the expression of endogenous let-7b at high concentrations (500 and 750 μM) (Fig.   1e), further suggesting that decreased let-7b from H [2]O [2] treatment may be linked to the decreased cell survival after given concentrations of H [2]O [2] treatment. [score:3]
Let-7b -transfected MSCs (let-7b-MSCs) showed high expression of survival-related proteins, including p-MEK, p-ERK and Bcl-2, leading to a decrease in Annexin V/PI- and TUNEL -positive cells under ROS-rich conditions. [score:3]
Quantitative data expressed as mean ± standard deviation of at least three independent experiments We utilized MBs to detect intracellular let-7b. [score:3]
However, such ROS -induced increase of autophage-related gene expressions was attenuated by let-7b transfection, and this may have attributed to the increased survival of let-7b transfected cells. [score:3]
Quantitative data expressed as the mean ± standard deviation of at least three independent experiments To examine the therapeutic potential of let-7b-enriched MSCs in ischemic myocardium, we transplanted let-7b-enriched MSCs into ischemic rat hearts. [score:3]
c Caspase-3 expression with or without let-7b transfection prior to H [2]O [2] treatment was detected by western blotting (* p <0.05). [score:3]
Furthermore, members of the let-7 family—namely let-7a, let-7e, and let-7 g—have also been reported to target caspase-3 in cancer cells, PC12 cells, and endothelial cells, respectively [26, 34, 35]. [score:3]
Furthermore, the number of TUNEL -positive apoptotic cells increased by H [2]O [2] treatment, but such an increase was suppressed by let-7b transfection (Fig.   3f), suggesting that the delivery of exogenous let-7b effectively prevented H [2]O [2] -induced apoptosis of MSCs. [score:3]
Our study indicates that the regulation of caspase-3 by let-7b can improve survival of hMSCs via the modulation of survival signaling and autophagy-related genes. [score:2]
Six candidate miRNAs including let-7b were selected and transfected into human MSCs in vitro. [score:1]
a Intracellular caspase-3 (green) and let-7b (red) were visualized under confocal microscopy. [score:1]
Aside from the miRNAs that are not members of the let-7 family, the predicted binding sequence of let-7 family members (a, b, c, d, e, f, g, and i) to the 3′ UTR of human caspase-3 is identical. [score:1]
e Schematics showing the working principle of a MB designed to detect let-7b. [score:1]
The only difference was that let-7b had a lower context -positive score (−0.40 for let-7b vs. [score:1]
After transfection of 100 nM let-7b mimic, the cells were incubated with or without 500 μM H [2]O [2]. [score:1]
Five animals per group (ligation, NC-MSCs, let-7b-MSCs) were used for morphological and functional analysis. [score:1]
Anti-apoptotic effect of let-7b on H [2]O [2] -treated MSCs. [score:1]
The cells were transfected with 100 nM let-7b mimics for 4 hours. [score:1]
e Effect of H [2]O [2] on endogenous let-7b expression was evaluated by real-time PCR. [score:1]
Thus, we also examined the effect of let-7b on autophagy-related genes. [score:1]
Detection of let-7b using a MB. [score:1]
Sequence alignment indicated that let-7b recognizes and binds to the sequence between 1069 and 1900 of the caspase-3 3′ UTR (Fig.   2a). [score:1]
The cells were first transfected with 100 nM let-7b mimics as described above, and then exposed to varying concentrations of H [2]O [2] for 6 hours in 10 % DMEM. [score:1]
The cells were treated with 500 μM H [2]O [2] for 6 hours with or without prior let-7b transfection. [score:1]
hMSCs were plated in a four-well culture dish (1 × 10 [4] cells per well) and treated with 500 μM H [2]O [2] for 6 hours with or without prior let-7b transfection. [score:1]
miRNA-23 has a completely irrelevant sequence to the let-7b, and thus a MB designed to detect miR-23 served as a NC. [score:1]
To detect cellular let-7b, the cells were transfected with 50 pM MB. [score:1]
Additionally, the negative control group (100 pM MB designed to detect miR-23 was used instead of MB for let-7b) did not produce significant fluorescence with the presence of let-7b mimic, suggesting the MB for let-7b was indeed specific for detecting let-7b. [score:1]
The Cy3 -modified longer sequence of the MB complementarily matches the sequence of let-7b, so that when let-7b binds to the MB it disturbs fluorophore (Cy3)–quencher (BHQ1) interaction producing fluorescence (Fig.   2e). [score:1]
Visual detection of let-7b in vitro using a MB. [score:1]
The cell survival data after miRNA transfection and H [2]O [2] treatment indicated that let-7b significantly attenuated cell survival after H [2]O [2] exposure, while other candidate miRNA had no significant effect on cell survival (Fig.   1d). [score:1]
The pmirGLO vector containing the 3′ UTR of caspase-3 was co -transfected with let-7b mimic or NC using siLentFect™ (Bio-Rad). [score:1]
This finding suggests that the compensation of let-7b prior to cell transplantation can be a therapeutically sound approach for treating ischemic hearts. [score:1]
However, such an increase of caspase-3 and decrease of let-7b were attenuated by let-7b transfection prior to H [2]O [2] treatment (Fig.   3a). [score:1]
Furthermore, our data showed that let-7b plays an important role in cell survival, apoptosis, and autophagy in MSCs under oxidative stress. [score:1]
This is one of the limitations of the present study, and specific roles of individual let-7 family members on the cell survival, especially of MSCs, will be an interesting subject of further study. [score:1]
Annexin V/PI staining indicated that H [2]O [2] increased both Annexin V and PI staining of MSCs showing increased apoptosis, but this was attenuated by let-7b transfection prior to H [2]O [2] treatment (Fig.   3e). [score:1]
Using ischemia/reperfusion mo del (I/R), the effect of MSCs enriched with let-7b was determined after transplantation into infarcted heart area. [score:1]
We designed a MB to detect the presence of let-7b, which forms a partially double-stranded structure with a longer Cy3 modified sequence (5′-AAC CAC ACA ACC TAC TAC CTC A-3′-Cy3) and a black hole quencher dye 1 (BHQ1) modified shorter sequence (3′-TGA TGG AGT-5′-BHQ1). [score:1]
These data suggest that let-7b may exert anti-apoptotic effect. [score:1]
The cells were either untreated (control), H [2]O [2] -treated (H [2]O [2]), or transfected with let-7b prior to H [2]O [2] treatment (H [2]O [2] + let-7b). [score:1]
However, such an increase of autophagic activity was attenuated by let-7b transfection prior to H [2]O [2] treatment, and this was confirmed by both immunocytochemistry (Fig.   3g) and western blot (Fig.   3h). [score:1]
The longer sequence of the MB was designed to complementarily match the sequence of let-7b (5′-TGA GGT AGT AGG TTG TGT GGT T-3′) so that when MB and let-7b bind to each other, making the fluorophore and the quencher sufficiently separated, fluorescence from the fluorophore can be detected. [score:1]
[1 to 20 of 59 sentences]
4
[+] score: 118
Also, the observation that ethanol increases the formation of HMGB1-let-7b complexes, and that HMGB1 inhibition prevents TLR7 induced neurotoxicity, uncovers a new potential for HMGB1 inhibition in preventing alcohol -induced and other neuroimmune pathologies. [score:5]
Mean ± SEM, *p < 0.05, N = 3–6 per group Since ethanol increases TLR7 expression, let-7 release, and HMGB1 release, we hypothesized that the ethanol -induced increase in TLR7 expression primes TLR7 signaling and increases vulnerability to neurotoxicity due to TLR7 activation. [score:5]
Many miRNAs, including let-7 isoforms, are upregulated in the brains of humans and mice after chronic alcohol [8, 9]. [score:4]
HMGB1 is known to be secreted in microvesicles [42, 56] and might escort let-7 to microvesicles for secretion, rather than to the Ago2 -associated RISC complex, where it would subsequently act intracellularly to regulate the stability target mRNAs. [score:4]
This shifting of the chaperone protein association of let-7b might alter its function or initiate targeting to microvesicles. [score:3]
Ethanol causes an increase in TLR7 expression, and release of let-7b and HMGB1 from microglia in microvesicles, potentiating neurodegeneration. [score:3]
Thus, we hypothesized that ethanol would increase TLR7 and let-7 expression in vitro contributing to neuroimmune activation. [score:3]
Ethanol increases TLR7 expression and its ligand let-7b and causes neuroimmune gene induction in rat HEC slice culture. [score:3]
We report here that ethanol exposure increases TLR7 expression and release of let-7b in microglia-derived microvesicles to promote neurodegeneration (Fig.   8). [score:3]
Thus, ethanol treatment of HEC brain slice cultures increases expression of TLR7, let-7b, and HMGB1. [score:3]
Our findings indicate that alcohol causes microglia to release let-7 and HMGB1 in MVs while concomitantly increasing TLR7 expression, leading to neurodegeneration. [score:3]
Studies utilizing miRNA profiling find increased expression of several let-7 isoforms in human and rodent brain after chronic alcohol [8, 9]. [score:3]
Ethanol increased let-7b expression in HEC slice tissue by more than twofold at 48 h of exposure (Fig.   2a). [score:3]
Using HEC slice culture, we found that ethanol induces TLR7 and let-7b expression. [score:3]
Ethanol also potentiated neuroimmune responses to a low dose of non-neurotoxic let-7b mimic (100 nM), increasing IL-1β expression by fourfold greater than let-7b alone (not shown). [score:3]
Let-7 release in MVs in particular has also been implicated in multiple inflammatory pathologies related to cancer, cardiovascular disease, and neurodegeneration [6, 53, 54]. [score:2]
c Ethanol potentiated let-7b -induced neurotoxicity (37.05 ± 2.4 vs 23.1 ± 1.7 mean fluorescent intensity) **** p < 0.0001 vs siControl, ####p < 0.0001 vs let7b, t test, N = 10 slices. [score:1]
Ethanol -induced increases in let-7b binding to HMGB1 appear to be unique from other ethanol -induced miRNAs. [score:1]
TLR7 agonist imiquimod (IMQ) increases TLR7, let-7b, and neuroimmune markers in brain slice tissue similar to ethanol. [score:1]
c SH-SY5Y neurons were treated with 100 mM ethanol for 24 h. Ethanol had no effect on let-7b release in MVs from SH-SY5Y neurons; 95.75 ± 5.2% vs 100 ± 8.1%, Control vs Ethanol, mean ± SEM. [score:1]
Further, ethanol increased let-7b binding to the danger signaling molecule high mobility group box-1 (HMGB1) in MVs, while reducing let-7 binding to classical chaperone protein argonaute (Ago2). [score:1]
Ethanol enhanced IMQ-TLR7 and let-7b induced neurotoxicity Our finding of increased HMGB1 binding to let-7b in MVs after ethanol, coupled with previous observations of HMGB1 involvement in TLR7 agonist activation [25], suggested that HMGB1 may be acting as a chaperone, facilitating let-7b secretion in MV and binding to TLR7. [score:1]
In rat HEC brain slice culture, we found that ethanol increases TLR7, HMGB1, IL-1β, TNFα, and let-7b consistent with findings in human alcoholics. [score:1]
Therefore, we assessed let-7b binding to Ago2 and HMGB1 in MVs. [score:1]
Ethanol caused a threefold increase in MV let-7b from BV2 microglia (Fig.   4b) but not SH-SY5Y neurons (Fig.   4c), suggesting microglia are the source of secreted let-7. Ethanol also caused a dose -dependent increase in media HMGB1 (Fig.   4d). [score:1]
Regardless, ethanol increased HMGB1-let-7b complexes in MVs released from HEC brain slices. [score:1]
b Ethanol reduces let-7b binding to argonaut (Ago2) by 50%. [score:1]
First, we confirmed that let-7b causes neurodegeneration through TLR7 in our culture using siRNA to TLR7 and a let-7b mimic (Fig.   6b). [score:1]
Using flow cytometry for MVs from HEC slice culture and analysis of SH-SY5Y neuronal and BV2 microglia cell lines, we found that the majority of microvesicular HMGB1 and let-7b are derived from microglia. [score:1]
We identify a role of let-7 in the pathology of alcoholism that involves inter-cellular signaling through TLR7, rather than its intracellular function involving mRNA stabilization. [score:1]
b Ethanol increased let-7b in BV2 microglia-derived MVs by 3-fold; 326.7 ± 76.3% vs 100 ± 18.2%, Ethanol vs Control, mean ± SEM, * p < 0.05, t-test. [score:1]
Thus, ethanol increases TLR7 -induced neurodegeneration, through induction of TLR7, let-7 release, and HMGB1 secretion. [score:1]
We further hypothesized that ethanol would cause the release of the endogenous TLR7 agonist miR let-7b in MVs. [score:1]
Therefore, we think the requirement for HMGB1 involves facilitating the interaction of let-7 with TLR7, rather than a requirement for co-stimulation of TLR4 by HMGB1. [score:1]
N = 2–10 slices per group let-7b can be released from cells in extracellular microvesicles (MVs) to exert its effects on recipient cells [40, 41]. [score:1]
Fig. 4Ethanol causes microvesicle (MV) release of let-7b and HMGB1 from microglia. [score:1]
Flow cytometric analysis of MVs from HEC media and analysis of MVs from brain cell culture lines found that microglia were the primary source of let-7b and HMGB1-containing MVs. [score:1]
The endogenous miRNA let-7b binds TLR7 to cause neurodegeneration. [score:1]
Thus, we report here the identification of a novel inter-cellular communication mechanism in the pathology of alcohol abuse, whereby ethanol causes the release of HMGB1-let-7 complexes in MV from microglia. [score:1]
We utilized specific cell lines to determine whether neurons or microglia release let-7b in MVs. [score:1]
