sort by

97 publications mentioning rno-let-7e

Open access articles that are associated with the species Rattus norvegicus and mention the gene name let-7e. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 297
We further verified that let-7a, c, d, e, and i were down-regulated in the acute ischemic tissue and forced overexpression of let-7e inhibited β [1]-AR expression and knockdown of this miRNA by AMO-let-7e increased β [1]-AR expression in neonatal rat cardiomyocytes. [score:13]
In this study, we, for the first time, displayed the involvement of let-7, a conserved and abundant miRNA in the heart [30], in the up-regulation of β [1]-AR in AMI in rats, which provides new insight into the mechanisms for regulation of β [1]-AR expression and overexpression of miRNA let-7e potentially inhibited AMI -induced arrhythmia in rat. [score:11]
Taken together, it is plausible that deregulation or, specifically, down-regulation of let-7e contributes to the adverse increase in β [1]-AR expression and let-7e supplement shows a potential anti-arrhythmic effect in ischemic heart, which may be a new therapeutic approach for preventing adverse β [1]-AR up-regulation and treating ischemic arrhythmia. [score:10]
On the basis of these data, one would expect that down-regulation of let-7 should also influence expression of β [2]-AR in addition to up-regulation of β [1]-AR. [score:9]
However, let-7e did not inhibit the mRNA level of ADRB1 gene, indicating that let-7e regulates β [1]-AR expression by disrupting mRNA translation, not by degrading the mRNA. [score:8]
Up-regulation of β [1]-AR and down-regulation of let-7 in infarcted heartsWe first compared the expression levels of β [1]-AR between the infarcted and non-infarcted LV tissues in a rat mo del of AMI. [score:8]
Fig. 1Up-regulation of β [1]-AR and down-regulation of let-7 in rat mo dels of acute myocardial infarction (AMI). [score:7]
Overexpression of let-7e significantly inhibited β [1]-AR expression. [score:7]
Up-regulation of β [1]-AR and down-regulation of let-7 in infarcted hearts. [score:7]
First, our data revealed that let-7 was significantly down-regulated, along with selectively increase in β [1]-AR expression, in the infarcted area of LV tissue. [score:6]
let-7e inhibits up-regulation of β [1]-AR in ischaemic heart. [score:6]
let-7e exerted its beneficial effect mainly through inhibiting the up-regulated β [1]-AR induced by ischemia. [score:6]
Third, we demonstrated that let-7e replacement could ameliorate the abnormal up-regulation of β [1]-AR expression in AMI. [score:6]
Regulation of β [1]-AR by let-7 in cardiomyocytes in vitroThe reciprocal alterations of β [1]-AR and let-7 in terms of their expression in AMI suggest a targeting relationship between them. [score:6]
As expected, all three miRNAs significantly inhibited luciferase activity, indicating that ADRB1 3′UTR is direct target of let-7 family. [score:6]
The reciprocal alterations of β [1]-AR and let-7 in terms of their expression in AMI suggest a targeting relationship between them. [score:5]
Notably, len-AMO-let-7e caused an overshoot of β [1]-AR expression relative to the baseline control level, strongly suggesting that this cardiac-enriched miRNA exerts important tonic inhibition of β [1]-AR in the heart. [score:5]
3 † HR, heart rate; EF, ejection fraction; FS, shortening fraction; Len-pre-let-7e, lentivirus vector carrying the precursor let-7e; Len-AMO-let-7e, lentivirus vector was enabled to express anti-miRNA-oligo of let-7e (AMO-let-7e); Len-NC was enabled to express the scramble of let-7e. [score:5]
To exploit this notion, we performed miRNA gene target prediction using TargetScan 6.0 database, and we indeed identified a binding site in the 3′UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Fig. 2A). [score:5]
Fig. 2Predicted seed -binding sites of let-7 in β [1]-AR 3′UTR and verification of β [1]-AR as a target for let-7. (A) Alignment of the sequences of let-7 family (bottom) with their target sites in the 3′UTRs of human, rat and mouse β [1]-AR mRNA (top). [score:5]
We also measured miR-1 expression in the tissue with the same treatments and found no difference in miR-1 expression among the groups, indicating that the observed changes of let-7e expression were specifically elicited by the lentivirus vector carrying the pre-let-7e or AMO-let-7e (Fig. 4A). [score:5]
As shown in Figure 4B, β [1]-AR expression was significantly down-regulated in the injected area of the heart in the len-pre-let-7e group, compared with control group. [score:5]
let-7e inhibits up-regulation of β [1]-AR in ischaemic heartTo investigate the regulation of β [1]-AR by let-7e in the infarcted rats, lentivirus vectors containing pre-let-7e, AMO-let-7e or a scrambled sequence were injected into the LV wall at five points within the expected infarct area 7 days prior to AMI. [score:5]
In silico prediction with Targetscan and miRanda showed that ADRB1 is a target of let-7; the seed sequence is conserved among species, such as rat, mouse and human beings. [score:5]
Importantly in vivo study, we demonstrated that β [1]-AR expression was regulated by let-7e via locally applying this miRNA to rat heart. [score:4]
On the other hand, AMO-let-7e, a specific inhibitor for let-7e, reduced the let-7e level to below the baseline control level, indicating a knockdown of both exogenous and endogenous let-7e. [score:4]
Indicating that miRNA let-7e decreased the up-regulation of β [1]-AR in AMI rats. [score:4]
Our study reveals a new mechanism of β [1]-AR regulated by let-7e and find that let-7e exerts a potential antiarrhythmic effect by targeting β [1]-AR in AMI rats. [score:4]
Clearly, mechanisms other than let-7 may also participate in the regulation of β [2]-AR expression in the heart. [score:4]
These results established let-7e as a regulator of β [1]-AR expression in rat heart. [score:4]
We then studied the expression of let-7, a cardiac-enriched miRNA, in the infarcted rat heart with miRCURY Array microarray version 11.0 containing 349 mature rat miRNAs. [score:3]
Targetscan predicts the presence of a putative binding site for let-7 in the 3′UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:3]
This indicates that targeting miRNA let-7e may be a promising therapeutic strategy for modulating β [1]-AR. [score:3]
The expression of β [1]-AR at mRNA level was unaffected by let-7e and AMO-let-7e (Fig. 3C). [score:3]
Negative control of let-7e did not show any effect on β [1]-AR expression (Fig. 3B). [score:3]
However, we definitely could not rule out other molecular targets of let-7, which are involved in its antiarrhythmic effect in the rats with AMI. [score:3]
Len-AMO-let-7e alone did not significantly affect the ischemic β [1]-AR overexpression. [score:3]
Lentivirus vectors expressing mature let-7e, anti-miRNA-oligo of let-7e (AMO-let-7e) or NC sequence were constructed by Invitrogen (Invitrogen). [score:3]
let-7e might be a promising target for intervention of β [1]-AR in the pathological condition, and let-7e supplement may be a new therapeutic approach for preventing and treating ischaemia -induced arrhythmia. [score:3]
AMO-let-7e resulted in a higher β [1]-AR protein level than the control group, indicating a relief of tonic inhibition of β [1]-AR by endogenous let-7e in NRVCs. [score:3]
The NC had no effect on let-7e expression (Fig. 3A). [score:3]
Second, we experimentally established β [1]-AR as a target gene for the members of the let-7 family. [score:3]
While the len-AMO-let-7e application caused conspicuous increase in β [1]-AR beyond the control level, presumably as a result of inhibition of the receptor by endogenous let-7e. [score:3]
Similarly, let-7a expression decreased by 41.6%±3.8%, let-7c by 31.6%±2.9%, let-7d by 28.6%±5.7%, let-7e by 39.2%±5.5% and let-7i by 51.3%±10.3% after 24 hrs of AMI (Fig. 1D). [score:3]
Len-NC did not exert any effects on β [1]-AR expression and len-pre-let-7e had no effect on β [1]-AR mRNA level (Fig. 4C). [score:3]
let-7a expression decreased by 44.6%±1.3%, let-7c by 21.1%±1.5%, let-7d by 69.3%±9.3%, let-7e by 36.2%±10.9% and let-7i by 46.9%±2.9% in the infarcted area of rat heart with 6hrs of AMI (Fig. 1D). [score:3]
Of note, len-let-7e profoundly mitigated AMI (6 hrs) -induced β [1]-AR overexpression, and which was abolished by co -treated with len-AMO-let-7e (Fig. 5). [score:3]
Study also demonstrated that the let-7 family shares the same downstream targets in human embryonic stem cells [40]. [score:3]
And finally, let-7e application markedly inhibited arrhythmia incidence in AMI rats. [score:3]
Len-NC had no effect on let-7e expression (Fig. 4A). [score:3]
Fig. 5Effects of let-7e on expression of β [1]-AR in ischaemic myocardium in a rat mo del of AMI. [score:3]
Fig. 6Inhibition of AMI -induced arrhythmia by Let-7e. [score:2]
Construction of plasmid carrying the 3′UTR of β [1]-adrenergic receptor (ADRB1) and luciferase assayTargetscan predicts the presence of a putative binding site for let-7 in the 3′UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:2]
Regulation of β [1]-AR by let-7e in vivo. [score:2]
Fig. 4Regulation of β [1]-AR by let-7e in vivo. [score:2]
Regulation of β [1]-AR by let-7 in cardiomyocytes in vitro. [score:2]
We also demonstrated that β [1]-AR is a target gene for let-7 revealed by luciferase reporter assay and analysis. [score:2]
The results from let-7e are most likely applicable to other members of the let-7 family based on their same mechanism of action conferred by their same seed site. [score:1]
These data indicate that let-7e has high antiarrhythmic efficacy, which is similar to classic β-blockers. [score:1]
Notably, len-pre-let-7e infection showed a significant reduction in arrhythmia score from 3.3 ± 0.4 for AMI to 1.7 ± 0.4 (P < 0.05). [score:1]
All these data indicate the specificity of let-7 action on ADRB1 3′UTR (Fig. 2B and C). [score:1]
A segment containing the let-7 miRNA binding sites flanked by the Hand lll and Sac I restriction sites and a scramble sequence as a negative control (NC) were synthesized by Invitrogen. [score:1]
Consistent with arrhythmia score results, len-pre-let-7e significantly reduced occurrence of PVCs from 30.7 ± 3.5 to 16.2 ± 5.7 (P < 0.05; Fig. S1A), and decreased episodes of VT from 21.8 ± 7.2 to 3.0 ± 1.4 (P < 0.05; Fig. S1B), and reduced episodes of NVF from 0.4 ± 0.2 to 0.0 ± 0.0 (Fig. S1C) in the AMI rats. [score:1]
Len-AMO-let-7e enhanced EF from 67.9 ± 1.4 to 81.4 ± 2.3 (P < 0.05) and FS from 46.8 ± 5.5 to 56.0 ± 5.2 (P < 0.05). [score:1]
Electrocardiography recording was performed after ligation of left coronary artery of rat subjected to the pre-treatments with len-pre-let-7e, len-AMO-let-7e or β [1]-AR blocker 7 days ago. [score:1]
Echocardiogram was performed on rats 7 days after treatments with len-pre-let-7e, len-AMO-let-7e or len-NC. [score:1]
More importantly, our study also showed that let-7e presented a potential antiarrhythmic efficacy in AMI rats as β-AR blocker did. [score:1]
The protein level of β [1]-AR in the ischaemia tissue (6 hrs of ischaemia) pre -treated with len-let-7e, len-AMO-let-7e, len-NC and saline for sham group for 7 days. [score:1]
Briefly, the precursor sequence of let-7e and its antisense fragment were synthesized by Invitrogen. [score:1]
However, in AMI rats, len-pre-let-7e reduced cardiac function but not affected HR. [score:1]
A variety of studies have demonstrated that let-7, an abundant and conserved miRNA, participates in various pathophysiological processes, such as cancer growth and formation [37] and axon regeneration [38]. [score:1]
These may suggest that local intramuscular injection of let-7e to LV wall is unable to affect β [1]-AR level in the sinoatrial node that controls HR. [score:1]
These data indicate that local application of let-7e appears not sufficient to make significant effects on the cardiac function and HR. [score:1]
Construction of HIV-1 -based lentivirus carrying pre-let-7e. [score:1]
The most important finding is that len-pre-let-7e significantly lowered the incidence of arrhythmia induced by AMI in rats; as expected, len-AMO-let-7e increased the incidence of AMI -induced arrhythmia. [score:1]
Figure S1 Alleviative effect of let-7e on the occurrence of PVCs, VT and NVF induced by acute myocardial infarction. [score:1]
let-7c: 5′-UGAGGUAGUAGGUUGUAUGGUU-3′; AMO-let-7c: 5′-AACCAUACAACCUACUACCUCA-3′; let-7d: 5′-AGAGGUAGUAGGUUGCAUAGUU-3′; AMO-let-7d: 5′-AACUAUGCAACCUACUACCUCU-3′; let-7e: UGAGGUAGGAGGUUGUAUAGUU; AMO-let-7e: 5′-AACUAUACAACCUCCUACCUCA-3′. [score:1]
The let-7 family includes let-7a, b, c, d, e, f, g and i and they all share an identical seed motif thereby presumably possessing the same cellular functions. [score:1]
Fig. 3Verification of gain- and loss-of-function of let-7e in cultured neonatal rat ventricular cells (NRVCs). [score:1]
showed that len-pre-let-7e, metoprolol and propranolol significantly caused deterioration of cardiac function, reflected by decreased EF and FS in AMI rats (Table 2). [score:1]
Anti-arrhythmic effects of let-7e in AMI rats. [score:1]
Furthermore, we evaluated the effects of let-7e on β [1]-AR expression in the heart. [score:1]
And as expected, it was decreased in the len-AMO-let-7e group. [score:1]
Virus-containing solution (20 μl, 1 × 10 [8] TU) including len-NC, precursor let-7e (len-pre-let-7e), AMO-let-7e (len-AMO-let-7e) or len-pre-let-7e and len-AMO-let-7e was injected using an insulin syringe into LV wall of rat heart. [score:1]
As described above, rats were infected with len-NC, precursor let-7e (len-pre-let-7e), AMO-let-7e (len-AMO-let-7e) or len-pre-let-7e + len-AMO-let-7e, or administrated with either β-AR blocker propranolol or metoprolol. [score:1]
Regulation of β [1]-AR by let-7e in vivolet-7e was increased by 1.5 ± 0.3-fold in the rat hearts administered with len-pre-let-7e compared with the control animals. [score:1]
However, len-pre-let-7e had no significant effect on HR of AMI rats (Table 2). [score:1]
Cardiac function and HR were not influenced by either len-pre-let-7e or len-AMO-let-7e in normal rats. [score:1]
Thirty-six hours after transfection of let-7e mimic (100 nM) or AMO-let-7e (200 nM), the NRVCs were used for qRT-PCR and analysis. [score:1]
Efficient transfection of let-7e was verified by 6.9 ± 0.9-fold elevation of this miRNA in NRVCs. [score:1]
let-7 family shares the same seed sequence (5′ GAGGUAG 3′) and are highly conserved across species in both their sequences and functions [39]. [score:1]
In contrast, len-AMO-let-7e increased arrhythmia score from 3.3 ± 0.4 to 5.8 ± 0.5 (P < 0.05). [score:1]
Effects of let-7e on cardiac function and heat rate. [score:1]
The present data indicate that like β-AR blocking agent, let-7e has pronounced antiarrhythmic effect in the setting of AMI. [score:1]
[1 to 20 of 94 sentences]
2
[+] score: 233
Let-7 can also inhibit LIN28B translation by binding to the 3′-untranslated region target sites, creating a double -negative feedback loop. [score:8]
Thus, five of the eight studied mature let-7 family members were significantly downregulated in the PFC, and the two of the remaining three showed a tendency to downregulation (let-7a: P=0.058; let-7e: P=0.080). [score:7]
[44] The let-7 family was previously shown to directly inhibit IL-6 expression in breast cancer cell lines, to be abundant in the adult brain and to be implicated in the regulation of neural stem cell proliferation, differentiation and synaptic plasticity. [score:7]
We showed that the exercise -induced upregulation of let-7 miRNAs in FSL was independent of Lin28b and Drosha changes, implying that other mechanisms are involved in regulating let-7 expression in response to physical activity. [score:7]
Third, we compared the total expression levels of pri-let-7b, pri-let-7c-1, pri-let-7f-1, pri-let-7i and pri-mir-98 between the FSL and FRL PFC; none of those pri-let-7 transcripts showed different expression between the rat strains (P>0.5, Figure 1d), indicating that reduction in mature let-7 expression in the FSL did not originate from decreased levels of pri-let-7 transcripts. [score:6]
Second, we examined whether the increased Il6 levels in the FSL associated with downregulation of let-7 expression. [score:6]
36, 37 Since the let-7 family is known to target Il6, the results suggest that the let-7 family dysregulation contributes to the overexpression of Il6 in the PFC of FSL. [score:6]
Increased Il6 levels are associated with downregulation of let-7 family expression in the prefrontal cortex of the FSL rats. [score:6]
21, 22, 23 A previous study showed that the let-7 family directly inhibited IL-6 expression in breast cancer cell lines, and thereby may act as an immunorepressor. [score:6]
24, 32, 33 Importantly, a recent study showed that LIN28B and LIN28A inhibited let-7 expression by different mechanisms, that is, LIN28B directly binds the primary let-7 (pri-let-7) transcripts and prevents DROSHA -mediated cleavage. [score:6]
Fourth, we assessed whether the expression levels of key enzymes (Drosha and Dicer) involved in miRNA biogenesis could potentially influence let-7 expression. [score:5]
43, 44 We hypothesized that Il6 expression was elevated in the prefrontal cortex (PFC) of the FSL strain compared with FRL, and that this elevation would associate with a downregulation of the let-7 family, in turn influenced by alterations in miRNA biogenesis. [score:5]
No differences were found for the mRNA levels of Lin28b and Drosha (P>0.8), suggesting that the physical activity increased expression of certain let-7 miRNAs expression independently of LIN28B and DROSHA. [score:5]
We also tested whether Hnrnpa1, a negative regulator of let-7 that is independent of LIN28 regulation, was associated with the decreased let-7 expression in the FSL. [score:5]
It is possible that let-7 dysregulation can lead to disturbances also in other pathophysiological processes because miRNAs often have multiple target genes. [score:4]
LIN28B elevation co-occurred with downregulation of the let-7 family in the FSL PFC. [score:4]
[58] Further, in blood samples from depressed patients, a number of let-7 family members were upregulated after a 3-month treatment with escitalopram. [score:4]
Let-7 expression showed the opposite expression changes over time, possibly dependent on the LIN28 dynamics. [score:4]
Second, we examined whether the Il6 reduction in the FSL runners associated with upregulation of let-7 miRNAs that showed a difference between naïve FSL and FRL (let-7b, let-7c, let-7f, let-7i and miR-98). [score:4]
Elevation of Il6 is associated with downregulation of let-7 miRNAs in the PFC of FSL, a rat mo del of depression. [score:4]
Increased Il6 levels are associated with downregulation of let-7 family expression in the prefrontal cortex of the FSL ratsFirst, we measured Il6 mRNA levels in the PFC from FSL and FRL rats. [score:4]
Elevation of Il6 is associated with downregulation of let-7 miRNAs in the PFC of FSL, a rat mo del of depressionElevation of peripheral proinflammatory cytokine IL-6 has been reported in clinical depression by a number of studies. [score:4]
Thus, the downregulation of let-7 family members in FSL PFC region was associated with increased LIN28B levels, increased LIN28B binding to pri-let-7 transcripts and reduced DROSHA levels. [score:4]
In cancer research, coordinated downregulation of multiple let-7 family members was found in many tumor types. [score:4]
The let-7 upregulation by physical activity appeared not to be associated with miRNA biogenesis processes but rather with epigenetic changes upstream pri-let-7 mRNA. [score:4]
[34] Besides, heteronuclear ribonucleoprotein A1 (hnRNPA1) was shown to negatively regulate let-7 biogenesis in cells lacking LIN28 expression. [score:4]
[54] In agreement, we found that Lin28b mRNA, but not Lin28a, was expressed at detectable levels in adult rat PFC, suggesting that LIN28B is the major paralog in regulating let-7 synthesis in the PFC. [score:4]
Physical activity rescued let-7 expression independent of LIN28B regulation. [score:4]
Second, we hypothesized that physical exercise would lower the elevated Il6 levels in the PFC of the FSL rats, by normalizing let-7 expression. [score:3]
Physical activity reduced Il6 levels and rescued let-7 expression in the FSL PFCFirst, we investigated where physical activity (voluntary wheel running) could normalize Il6 expression in the FSL PFC. [score:3]
[35] Next, we showed that LIN28B overexpression was associated with enrichment of LIN28B-pri-let-7 binding in FSL in vivo, which most likely led to excessive repression of mature let-7 synthesis, explaining the reduced mature let-7 levels. [score:3]
[59] Collectively, these results may suggest a role for let-7 as a therapeutic target in depression. [score:3]
Thus, physical activity reduced the elevated Il6 levels in PFC region of the FSL rats and increased expression of certain let-7 family members present already at primary transcript stage, possibly through epigenetic mechanisms. [score:3]
This Il6 decrease associated with an increased let-7 expression. [score:3]
The individual let-7 family members may compete with each other when exerting their repressive function since each member uses the same seed (5′-GAGGUA-3′ sequence of the let-7) as a template for recognizing complementary sites in the 3′-untranslated region of Il6 (5′-UACCUCA-3′). [score:3]