Ethanol also increased the binding of let-7b to the DAMP and chaperone HMGB1, while reducing let-7b binding to Ago2. [score:1]
siRNA against TLR7 mRNA (siTLR7) prevented let-7 induced neurotoxicity. [score:1]
For ethanol exposures, slices were exposed to ethanol (25–100 mM) for 48 h. For let-7b mimic exposure studies, slices were treated with DOTAP, DOTAP plus let-7b mimic, or let-7b mimic plus ethanol for 48 h. For TLR7 agonist enhancement studies, slices were treated with either 500 ng/mL of imiquimod (IMQ) or vehicle for 48 h, followed by addition of either ethanol (100 mM) or vehicle for 96 h. HEC slice cultures were removed at the end of the experiment and fixed with 4% paraformaldehyde with 5% sucrose in 0.01 M PBS for 24 h at 4 °C. [score:1]
The miR let-7 is an endogenous ligand for TLR7 that results in neurodegeneration [6] and let-7 isoforms are increased in the brains of human alcoholics [9]. [score:1]
We then asked which cell type was responsible for microvesicular let-7 and HMGB1 release. [score:1]
Thus, we hypothesized that HMGB1 would bind miR let-7b in MVs to help facilitate its activity as an endogenous agonist of TLR7. [score:1]
Given the “chaperone-like” nature of HMGB1 for nucleic acids, and our finding of let-7b and HMGB1 in MVs derived from microglia, we hypothesized that HMGB1 binds miR let-7b in MVs. [score:1]
The let-7b isoform in particular activates TLR7. [score:1]
In the case of let-7b, less than 20% of let-7b is bound to Ago2 in MVs from human plasma [44]. [score:1]
Ethanol enhanced IMQ-TLR7 and let-7b induced neurotoxicity Our finding of increased HMGB1 binding to let-7b in MVs after ethanol, coupled with previous observations of HMGB1 involvement in TLR7 agonist activation [25], suggested that HMGB1 may be acting as a chaperone, facilitating let-7b secretion in MV and binding to TLR7. [score:1]
In order to determine if this ethanol effect showed specificity for let-7b, we assessed two additional relevant pro-inflammatory miRNAs, miR-155 and miR181c. [score:1]
Ethanol caused TLR7 -associated neuroimmune gene induction and initiated the release let-7b in microvesicles (MVs), enhancing TLR7 -mediated neurotoxicity. [score:1]
Ethanol caused a nearly fourfold increase in release of let-7b in media MVs (Fig.   4a). [score:1]
The endogenous TLR7 agonist miR let-7 has been found to cause neurodegeneration [6]. [score:1]
Further, let-7b was increased in MVs by 28% during ethanol withdrawal (not shown). [score:1]
Concomitantly, ethanol reduced the association of let-7b with its classical chaperone protein argonaute (Ago2) [37] in microvesicles by approximately 50% (Fig.   5b). [score:1]
let-7b, miR-155, and miR181c were assessed as described above. [score:1]
Concomitant with the increase in TLR7, ethanol also increases the release of let-7b and HMGB1 in MVs and potentiates let-7b induced neurodegeneration via TLR7 activation. [score:1]
Hippocampal-entorhinal (HEC) slices were treated with TLR7 agonist Imiquimod (IMQ, 500 ng/mL), let-7b (5 μM), or ethanol (100 mM) for 48 h. Cell death was assessed by fluorescent propridium iodide (PI) uptake. [score:1]
Fig. 8 Proposed mechanism of HMGB1 and let-7 release in microvesicles. [score:1]
Ethanol increases the binding of let-7 with HMGB1 in microvesicles. [score:1]
We then found that ethanol does indeed potentiate let-7b -induced neurotoxicity (Fig.   6c). [score:1]
Thus, ethanol concomitantly induces activation of both TLR7 and its endogenous ligand, let-7b. [score:1]
b let-7b caused neurotoxicity in HEC slice tissue as shown by a greater than twofold increase in PI uptake relative to control. [score:1]
Fig. 2Ethanol increases miR let-7b, HMGB1 in hippocampal-entorhinal slice culture (HEC). [score:1]
let-7b was increased in MVs 3.7-fold by ethanol. [score:1]
Thus, ethanol releases let-7b and HMGB1 from HEC brain slice cultures and BV2 microglia. [score:1]
Other let-7 family members in addition to other pro-inflammatory miRNAs were assessed and are shown in Additional file 4: Table S1. [score:1]
Thus, sensitization of TLR7 signaling with either IMQ or let-7 results in increased neurotoxicity to ethanol. [score:1]
The combination of these tools shows that microglia are the primary source of let-7b in MVs in response to ethanol. [score:1]
Our findings suggest that recurrent TLR7 activation by ethanol -induced microglial let-7 and HMGB1 release contributes to the progressive neurodegeneration associated with alcoholism. [score:1]
Ethanol increases TLR7 activation and releases of HMGB1-miR-let-7 complexes in microglia-derived vesicles that cause neurotoxicity via TLR7 activation. [score:1]
let-7b levels were threefold control at 24 h and fivefold control at 48 h. Error bars denote mean ± SEM. [score:1]
Our results identify that ethanol induces neuroimmune pathology involving the release of let-7b/HMGB1 complexes in microglia-derived microvesicles. [score:1]
Ethanol was found to increase the association of let-7b with HMGB1 in MVs by 50% (Fig.   5a). [score:1]
Ethanol releases miR let-7b and HMGB1 complexes in MVs from microglia. [score:1]
Flow cytometric and cell line studies identified microglia as the primary source of the MV-secreted HMGB1 and let-7b. [score:1]
We also found that let-7b is released during withdrawal. [score:1]
Rat hippocampal-entorhinal cortex (HEC) slice culture was used to assess specific effects of ethanol on TLR7, let-7b, and microvesicles. [score:1]
let-7b in particular has a GU-rich region that is readily recognized by TLR7. [score:1]
Therefore, we assessed whether let-7b and HMGB1 were released in MVs in response to ethanol, as this could serve as an inter-cellular communication signal. [score:1]
[1 to 20 of 81 sentences]
5
[+] score: 111
In this study, we, for the first time, displayed the involvement of let-7, a conserved and abundant miRNA in the heart [30], in the up-regulation of β [1]-AR in AMI in rats, which provides new insight into the mechanisms for regulation of β [1]-AR expression and overexpression of miRNA let-7e potentially inhibited AMI -induced arrhythmia in rat. [score:11]
On the basis of these data, one would expect that down-regulation of let-7 should also influence expression of β [2]-AR in addition to up-regulation of β [1]-AR. [score:9]
Up-regulation of β [1]-AR and down-regulation of let-7 in infarcted heartsWe first compared the expression levels of β [1]-AR between the infarcted and non-infarcted LV tissues in a rat mo del of AMI. [score:8]
Fig. 1Up-regulation of β [1]-AR and down-regulation of let-7 in rat mo dels of acute myocardial infarction (AMI). [score:7]
Up-regulation of β [1]-AR and down-regulation of let-7 in infarcted hearts. [score:7]
First, our data revealed that let-7 was significantly down-regulated, along with selectively increase in β [1]-AR expression, in the infarcted area of LV tissue. [score:6]
Regulation of β [1]-AR by let-7 in cardiomyocytes in vitroThe reciprocal alterations of β [1]-AR and let-7 in terms of their expression in AMI suggest a targeting relationship between them. [score:6]
As expected, all three miRNAs significantly inhibited luciferase activity, indicating that ADRB1 3′UTR is direct target of let-7 family. [score:6]
The reciprocal alterations of β [1]-AR and let-7 in terms of their expression in AMI suggest a targeting relationship between them. [score:5]
To exploit this notion, we performed miRNA gene target prediction using TargetScan 6.0 database, and we indeed identified a binding site in the 3′UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Fig. 2A). [score:5]
Fig. 2Predicted seed -binding sites of let-7 in β [1]-AR 3′UTR and verification of β [1]-AR as a target for let-7. (A) Alignment of the sequences of let-7 family (bottom) with their target sites in the 3′UTRs of human, rat and mouse β [1]-AR mRNA (top). [score:5]
In silico prediction with Targetscan and miRanda showed that ADRB1 is a target of let-7; the seed sequence is conserved among species, such as rat, mouse and human beings. [score:5]
Clearly, mechanisms other than let-7 may also participate in the regulation of β [2]-AR expression in the heart. [score:4]
We then studied the expression of let-7, a cardiac-enriched miRNA, in the infarcted rat heart with miRCURY Array microarray version 11.0 containing 349 mature rat miRNAs. [score:3]
Targetscan predicts the presence of a putative binding site for let-7 in the 3′UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:3]
However, we definitely could not rule out other molecular targets of let-7, which are involved in its antiarrhythmic effect in the rats with AMI. [score:3]
Second, we experimentally established β [1]-AR as a target gene for the members of the let-7 family. [score:3]
Study also demonstrated that the let-7 family shares the same downstream targets in human embryonic stem cells [40]. [score:3]
Construction of plasmid carrying the 3′UTR of β [1]-adrenergic receptor (ADRB1) and luciferase assayTargetscan predicts the presence of a putative binding site for let-7 in the 3′UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:2]
Regulation of β [1]-AR by let-7 in cardiomyocytes in vitro. [score:2]
We also demonstrated that β [1]-AR is a target gene for let-7 revealed by luciferase reporter assay and analysis. [score:2]
All these data indicate the specificity of let-7 action on ADRB1 3′UTR (Fig. 2B and C). [score:1]
A segment containing the let-7 miRNA binding sites flanked by the Hand lll and Sac I restriction sites and a scramble sequence as a negative control (NC) were synthesized by Invitrogen. [score:1]
The results from let-7e are most likely applicable to other members of the let-7 family based on their same mechanism of action conferred by their same seed site. [score:1]
A variety of studies have demonstrated that let-7, an abundant and conserved miRNA, participates in various pathophysiological processes, such as cancer growth and formation [37] and axon regeneration [38]. [score:1]
The let-7 family includes let-7a, b, c, d, e, f, g and i and they all share an identical seed motif thereby presumably possessing the same cellular functions. [score:1]
let-7 family shares the same seed sequence (5′ GAGGUAG 3′) and are highly conserved across species in both their sequences and functions [39]. [score:1]
[1 to 20 of 27 sentences]
6
[+] score: 98
Down-regulation of β [1]-ARs and up-regulation of let-7 in chronic ischemic failing heartThe expression level of β [1]-ARs was decreased by 34.0 ± 6.3% in failing hearts compared with those in non-failing hearts (Figure 1A). [score:8]
Our previous study revealed that let-7 is considerably down-regulated in the setting of acute myocardial ischemia which results in the upregulation of β [1]-ARs and the associated arrhythmogenesis and dysfunction of the heart. [score:7]
The mechanisms for let-7 up-regulation and the possible pathophysiological role of let-7 upregulation in CIHF remained unknown. [score:7]
Down-regulation of β [1]-ARs and up-regulation of let-7 in chronic ischemic failing heart. [score:7]
First, the level of let-7 family members, especially let-7a, was significantly up-regulated in CIHF, along with down-regulation of β [1]-ARs. [score:7]
Intriguingly, in our preliminary studies in a rate mo del of chronic myocardial ischemia, members of the let-7 miRNAs family were found upregulated, whereas let-7a showed the opposite expression. [score:6]
Artificial mediation on this feedback circuit by interfering let-7 expression may be a potential strategy and new idea for the regulation of β [1]-AR expression in the prevention and treatment of heart failure. [score:6]
Let-7 regulates expression of β [1]-ARs in cardiomyocytesTargetScan miRNA database was used to predict a binding site at the 3’UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Figure 2A). [score:6]
Let-7 belongs to a miRNA family containing 13 members sharing the same seed sequence thereby the same set of target genes [18], and is affluently expressed in the heart [19]. [score:5]
Under such a condition, the levels of β [1]-AR protein and mRNA were both reduced in a concentration dependent manner (Figure 1D and 1E), whereas, the members of let-7 family, particularly let-7a, were markedly up-regulated (Figure 1F). [score:4]
Studies discovered the deregulation of the let-7 members in cardiovascular diseases, such as cardiac hypertrophy, cardiac fibrosis, and myocardial infarction [20]. [score:4]
A. Alignment of the sequences of let-7 family (bottom) with their target sites in the 3’UTRs of human, rat and mouse β1-AR mRNAs (top). [score:3]
In agreement with the in vivo data, reciprocal changes of expression of β [1]-AR and let-7 miRNAs were also observed in ISO -treated NRVCs. [score:3]
This discrepancy of let-7 family expression may be attributed to the family members’ transcript from different gene clusters which contribute to different processes in heart failure. [score:3]
Let-7 regulates expression of β [1]-ARs in cardiomyocytes. [score:3]
Figure 2 A. Alignment of the sequences of let-7 family (bottom) with their target sites in the 3’UTRs of human, rat and mouse β1-AR mRNAs (top). [score:3]
Targetscan predicts the presence of a putative binding site for let-7 in the 3’UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:3]
TargetScan miRNA database was used to predict a binding site at the 3’UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Figure 2A). [score:3]