28, 50 However, other roles of let-7 family in the adult brain have been less investigated although let-7 is upregulated in later developmental stages and is one of the most abundant miRNA families in the adult brain. [score:3]
These results suggested that elevation of Il6 in the FSL PFC is associated with a deficiency of let-7 family expression, possibly linked with a disturbed let-7 biogenesis. [score:3]
[57] These results suggest that the antidepressant-like effect of physical activity may, in part, be due to brain let-7 expression. [score:3]
23, 29, 30, 31 This reduction was associated with an overexpression of LIN28 (including paralogous LIN28A and LIN28B in mammals), an RNA -binding protein that selectively represses let-7 maturation. [score:3]
Noteworthy, the let-7 deficiency in the FSL was not associated with changes in Hnrnpa1, which was a negative regulator of let-7 biogenesis when LIN28 regulation was absent. [score:3]
22, 23, 24, 25, 26 We showed that the Il6 elevation in PFC of FSL was associated with a reduced let-7 miRNAs expression. [score:3]
However, Il6 and let-7 are expressed throughout the central nervous system, including both neuron and glia cells. [score:3]
51, 52 We found that let-7 expression in the PFC of depressed FSL rats associated with elevated Il6. [score:3]
cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) followed by RT-PCR for pri-let-7 expression. [score:3]
In addition to LIN28B changes, we observed that FSL PFC had a decreased DROSHA expression, suggesting a disturbed miRNA biogenesis probably not only in let-7 but also in a variety of other miRNAs. [score:3]
In addition, we show that physical activity normalizes Il6 levels and could rescue let-7 expression. [score:3]
[53] Notably, let-7 expression appeared to be more decreased by chronic than acute stress paradigm, [53] which may be in line with our data, as FSL is a genetic mo del that exhibits a persistent depression-like behavior. [score:3]
Pri-let-7 and mRNA expression data were normalized to two reference genes (Gapdh, glyceraldehyde-3-phosphate dehydrogenase; and Ppia, cyclophilin A). [score:3]
First, we tested the hypothesis that overexpression of LIN28A and LIN28B, acting as let-7 repressors, was associated with the let-7 family deficiency in the FSL. [score:3]
Physical activity reduced Il6 levels and rescued let-7 expression in the FSL PFC. [score:3]
We show that the low levels of let-7 may be a result of disturbed LIN28B -mediated miRNA biogenesis and DROSHA dysregulation. [score:2]
[27] Noteworthy, let-7 could also be regulated in an LIN28B-independent fashion, for example, through epigenetic mechanisms such as DNA methylation and histone modifications, 49, 55 which is supported by our data from FSL rats under physical exercise (discussed in the next section). [score:2]
Let-7 deficiency is associated with LIN28B overexpression in the PFC of FSL rats. [score:2]
Our results warrant further studies on let-7 regulation in depression. [score:2]
Second, to gain further support that LIN28B directly associated with pri-let-7 to block mature let-7 synthesis in vivo, we performed RIP analysis. [score:2]
The results also suggest that this decrease of let-7 miRNA levels is in part due to a disturbed LIN28B -mediated miRNA biogenesis, and possibly in part due to a dysregulated DROSHA. [score:2]
The let-7 family has an important role in early neurodevelopment. [score:2]
Physical activity was found to normalize the Il6 and let-7 levels through epigenetic regulations upstream primary miRNA transcription. [score:2]
[20] In human, the let-7 family consists of 12 genes encoding nine distinct miRNAs (let-7a to let-7i and miR-98). [score:1]
[16] Lethal-7 (let-7) is one of the most studied miRNA families and is highly conserved between species. [score:1]
Consistently, a recent study reported that physical exercise was able to induce let-7 in the mouse hippocampus. [score:1]
[42] (6) We did not have the possibility to analyze Il6 and let-7 in specific cell types in this experiment. [score:1]
LIN28 is an RNA -binding protein that selectively represses let-7 maturation. [score:1]
In agreement, let-7 miRNAs were also found to respond actively to antidepressant drug treatment. [score:1]
There is increasing evidence suggesting the involvement of the let-7 family in inflammation and immune response. [score:1]
In the present study, we demonstrate increased Il6 levels and in parallel decreased levels of let-7 miRNA family in the PFC of a well-established mo del of depression, the FSL rat. [score:1]
Thus we observed that Il6 correlated negatively with each of the let-7 family miRNAs, however, none with statistical significance. [score:1]
28, 68, 69 We provide results demonstrating for, we believe, the first time that elevated proinflammatory Il6 in the depressed brain is associated with let-7 deficiency. [score:1]
[1 to 20 of 68 sentences]
3
[+] score: 157
Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivoTo further verify that Lin28B expression down-regulation in dystrophic retinas causes let-7 family molecule accumulation, we used an adenoviral expression system to overexpress Lin28B in the retina by delivering Ad/Lin28B into the subretinal space of RCS-p+ rats at p21. [score:12]
To further verify that Lin28B expression down-regulation in dystrophic retinas causes let-7 family molecule accumulation, we used an adenoviral expression system to overexpress Lin28B in the retina by delivering Ad/Lin28B into the subretinal space of RCS-p+ rats at p21. [score:10]
We tested the expression level of Lin28B usingting since previous studies have shown that the developmentally regulated RNA -binding protein, Lin28, selectively repressed the expression of let-7 microRNA [36]. [score:7]
Downregulation of Lin28B may upregulate let-7 family molecules. [score:7]
Upregulateion of let-7e and let-7i and downregulation of Lin28B in dystrophic rat retinas. [score:7]
In RCS-p+ rats, let-7c, let-7e and let-7i, were upregulated 2.4 ± 0.6, 3.4 ± 0.8, and 10.6 ± 2.6 times at p15, respectively and upregulated 1.3 ± 0.5, 1.8 ± 0.2, and 1.8 ± 0.2 times at p30, respectively (Figure 3A). [score:7]
The expression of most let-7 miRNA family molecules was increased, especially let-7e and let-7i, which were upregulated 4 times and 12 times, respectively in dystrophic rat retinas. [score:6]
We found that upregulating Lin28B RNA binding protein induced Müller cells to remain in a pluripotent state by repressing let-7e and let-7i expression, which promoted de-differentiated Müller cells to acquire a neuronal fate. [score:6]
We proposed that upregulating Lin28B might repress overexpression of let-7e and let-7i in the Müller cells during retinal degeneration, thereby tightly controlled their de-differentiation and proliferation. [score:6]
The expression of Lin28 was significantly increased in the retina of zebra fish after injury, which promoted Müller cells to proliferate and de-differentiate into retinal progenitors by negatively regulating the expression of microRNA let-7 [25, 26]. [score:6]
These data suggested that reduced expression of Lin28B may increase expression of the let-7 family in Müller cells from RCS-p+ rat retinas. [score:5]
Recently, it revealed that the let-7 family regulated posttranscriptional genetic circuits involved in the heterochronic pathway that regulated developmental timing and aging in C. elegans [48]. [score:4]
We observed that Müller cells had a transient de-differentiation and proliferation in the retina of RCS-p+ rats and identified that Lin28B, an evolutionarily conserved RNA -binding protein, may stimulate Müller cell de-differentiation by down -regulating the expression of the microRNAs let-7e and let-7i. [score:4]
We explored why let-7e and let-7i were upregulated in Müller cells during retinal degeneration. [score:4]
Among these members, let-7e and let-7i were upregulated most obviously. [score:4]
These data provide a point for further studies to uncover the underlying mechanisms of the Lin28B and let-7 signaling pathway mediated de-differentiation and proliferation of Müller cells with the ultimate aim of developing endogenous stem cells for regeneration and repair of retinal degenerative diseases. [score:3]
Considering the growing evidence implicates that miRNAs have a variety of effects on glia including development, differentiation, activation [45], as well as cell fate determination [46, 47], we performed microRNA array analysis of RCS rat retinas and found that let-7 miRNA family molecules seemed to have a strikingly different expression pattern in RCS-p+ rats compared with control rats. [score:3]
Figure 5Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivo(A– B3) against GS (blue) and in situ hybridization with LNA let-7e or let-7i probes (red) at 2 weeks after subretinal space injection of Ad/Lin28B or Ad/GFP (green) in RCS-p+ rats. [score:3]
Figure 3(A) Relative quantitative analysis showed that most members of the let-7 family, except let-7a and let-7f at p15, were upregulated at p15 and p30 in RCS-p+ rats' retina compared with controls. [score:3]
To verify that the expression of let-7e and let-7i was in Müller cells, immunofluorescence staining was performed against GS together with fluorescence in situ hybridization for let-7e and let-7i. [score:3]
We confirmed that the expression levels of let-7e and let-7i miRNAs were significantly repressed in Müller cells transfected Ad/Lin28B, as the cells gained features of stem/progenitor cells. [score:3]
MicroRNA let-7 was involved in cell differentiation and inhibited tumorigenesis. [score:3]
The expression of let-7e and let-7i co-localized with GS in somas and processes of Müller cells. [score:3]
The deficiency of let-7 can stimulate DNA replication and cell division [27], so it suggested that let-7, miR-125, and miR-9 were the key regulators of retinal progenitor cells in the early to late developmental stages [28, 29]. [score:3]
Our results suggested that overexpression of let-7e and let-7i might be the specific event that blocks de-differentiation and further proliferation of Müller cells in degenerated retinas. [score:3]
The majority of the let-7 family was enriched and upregulated during the early stages of retinal degeneration, p15 and p30, in retina of RCS-p+ rats compared with controls. [score:3]
Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivo. [score:3]
Increased expression of let-7e and let-7i in the retinas of RCS rats. [score:3]
We found that the intensity of let-7e and let-7i signals in Müller cells were significantly down-regulated in Ad/Lin28B treated retinas when compared with the Ad/GFP treated retinas (Figure 5A– 5B3). [score:3]
We believed that it might be Lin28B that negatively regulated the levels of let-7e and let-7i. [score:2]
The results showed reduced expressions of let-7e and let-7i in the Ad/Lin28B infected group compared with Ad/GFP infected group. [score:2]
In summary, we proposed that the activation of Müller cells produced a transitory progenitor state that quickly resulted in gliogenesis under the regulation of let-7e and let-7i in the degenerative retina of RCS-p+ rats. [score:2]
The prominent genes regulated by let-7 consist of those involved in executing cell-fate decisions, oncogenes and cell-cycle factors [47]. [score:2]
Recent studies have found that Lin28, miRNA -binding proteins, directly block the biogenesis of let-7 miRNAs post-transcriptionally by binding to the terminal loop region of the let-7 primary or precursor miRNAs (pri- or pre-miRNAs) of miRNAs in mammalian cells [36, 50– 53]. [score:2]
The major functions of the let-7 family include regulation of cell cycle progression and cell proliferation. [score:2]
The intrinsic timing mechanism that controls the developmental decline in neuronal regeneration depends on the progressive increase of let-7 in neurons [49]. [score:2]
Our results are in accordance with previous studies on zebrafish which demonstrated that Lin28 and let-7 were involved in the de-differentiation of Müller cells after retina injury [26]. [score:1]
against GS combined with fluorescent in situ hybridization for let-7e or let-7i at 2 weeks after Ad/Lin28B or Ad/GFP administration was performed. [score:1]
These results suggested that in RCS-p+ rat retinas the levels of let-7e and let-7i increased in Müller cells, which may diminish Müller cell de-differentiation and proliferation during retinal degeneration. [score:1]
We found that let-7e and let-7i co-localized with GS in the somas and processes of Müller cells of RCS-p+ rats. [score:1]
Our findings underlined the importance of the opposite effects between Lin28B and let-7e and let-7i on Müller cells, which played an important role in promoting retinal regeneration and repair. [score:1]
The intensity of let-7e and let-7i signals in RCS-p+ rat retinas was stronger than that of controls at early stages of retinal degeneration, p15 and p30 (Figure 3B– 3C3). [score:1]
[1 to 20 of 42 sentences]
4
[+] score: 133
All in all, the above expression data from two rodent species strongly suggest a dynamic reciprocal regulation of Lin28a and let-7 (and related miRNAs) along the spermatogenic cycle, whereby high expression of Lin28a or Lin28b is associated with (and possibility caused by) low or absent expression of regulatory miRNAs in specific cell types of the seminiferous epithelium; this profile of reciprocal changes is depicted in Fig. 2-II. [score:9]
However, while this phenomenon might explain loss of expression of some transcripts (e. g., Lin28b), the arrest of spermatogenesis at early stages can hardly justify the observed increases in miRNAs, such as let-7b and mir-145, which are abundantly expressed in spermatocytes and early spermatids, therefore suggesting additional regulatory phenomena reciprocally linking Lin28 and let-7 expression in the testis. [score:8]
This is a complex event, regulated by a large number of factors, including miRNAs 30, which function mainly post-transcriptionally by controlling the stability or translation of their target mRNAs 7. Among the miRNAs described in rodent testis, the let-7 family displays prominent expression 53 55. [score:8]
Different mo dels of perturbed puberty and hormonal manipulation, targeting key endocrine axes with proven roles in the control of testicular function, were explored as a means to provide indirect evidence for the relevance of the Lin28 /let-7 system in the regulation of the rat testis and its modulation by key developmental and hormonal signals. [score:6]
Interestingly, recent studies from our group assessing the dynamics in the hypothalamic expression of the Lin28/let-7 system documented that, as is the case for the testis, at central levels reciprocal changes between Lin28 and let-7 expression levels are detectable along postnatal maturation and in neonatally estrogenized rats. [score:5]
Regulation of testicular expression of the Lin28/let-7 system by other pituitary hormonal axes was also explored using various approaches. [score:4]
How to cite this article: Sangiao-Alvarellos, S. et al. Testicular expression of the Lin28/let-7 system: Hormonal regulation and changes during postnatal maturation and after manipulations of puberty. [score:4]
Regulation of the expression of the Lin28/let-7 hub was explored in vivo in a number of mo dels of neuroendocrine manipulation, known to impact on testicular function. [score:4]
These findings suggest that the bidirectional regulatory loops between Lin28 and let-7 miRNAs might operate at different levels of the reproductive axis, but the nature and functional implications of this regulatory loop likely vary at different tissues. [score:4]
Thus, in Experiment 5, regulation of testicular Lin28/let-7 expression by pituitary gonadotropins was explored. [score:4]
Hormonal regulation of testicular expression of the Lin28/let-7 system and related miRNAs. [score:4]
Testicular expression of the elements of the Lin28/let-7 system was also affected in mo dels of photoperiodic and nutritional manipulation, as well as after HPX, suggesting the convergence of multiple regulatory signals. [score:4]
As mentioned above, compelling biochemical data suggest the existence of a double negative feedback loop whereby Lin28a/Lin28b redundantly represses the synthesis of mature let-7 miRNAs, which in turn suppress Lin28 levels. [score:3]
The impact of postnatal under-nourishing on testicular expression of the Lin28 /let-7 system was explored using rats reared in large litters (20 pups/litter), as mo del of delayed puberty 45. [score:3]
Changes in the profiles of testicular expression of Lin28/let-7 in mo dels of perturbed puberty. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in rat testis during postnatal maturation. [score:3]
Thus, both congenital elimination of Lin28a 36 and embryonic over -expression of let-7 24 have been shown to induce a reduction of the germ cell pool, with Lin28a KO mice displaying reduced fertility in adulthood 36. [score:3]
Changes in testis expression of the Lin28/let-7 system in mo dels of perturbed puberty. [score:3]
While additional mechanistic studies are needed to fully support these hypotheses, our present results, which characterize the profiles of developmental expression and hormonal regulation of the Lin28/let-7 system in the rodent testis, help to consolidate the view that the elements of this system are involved in the dynamic control of male gonadal maturation and function in mammals. [score:3]
Impact of growth hormone deficiency on the expression profiles of the components of the Lin28/ let-7 axis and related factors in adult rat testis. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in pubertal rat testis rats following neonatal estrogenization. [score:3]
Expression profiles of the components of the Lin28/let-7 axis and related factors in rat testis following photoperiod manipulation (dark (10–15), constant darkness from postnatal day [PND] 10–15). [score:3]
In order to complement our expression data, localization analyses were applied to adult testicular samples to address the pattern of cellular distribution of key elements of the Lin28/ let-7 system. [score:3]
For instance, during neonatal period, Lin28a/Lin28b mRNA expression was minimum and (especially for Lin28b) increased thereafter, whereas let-7 and also mir-132, mir-9 and mir-145 miRNAs abundance was maximal on PND1, decreasing progressively along postnatal maturation. [score:3]
Analyses in mo dels of perturbed puberty, with variable impact on pubertal timing, revealed that early manipulations of the hormonal and nutritional milieu, as well as photic cues, could influence the profiles of expression of different members of the Lin28/let-7 hub along postnatal testicular maturation. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in rat testis following postnatal undernutrition, caused by rearing in large litters (20 pups per litter). [score:3]
In addition, in Experiment 6, testicular Lin28/let-7 expression levels were monitored in a rat mo del of GH deficiency, a dwarf rat strain derived from the Lewis rat (2–3 months old; Harlan, UK). [score:3]
For instance, on the basis of previous findings and our current data, it is arguable that the concomitant increase in Lin28a/Lin28b and decrease of let-7 expression during post-natal maturation might favour completion of spermatogenesis during puberty, while reversion of the Lin28/let-7 ratio might contribute to perturbation of spermatogenesis in mo dels such as neonatal estrogenization. [score:3]
Expression of Lin28/let-7 and related miRNAs in the testis during postnatal maturation. [score:3]
Expression of Lin28/let-7 system and related miRNAs in the testis during postnatal maturation. [score:3]
Notably, comparison of expression analyses of Lin28a/Lin28b transcripts (and let-7 miRNAs) in the testis of rats (present results) and mice 53 reveals a strikingly similar profile between these two rodent species, suggesting a notable degree of conservation of the Lin28 system in the testis. [score:3]
Assessment of hormonal regulation of testicular Lin28/let-7 expression was first evaluated using HPX rats, with or without gonadotropin replacement, as experimental mo del. [score:2]
The Lin28/let-7 tandem is subjected to a dual negative feedback regulatory loop. [score:2]
Hormonal regulation of the Lin28/let-7 system in the testis. [score:2]
Our current findings complement those previous observations and help to provide educated hypotheses in the testicular roles of the Lin28/let-7 system in the postnatal testis in normal and pathophysiological conditions. [score:1]
The same profiles of inverse relationship was found in mo dels of altered puberty due to neonatal estrogenization, where Lin28a/Lin28b mRNA levels were consistently reduced while let-7 levels were increased, and in the dwarf GH -deficient rat mo del, which displayed opposite profiles. [score:1]
Finally, in Experiment 7, the involvement of other neurohormonal axes in the control of testicular Lin28/let-7 expression was assessed by measuring changes in mRNA/miRNA levels in mo dels of surgical deprivation of adrenal hormones, by adrenalectomy (ADX), and chemically -induced hypothyroidism by administration of 0.1% aminotriazole in drinking water for three weeks in keeping with previous references 49 50. [score:1]
Recent works suggest a role for Lin28/ let-7 axis in fertility and spermatogenesis. [score:1]
However, the trends of such changes were diametrically opposite between the hypothalamus and the testis, so that the hypothalamic Lin28/let-7 ratio decreased during maturation and increased after neonatal estrogenization 16, whereas the contrary applies to the testis. [score:1]