Thus, it forms a critical feedback loop signaling pathway of β [1]-AR/cAMP/PKA/GATA-4/let-7/β [1]-AR, and the decreasing of β [1]-AR in CIHF is induced by β [1]-AR activation in early phase of CIHF, which is a kind of self-regulation of β [1]-AR in the course of ischemia induced heart failure. [score:2]
Construction of plasmid carrying the 3’UTR of β [1]-adrenergic receptor (ADRB1) gene and luciferase assayTargetscan predicts the presence of a putative binding site for let-7 in the 3’UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:2]
It is conceivable based on our findings that let-7 participates in the β [1]-AR/cAMP/PKA/GATA-4 signaling pathway as an upstream component and its participation forms a negative feedback loop. [score:1]
A-C. β1-AR protein, β1-AR mRNA and let-7 family levels in the hearts of ischemic heart failure rats; D-F. β1-AR protein, β1-AR mRNA and let-7 family levels in NRVCs treated with isoproterenol (ISO) for 72 h. HF, heart failure; Ctl, control. [score:1]
Level of β1-AR and let-7 in chronic ischemic failing hearts and ISO -treated neonatal rat ventricular cardiomyocytes (NRVCs). [score:1]
We therefore proposed the modified signaling pathway: β [1]-AR↑→cAMP↑→PKA↑→GATA-4↑→let-7↑→β [1]-AR↓. [score:1]
Figure 1 A-C. β1-AR protein, β1-AR mRNA and let-7 family levels in the hearts of ischemic heart failure rats; D-F. β1-AR protein, β1-AR mRNA and let-7 family levels in NRVCs treated with isoproterenol (ISO) for 72 h. HF, heart failure; Ctl, control. [score:1]
A segment containing the let-7 miRNA binding sites flanked by the Hand III and Sac I restriction sites and a scramble sequence as a negative control (NC) were synthesized by Invitrogen. [score:1]
[1 to 20 of 26 sentences]
7
[+] score: 96
There are two regulatory types of H19: on one hand, it can encode miR-675 from its first exon, inhibiting its target genes 17, 39; on the other hand, it can function as a ceRNA to bind a series of miRNAs including let-7b 18, 22, 23, derepressing their targets. [score:8]
In addition, using gain- and loss-of-function approaches in vivo, we found that H19 played an important role in hippocampal neuron apoptosis by acting as a competing endogenous RNA to target let-7b to regulate Casp3 expression. [score:6]
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA group Recent studies demonstrated that H19 could regulate gene expression by acting as competing endogenous RNA for miRNA let-7, resulting in the derepression of several protein-coding genes targeted by let-7 18, 22, 23, as H19 harbors both canonical and non-canonical -binding sites for the let-7 family [23]. [score:6]
H19 overexpression and knockdown in the in vivo study further verified a strong negative correlation of H19 and let-7b expression in epileptic rats at 7 days (Fig.   5c, d) and 60 days (Supplementary Figures  5a–d) after SE. [score:6]
These data suggested that H19 played an important role in SE -induced hippocampal neuron damage by acting as a competing endogenous RNA to target let-7b to regulate Casp3 expression. [score:6]
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA group According to the prediction of miRNA target gene, Casp3 is one of the potential downstream target genes of the let-7 family. [score:5]
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA groupAccording to the prediction of miRNA target gene, Casp3 is one of the potential downstream target genes of the let-7 family. [score:5]
The upregulation of H19 in the latent period of epilepsy is involved in SE -induced neuronal damage by functioning as a competing endogenous RNA to sponge miRNA let-7b in the regulation of cellular apoptosis. [score:5]
H19 regulates gene expression by acting as a competing endogenous RNA for let-7 in SE -induced neural damage during epileptogenesis. [score:4]
c, d qPCR quantification of H19 and let-7b levels in CA3 subfield of hippocampus from H19 overexpression (c) and H19 knockdown (d) rats with or without KA treatment for 7 days (n = 8). [score:4]
g, h qPCR quantification of let-7b and Casp3 mRNA levels in CA3 subfield of hippocampus from g H19 overexpression (n = 8) and h H19 knockdown (n = 4–5) rats with or without KA treatment for 7 days. [score:4]
H19 overexpression and knockdown in the in vivo study further verified the strong negative correlation of let-7b and Casp3 protein levels in epileptic rats at 7 days (Fig.   5g, h) and 60 days after SE (Supplementary Figures  5e, f). [score:4]
The expression levels of the let-7 family members were examined in CA3 subfield of the hippocampus from rats at 1 day after SE. [score:3]
f Top, complementarity between let-7b seed sequence and the 3′-UTR position of Casp3 of rat predicted by a computational and bioinformatics -based approach using TargetScan. [score:3]
H19 contributed to cellular apoptosis by targeting let-7b. [score:3]
H19 might function by sponging let-7b targeting Casp3. [score:3]
The relative H19 levels were normalized to GAPDH and the relative expression levels of let-7 family members were normalized to U6. [score:3]
b The expression levels of let-7 family members (let-7a, let-7b, let-7d, let-7e, let-7g, and let-7i) in CA3 subfield of hippocampus from sham-operated and KA -induced epileptic rats at 1 day after surgery as determined using qPCR (n = 7–8). [score:3]
The luciferase assay demonstrated that co-transfection of the let-7b mimic plasmid containing a sequence of position 325–331 in Casp3 3′-untranslated region (3′-UTR) consistently produced less luciferase activities by 31.72%. [score:2]
Mutation of the binding sites abolished the repressive effect of let-7b (Fig.   5f). [score:2]
Fig. 5 a Bioinformatics-predicted binding sites for eight let-7 subtypes (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, and let-7i) in rat H19. [score:1]
The bioinformatics analysis also revealed putative complementary sequences for let-7 family members (let-7a, let-7b, let-7d, let-7e, let-7g, and let-7i) in rat H19 (Fig.   5a). [score:1]
Gao Y The H19/let-7 double -negative feedback loop contributes to glucose metabolism in muscle cellsNucleic Acids Res. [score:1]
e Correlations according to Pearson coefficient between H19 and let-7b levels in surgically resected hippocampal samples from patients with TLE (n = 12). [score:1]
and luciferase assays demonstrate that vertebrate H19 harbors binding sites for the miRNA let-7 family and can bind to let-7 directly to modulate its availability [23] The results from the present study are consistent with the reports. [score:1]
a Bioinformatics-predicted binding sites for eight let-7 subtypes (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, and let-7i) in rat H19. [score:1]
Kallen AN The imprinted H19 lncRNA antagonizes let-7 microRNAsMol. [score:1]
HEK293 cells were seeded into 96-well plates, and 100 μl of transfection solution containing 0.5 μl Lipofectamine 2000 (Invitrogen, USA) and 25 ng reporter plasmids with 50 nM let-7b mimic or 50 nM mimic control, respectively, were added. [score:1]
Mutant Casp3 (Casp3-Mut) was generated by mutating the putative let-7b -binding site (underlined). [score:1]
Nucleotides of the miRNA let-7 seed region (positions 2–8) are marked in red. [score:1]
Correlation analysis also showed that H19 and let-7b had a negative correlation in hippocampal samples from patients with TLE (Fig.   5e). [score:1]
[1 to 20 of 31 sentences]
8
[+] score: 90
Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivoTo further verify that Lin28B expression down-regulation in dystrophic retinas causes let-7 family molecule accumulation, we used an adenoviral expression system to overexpress Lin28B in the retina by delivering Ad/Lin28B into the subretinal space of RCS-p+ rats at p21. [score:12]
To further verify that Lin28B expression down-regulation in dystrophic retinas causes let-7 family molecule accumulation, we used an adenoviral expression system to overexpress Lin28B in the retina by delivering Ad/Lin28B into the subretinal space of RCS-p+ rats at p21. [score:10]
We tested the expression level of Lin28B usingting since previous studies have shown that the developmentally regulated RNA -binding protein, Lin28, selectively repressed the expression of let-7 microRNA [36]. [score:7]
Downregulation of Lin28B may upregulate let-7 family molecules. [score:7]
The expression of most let-7 miRNA family molecules was increased, especially let-7e and let-7i, which were upregulated 4 times and 12 times, respectively in dystrophic rat retinas. [score:6]
The expression of Lin28 was significantly increased in the retina of zebra fish after injury, which promoted Müller cells to proliferate and de-differentiate into retinal progenitors by negatively regulating the expression of microRNA let-7 [25, 26]. [score:6]
These data suggested that reduced expression of Lin28B may increase expression of the let-7 family in Müller cells from RCS-p+ rat retinas. [score:5]
Recently, it revealed that the let-7 family regulated posttranscriptional genetic circuits involved in the heterochronic pathway that regulated developmental timing and aging in C. elegans [48]. [score:4]
These data provide a point for further studies to uncover the underlying mechanisms of the Lin28B and let-7 signaling pathway mediated de-differentiation and proliferation of Müller cells with the ultimate aim of developing endogenous stem cells for regeneration and repair of retinal degenerative diseases. [score:3]
Considering the growing evidence implicates that miRNAs have a variety of effects on glia including development, differentiation, activation [45], as well as cell fate determination [46, 47], we performed microRNA array analysis of RCS rat retinas and found that let-7 miRNA family molecules seemed to have a strikingly different expression pattern in RCS-p+ rats compared with control rats. [score:3]
Figure 3(A) Relative quantitative analysis showed that most members of the let-7 family, except let-7a and let-7f at p15, were upregulated at p15 and p30 in RCS-p+ rats' retina compared with controls. [score:3]
MicroRNA let-7 was involved in cell differentiation and inhibited tumorigenesis. [score:3]
The deficiency of let-7 can stimulate DNA replication and cell division [27], so it suggested that let-7, miR-125, and miR-9 were the key regulators of retinal progenitor cells in the early to late developmental stages [28, 29]. [score:3]
The majority of the let-7 family was enriched and upregulated during the early stages of retinal degeneration, p15 and p30, in retina of RCS-p+ rats compared with controls. [score:3]
Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivo. [score:3]
Figure 5Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivo(A– B3) against GS (blue) and in situ hybridization with LNA let-7e or let-7i probes (red) at 2 weeks after subretinal space injection of Ad/Lin28B or Ad/GFP (green) in RCS-p+ rats. [score:3]
The prominent genes regulated by let-7 consist of those involved in executing cell-fate decisions, oncogenes and cell-cycle factors [47]. [score:2]
Recent studies have found that Lin28, miRNA -binding proteins, directly block the biogenesis of let-7 miRNAs post-transcriptionally by binding to the terminal loop region of the let-7 primary or precursor miRNAs (pri- or pre-miRNAs) of miRNAs in mammalian cells [36, 50– 53]. [score:2]
The major functions of the let-7 family include regulation of cell cycle progression and cell proliferation. [score:2]
The intrinsic timing mechanism that controls the developmental decline in neuronal regeneration depends on the progressive increase of let-7 in neurons [49]. [score:2]
Our results are in accordance with previous studies on zebrafish which demonstrated that Lin28 and let-7 were involved in the de-differentiation of Müller cells after retina injury [26]. [score:1]
[1 to 20 of 21 sentences]
9
[+] score: 85
In gastric epithelial cells, overexpression of let-7b attenuates NF-κB activity and then regulates downstream genes related to the inflammatory and immune responses by targeting TLR4 [44]. [score:6]
Furthermore, overexpression of let-7b could augment the regulatory functions of LPS pre-Exo or un-Exo, and inhibition of let-7b in the LPS pre-Exo group had exactly the reverse effect (Fig.   6; Additional file 2: Fig. S1). [score:6]
As a feed-forward loop, LPS pre-MSCs produced let-7b which directly regulates TLR4 expression to maintain a relative homeostasis. [score:5]
THP-1 cells were treated with LPS pre-Exo and transfected with the let-7b mimics, let-7b inhibitor or the AKT inhibitor, LY294002. [score:5]
Fig.  4Unsupervised hierarchical cluster analysis of miRNA expression in LPS pre-Exo uncovers let-7b as a regulator of TLR4 in macrophage polarization. [score:4]
We also found that the AKT inhibitor LY294002 prevented the effects of LPS pre-Exo on THP-1 cells (Fig.   6), further indicating that LPS pre-Exo mediate the modulation of macrophage polarization through let-7b via TLR4/NF-κB/STAT3/AKT regulatory signaling. [score:4]
Then let-7b was selectively packaged into exosome and transferred to macrophages, negatively regulate TLR4 expression and orchestrate macrophage plasticity, thus fine-tuning the inflammatory response and wound healing. [score:4]
Further investigation of the mechanisms that control let-7b expression demonstrated that a TLR4/NF-κB/STAT3/AKT regulatory signaling pathway plays a critical role in the regulation of macrophage plasticity. [score:3]
c Real-time RT-PCR analysis of let-7b expression in treated THP-1 cells at 48 h. Data are presented as the mean ± SEM of three separate experiments. [score:3]
Furthermore, we found let-7b has the highest expression level in the five unique miRNAs presented in LPS pre-Exo (Fig.   4b). [score:3]
These data indicated that let-7b is abundantly expressed in LPS pre-Exo, and performs its active function through TLR4 in the course of macrophage polarization. [score:3]
The let-7 family was the second miRNA family identified as a regulator of developmental timing and cell proliferation; however, it is becoming more apparent that they also mediate immune responses and adjust inflammation [41]. [score:3]
Moreover, LPS pre-Exo possessed an apparent advantage for the switch of macrophages to an M2-like profile in inflammatory conditions, and let-7b, distinctively shuttled by LPS pre-Exo, might participate in macrophage polarization by targeting TLR4 to better resolve inflammation and maintain tissue homeostasis. [score:3]
Furthermore, the exosome-specific let-7b released from LPS pre-MSCs can concomitantly activate feedback inhibitory mechanisms that restrain the magnitude of inflammatory responses to promote proper wound healing. [score:3]
Our results are in agreement with these studies, indicating that after LPS preconditioning, MSC-derived exosomes transfer let-7b to THP-1 cells and modulate their behavior through the inhibition of TLR4. [score:3]
Subsequently, we evidenced that THP-1 cells that took up LPS pre-Exo expressed significantly higher levels of let-7b and low levels of TLR4, but no significant changes in these two genes were observed in THP-1 cells taking up un-Exo (Fig.   4c, d). [score:3]
Remarkably owing to the entire restraint of STAT3 activation in presence of let-7b inhibitor, it is probably let-7b as a key trigger for STAT3 mediated transformation of LPS pre-Exo treated THP-1 cells. [score:3]
Moreover, TLR4 is by now one of the identified target genes of let-7b [41]. [score:3]
Taken together, we consider that TLR4/NF-κB/STAT3/AKT signaling is an essential pathway for the regulation of macrophage polarization and wound healing via LPS pre-Exo-shuttled let-7b. [score:2]
Given the essential role of the miRNA processing machinery in immune cell development, we revealed that LPS pre-MSCs may secrete exosomes that carry unique “marker signature” of let-7b by microarray analysis and contribute to how the macrophages reach a fully reprogrammed stage. [score:2]
Microarray analysis of LPS pre-Exo identified the unique expression of let-7b compared with un-Exo, and the let-7b/TLR4 pathway served as potential contributor to macrophage polarization and inflammatory ablation. [score:2]
Guo et al. have reported that let-7b, a member of the let-7 family, has differential expression patterns in inflamed tissues compared with healthy controls [43]. [score:2]
Using microarray analysis, we found that let-7b in LPS pre-Exo has dramatic effects on the regulation of macrophage plasticity to resolve chronic inflammation and enhance cutaneous wound healing. [score:2]
LPS pre-Exo may have improved regulatory abilities for macrophage polarization and resolution of chronic inflammation by shuttling let-7b, and these exosomes carry much immunotherapeutic potential for wound healing. [score:2]
Let-7b regulates macrophage polarization via TLR4/NF-κB/STAT3/AKT signaling. [score:1]
THP-1 cells were treated with un-Exo and transfected with the let-7b mimics. [score:1]
Among them, five miRNAs (let-7b, miR-1180, miR-183, miR-550b, and miR-133a) were only present in LPS pre-Exo. [score:1]
We further analyzed the molecular mechanism whereby let-7b transferred by LPS pre-Exo participates in macrophage plasticity. [score:1]
Pobezinsky et al. discovered that the let-7 miRNA is pivotal for the terminal differentiation and cytokine effector function of natural killer T cells [42]. [score:1]
LPS pre-Exo possessed an apparent advantage for the switch of macrophages to an M2-like profile in inflammatory conditions by shuttling let-7b, and these exosomes carry much immunotherapeutic potential for wound healing. [score:1]
[1 to 20 of 30 sentences]
10
[+] score: 78
Protein kinase B or Akt, a key protein involved in the activation of PI3K-Akt pathway and is crucial in promoting cell survivability [43], is inhibited by the key microRNAs (miR-22, miR-214, miR-125a-3p, miR-320 and let-7 family) that are down-regulated with the addition of IGF-1. Chen et al. reported that down-regulation of miR-133b significantly overexpressed Akt1 mRNA, which increased T24 bladder cancer cell proliferation and reduced cell apoptosis [44]. [score:11]
However, BMSC-derived NPCs with addition of IGF-1 showed 12 microRNAs which include miR-22, miR-1224, miR-125a-3p, miR-214, miR-320, miR-708 and miR-93 were consistently down-regulated and only miR-496 remained up-regulated compared to Group C from Day 1 to Day 5. The let-7 family (let-7b, let-7c, let-7d, let-7e and let-7i) were constantly down-regulated in both groups. [score:9]
The expression of let-7b was down-regulated on both Day 3 (Figure 3C) and Day 5 (Figure 3D) after induction whereas miR-181a and miR-26a remained up-regulated. [score:9]
Of these, let-7b was from the down-regulated list, and miR-26a and miR-181a were from the up-regulated list. [score:7]
The genes up-regulated by down-regulation of miR-22 (A); miR-125a-3p (B); let-7 family (C); miR-214 (D); and miR-320 (E) were analyzed using GeneMANIA web tool with default weighting method (i. e., weighting based to maximize connectivity between input genes). [score:7]
MicroRNAs Query Genes miR-22 Myc; Ets1; Tp53; Agt; Esr1; Pten; Akt1 miR-214 Bcl2; Adora1; Myc; Neurod1; Dhcr24; Kras; Fgfr1; Apc; pcgfr1; Prnp; Akt1 miR-125a-3p Bcl2; Egfr; Tp53; Apc; Akt1; Rela miR-320 Bcl2; Adora1; Acvr1; Neurod1; Dhcr24; Tp53; Hmox1; Nol3; Pten; Akt1; Cebpb Let-7 Family Cdkn1a; Tnf; Bcl2; Adora1; Egfr; Myc; Il10; Acvr1; Sycp3; Neurod1; Dhcr24; Cdkn1b; SMAD3; Kras; ras3; Neurod1Birc2; Tp53; Kcnh8; FN1; Fgfr1; Clu; Fas; Pten; Akt1; Rela; Cebpb We assessed the predicted target genes of the down-regulated microRNAs with the KEGG database. [score:6]
Besides, Cimadamore et al. reported that LIN28 binds to precursor let-7 microRNA and blocks the production of mature let-7i microRNAs, inhibiting neuronal differentiation by targeting MASH1 and NGN1 genes [25]. [score:5]
ijms-16-09693-t006_Table 6 Table 6Pathways of predicted target genes for down-regulated microRNAs in Group A, Group B and Let-7 Family. [score:5]
In Groups A and B, let-7 family microRNAs were observed to be consistently down-regulated. [score:4]
The qRT-PCR analysis confirmed that let-7b, miR-181a, and miR-26a were significantly up-regulated on Day 1 after differentiation (Figure 3B). [score:4]
This process suggests that the down-regulation of the let-7 microRNA family promotes cell proliferation during early neurogenesis. [score:4]
Query genes for individual microRNA are listed in Table 5. The major targeted genes by all or four out of five key microRNAs (miR-22, miR-214, miR-125a-3p, miR-320 and let-7 family) included Akt1, Tp53, Pten and Bcl2. [score:3]
Cimadamore F. Amador-Arjona A. Chen C. Huang C. T. Terskikh A. V. SOX2–LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors Proc. [score:2]
Additionally, the statistical significant pathways (FDR < 0.01) involving cell proliferation and survivability related to this study are listed in Table 6. The significance levels of the related pathways were compared with pathways targeted by specific let-7 microRNAs independently to exclude the possibility that those pathways are due to let-7 microRNAs alone. [score:2]
[1 to 20 of 14 sentences]
11
[+] score: 71
Suppressing let-7b expression by let-7b antagomir prevented decrease of IGF1R protein expression post-burn injury (Figure 3A, lane 3). [score:7]
Cumulatively, our results indicated that let-7b expression is upregulated in burn patients, comparatively more than miR-194. [score:6]
To confirm that the inhibition of PI3K/Akt-mTOR pathway is being mediated by increased let-7b levels targeting IGF1R, control or let-7b antagomir were injected through the tail vein of rat each day for 7 days before inducing burn injury. [score:5]
Cumulatively, this indicated that burn serum exposure can promote let-7b expression, which can attenuate IGF1R protein expression and PI3K/Akt signal pathway resulting in hyperglycemia. [score:5]
Immunofluorescence assay to detect relative expression of IRβ and IGF1R protein in anterior tibial muscle obtained from burn and sham rats at day 7. Impaired PI3K/Akt signaling in burn rats induced by high expression of let-7b. [score:4]
Cumulatively, this indicated that let-7b directly targets IGFIR in vivo and attenuates PI3K/Akt pathway resulting in hyperglycemia. [score:4]
To confirm that IGF1R is a bona-fide target within our experimental system, L6 myotubes treated with burn serum were transfected with renilla luciferase constructs harboring either wild-type or let-7b binding mutant (let-7b predicted sites deleted) IGF1R 3′UTR. [score:3]
However, on co-transfection of let-7b antagomir along with the luciferase reporter constructs expression from renilla reporters harboring either the wild-type or mutant IGF1R 3′UTR were comparable (Figure 4B). [score:3]
Expression of let-7b is induced post-burn injury. [score:3]
Real-time PCR analysis showed that let-7b was significantly up-regulated in burn patients (5.49 ± 2.06 folds) compared with healthy subjects (Figure 1B; p = 0.018) (P<0.05). [score:3]
MiR-194 expression was also higher in serum from burn patients (1.62 ± 0.27) (Figure 1B; p = 0.039) (P<0.05), but the changes were much more with let-7b than miR-194. [score:3]
Finally, we wanted to evaluate if serum from burn rats was capable to transfer the effect of let-7b expression on IGF1R protein expression in L6 cells. [score:3]
Our results indicate that increased let-7b suppressing IGF1R activation ultimately leads to inactivation of Gsk3β and concurrent activation of glycogen synthase leading to hyperglycemia. [score:3]
Our results show that the miRNA let-7b is robustly induced in burn injury and attenuates IGF1R protein expression and downstream activation of GSK3β that results in hyperglycemia. [score:3]
This proved that IGF1R is a bona-fide target of let-7b in the context of burn injury. [score:3]
Furthermore, the high expression of let-7b attenuated PI3K/Akt activation and Gsk3β activation, which was proved by using anti-let7b antagomir in vivo which de-repressed the aforementioned signaling pathways in the sham rats. [score:3]
To make the IGF1R 3′UTR mutant construct, site-directed mutagenesis was used to delete 99-105, 2619-2626, and 6661-6667 regions, corresponding to the predicted let-7b binding sites. [score:2]
Our results showed that the miRNA let-7b is robustly induced in both the 30% TBSA rat mo del of burn injury as well as in patients with burn injury. [score:1]
L6 myotubes (4 × 10 [4]), treated with serum from burn rats, were transiently transfected with wild-type and let-7b binding mutant of IGF1R luciferase vectors using Lipofectamine LTX (Life Technologies, Beijing, China) as per the manufacturer's instructions. [score:1]
Hence, we focused on let-7b in further experiments. [score:1]
Instead let-7b had three binding sites in the 3′UTR of IGF1R - 99-105 (P [CT] = 0.74), 2619-2626 (P [CT] = 0.93), 6661-6667 (P [CT] = 0.89) sites with higher probability of preferential conservation (Supplementary Figure 1). [score:1]
We assessed the levels of let-7b, let-7e, miR-194, miR-15, miR-133a, miR-15, and miR-195 (as a non-specific control) by real-time PCR. [score:1]
Importantly, let-7b antagomir restored levels of phosphorylated Akt at serine 473, phosphorylated Gsk3β at serine 9, and phosphorylated S6 kinase to levels comparable to the sham rats (Figure 3A, lanes 2 and 3). [score:1]
Where indicated, cells were co -transfected with let-7b antagomir. [score:1]
For six of the 9 rats in the burn group, let-7b antagomir or control antagomir (n=3 for each group) (ThermoFisher Scientific) was injected at 100 fmol/kg body weight through the tail vein post-anesthesia every day for 7 days before induction of burn injury. [score:1]
[1 to 20 of 25 sentences]
12
[+] score: 62
Consistent with obtained results of the five members of let-7expression profile in the different experimental group, by applying mirSVR online data base for their mRNA targets prediction, we uncovered COX-2 gene (NM_011198) as a target for the five members while let-7b only regulates the expression of iNOS (NM_012611) gene. [score:10]
Amongst them let-7 family miRNA that were reported to be broadly expressed across all differentiated tissues and their expression is tightly controlled during embryonic stem cells differentiation. [score:5]
It is clearly demonstrated that LPS -induced neurotoxicity suppresses let-7 family miRNAs expression, an effect that is ameliorated by co-administration of either cur or VPA. [score:5]
Recently, alteration of miR- let-7 members expression has also been reported in several other neurodegenerative diseases including schizophrenia, AD and addiction (Beveridge et al., 2010; Hollander et al., 2010; Santarelli et al., 2011; Wang et al., 2011). [score:5]
Evidently the distinguished pattern of let-7 five members’ expression in each group is directly correlated to the genetic remo deling activity that is exerted by LPS, Cur, or VPA. [score:4]
Also we are interested in studying the expression profiles of lethal-7 (let-7) miRNAs family members as signaling molecules in regulation of inflammatory enzymes cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS). [score:4]