This protocol of neonatal estrogenization resulted also in detectable changes in the Lin28/ let-7 axis at the expected time of puberty (PND-45). [score:1]
[1 to 20 of 40 sentences]
5
[+] score: 105
Down-regulation of β [1]-ARs and up-regulation of let-7 in chronic ischemic failing heartThe expression level of β [1]-ARs was decreased by 34.0 ± 6.3% in failing hearts compared with those in non-failing hearts (Figure 1A). [score:8]
Our previous study revealed that let-7 is considerably down-regulated in the setting of acute myocardial ischemia which results in the upregulation of β [1]-ARs and the associated arrhythmogenesis and dysfunction of the heart. [score:7]
The mechanisms for let-7 up-regulation and the possible pathophysiological role of let-7 upregulation in CIHF remained unknown. [score:7]
Down-regulation of β [1]-ARs and up-regulation of let-7 in chronic ischemic failing heart. [score:7]
First, the level of let-7 family members, especially let-7a, was significantly up-regulated in CIHF, along with down-regulation of β [1]-ARs. [score:7]
In the present study, we found that let-7a, b, c, d, f and I were significantly upregulated and let-7e downregulated in rat failure hearts. [score:7]
Intriguingly, in our preliminary studies in a rate mo del of chronic myocardial ischemia, members of the let-7 miRNAs family were found upregulated, whereas let-7a showed the opposite expression. [score:6]
Artificial mediation on this feedback circuit by interfering let-7 expression may be a potential strategy and new idea for the regulation of β [1]-AR expression in the prevention and treatment of heart failure. [score:6]
Let-7 regulates expression of β [1]-ARs in cardiomyocytesTargetScan miRNA database was used to predict a binding site at the 3’UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Figure 2A). [score:6]
Let-7 belongs to a miRNA family containing 13 members sharing the same seed sequence thereby the same set of target genes [18], and is affluently expressed in the heart [19]. [score:5]
Under such a condition, the levels of β [1]-AR protein and mRNA were both reduced in a concentration dependent manner (Figure 1D and 1E), whereas, the members of let-7 family, particularly let-7a, were markedly up-regulated (Figure 1F). [score:4]
Studies discovered the deregulation of the let-7 members in cardiovascular diseases, such as cardiac hypertrophy, cardiac fibrosis, and myocardial infarction [20]. [score:4]
A. Alignment of the sequences of let-7 family (bottom) with their target sites in the 3’UTRs of human, rat and mouse β1-AR mRNAs (top). [score:3]
In agreement with the in vivo data, reciprocal changes of expression of β [1]-AR and let-7 miRNAs were also observed in ISO -treated NRVCs. [score:3]
This discrepancy of let-7 family expression may be attributed to the family members’ transcript from different gene clusters which contribute to different processes in heart failure. [score:3]
Let-7 regulates expression of β [1]-ARs in cardiomyocytes. [score:3]
Figure 2 A. Alignment of the sequences of let-7 family (bottom) with their target sites in the 3’UTRs of human, rat and mouse β1-AR mRNAs (top). [score:3]
Targetscan predicts the presence of a putative binding site for let-7 in the 3’UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:3]
TargetScan miRNA database was used to predict a binding site at the 3’UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Figure 2A). [score:3]
Thus, it forms a critical feedback loop signaling pathway of β [1]-AR/cAMP/PKA/GATA-4/let-7/β [1]-AR, and the decreasing of β [1]-AR in CIHF is induced by β [1]-AR activation in early phase of CIHF, which is a kind of self-regulation of β [1]-AR in the course of ischemia induced heart failure. [score:2]
Construction of plasmid carrying the 3’UTR of β [1]-adrenergic receptor (ADRB1) gene and luciferase assayTargetscan predicts the presence of a putative binding site for let-7 in the 3’UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:2]
It is conceivable based on our findings that let-7 participates in the β [1]-AR/cAMP/PKA/GATA-4 signaling pathway as an upstream component and its participation forms a negative feedback loop. [score:1]
A-C. β1-AR protein, β1-AR mRNA and let-7 family levels in the hearts of ischemic heart failure rats; D-F. β1-AR protein, β1-AR mRNA and let-7 family levels in NRVCs treated with isoproterenol (ISO) for 72 h. HF, heart failure; Ctl, control. [score:1]
Level of β1-AR and let-7 in chronic ischemic failing hearts and ISO -treated neonatal rat ventricular cardiomyocytes (NRVCs). [score:1]
We therefore proposed the modified signaling pathway: β [1]-AR↑→cAMP↑→PKA↑→GATA-4↑→let-7↑→β [1]-AR↓. [score:1]
Figure 1 A-C. β1-AR protein, β1-AR mRNA and let-7 family levels in the hearts of ischemic heart failure rats; D-F. β1-AR protein, β1-AR mRNA and let-7 family levels in NRVCs treated with isoproterenol (ISO) for 72 h. HF, heart failure; Ctl, control. [score:1]
A segment containing the let-7 miRNA binding sites flanked by the Hand III and Sac I restriction sites and a scramble sequence as a negative control (NC) were synthesized by Invitrogen. [score:1]
[1 to 20 of 27 sentences]
6
[+] score: 59
c Expression levels of Trim71 and effects of let-7 siRNA in control (C) and folate -deficient (MDD) H19-7 cells at 13 h after induction of differentiation (Si− = non -targeting siRNA, Si+ = let-7 -targeted siRNA). [score:7]
Belonging to the family of Trim-NHL ubiquitin ligases, Trim71 is highly expressed in undifferentiated cells, such as embryonic stem cells, but becomes rapidly downregulated upon differentiation, in response to the rise of let-7 levels [59]. [score:6]
For d and e: statistically significant difference with the respective control: * P < 0.05 and** P < 0.01; statistically significant difference between Si− and Si+: ° P < 0.05 (n = 5) Let-7 siRNA that repeatedly inhibited the expression of let-7a by >85 % after quantification by increased Trim71 levels in both control and folate -deficient H19-7 cells at 13 h after induction of their differentiation (Fig. 6c). [score:5]
Early Methyl Donor Deficiency Alters the Expression Pattern of a Wide Range of Genes Influenced by Let-7 and miR-34 and Involved in Various Aspects of Development. [score:4]
While it cannot fully prevent early-occurring NTDs such as spina bifida, maternal supplementation with folic acid during the period corresponding to the last trimester of pregnancy in women appeared to help preserve a normal development, at least partly through restoring let-7 and miR-34 normal expression. [score:4]
Among the subset of miRNAs known to be regulated by methylation [28], let-7 (lethal 7) and miR-34 are believed to exert a requisite role at various steps of cerebral development, while they would influence the occurrence of NTDs [27, 29]. [score:3]
Methyl Donor Deficiency Affects Protein Expression Levels of Known Downstream Pathways of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
a Expression levels of let-7 in arbitrary units (AU) in the midbrains of control (C) and deficient (MDD) rat embryos at E16 and E20, and effects of folic acid (B9) supplementation. [score:3]
Most importantly, folic acid supplementation helped restoring the levels of let-7 and miR-34 and their respective targets. [score:3]
Methyl Donor Deficiency Increases Expression Levels of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
Fig. 3Effects of methyl donor deficiency on the expression of let-7 and miR-34: influence of folic acid supplementation. [score:3]
Fig. 6Effects of methyl donor deficiency and folic acid supplementation on Trim71, a target of let-7. Consequences of silencing let-7a on differentiating H19-7 cells. [score:3]
Depending on the experimental mo dels used, it was reported that let-7a could act through various pathways involving the participation of transcription factors such as Abrupt, Sox2, Tlx, or cell cycle regulators such as CDK/Cyclin complexes [56, 57], contributing to the overall effect of let-7 on increasing the number of cells in the G1 phase of the cell cycle. [score:2]
In the present study, we chose to further investigate the well-established target of let-7, Trim71 (also called Lin41), which is required for embryonic development and proper neural tube closure [29, 58]. [score:2]
Taken together, our data therefore suggest that the alterations observed in let-7 and miR-34 pathways in response to methyl donor deficiency may participate to a disruption of the proliferation/differentiation balance, resulting in improper development of the central nervous system, and influencing the occurrence of NTDs. [score:2]
Statistically significant differences between MMD and MDD-B9: * P < 0.05, ** P < 0.01 We chose to investigate Trim71, which is a key effector of the let-7 microRNA pathway, that promotes cell proliferation and inhibits differentiation to control various developmental processes [45]. [score:2]
By using the microarray approach, the identification of new putative target genes affected in response to methyl donor deficiency via let-7 and miR-34 warrants further investigations. [score:1]
In order to identify further mechanisms underlying the effect of maternal B-vitamin status on neural tube and brain development, in line with potential epigenetic dysregulations, we investigated the participation of let-7 and miR-34 as well as their related pathways in the consequences of methyl donor deficiency both in vivo on a validated rat mo del of maternal deficiency [30, 31] and in vitro in hippocampal progenitors [32]. [score:1]
f Representative influence of let-7 siRNA on cell morphology at 13 h after induction of differentiation. [score:1]
Products of RT reaction (1.33 μL) were used in a real-time PCR reaction, which also included 10 μL of the TaqMan Universal Master Mix II, and 1 μL TaqMan miRNA assay containing the sequence-specific primers of either the target miRNA (let-7: UGAGGUAGUAGGUUGUAUAGUU, miR-34: UGGCAGUGUCUUAGCUGGUUGU) or the U6SnoRNA (CACGAATTTGCGTGTCATCCTT) used as an endogenous control for normalization. [score:1]
[1 to 20 of 20 sentences]
7
[+] score: 58
Protein kinase B or Akt, a key protein involved in the activation of PI3K-Akt pathway and is crucial in promoting cell survivability [43], is inhibited by the key microRNAs (miR-22, miR-214, miR-125a-3p, miR-320 and let-7 family) that are down-regulated with the addition of IGF-1. Chen et al. reported that down-regulation of miR-133b significantly overexpressed Akt1 mRNA, which increased T24 bladder cancer cell proliferation and reduced cell apoptosis [44]. [score:11]