miRNA let-7 family members are highly expressed in central nervous system and were shown to play crucial role in cell development and differentiation. [score:4]
Also we shed the light on the role of five let-7 family in VPA-Cur mediated mechanism of actions as novel therapeutic targets. [score:3]
FIGURE 7 Quantitative real time RT-PCR analyses of let-7 miRNAs family expression profile in different experimental groups. [score:3]
Interestingly we observed an overall altered expression profile in the five types of let-7 miRNAs in induced versus protected and treated rats. [score:3]
Therefore we analyzed the expression profile of five members of let-7 family (a, b, c, e, and f) in the different experimental groups. [score:3]
We provide strong evidence for meaningful changes in five let-7 members miRNA expression during induction, progression, and treatment with Cur and VPA as the most salient feature. [score:3]
MODULATION OF FIVE MEMBERS OF let-7 FAMILY miRNAs. [score:1]
The results show that let-7 a, b, and c were under detection level in LPS induced rats, an effect that was countered by either co-VPA or co-Cur incorporation (Figure 7). [score:1]
In our study, we screened in particular, five types of let-7 miRNAs family which are; let-7a, let-7b, let-7c, let-7e, and let-7f for possible modulation during the course of induction, protection, and treatment. [score:1]
Our work thus clearly indicates that miRNAs such as let-7 members deserve further functional exploration to deepen our understanding of molecular mechanisms driving not only neuroinflammation but also other neurodegenerative disorders. [score:1]
Co-administration of either Cur or VPA a particular differential expression was observed in all investigated members of let-7 miRNAs confirming their function as important players in neuro-protection. [score:1]
Treatment of induced rats with VPA or Cur alone did not induce let-7 a, b, and c in the same pattern as their combination did which indicate the synergistic effect VPA-Cur treatment. [score:1]
In our study we measured the alterations in the expression levels of five different types of let-7 miRNAs (Let-7 a, b, c, e, and f). [score:1]
group which confirms the implication of these let-7 members in self-healing mechanism. [score:1]
Evidently we observed significant elevations in let-7 a, c, and f in self-rec. [score:1]
Moreover VPA+Cur combination for treating induced rats significantly (* p < 0.01) induced the five members of let-7 family in comparison to LPS -induced rats. [score:1]
[1 to 20 of 22 sentences]
13
[+] score: 59
c Expression levels of Trim71 and effects of let-7 siRNA in control (C) and folate -deficient (MDD) H19-7 cells at 13 h after induction of differentiation (Si− = non -targeting siRNA, Si+ = let-7 -targeted siRNA). [score:7]
Belonging to the family of Trim-NHL ubiquitin ligases, Trim71 is highly expressed in undifferentiated cells, such as embryonic stem cells, but becomes rapidly downregulated upon differentiation, in response to the rise of let-7 levels [59]. [score:6]
For d and e: statistically significant difference with the respective control: * P < 0.05 and** P < 0.01; statistically significant difference between Si− and Si+: ° P < 0.05 (n = 5) Let-7 siRNA that repeatedly inhibited the expression of let-7a by >85 % after quantification by increased Trim71 levels in both control and folate -deficient H19-7 cells at 13 h after induction of their differentiation (Fig. 6c). [score:5]
Early Methyl Donor Deficiency Alters the Expression Pattern of a Wide Range of Genes Influenced by Let-7 and miR-34 and Involved in Various Aspects of Development. [score:4]
While it cannot fully prevent early-occurring NTDs such as spina bifida, maternal supplementation with folic acid during the period corresponding to the last trimester of pregnancy in women appeared to help preserve a normal development, at least partly through restoring let-7 and miR-34 normal expression. [score:4]
Among the subset of miRNAs known to be regulated by methylation [28], let-7 (lethal 7) and miR-34 are believed to exert a requisite role at various steps of cerebral development, while they would influence the occurrence of NTDs [27, 29]. [score:3]
Methyl Donor Deficiency Affects Protein Expression Levels of Known Downstream Pathways of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
a Expression levels of let-7 in arbitrary units (AU) in the midbrains of control (C) and deficient (MDD) rat embryos at E16 and E20, and effects of folic acid (B9) supplementation. [score:3]
Most importantly, folic acid supplementation helped restoring the levels of let-7 and miR-34 and their respective targets. [score:3]
Methyl Donor Deficiency Increases Expression Levels of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
Fig. 3Effects of methyl donor deficiency on the expression of let-7 and miR-34: influence of folic acid supplementation. [score:3]
Fig. 6Effects of methyl donor deficiency and folic acid supplementation on Trim71, a target of let-7. Consequences of silencing let-7a on differentiating H19-7 cells. [score:3]
Depending on the experimental mo dels used, it was reported that let-7a could act through various pathways involving the participation of transcription factors such as Abrupt, Sox2, Tlx, or cell cycle regulators such as CDK/Cyclin complexes [56, 57], contributing to the overall effect of let-7 on increasing the number of cells in the G1 phase of the cell cycle. [score:2]
In the present study, we chose to further investigate the well-established target of let-7, Trim71 (also called Lin41), which is required for embryonic development and proper neural tube closure [29, 58]. [score:2]
Taken together, our data therefore suggest that the alterations observed in let-7 and miR-34 pathways in response to methyl donor deficiency may participate to a disruption of the proliferation/differentiation balance, resulting in improper development of the central nervous system, and influencing the occurrence of NTDs. [score:2]
Statistically significant differences between MMD and MDD-B9: * P < 0.05, ** P < 0.01 We chose to investigate Trim71, which is a key effector of the let-7 microRNA pathway, that promotes cell proliferation and inhibits differentiation to control various developmental processes [45]. [score:2]
By using the microarray approach, the identification of new putative target genes affected in response to methyl donor deficiency via let-7 and miR-34 warrants further investigations. [score:1]
In order to identify further mechanisms underlying the effect of maternal B-vitamin status on neural tube and brain development, in line with potential epigenetic dysregulations, we investigated the participation of let-7 and miR-34 as well as their related pathways in the consequences of methyl donor deficiency both in vivo on a validated rat mo del of maternal deficiency [30, 31] and in vitro in hippocampal progenitors [32]. [score:1]
f Representative influence of let-7 siRNA on cell morphology at 13 h after induction of differentiation. [score:1]
Products of RT reaction (1.33 μL) were used in a real-time PCR reaction, which also included 10 μL of the TaqMan Universal Master Mix II, and 1 μL TaqMan miRNA assay containing the sequence-specific primers of either the target miRNA (let-7: UGAGGUAGUAGGUUGUAUAGUU, miR-34: UGGCAGUGUCUUAGCUGGUUGU) or the U6SnoRNA (CACGAATTTGCGTGTCATCCTT) used as an endogenous control for normalization. [score:1]
[1 to 20 of 20 sentences]
14
[+] score: 52
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These candidate miRNAs included representatives that exhibited regulated patterns of expression from each of the two primary classes detected, namely: those with highest expression in the caput (let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p), or highest expression in the cauda (miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:8]
This is consistent with current mo dels of let-7 function which indicate that the family members are barely detectable during embryonic development before being up-regulated in differentiated cells where they are likely to possess highly redundant roles through targeting of an overlapping set of mRNAs [33]. [score:7]
In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
0135605.g008 Fig 8In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
Similarly, dysregulation of let-7 leads to a less differentiated cellular state and the development of cell -based diseases such as cancer [51, 52]. [score:5]
It remains to be determined whether the 8 let-7 family members that are expressed in the epididymis have different activities or whether they collectively target a similar cohort of genes. [score:5]
In this context, qPCR confirmed highly significant down-regulation of let-7c-5p, let-7b-5p, miR-375-3p, miR-467d-3p, and miR-200c-3p between the proximal and distal epididymal segments. [score:4]
Nevertheless, it is tempting to speculate that the redundancy in let-7 expression may contribute to the stringent molecular mechanisms that help the epididymis evade tumorigenesis. [score:3]
Let-7 (lethal-7) is a founding member of the miRNA family that was originally described in Caenorhabditis elegans, where it controls the timing of terminal differentiation, acting as a key regulator of multiple genes required for exit from the cell cycle (reviewed by [33]). [score:2]
The role of let-7 in cell differentiation and cancer. [score:1]
The let-7 miRNA family has since been shown to display a remarkable level of sequence and functional conservation across the animal kingdom, with 14 and 13 different family members represented in mouse and human, respectively [33]. [score:1]
The let-7 family of microRNAs. [score:1]
Interestingly, among the conserved miRNAs found in all epididymal regions, we identified 8/14 and 4/7 members of the let-7 family (let-7a—let-7f, let-7i) and miR-30 (miR-30a— miR-30d) family, respectively. [score:1]
[1 to 20 of 13 sentences]
15
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
Interestingly, the expression abundance varies among the let-7 family members (Tables 1 and 2); let-7a and let-7j, each have 80 reads; similarly, let-7b, let-7c and let-7e have almost the same number of reads (63–64); let-7d, let-7f and let-7j have 18 to 32 reads; and let-7h, let-7i and let-7k have a lower number of reads (5–9) (Tables 1 and 2). [score:3]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
Hence the let-7 miRNA family is represented by 11 members, and this study provides the evidence for the expression of all 11 let-7 family members in pig. [score:3]
Here, we found evidence for the expression of all 10 let-7 members in pig. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
Similarly, let-7, miR-98, miR-16 and miR-130a are abundantly expressed in 13 of the 14 tissues (except in pancreas) (Figure 3A). [score:3]
let-7, miR-98, miR-130a and miR-16 showed uniform levels of expression in 13 different tissues but were hardly detected in pancreas (Figure 3A). [score:3]
The miR-98 sequence differs from that of the let-7 family by one nt at position 11 from the 5' end, thus miR-98 is also a member of the let-7 family. [score:1]
The let-7 family has 10 members in diverse animal species (miRBase). [score:1]
[1 to 20 of 10 sentences]
16
[+] score: 24
One of the important findings from the study by Ham and colleagues is that the let-7b suppresses autophagic activity in MSCs as shown by the fact that autophagy-related genes Atg5, 7, and 12 and beclin-1 were significantly downregulated in let-7b -overexpressed MSCs. [score:8]
Although Ham and colleagues reported that autophagic activity and the expression of autophagy-related genes were attenuated upon exogenous let-7b introduced into MSCs, it is still unclear how let-7b regulates autophagy and whether autophagy attenuated by let-7b is directly associated with MSC in vivo survival. [score:5]
Notably, the study by Ham and colleagues has revealed that delivery of let-7b -overexpressed MSCs markedly promotes neovascularization in the infarcted myocardium and functional recovery of damaged heart as assessed by significantly increased ejection fraction and cardiac output as well as approximately 10 % reduction of fibrotic area in the let-7b -overexpressed MSC delivery group as compared with control. [score:4]
Ham and colleagues have provided evidence that let-7b might promote cellular survival of MSCs both in vitro and in vivo presumably by preventing cell apoptosis and autophagy, thus enhancing cell survival in the treatment of ischemic heart disease. [score:3]
Recently in Stem Cell Research & Therapy, Ham and colleagues [1] reported that the microRNA let-7b can potently improve the survival of MSCs by inhibiting apoptosis-related caspase-3 and enhance ventricular function, microvessel density, and recovery of ischemic myocardial injury. [score:3]
Therefore, it will be an interesting question for further study to unravel the complex crosstalk among let-7b, cellular apoptosis, and autophagy in MSCs under specific conditions. [score:1]
[1 to 20 of 6 sentences]
17
[+] score: 24
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
All Let-7 family members are believed to have similar functions because they share a common seed region (nucleotides 2–8), which mediates interactions between miRNA and target mRNAs [25]. [score:3]
Among them, five members of the Let-7 family (mmu-let-7a, mmu-let-7b, mmu-let-7c, mmu-let-7f, and mmu-let-7i) were dysregulated in response to obesity and weight reduction following LFD feeding. [score:2]
Mice with global overexpression of Let-7 are viable, but they have reduced body size and weight [25]. [score:2]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
In mice, 12 genes encode members of the Let-7 family, which includes nine slightly different miRNAs (Let-7a, Let-c, and Let-7f [all encoded by two genes], and Let-7b, Let-7d, Let-7e, Let-7g, Let-7i, and miR-98 [all encoded by one gene]). [score:1]
Furthermore, Let-7 transgenic mice exhibit impaired glucose tolerance because of diminished glucose -induced insulin secretion, and anti-miR–induced silencing of Let-7 has been proven to improve blood glucose levels and insulin resistance in obese mice [25]. [score:1]
[1 to 20 of 8 sentences]
18
[+] score: 24
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Of the three ZT06 groups that illustrated differential expression of miRNAs due to CD, emphasis was placed on the two-week chronic ZT06 group due to the differential expression of miRs 146a and 146b, and miR-127 (Figures 5A-5B and 6A). [score:11]
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Differentially expressed miRNAs based on Illumina sequencing in all the circadian-disrupted samples and their links to breast cancer development and circadian rhythms. [score:10]
Within the 24-hour chronic ZT06 group, two miRNAs from the same gene family that are linked to breast cancer and circadian rhythms, let-7b and let-7c, were differentially expressed (Tables 1 and 2). [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 22
Tsp-let-7 showed very low expression in NBL stage, whereas tsp-miRNA-100 was detected in rather high abundance at the same development stage. [score:4]
Further, MiR-100 and let-7, the two conserved miRNA in metazoa, play a role in regulation of developmental timing [18], [42], [45]. [score:3]
First, the above miRNAs identified in sequencing were all amplified by qRT-PCR (Fig. 6A) and except the tsp-let-7 which was found less expressed in NBL, the qRT-PCR results were all consistent with the TPM values of sequencing results. [score:3]
The following forward primers were designed to confirm the sequencing results of miRNAs that showed differential expression patterns: tsp-miR-100 5′-AAC CCG TAG ATC CGA ACT TGT GT-3′; tsp-let-7 5′-TGA GGT AGT AGG TTG TAT AGT T-3′; tsp-miR-228 5′-AAT GGC ACT GGA TGA ATT CAC GG-3′; tsp-miR-1 5′-TGG AAT GTA AAG AAG TAT GTA G-3′; tsp-miR-31 5′-AGG CAA GAT GTT GGC ATA GCT GA-3′; tsp-novel-108 5′-CTT GGC ACT GTA AGA ATT CAC AGA-3′; tsp-novel-83 5′-TTG AGC AAT TTT GAT CGT AGC-3′; tsp-novel-46 5′-TGG ACG GCG AAT TAG TGG AAG-3′; tsp-novel-86 5′-TGA GAT CAC CGT GAA AGC CTT T-3′; tsp-novel-21 5′-TCA CCG GGT AAT AAT TCA CAG C-3′. [score:2]
The biological function of miRNAs was first demonstrated in C. elegans, where two miRNAs (Let-7 and Lin-4) were shown to be regulators for stage-specific differentiation of the worm [17], [18]. [score:2]
The oligonucleotide probes used for hybridization are as follows: tsp-mir-100 probes: 5′ACACAA*GTTC*GGATCT*AC*GGGTT3′ tsp-let-7 probes: 5′AACTAT*ACA*ACCT*ACT*ACCTCA3′ tsp-novel-108 probes: 5′TCT*GT*GAATTCTT*ACA*GTGCCAAG3′ tsp-novel-83 probes: 5′GCTAC*GATC*AA*AATT*GCTCAA3′ (LNA (Locked nucleic acid) substitutions are indicated by a “*”). [score:1]
0026448.t001 The sequencing data showed that, of the 21 conserved miRNAs, tsp-let-7 and tsp-miR-87 were found to locate only in the 3′ arm of their pre-miRNAs, and tsp-miR-31 was located only in the 5′ arm of the hairpin structures. [score:1]
Five conserved miRNAs (tsp-miR-228, tsp-miR-100, tsp-let-7, tsp-miR-1 and tsp-miR-31) and five novel miRNAs (tsp-novel-108, tsp-novel-83, tsp-novel-46, tsp-novel-86 and tsp-novel-21) with relatively higher TPM values identified by sequencing were validated by qRT-PCR and Northern blot. [score:1]
0026448.t001The sequencing data showed that, of the 21 conserved miRNAs, tsp-let-7 and tsp-miR-87 were found to locate only in the 3′ arm of their pre-miRNAs, and tsp-miR-31 was located only in the 5′ arm of the hairpin structures. [score:1]
The reason for tsp-let-7 being found less common in NBL is not known. [score:1]
The oligonucleotide probes used for hybridization are as follows: tsp-mir-100 probes: 5′ACACAA*GTTC*GGATCT*AC*GGGTT3′ tsp-let-7 probes: 5′AACTAT*ACA*ACCT*ACT*ACCTCA3′ tsp-novel-108 probes: 5′TCT*GT*GAATTCTT*ACA*GTGCCAAG3′ tsp-novel-83 probes: 5′GCTAC*GATC*AA*AATT*GCTCAA3′ (LNA (Locked nucleic acid) substitutions are indicated by a “*”). [score:1]
Their homologs, tsp-miRNA-100 and t sp-let-7, were found throughout the life cycle of T. spiralis. [score:1]
The abundance of tsp-miRNA-100 was almost identical with that of tsp-let-7 in both Ad and ML stage, indicating that miRNA-100 may be more functional in NBL stage. [score:1]
[1 to 20 of 13 sentences]
20
[+] score: 20
The TGFBR1 gene, which mediates the action of TGF-β, is a predicted target gene of the let-7/miR-98 family according to TargetScan 4.2 (containing conserved sites for let-7a-g and i, and for miR-98). [score:5]
A likely scenario, in the early stage, is that let-7 expressed higher and miR-21 level is lower, which inhibits TGF-β signaling that is necessary for lung regeneration. [score:5]
Taken together, the changes in let-7 and miR-21 expression level create an unopposed profibrotic balance in RILI development. [score:4]
Whereas in the late stage, let-7 expressed at a relatively low level and miR-21 level is higher, which may allow an enhanced TGF-β signaling activity that is necessary for lung fibrosis. [score:3]
Regulation of TGFBR1 by let-7 and SMAD7 by miR-21, which was suggested by our results, may further fine-tune the TGF-β signaling activity to the necessary level at each RILI developmental stage. [score:3]
[1 to 20 of 5 sentences]
21
[+] score: 20
Patel K Kollory A Takashima A Sarkar S Faller DV Ghosh SK MicroRNA let-7 downregulates STAT3 phosphorylation in pancreatic cancer cells by increasing SOCS3 expressionCancer Lett. [score:6]
Chen Z Wang D Gu C Liu X Pei W Li J Down-regulation of let-7 microRNA increased K-ras expression in lung damage induced by radonEnviron Toxicol Pharmacol. [score:6]
Moreover, let-7 expression also negatively correlated with the severity of PAH in patients with systemic scleroderma [19]. [score:3]
Sun T Fu M Bookout AL Kliewer SA Mangelsdorf DJ MicroRNA let-7 regulates 3 T3-L1 adipogenesisMol Endocrinol. [score:2]
Izumiya Y Jinnn M Kimura Y Wang Z Onoue Y Hanatani S Expression of Let-7 family microRNAs in skin correlates negatively with severity of pulmonary hypertension in patients with systemic sclerodermaIJC Heart & Vasculature. [score:2]
Bao MH Zhang YW Lou XY Cheng Y Zhou HH Protective effects of let-7a and let-7b on oxidized low-density lipoprotein induced endothelial cell injuriesPLoS One. [score:1]
[1 to 20 of 6 sentences]
22
[+] score: 19
In addition to regulating apoptosis by targeting caspase-3 [10], it was also demonstrated that let-7 family members regulate RAS and HMGA2 oncogene through the 3'UTR [53- 55]. [score:5]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
Let-7a, a member of the let-7 family, is associated with apoptosis by directly targeting caspase-3 [10]. [score:4]
In general, let-7 family members were upregulated at 3 days, and decreased at 8 days of differentiation. [score:4]
Let-7 was first identified in Caenorhabditis elegans and reported to control the timing of fate specification during larval development [11]. [score:1]
The let-7 family consists of eleven very closely related genes [51]. [score:1]
[1 to 20 of 6 sentences]
23
[+] score: 18
The most downregulated miRNA during EB formation was miR-let-7a, which is of interest because let-7 has been shown to regulate developmental timing in Caenorhabditis elegans [22]. [score:6]
RISC -mediated target RNA cleavage activity was determined by in vitro cleavage of a [32]P-target mRNA that perfectly matched the miR-302b or let-7 sequence. [score:5]
Fig 4A demonstrates the specific expression of miR-302b and let-7 in hES and HeLa cells, respectively. [score:3]
Conversely, let-7 RISC in HeLa extracts cleaved let-7 target RNA while hES RISC did not show detectable activity in this experiment. [score:3]
Since let-7a is abundant in HeLa, we selected let-7 as a control in our experiments. [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 18
Althogether these studies strongly suggest that an up-regulation of most, if not all, members of the let-7 and miR-7 families and of the miR-132/212 cluster marks hypothalamus development while miR-9, miR-124a, miR-145 and miR-219 displayed nucleus-specific regulations of expression. [score:8]
Let-7b, miR-124a and miR-9 displayed no expression differences in MPN between P15 and P30 while let-7a, miR-7, miR-132, miR-145 and miR-219 displayed up-regulations. [score:6]
Our data also established the up-regulation of all members of the let-7 and miR-7 gene families, as well as that of the four miRNAs encoded by the miR-132/212 cluster, i. e. miR-132-3p, miR-132-5p, miR-212-3p and miR-212-5p, when comparing stages P14 and P28. [score:4]
[1 to 20 of 3 sentences]
25
[+] score: 16
A strong decrease of let-7 expression levels has been associated with an aberrant overexpression of HMGA1 and HMGA2 in several human highly malignant carcinomas (58, 59). [score:5]
Moreover, HMGA2 overexpression correlated with low levels of let-7, a miRNA able to target and repress HMGA2, and with p53 (40). [score:5]
A more recent study confirmed that HMGA2 is highly expressed in metastatic lung adenocarcinoma, where it contributes to cancer progression and metastasis by acting as a competing endogenous RNA for let-7 miRNA family (47). [score:3]
Moreover, it is worthy to note that the 3′-UTR of HMGA2 carries as many as seven let-7 binding sites, then taking also part in the modulation of HMGA1 expression levels (47). [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 15
In our miRNA-analysis, let-7a, let 7c and let-7f had the greatest amount of experimentally verified target mRNAs among the dysregulated genes supporting the role of Let-7 family of miRNAs as a putatively important regulator of cardiac hypertrophic response through their gene target [59]. [score:7]
In addition, the analysis of regulatory pathways as well as miRNA-mRNA interactions predict that Nrf2 and IRF transcription factors as well as the let-7 family of miRNAs are playing roles in the regulation of mechanical stretch induced gene expression response in cardiomyocytes and these may help in elucidating the genes and regulatory pathways underlying cardiac hypertrophy. [score:6]
At present, little is known about the role of Let-7 family of miRNAs in stretched cardiomyocytes but analyses of mechanosensitive miRNAs associated with muscular dystrophies indicated that the let-7 family was dysregulated in mice with muscular dystrophies with myositis (mdm-mice) [61]. [score:2]
[1 to 20 of 3 sentences]
27
[+] score: 14
Although it has been reported that brain-specific miR-124, miR-125b and let-7 are expressed in mouse and rat eye lenses [27– 30], no studies have involved the spatial and temporal expression profiles of miRNAs in lens development and cataractogenesis. [score:6]
2XUp  let-7b poly (ADP-ribose) polymerase family, member 3, Glutaredoxin-2, Fibroblast growth factor 20 (FGF-20), FGF -binding protein 1, Multiple EGF-like domains 6 precursor, Hsp70 -binding protein 1, IGF2 mRNA -binding protein 3, Myc proto-oncogene protein (c-Myc), Hsp70 -binding protein 1 (HspBP1), FGF receptor activating protein 1, Tumor protein p53-inducible nuclear protein 1, Vimentin, Thioredoxin mitochondrial precursor (Mt-Trx)  let-7c poly (ADP-ribose) polymerase family, member 3, Vascular endothelial growth factor C precursor (VEGF-C), FGF-20, IGF2 mRNA -binding protein 3, Glutaredoxin-2, NF-kappa-B essential modulator (NEMO) (NF-kappa-B essential modifier), Hsp70 -binding protein 1, c-Myc, Heat shock factor 2-bindlng protein, AQP-2, Tumor protein p53-inducible nuclear protein 1, Vimentin, Mt-Trx  miR-29a Tropomyosin alpha-1 chain (Tropomyosin-1) (Alpha-tropomyosin), glutathione peroxidase 7, PDGF B-chain, Dicer1  miR-29c Tropomyosin-1, Dicer1, TGF-beta-2, glutathione peroxidase 7, PDGF A-chain, Multiple EGF-like domains 6 precursor, FGF receptor–activating protein 1, SMAD 6, AQP-11  miR-204* Tropomyosin-1, Hsp70 -binding protein 1, Mitogen-activated protein kinase 4, Gamma crystallin D, IGFBP-1, Glutathione S-transferase P (GST class-pi), Sulfiredoxin 1 To predict genes targeted by miRNAs, Sanger miBase Software was utilized. [score:3]
Relative expression levels of miRNAs, let-7b, let-7c, miR-29a, miR-29c, miR-204, miR-126, miR-451 in ED16, 4W and 14W lenses are represented as histograms with normalized averages ± SD. [score:3]
Levels of let-7b, let-7c, miR-29a, miR-29c and miR-204 were dramatically altered during the progression of development. [score:2]
[1 to 20 of 4 sentences]
28
[+] score: 13
Other miRNAs from this paper: rno-mir-340-1, rno-mir-142, rno-mir-144, rno-mir-153, rno-mir-340-2
There were 10 miRNAs that were consistently up−/down-regulated at least 1.5-fold at all five time points after TBI (Table 1), among which miR-142-3p, -144, -340-5p, -674-5p, -153, -186, -190, -132* and -138-1* were up-regulated, whereas let-7b was down-regulated. [score:10]
GO analysis of selected miRNAs (miR-142-3p, -144, -340-5p, -674-5p, -153, -186, -190, -132*, -138-1* and let-7b) revealed that many of their target genes are involved in biological processes and cellular functions that might be related to TBI pathophysiology. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 13