However, BMSC-derived NPCs with addition of IGF-1 showed 12 microRNAs which include miR-22, miR-1224, miR-125a-3p, miR-214, miR-320, miR-708 and miR-93 were consistently down-regulated and only miR-496 remained up-regulated compared to Group C from Day 1 to Day 5. The let-7 family (let-7b, let-7c, let-7d, let-7e and let-7i) were constantly down-regulated in both groups. [score:9]
The genes up-regulated by down-regulation of miR-22 (A); miR-125a-3p (B); let-7 family (C); miR-214 (D); and miR-320 (E) were analyzed using GeneMANIA web tool with default weighting method (i. e., weighting based to maximize connectivity between input genes). [score:7]
MicroRNAs Query Genes miR-22 Myc; Ets1; Tp53; Agt; Esr1; Pten; Akt1 miR-214 Bcl2; Adora1; Myc; Neurod1; Dhcr24; Kras; Fgfr1; Apc; pcgfr1; Prnp; Akt1 miR-125a-3p Bcl2; Egfr; Tp53; Apc; Akt1; Rela miR-320 Bcl2; Adora1; Acvr1; Neurod1; Dhcr24; Tp53; Hmox1; Nol3; Pten; Akt1; Cebpb Let-7 Family Cdkn1a; Tnf; Bcl2; Adora1; Egfr; Myc; Il10; Acvr1; Sycp3; Neurod1; Dhcr24; Cdkn1b; SMAD3; Kras; ras3; Neurod1Birc2; Tp53; Kcnh8; FN1; Fgfr1; Clu; Fas; Pten; Akt1; Rela; Cebpb We assessed the predicted target genes of the down-regulated microRNAs with the KEGG database. [score:6]
Besides, Cimadamore et al. reported that LIN28 binds to precursor let-7 microRNA and blocks the production of mature let-7i microRNAs, inhibiting neuronal differentiation by targeting MASH1 and NGN1 genes [25]. [score:5]
ijms-16-09693-t006_Table 6 Table 6Pathways of predicted target genes for down-regulated microRNAs in Group A, Group B and Let-7 Family. [score:5]
In Groups A and B, let-7 family microRNAs were observed to be consistently down-regulated. [score:4]
This process suggests that the down-regulation of the let-7 microRNA family promotes cell proliferation during early neurogenesis. [score:4]
Query genes for individual microRNA are listed in Table 5. The major targeted genes by all or four out of five key microRNAs (miR-22, miR-214, miR-125a-3p, miR-320 and let-7 family) included Akt1, Tp53, Pten and Bcl2. [score:3]
Cimadamore F. Amador-Arjona A. Chen C. Huang C. T. Terskikh A. V. SOX2–LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors Proc. [score:2]
Additionally, the statistical significant pathways (FDR < 0.01) involving cell proliferation and survivability related to this study are listed in Table 6. The significance levels of the related pathways were compared with pathways targeted by specific let-7 microRNAs independently to exclude the possibility that those pathways are due to let-7 microRNAs alone. [score:2]
[1 to 20 of 11 sentences]
8
[+] score: 52
Amongst them let-7 family miRNA that were reported to be broadly expressed across all differentiated tissues and their expression is tightly controlled during embryonic stem cells differentiation. [score:5]
It is clearly demonstrated that LPS -induced neurotoxicity suppresses let-7 family miRNAs expression, an effect that is ameliorated by co-administration of either cur or VPA. [score:5]
Recently, alteration of miR- let-7 members expression has also been reported in several other neurodegenerative diseases including schizophrenia, AD and addiction (Beveridge et al., 2010; Hollander et al., 2010; Santarelli et al., 2011; Wang et al., 2011). [score:5]
Evidently the distinguished pattern of let-7 five members’ expression in each group is directly correlated to the genetic remo deling activity that is exerted by LPS, Cur, or VPA. [score:4]
Also we are interested in studying the expression profiles of lethal-7 (let-7) miRNAs family members as signaling molecules in regulation of inflammatory enzymes cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS). [score:4]
miRNA let-7 family members are highly expressed in central nervous system and were shown to play crucial role in cell development and differentiation. [score:4]
Also we shed the light on the role of five let-7 family in VPA-Cur mediated mechanism of actions as novel therapeutic targets. [score:3]
FIGURE 7 Quantitative real time RT-PCR analyses of let-7 miRNAs family expression profile in different experimental groups. [score:3]
Interestingly we observed an overall altered expression profile in the five types of let-7 miRNAs in induced versus protected and treated rats. [score:3]
Therefore we analyzed the expression profile of five members of let-7 family (a, b, c, e, and f) in the different experimental groups. [score:3]
We provide strong evidence for meaningful changes in five let-7 members miRNA expression during induction, progression, and treatment with Cur and VPA as the most salient feature. [score:3]
MODULATION OF FIVE MEMBERS OF let-7 FAMILY miRNAs. [score:1]
The results show that let-7 a, b, and c were under detection level in LPS induced rats, an effect that was countered by either co-VPA or co-Cur incorporation (Figure 7). [score:1]
In our study, we screened in particular, five types of let-7 miRNAs family which are; let-7a, let-7b, let-7c, let-7e, and let-7f for possible modulation during the course of induction, protection, and treatment. [score:1]
Our work thus clearly indicates that miRNAs such as let-7 members deserve further functional exploration to deepen our understanding of molecular mechanisms driving not only neuroinflammation but also other neurodegenerative disorders. [score:1]
Co-administration of either Cur or VPA a particular differential expression was observed in all investigated members of let-7 miRNAs confirming their function as important players in neuro-protection. [score:1]
Treatment of induced rats with VPA or Cur alone did not induce let-7 a, b, and c in the same pattern as their combination did which indicate the synergistic effect VPA-Cur treatment. [score:1]
In our study we measured the alterations in the expression levels of five different types of let-7 miRNAs (Let-7 a, b, c, e, and f). [score:1]
group which confirms the implication of these let-7 members in self-healing mechanism. [score:1]
Evidently we observed significant elevations in let-7 a, c, and f in self-rec. [score:1]
Moreover VPA+Cur combination for treating induced rats significantly (* p < 0.01) induced the five members of let-7 family in comparison to LPS -induced rats. [score:1]
[1 to 20 of 21 sentences]
9
[+] score: 40
Mean ± SEM, *p < 0.05, N = 3–6 per group Since ethanol increases TLR7 expression, let-7 release, and HMGB1 release, we hypothesized that the ethanol -induced increase in TLR7 expression primes TLR7 signaling and increases vulnerability to neurotoxicity due to TLR7 activation. [score:5]
Many miRNAs, including let-7 isoforms, are upregulated in the brains of humans and mice after chronic alcohol [8, 9]. [score:4]
HMGB1 is known to be secreted in microvesicles [42, 56] and might escort let-7 to microvesicles for secretion, rather than to the Ago2 -associated RISC complex, where it would subsequently act intracellularly to regulate the stability target mRNAs. [score:4]
Thus, we hypothesized that ethanol would increase TLR7 and let-7 expression in vitro contributing to neuroimmune activation. [score:3]
Our findings indicate that alcohol causes microglia to release let-7 and HMGB1 in MVs while concomitantly increasing TLR7 expression, leading to neurodegeneration. [score:3]
Studies utilizing miRNA profiling find increased expression of several let-7 isoforms in human and rodent brain after chronic alcohol [8, 9]. [score:3]
Let-7 release in MVs in particular has also been implicated in multiple inflammatory pathologies related to cancer, cardiovascular disease, and neurodegeneration [6, 53, 54]. [score:2]
Further, ethanol increased let-7b binding to the danger signaling molecule high mobility group box-1 (HMGB1) in MVs, while reducing let-7 binding to classical chaperone protein argonaute (Ago2). [score:1]
Ethanol caused a threefold increase in MV let-7b from BV2 microglia (Fig.   4b) but not SH-SY5Y neurons (Fig.   4c), suggesting microglia are the source of secreted let-7. Ethanol also caused a dose -dependent increase in media HMGB1 (Fig.   4d). [score:1]
We identify a role of let-7 in the pathology of alcoholism that involves inter-cellular signaling through TLR7, rather than its intracellular function involving mRNA stabilization. [score:1]
Thus, ethanol increases TLR7 -induced neurodegeneration, through induction of TLR7, let-7 release, and HMGB1 secretion. [score:1]
Therefore, we think the requirement for HMGB1 involves facilitating the interaction of let-7 with TLR7, rather than a requirement for co-stimulation of TLR4 by HMGB1. [score:1]
Thus, we report here the identification of a novel inter-cellular communication mechanism in the pathology of alcohol abuse, whereby ethanol causes the release of HMGB1-let-7 complexes in MV from microglia. [score:1]
siRNA against TLR7 mRNA (siTLR7) prevented let-7 induced neurotoxicity. [score:1]
The miR let-7 is an endogenous ligand for TLR7 that results in neurodegeneration [6] and let-7 isoforms are increased in the brains of human alcoholics [9]. [score:1]
We then asked which cell type was responsible for microvesicular let-7 and HMGB1 release. [score:1]
The endogenous TLR7 agonist miR let-7 has been found to cause neurodegeneration [6]. [score:1]
Fig. 8 Proposed mechanism of HMGB1 and let-7 release in microvesicles. [score:1]
Ethanol increases the binding of let-7 with HMGB1 in microvesicles. [score:1]
Other let-7 family members in addition to other pro-inflammatory miRNAs were assessed and are shown in Additional file 4: Table S1. [score:1]
Thus, sensitization of TLR7 signaling with either IMQ or let-7 results in increased neurotoxicity to ethanol. [score:1]
Our findings suggest that recurrent TLR7 activation by ethanol -induced microglial let-7 and HMGB1 release contributes to the progressive neurodegeneration associated with alcoholism. [score:1]
Ethanol increases TLR7 activation and releases of HMGB1-miR-let-7 complexes in microglia-derived vesicles that cause neurotoxicity via TLR7 activation. [score:1]
[1 to 20 of 23 sentences]
10
[+] score: 36
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA group Recent studies demonstrated that H19 could regulate gene expression by acting as competing endogenous RNA for miRNA let-7, resulting in the derepression of several protein-coding genes targeted by let-7 18, 22, 23, as H19 harbors both canonical and non-canonical -binding sites for the let-7 family [23]. [score:6]
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA group According to the prediction of miRNA target gene, Casp3 is one of the potential downstream target genes of the let-7 family. [score:5]
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA groupAccording to the prediction of miRNA target gene, Casp3 is one of the potential downstream target genes of the let-7 family. [score:5]