Among these miRNAs, Let-7 is involved in the airway inflammation by directly regulating IL-13 expression [51]. [score:5]
The down-regulated miRNAs included miR-24, miR-26a, miR-126, and Let-7 family members. [score:4]
We also found that Let-7 family was down-regulated in ARDS. [score:3]
Let-7 is also a regulator of apoptosis in tumors [44]. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 12
Once again the findings highlight the possibilities by which specific miRNAs instruct pathophysiological processes in fatty liver disease with miR-7-5p targeting suppressor of cytokine signalling SOCs and calveolin-1, i. e. an essential component of membrane lipid rafts with complex functions in cell signalling while the subnetwork of let-7b-5p involves translational control of the LDL receptor, hepatic lipoprotein lipase and SNAP23 that forms a complex with other vesicle -associated membrane protein and is part of the fusion machinery in macro-vesicular steatosis. [score:9]
Among the top 10 miRNAs is let-7b-5p known to influence translation of insulin receptor substrate 2 transcripts and this protein functions as an adaptor to link receptor tyrosine kinases with downstream effectors. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 11
BDNF regulates protein synthesis via let-7. BDNF stimulation upregulates Lin28, an RNA binding protein that can bind precursors of let-7, preventing them from being processed by the Dicer–TRBP machinery. [score:5]
The resulting diminished levels of mature let-7 miRNAs relieve repression of mRNAs with let-7 binding sites and permit their translation (32). [score:3]
In addition, let-7 regulates dendritic spine density along the length of neurons (33). [score:2]
Let-7 is involved in neurogenesis (30) as well as neuronal development and function (31). [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 11
Similarly, miR-195 (predicted to target BDNF), and let-7b and miR-98 (both predicted to target NGF) have been shown previously in human muscle to increase with aging [45], consistent with our analysis in VO rat muscle. [score:5]
Finally, TargetScan identified the following miRNAs that are conserved in humans as likely to influence NGF transcript levels: let-7b-5p and miR-98-5p and these miRNAs share a common seed sequence (CUACCUCA). [score:3]
MicroRNAs predicted to influence neurotrophins: a BDNF (miR-206-3p, miR-10a-5p, miR-1b, miR-195-5p and miR-497-5p), b NT3 (miR-21-5p, miR-222-3p and miR-221-3p), and c NGF (let-7b-5p and miR-98-5p) were quantified by qPCR analysis in YA (n = 8) vs VO (n = 10) rat vastus lateralis muscle and WT (n = 8) vs Sarco (n = 7) gastrocnemius muscle. [score:1]
Both let-7b-5p and miR-98-5p were increased significantly in VO rat muscle (Fig.   5c). [score:1]
Finally, for NGF, our analysis revealed an increase in both let-7b-5p and miR-98-5p in VO rat muscle. [score:1]
[1 to 20 of 5 sentences]
33
[+] score: 11
In endometriosis, the upregulation of H19 expression was shown to promote endometriotic stromal cell proliferation through the downregulation of let-7 to target IGF1R [12]. [score:11]
[1 to 20 of 1 sentences]
34
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, there were seven miRNAs that were only expressed at high levels in one neural tissue, for example let-7b, miR-16, miR-22, miR-206, and miR-143 specifically expressed in olfactory bulb (Fig. 3b). [score:5]
They demonstrated that there is a relationship between the expression profiles and the staged embryo temporal regulation of a large class of miRNAs, such as members of the let-7 family. [score:4]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 10
For example, rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p are most highly expressed in both HF and control group in our study, which was consistent with the previous studies that rno-miR-133, rno-miR-1 and rno-miR-499 are highly expressed in the heart[26], and miR-1, let-7 and miR-133 are highly expressed in the murine heart[27]. [score:7]
The most highly expressed miRNAs were rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p in both HF and control group. [score:3]
[1 to 20 of 2 sentences]
36
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Our previous studies demonstrated that an irreversible let-7 downregulation is a necessary step for MCS to display its full carcinogenic effect [98, 104]. [score:4]
Conversely, the let-7 irreversible downregulation is a hallmark of malignant lung cancer, including adenocarcinoma in mice [6, 102] and nonsmall cell lung cancer (NSCLC) in humans [103]. [score:4]
An important difference between benign and malignant lung lesions induced by MCS is the maintenance of let-7 homeostasis. [score:1]
The data obtained in the present study provide evidence that the let-7 family, whose a-f isoforms were spotted on the microarray used, was not altered in either microadenoma or adenoma. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
miRNA-target prediction showed that MRAK088388 and N4bp2 had the same MRE for miR-29b-3p, whereas MRAK081523 and Plxna4 had the same MRE for let-7. To identify the ceRNA interaction between MRAK088388 and N4bp2, as well as between MRAK081523 and Plxna4, we detected whether they are co-expressed in lung tissues by using qRT-PCR. [score:5]
Let-7 isoform let-7d expression significantly decreases and has a key regulatory function in IPF [46], but the function of let-7i has not been reported. [score:4]
By the same method, we found that MRAK081523 and Plxna4 had the same MREs for miR-218, miR-141, miR-98 and let-7. Plxna4 reportedly promotes tumour progression and tumour angiogenesis by enhancing VEGF and basic fibroblast growth factor signalling [44]. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 9
Experimentally, over -expression of let-7 can inhibit lung cancer cell growth in vitro. [score:5]
The reduction in the expression of let-7 in human lung cancers is correlated to increased death rates in patients [62]. [score:3]
This discovery shows that let-7 may have potential clinical value in treating lung cancers. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 9
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We speculate that some of the developmentally regulated microRNAs we describe in this report play roles in the control of mammalian brain development, possibly by controlling developmental timing, by analogy to the roles of the lin-4 and let-7 microRNAs in C. elegans. [score:5]
In C. elegans, lin-4 and let-7 act in developmental timing, and the microRNA lsy-6 controls neuronal asymmetry [19]. [score:2]
A second heterochronic gene, let-7, encodes another small non-coding RNA that is conserved in flies and mammals [5]. [score:1]
Like the lin-4 and let-7 genes, other microRNAs encode 21-25-nucleotide RNAs derived from longer transcripts that are predicted to form stem-loop structures. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 9
Inhibition of FGF signaling through SU5402 -treated primitive streak regions of chick embryos identified up-regulation of let-7b, miR-9, miR-19b, miR-107, miR-130b, miR-148a, miR-203, and miR-218 and down-regulation of miR-29a and miR-489 (Bobbs et al. 2012). [score:9]
[1 to 20 of 1 sentences]
41
[+] score: 9
The top pathways that were identified to be affected by the altered miRNA expression profile in the Cd -treated HepG2 cells were focal adhesion and the MAPK signaling pathway, and members of the let-7 miRNA family are known to serve a tumor suppressor role [58, 59]. [score:5]
Fabbri et al. treated HepG2 human hepatoma cells with 10 µM Cd for 24 h and reported decreased expression of 12 miRNAs, including members of the let-7 family (let-7a, let-7b, let-7e, and let-7g) and miR-455-3p [58]. [score:3]
Boyerinas B. Park S. M. Hau A. Murmann A. E. Peter M. E. The role of let-7 in cell differentiation and cancerEndocr. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 9
On the one hand, previous studies have suggested that let-7 can suppress the expression of MOR [43], and our previous results suggest miR-365 can modulate morphine tolerance by targeting the beta-arrestin 2 protein [11]. [score:7]
Among ncRNAs, some studies have reported that miRNAs are involved in the development of morphine tolerance [7, 8], including the let-7 family, miR-23b [9], miR-133b, miR-339 [10], miR-365 [11] and miR-219-5p [12]. [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 9
The unique miRNA expression patterns distinguishing the ASH group from the control group were composed of six downregulated (miR-199a-3p, miR-214, miR-93, miR-146a, miR-191 and let-7b) and six upregulated (miR-129, miR-490, miR-21, miR-503, miR-183 and miR-185) miRNAs. [score:9]
[1 to 20 of 1 sentences]
44
[+] score: 9
MicroRNA let-7 and its family members have been reported to participate in many diseases including kidney diseases. [score:5]
Also, let-7 family members regulated collagen expression in glomerular mesangial cells under diabetic conditions [20]. [score:4]
[1 to 20 of 2 sentences]
45
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
In breast cancer cells, over -expression of miR-221, miR-222, let-7 and miR-20b is associated with reduced of ERα protein content, signaling and expression of ERα target genes [47- 49]. [score:7]
These include rno-miR-195, rno-miR-125a-5p, rno-let-7a, rno-miR-16, rno-miR-30b-5p, rno-let-7c, rno-let-7b, rno-miR-125b-5p, rno-miR-221, rno-miR-222, rno-miR-26a, rno-miR-322, rno-miR-23a, rno-miR-191, rno-miR-30 family, rno-miR-21, rno-miR-126, rno-miR-23b, rno-miR-145 and rno-miR-494. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 8
Metformin treatment has been shown to inhibit c-myc expression by up -regulating let-7 family (tumor suppressor) [11]. [score:8]
[1 to 20 of 1 sentences]
47
[+] score: 7
All let-7 family members show anti-viral properties during flavivirus infection [34], and in human cell culture, let7-c targets IL-10 to reduce IL-10 expression levels [39]. [score:5]
Most have not been associated with virus infection; however three, miR-122, miR-324 and let-7, have been identified in studies of host responses to viruses [34– 36]. [score:1]
Let-7 family miRNAs have also been shown to have immunomodulatory function. [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 7
Because the target genes of let-7 (MOR) and miR-23b (MOR1) interact with the target gene of miR-365 (β-arrestin 2), we cannot rule out that there may be a relationship between these miRNAs and miR-365. [score:5]
Previous studies have reported that multiple miRNA -based pathways, such as let-7 and miR-23b, contributed to morphine tolerance 10 27, and some of these show the same deregulation pattern of miR-365. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 7
Our previous study has reported that after sciatic nerve injury, the differentially expressed let-7 miRNAs regulate SC phenotype by directly targeting NGF and affect sciatic nerve regeneration 20. [score:7]
[1 to 20 of 1 sentences]
50
[+] score: 7
Wang S Let-7/miR-98 regulate Fas and Fas -mediated apoptosisGenes Immun. [score:2]
Su J Chen P Johansson G Kuo ML Function and regulation of let-7 family microRNAsMicrorna. [score:2]
MiR-98 is one of the members of the let-7 miRNA family, which is first discovered to control the developmental timing of cell differentiation and proliferation in C. elegans 12, 13. [score:2]
Therefore, let-7/miR-98 miRNAs are considered as an oncomir family crucial in regulating cell cycle and apoptosis [15]. [score:1]
[1 to 20 of 4 sentences]
51
[+] score: 7
Both in silico analyses using a variety of prediction algorithms, as well a large body of experimental literature [35]– [42] indicated that Let-7 and miR1 target multiple components of the IGF signaling cascade, ranging from mRNA binding proteins that coordinate the translation of IGFs to members of the IGF family, their receptors and downstream signaling pathways. [score:5]
Our two presumptive IGF pathway interacting miRNAs, Let-7 and miR1 as well as our control, miR124, represent three members of a small family of five miRNAs that have been conserved throughout bilaterian evolution (from invertebrates to mammals) [47], and the functions of the Let7 family, in particular, exhibit strong evolutionary conservation [43]. [score:1]
J Cell Mol Med 43 Roush S Slack FJ 2008 The let-7 family of microRNAs. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 7
When the signal density of miRs was cut off by a value of 100, a group of 13 miRs were significantly up-regulated including miR-210, -25, -450a, -130a, -3593-3p, -34c*, -214, -181a, -23b, -34a, -31, -31*, and -140*; whereas 20 miRs (miR-377, -146a, -222, -652*, -466b-1*, -664-1*, -196c*, -466c*, -29c, -32*, -195, -466b, -188, -146b, -92a, let-7b, -466b-2*, -466d, -485*, and -181c) were significantly down-regulated in MSCs under hypoxic conditions. [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 7
Interestingly, a recent study demonstrated that loss of let-7 up-regulates EZH2 in prostate cancer with the acquisition of cancer stem cell signatures [60], suggesting that let-7 functions to promote cell differentiation through repression of EZH2 in prostate cancer. [score:4]
For example, many target genes of miRNAs let-7, mir-1, and mir-145 were hypermethylated in cells cultured under AR-inducing conditions for 3 days compared to 1 day (Table S6), suggesting a promoting role of these microRNAs in secretory differentiation of prostatic epithelial cells. [score:2]
Our results indicate that let-7 may play a similar role in normal prostatic epithelial cells. [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 7
miR-448, let-7b, miR-540, miR-296, miR-880, miR-200a, miR-500, miR-10b, miR-336, miR-30d, miR-208, let-7e, miR-142-5p, miR-874, miR-375, miR-879, miR-501, and miR-188 were upregulated, while miR-301b, miR-134, and miR-652 were downregulated in TMH group (Table 5). [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 6
Frost and Olson (24) demonstrated that both global and pancreas-specific overexpression of let-7 in mice resulted in impaired glucose tolerance and reduced glucose -induced pancreatic insulin secretion. [score:3]
Inhibition of the let-7 family prevents impaired glucose tolerance in mice with diet -induced obesity, partially by improving insulin sensitivity in the liver and muscle (24). [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 6
Prominent among this group were miRNAs that are enriched in neurons and associated with developmental regulation (let-7i, let-7f, let-7b, miR-98), cell cycle regulation (miR-137, mIR-128) and neural activity (miR-132, miR-212). [score:4]
Mir-98 is a member of the let-7 family, highly conserved across species in sequence and function and involved in the developmental timing of cell fates (reviewed [40]). [score:2]
[1 to 20 of 2 sentences]
57
[+] score: 6
A number of miRNAs are expressed at high intensities throughout the perinatal period, but are not regulated from E20 to P2 (listed with decreasing expression level: miR-298, -494, -292-5p, -503, -290, -320, let-7c, -327, -185, let-7b and let-7a). [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
27, 28 Kallen et al. [29] reported that the increased expression of paternally imprinted H19 lncRNA may act as a sponge for let-7, thereby explaining the downregulation of this miRNA in non-small-cell lung cancer types. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
On the other hand, corresponding ethanol effects in the ventral striatum revolved around cell death processes with inhibition of RNAs including MAP3K2 and upregulation of RNAs like let-7 (Figure 5, left). [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 5
As positive controls, differentiation miRNA let-7 showed lower expression while miR-17 showed higher expression in c-kit(+) progenitors (Figure 1E). [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
It was found to be a putative target for let-7 family members, miR-26ab, miR-181 family, miR-150, miR-27b, miR-23ab, miR-425, miR-125a-5p, and miR-128ab. [score:3]
According to our in silico analysis, Ppar γ is likely regulated by microRNAs like let-7 family members, miR-30 family members, miR-27b, miR-23ab, miR-93, miR-25, miR-128ab, miR-320, and miR-135. [score:2]
[1 to 20 of 2 sentences]
62
[+] score: 5
In the PH-group, 49 miRNAs were significantly deregulated (e. g., rno-miR-26a/b, rno-miR-125b-5p and various members of the let-7 family), showing an expression change to at least ≤ 0.8 or ≥ 1.2 compared to normal healthy liver [6], while 45 miRNAs showed significant expression changes in liver samples of animals undergoing SL (Table 1). [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
Given that let-7 family members are normally ascribed a tumor suppressor function, the authors speculated that a high let-7a/low miR-206 ‘signature’ might designate colon tumors with a unique phenotype in terms of cancer progression, compartmentalization, or microenvironment [33]. [score:3]
Loss of let-7a, and of other let-7 family members, coincided with changes in other high-abundance miRNAs in the heterocyclic amine -induced rat colon tumors examined here [24]. [score:1]
In a recent investigation of carcinogen -induced rat colon tumors [24], we identified a loss of multiple let-7 family members coinciding with increased expression of miRNA -binding proteins Lin28A/Lin28B, as well as the stem-cell factors c-Myc, Sox2, Oct-3/4, and NANOG. [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 5
For example, Let-7 binds to 3′-UTR of MOR to repress its expression [12]. [score:2]
In a previous study, we demonstrated the deregulation of nine different miRNAs in rat spinal cord after chronic morphine injection, including let-7, miR-365 and miR-219-5p (miR-219) [4]. [score:2]
In addition to let-7 and miR-23b, other miRNAs involved in morphine tolerance include miR-124, miR-190, miR-103 and miR-93-5p [14– 17]. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 5
These comparisons revealed that the highly expressed miRNAs from our study were also reported in the study by Timo Brandenburger et al. [20]; they showed that miR-124, the let-7 family and miR-34b-3p belonged to the group of highly expressed miRNAs in the rat spinal cord. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 4
For example, evidence indicate that let-7, miR-140 and miR-92a are crucial for skeletal development [4– 5]; and deficiency of these miRNAs suppress the proliferation as well as the differentiation of growth plate chondrocytes, leading to a dramatic growth defect [4– 5]. [score:4]
[1 to 20 of 1 sentences]
67
[+] score: 4
Recent studies have partially verified this hypothesis; e. g., let-7 miRNA expression can be observed in ESC and progenitor cells, but is absent in breast cancer stem cells. [score:3]
The reintroduction of let-7 into these cells causes differentiation and reduction of proliferation and tumor-forming ability. [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 4
Worringer KA Rand TA Hayashi Y Sami S Takahashi K Tanabe K The let-7/LIN-41 pathway regulates reprogramming to human induced pluripotent stem cells by controlling expression of prodifferentiation genesCell Stem Cell. [score:4]
[1 to 20 of 1 sentences]
69
[+] score: 4
Following 10 days of bedrest, 15 miRs were downregulated in biopsies from the vastus lateralis, including miR-23a and miR-206, and let-7 family members [13]. [score:4]
[1 to 20 of 1 sentences]
70
[+] score: 4
And 17 miRNAs are downregulated as shown in the lower part of this figure, let-7d, miR-665, miR-125b*, let-7b*, miR-124*, miR-770, miR-383, miR-29b-2*, miR-760-3p, miR-324-3p, miR-135b, miR-21, miR-409-5p, let-7f-1*, miR-28, miR-499*,let-7i* (Table 2). [score:4]
[1 to 20 of 1 sentences]
71
[+] score: 3
A previous study demonstrates that signal transducers and activators of transcription 3 (STAT3)-coordinated Lin-28-let-7-HMGA2 and miR-200-ZEB1 circuits initiate and maintain oncostatin M -driven EMT 5. The interplay of these EMT activators, such as HMGA2 and ZEB1 6– 8, represses E-cadherin expression. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Qian P et al also observed that the p44/42 MAPK-matrix metalloproteinase (MMP)-2/MMP-9 pathway can be used to enhance mammary carcinoma cell migration and invasion consequent to let-7 g depletion by increasing the expression of Gab2 and fibronectin1 (40). [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
Okoye et al. have recently documented that murine CD4 [+]CD25 [+]Foxp3 [+]Treg release miRNA-containing exosomes, that transfer Let-7b, Let-7d and miR-155 into Th1 cells, contributing to suppressing Th1 activation and inflammation in murine colitis [10]. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
Guo WT Wang XW Yan YL Li YP Yin X Zhang Q Suppression of epithelial-mesenchymal transition and apoptotic pathways by miR-294/302 family synergistically blocks let-7 -induced silencing of self-renewal in embryonic stem cellsCell Death Differ. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
Other miRNAs shown to regulate neuronal lineage commitment include members of the let-7 family and miR-125b (Leucht et al., 2008; Rybak et al., 2008). [score:2]
A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 3
Let-7 miRNA have been predicted or experimentally confirmed in a wide range of species including human to C. elegans. [score:1]
The hsa-miR-mit-2 has three matches with let-7 human miRNA, that is, hsa-let-7i, hsa-let-7b, and hsa-let-7g. [score:1]
The miRNA let-7 family was well represented. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 3
Four of the 18 novel miRNAs were among the 50 most highly expressed miRNAs in the rat DRG (mmu-miR-486-5p, rnoH-miR-148a-3p, rnoH-let-7 g and rnoH-miR-676-3p, set in italics in Additional file 1: Table S1). [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Other miRNAs that were abundantly expressed after FNS include the let-7 family members. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
The let-7 family of miRNAs, which is functionally conserved from worms to humans, is important to normal development and differentiation and has been reported to be deregulated in various cancers (reviewed by Boyerinas et al. 2010). [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Other miRNAs predicted to target Mtpn include miR-124a and let-7b [33]. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
Members of the let-7 family of miRNAs (7a, 7c, 7f, and 7b) exhibit the highest expression levels throughout the life span. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
2) Some miRNAs, including let-7 family (let-a, -b and -c), miR-16, miR-23b, miR-26, miR-31 and miR-375, were always highly expressed either before or after transdifferentiation (data not shown). [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Many of the best-studied miRNAs contained TFBS (e. g., mir-200a, b, c; mir-125a; let-7b), including those that have wide tissue expression patterns (e. g. mir-16-2) and others enriched in specific organs such as brain (mir-124-1,2) or liver (mir-122) [7]. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 2
Li S Let-7 microRNAs regenerate peripheral nerve regeneration by targeting nerve growth factorMol. [score:2]
[1 to 20 of 1 sentences]
85
[+] score: 2
For example, miR-let-7b may directly activate nociceptive nerve fibers and elicit pain via TLR7 and TRPA1 [23]. [score:2]
[1 to 20 of 1 sentences]
86
[+] score: 2
In cancer cells, miR-326 [17], miR-34a [18], miR-206 [19], let-7 [35] have been shown to regulate the Notch signaling pathway. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
Several candidate therapeutic miRNAs have progressed into clinical and preclinical development; for example, antisense miR-122 is being developed as a treatment for hepatitis C virus, miR-208/499 for chronic heart failure, miR-195 for myocardial infarction and miR-34 and let-7 for cancer 10, 11. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
Numerous miRNAs have been identified in nearly all metazoan genomes examined since the discovery of the two first miRNAs, lin-4 and let-7 [12, 15, 16], and many studies have reported that miRNAs can influence hormone regulation. [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 2
The miRNA family, let-7i and let-7 have been found to regulate the key features of breast cancer stem cells like a self-renewal, multipotent differentiation and tumorigenicity [29]. [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
16.5 fmol (equivalent to 1*10 [9] copies) of synthetic miRNAs (Let-7a, Let-7b, Let-7c, Let-7d, Let-7e and Let-7f) were spiked into 50 ng of yeast RNA. [score:1]
Top and middle panels; Two members of the Let-7 family (Let-7a and Let-7e) were spiked into yeast total RNA and 10 ng of yeast total RNA containing 2*10 [8] copies of the selected miRNA (or 3.3 fmol) were reversed transcribed using the miQPCR. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 1
The first two miRNAs, lin-4 and let-7, were discovered in the Caenorhabditis elegans [13], [14]. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
Recently, some miRNAs in the nucleus accumbens have been reported to be involved in behavioral changes in cocaine CPP, such as miR-181a, miR-124 and let-7b [7, 8]. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
We found four microRNAs (LET-7, MIR-100, MIR-125, and MIR-126) that could detect teratomas and had previously been associated with oncogenic transformations (Gu et al., 2015, Wu et al., 2015). [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Circulating let-7 levels in plasma and extracellular vesicles correlate with hepatic fibrosis progression in chronic hepatitis c. Hepatology 64, 732– 745. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
In the 3′UTR sequences of the collagen-1 and collagen-4 mRNA, potential binding sites for the members of the let-7 family were detected. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
Kallen AN The imprinted h19 lncrna antagonizes let-7 micrornasMol. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
lin-4 and let-7 miRNAs are the apparent exceptions to the generic scheme [7]. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
For example, the miR-125 and let-7 microRNAs are dramatically induced at puparium formation, in tight temporal synchrony with the 20E primary-response E74A mRNA, but do so in a manner that is independent of either 20E or EcR [24]. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Other miRNAs from this paper: rno-mir-21, rno-mir-30a, rno-mir-126a, rno-mir-126b, rno-mir-155
Circulating miR-30a, miR-126 and let-7b as biomarker for ischemic stroke in humans. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Recent research showed that hypothalamus let-7, miR-148a, miR-124, miR-107 and miR-370 were confirmed to be related to EA tolerance (Cui et al., 2017). [score:1]
[1 to 20 of 1 sentences]