H19 regulates gene expression by acting as a competing endogenous RNA for let-7 in SE -induced neural damage during epileptogenesis. [score:4]
b The expression levels of let-7 family members (let-7a, let-7b, let-7d, let-7e, let-7g, and let-7i) in CA3 subfield of hippocampus from sham-operated and KA -induced epileptic rats at 1 day after surgery as determined using qPCR (n = 7–8). [score:3]
The expression levels of the let-7 family members were examined in CA3 subfield of the hippocampus from rats at 1 day after SE. [score:3]
The relative H19 levels were normalized to GAPDH and the relative expression levels of let-7 family members were normalized to U6. [score:3]
The bioinformatics analysis also revealed putative complementary sequences for let-7 family members (let-7a, let-7b, let-7d, let-7e, let-7g, and let-7i) in rat H19 (Fig.   5a). [score:1]
Gao Y The H19/let-7 double -negative feedback loop contributes to glucose metabolism in muscle cellsNucleic Acids Res. [score:1]
and luciferase assays demonstrate that vertebrate H19 harbors binding sites for the miRNA let-7 family and can bind to let-7 directly to modulate its availability [23] The results from the present study are consistent with the reports. [score:1]
a Bioinformatics-predicted binding sites for eight let-7 subtypes (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, and let-7i) in rat H19. [score:1]
Fig. 5 a Bioinformatics-predicted binding sites for eight let-7 subtypes (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, and let-7i) in rat H19. [score:1]
Kallen AN The imprinted H19 lncRNA antagonizes let-7 microRNAsMol. [score:1]
Nucleotides of the miRNA let-7 seed region (positions 2–8) are marked in red. [score:1]
[1 to 20 of 14 sentences]
11
[+] score: 30
Here we found that 13 of the 349 miRNAs examined were aberrantly expressed in samples from the 2-mg/kg–treated animals, and two down-regulated miRNAs (rno-let-7e* and rno-miR-489) were consistent with the up- regulation of mRNA expression of their predicted target genes, Bcl10 and Ccna2. [score:11]
Using miRGen and MicroCosm, we found that Ccna2 and Bcl10, two genes that were up-regulated in our mRNA arrays, were the predicted targets of the down-regulated rno-miR-489 and rno-let-7e*, respectively. [score:9]
For example, let-7e* was down-regulated in malignant mesothelioma (Guled et al. 2009), and let-7a was up-regulated in lung, lymphoma, and ovarian cancers (Boyerinas et al. 2010). [score:7]
The let-7 family of miRNAs, which is functionally conserved from worms to humans, is important to normal development and differentiation and has been reported to be deregulated in various cancers (reviewed by Boyerinas et al. 2010). [score:3]
[1 to 20 of 4 sentences]
12
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
Interestingly, the expression abundance varies among the let-7 family members (Tables 1 and 2); let-7a and let-7j, each have 80 reads; similarly, let-7b, let-7c and let-7e have almost the same number of reads (63–64); let-7d, let-7f and let-7j have 18 to 32 reads; and let-7h, let-7i and let-7k have a lower number of reads (5–9) (Tables 1 and 2). [score:3]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
Hence the let-7 miRNA family is represented by 11 members, and this study provides the evidence for the expression of all 11 let-7 family members in pig. [score:3]
Here, we found evidence for the expression of all 10 let-7 members in pig. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
Similarly, let-7, miR-98, miR-16 and miR-130a are abundantly expressed in 13 of the 14 tissues (except in pancreas) (Figure 3A). [score:3]
let-7, miR-98, miR-130a and miR-16 showed uniform levels of expression in 13 different tissues but were hardly detected in pancreas (Figure 3A). [score:3]
The miR-98 sequence differs from that of the let-7 family by one nt at position 11 from the 5' end, thus miR-98 is also a member of the let-7 family. [score:1]
The let-7 family has 10 members in diverse animal species (miRBase). [score:1]
[1 to 20 of 10 sentences]
13
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This is consistent with current mo dels of let-7 function which indicate that the family members are barely detectable during embryonic development before being up-regulated in differentiated cells where they are likely to possess highly redundant roles through targeting of an overlapping set of mRNAs [33]. [score:7]
Similarly, dysregulation of let-7 leads to a less differentiated cellular state and the development of cell -based diseases such as cancer [51, 52]. [score:5]
It remains to be determined whether the 8 let-7 family members that are expressed in the epididymis have different activities or whether they collectively target a similar cohort of genes. [score:5]
Nevertheless, it is tempting to speculate that the redundancy in let-7 expression may contribute to the stringent molecular mechanisms that help the epididymis evade tumorigenesis. [score:3]
Let-7 (lethal-7) is a founding member of the miRNA family that was originally described in Caenorhabditis elegans, where it controls the timing of terminal differentiation, acting as a key regulator of multiple genes required for exit from the cell cycle (reviewed by [33]). [score:2]
The role of let-7 in cell differentiation and cancer. [score:1]
The let-7 miRNA family has since been shown to display a remarkable level of sequence and functional conservation across the animal kingdom, with 14 and 13 different family members represented in mouse and human, respectively [33]. [score:1]
The let-7 family of microRNAs. [score:1]
Interestingly, among the conserved miRNAs found in all epididymal regions, we identified 8/14 and 4/7 members of the let-7 family (let-7a—let-7f, let-7i) and miR-30 (miR-30a— miR-30d) family, respectively. [score:1]
[1 to 20 of 9 sentences]
14
[+] score: 22
Tsp-let-7 showed very low expression in NBL stage, whereas tsp-miRNA-100 was detected in rather high abundance at the same development stage. [score:4]
Further, MiR-100 and let-7, the two conserved miRNA in metazoa, play a role in regulation of developmental timing [18], [42], [45]. [score:3]
First, the above miRNAs identified in sequencing were all amplified by qRT-PCR (Fig. 6A) and except the tsp-let-7 which was found less expressed in NBL, the qRT-PCR results were all consistent with the TPM values of sequencing results. [score:3]
The following forward primers were designed to confirm the sequencing results of miRNAs that showed differential expression patterns: tsp-miR-100 5′-AAC CCG TAG ATC CGA ACT TGT GT-3′; tsp-let-7 5′-TGA GGT AGT AGG TTG TAT AGT T-3′; tsp-miR-228 5′-AAT GGC ACT GGA TGA ATT CAC GG-3′; tsp-miR-1 5′-TGG AAT GTA AAG AAG TAT GTA G-3′; tsp-miR-31 5′-AGG CAA GAT GTT GGC ATA GCT GA-3′; tsp-novel-108 5′-CTT GGC ACT GTA AGA ATT CAC AGA-3′; tsp-novel-83 5′-TTG AGC AAT TTT GAT CGT AGC-3′; tsp-novel-46 5′-TGG ACG GCG AAT TAG TGG AAG-3′; tsp-novel-86 5′-TGA GAT CAC CGT GAA AGC CTT T-3′; tsp-novel-21 5′-TCA CCG GGT AAT AAT TCA CAG C-3′. [score:2]
The biological function of miRNAs was first demonstrated in C. elegans, where two miRNAs (Let-7 and Lin-4) were shown to be regulators for stage-specific differentiation of the worm [17], [18]. [score:2]
The oligonucleotide probes used for hybridization are as follows: tsp-mir-100 probes: 5′ACACAA*GTTC*GGATCT*AC*GGGTT3′ tsp-let-7 probes: 5′AACTAT*ACA*ACCT*ACT*ACCTCA3′ tsp-novel-108 probes: 5′TCT*GT*GAATTCTT*ACA*GTGCCAAG3′ tsp-novel-83 probes: 5′GCTAC*GATC*AA*AATT*GCTCAA3′ (LNA (Locked nucleic acid) substitutions are indicated by a “*”). [score:1]
0026448.t001 The sequencing data showed that, of the 21 conserved miRNAs, tsp-let-7 and tsp-miR-87 were found to locate only in the 3′ arm of their pre-miRNAs, and tsp-miR-31 was located only in the 5′ arm of the hairpin structures. [score:1]
Five conserved miRNAs (tsp-miR-228, tsp-miR-100, tsp-let-7, tsp-miR-1 and tsp-miR-31) and five novel miRNAs (tsp-novel-108, tsp-novel-83, tsp-novel-46, tsp-novel-86 and tsp-novel-21) with relatively higher TPM values identified by sequencing were validated by qRT-PCR and Northern blot. [score:1]
0026448.t001The sequencing data showed that, of the 21 conserved miRNAs, tsp-let-7 and tsp-miR-87 were found to locate only in the 3′ arm of their pre-miRNAs, and tsp-miR-31 was located only in the 5′ arm of the hairpin structures. [score:1]
The reason for tsp-let-7 being found less common in NBL is not known. [score:1]
The oligonucleotide probes used for hybridization are as follows: tsp-mir-100 probes: 5′ACACAA*GTTC*GGATCT*AC*GGGTT3′ tsp-let-7 probes: 5′AACTAT*ACA*ACCT*ACT*ACCTCA3′ tsp-novel-108 probes: 5′TCT*GT*GAATTCTT*ACA*GTGCCAAG3′ tsp-novel-83 probes: 5′GCTAC*GATC*AA*AATT*GCTCAA3′ (LNA (Locked nucleic acid) substitutions are indicated by a “*”). [score:1]
Their homologs, tsp-miRNA-100 and t sp-let-7, were found throughout the life cycle of T. spiralis. [score:1]
The abundance of tsp-miRNA-100 was almost identical with that of tsp-let-7 in both Ad and ML stage, indicating that miRNA-100 may be more functional in NBL stage. [score:1]
[1 to 20 of 13 sentences]
15
[+] score: 20
The TGFBR1 gene, which mediates the action of TGF-β, is a predicted target gene of the let-7/miR-98 family according to TargetScan 4.2 (containing conserved sites for let-7a-g and i, and for miR-98). [score:5]
A likely scenario, in the early stage, is that let-7 expressed higher and miR-21 level is lower, which inhibits TGF-β signaling that is necessary for lung regeneration. [score:5]
Taken together, the changes in let-7 and miR-21 expression level create an unopposed profibrotic balance in RILI development. [score:4]
Whereas in the late stage, let-7 expressed at a relatively low level and miR-21 level is higher, which may allow an enhanced TGF-β signaling activity that is necessary for lung fibrosis. [score:3]
Regulation of TGFBR1 by let-7 and SMAD7 by miR-21, which was suggested by our results, may further fine-tune the TGF-β signaling activity to the necessary level at each RILI developmental stage. [score:3]
[1 to 20 of 5 sentences]
16
[+] score: 19
In addition to regulating apoptosis by targeting caspase-3 [10], it was also demonstrated that let-7 family members regulate RAS and HMGA2 oncogene through the 3'UTR [53- 55]. [score:5]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
Let-7a, a member of the let-7 family, is associated with apoptosis by directly targeting caspase-3 [10]. [score:4]
In general, let-7 family members were upregulated at 3 days, and decreased at 8 days of differentiation. [score:4]
Let-7 was first identified in Caenorhabditis elegans and reported to control the timing of fate specification during larval development [11]. [score:1]
The let-7 family consists of eleven very closely related genes [51]. [score:1]
[1 to 20 of 6 sentences]
17
[+] score: 19
Patel K Kollory A Takashima A Sarkar S Faller DV Ghosh SK MicroRNA let-7 downregulates STAT3 phosphorylation in pancreatic cancer cells by increasing SOCS3 expressionCancer Lett. [score:6]
Chen Z Wang D Gu C Liu X Pei W Li J Down-regulation of let-7 microRNA increased K-ras expression in lung damage induced by radonEnviron Toxicol Pharmacol. [score:6]
Moreover, let-7 expression also negatively correlated with the severity of PAH in patients with systemic scleroderma [19]. [score:3]
Sun T Fu M Bookout AL Kliewer SA Mangelsdorf DJ MicroRNA let-7 regulates 3 T3-L1 adipogenesisMol Endocrinol. [score:2]
Izumiya Y Jinnn M Kimura Y Wang Z Onoue Y Hanatani S Expression of Let-7 family microRNAs in skin correlates negatively with severity of pulmonary hypertension in patients with systemic sclerodermaIJC Heart & Vasculature. [score:2]
[1 to 20 of 5 sentences]
18
[+] score: 18
The most downregulated miRNA during EB formation was miR-let-7a, which is of interest because let-7 has been shown to regulate developmental timing in Caenorhabditis elegans [22]. [score:6]
RISC -mediated target RNA cleavage activity was determined by in vitro cleavage of a [32]P-target mRNA that perfectly matched the miR-302b or let-7 sequence. [score:5]
Fig 4A demonstrates the specific expression of miR-302b and let-7 in hES and HeLa cells, respectively. [score:3]
Conversely, let-7 RISC in HeLa extracts cleaved let-7 target RNA while hES RISC did not show detectable activity in this experiment. [score:3]
Since let-7a is abundant in HeLa, we selected let-7 as a control in our experiments. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 16
A strong decrease of let-7 expression levels has been associated with an aberrant overexpression of HMGA1 and HMGA2 in several human highly malignant carcinomas (58, 59). [score:5]
Moreover, HMGA2 overexpression correlated with low levels of let-7, a miRNA able to target and repress HMGA2, and with p53 (40). [score:5]
A more recent study confirmed that HMGA2 is highly expressed in metastatic lung adenocarcinoma, where it contributes to cancer progression and metastasis by acting as a competing endogenous RNA for let-7 miRNA family (47). [score:3]
Moreover, it is worthy to note that the 3′-UTR of HMGA2 carries as many as seven let-7 binding sites, then taking also part in the modulation of HMGA1 expression levels (47). [score:3]
[1 to 20 of 4 sentences]
20
[+] score: 15
In our miRNA-analysis, let-7a, let 7c and let-7f had the greatest amount of experimentally verified target mRNAs among the dysregulated genes supporting the role of Let-7 family of miRNAs as a putatively important regulator of cardiac hypertrophic response through their gene target [59]. [score:7]
In addition, the analysis of regulatory pathways as well as miRNA-mRNA interactions predict that Nrf2 and IRF transcription factors as well as the let-7 family of miRNAs are playing roles in the regulation of mechanical stretch induced gene expression response in cardiomyocytes and these may help in elucidating the genes and regulatory pathways underlying cardiac hypertrophy. [score:6]
At present, little is known about the role of Let-7 family of miRNAs in stretched cardiomyocytes but analyses of mechanosensitive miRNAs associated with muscular dystrophies indicated that the let-7 family was dysregulated in mice with muscular dystrophies with myositis (mdm-mice) [61]. [score:2]
[1 to 20 of 3 sentences]
21
[+] score: 14
The microarray results presented here also demonstrated decreased expression of let-7e-3p, and both the microarray and real-time PCR validation from our study demonstrated decreased expression of miR-455-3p. [score:5]
The top pathways that were identified to be affected by the altered miRNA expression profile in the Cd -treated HepG2 cells were focal adhesion and the MAPK signaling pathway, and members of the let-7 miRNA family are known to serve a tumor suppressor role [58, 59]. [score:5]
Fabbri et al. treated HepG2 human hepatoma cells with 10 µM Cd for 24 h and reported decreased expression of 12 miRNAs, including members of the let-7 family (let-7a, let-7b, let-7e, and let-7g) and miR-455-3p [58]. [score:3]
Boyerinas B. Park S. M. Hau A. Murmann A. E. Peter M. E. The role of let-7 in cell differentiation and cancerEndocr. [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 13
Among these miRNAs, Let-7 is involved in the airway inflammation by directly regulating IL-13 expression [51]. [score:5]
The down-regulated miRNAs included miR-24, miR-26a, miR-126, and Let-7 family members. [score:4]
We also found that Let-7 family was down-regulated in ARDS. [score:3]
Let-7 is also a regulator of apoptosis in tumors [44]. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 12
We selected up-regulation of oncogenic miRNAs such as mir-21 as well as down-regulation of the tumor suppressor miRNAs Let-7e, mir-135a, and mir-375 for our analysis. [score:9]
Moreover, the oncogenic miRNA, mir-21 was increased 3.8 fold, whereas the tumor suppressor miRNAs, Let-7e, mir-135a, and mir-375 were decreased by 2.9, 2.7 and 5.9 fold, respectively. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 12
Althogether these studies strongly suggest that an up-regulation of most, if not all, members of the let-7 and miR-7 families and of the miR-132/212 cluster marks hypothalamus development while miR-9, miR-124a, miR-145 and miR-219 displayed nucleus-specific regulations of expression. [score:8]
Our data also established the up-regulation of all members of the let-7 and miR-7 gene families, as well as that of the four miRNAs encoded by the miR-132/212 cluster, i. e. miR-132-3p, miR-132-5p, miR-212-3p and miR-212-5p, when comparing stages P14 and P28. [score:4]
[1 to 20 of 2 sentences]
25
[+] score: 11
Six candidate miRNAs that are predicted to target caspase-3 (let-7, miR-138, miR-30b, miR-129, miR-203, and miR-219-5p) and have an aggregate Pct greater than 0.2 were selected (Fig.   1c). [score:3]
Since we did not examine the effect of other let-7 family members on caspase-3 expression in the present study, it is difficult to draw any conclusion on the specificity of let-7b in MSCs. [score:3]
Furthermore, members of the let-7 family—namely let-7a, let-7e, and let-7 g—have also been reported to target caspase-3 in cancer cells, PC12 cells, and endothelial cells, respectively [26, 34, 35]. [score:3]
Aside from the miRNAs that are not members of the let-7 family, the predicted binding sequence of let-7 family members (a, b, c, d, e, f, g, and i) to the 3′ UTR of human caspase-3 is identical. [score:1]
This is one of the limitations of the present study, and specific roles of individual let-7 family members on the cell survival, especially of MSCs, will be an interesting subject of further study. [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 11
BDNF regulates protein synthesis via let-7. BDNF stimulation upregulates Lin28, an RNA binding protein that can bind precursors of let-7, preventing them from being processed by the Dicer–TRBP machinery. [score:5]
The resulting diminished levels of mature let-7 miRNAs relieve repression of mRNAs with let-7 binding sites and permit their translation (32). [score:3]
In addition, let-7 regulates dendritic spine density along the length of neurons (33). [score:2]
Let-7 is involved in neurogenesis (30) as well as neuronal development and function (31). [score:1]
[1 to 20 of 4 sentences]
27
[+] score: 11
In endometriosis, the upregulation of H19 expression was shown to promote endometriotic stromal cell proliferation through the downregulation of let-7 to target IGF1R [12]. [score:11]
[1 to 20 of 1 sentences]
28
[+] score: 10
For example, rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p are most highly expressed in both HF and control group in our study, which was consistent with the previous studies that rno-miR-133, rno-miR-1 and rno-miR-499 are highly expressed in the heart[26], and miR-1, let-7 and miR-133 are highly expressed in the murine heart[27]. [score:7]
The most highly expressed miRNAs were rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p in both HF and control group. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 10
All Let-7 family members are believed to have similar functions because they share a common seed region (nucleotides 2–8), which mediates interactions between miRNA and target mRNAs [25]. [score:3]
Mice with global overexpression of Let-7 are viable, but they have reduced body size and weight [25]. [score:2]
Among them, five members of the Let-7 family (mmu-let-7a, mmu-let-7b, mmu-let-7c, mmu-let-7f, and mmu-let-7i) were dysregulated in response to obesity and weight reduction following LFD feeding. [score:2]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
In mice, 12 genes encode members of the Let-7 family, which includes nine slightly different miRNAs (Let-7a, Let-c, and Let-7f [all encoded by two genes], and Let-7b, Let-7d, Let-7e, Let-7g, Let-7i, and miR-98 [all encoded by one gene]). [score:1]
Furthermore, Let-7 transgenic mice exhibit impaired glucose tolerance because of diminished glucose -induced insulin secretion, and anti-miR–induced silencing of Let-7 has been proven to improve blood glucose levels and insulin resistance in obese mice [25]. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Our previous studies demonstrated that an irreversible let-7 downregulation is a necessary step for MCS to display its full carcinogenic effect [98, 104]. [score:4]
Conversely, the let-7 irreversible downregulation is a hallmark of malignant lung cancer, including adenocarcinoma in mice [6, 102] and nonsmall cell lung cancer (NSCLC) in humans [103]. [score:4]
An important difference between benign and malignant lung lesions induced by MCS is the maintenance of let-7 homeostasis. [score:1]
The data obtained in the present study provide evidence that the let-7 family, whose a-f isoforms were spotted on the microarray used, was not altered in either microadenoma or adenoma. [score:1]
[1 to 20 of 4 sentences]
31
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
miRNA-target prediction showed that MRAK088388 and N4bp2 had the same MRE for miR-29b-3p, whereas MRAK081523 and Plxna4 had the same MRE for let-7. To identify the ceRNA interaction between MRAK088388 and N4bp2, as well as between MRAK081523 and Plxna4, we detected whether they are co-expressed in lung tissues by using qRT-PCR. [score:5]
Let-7 isoform let-7d expression significantly decreases and has a key regulatory function in IPF [46], but the function of let-7i has not been reported. [score:4]
By the same method, we found that MRAK081523 and Plxna4 had the same MREs for miR-218, miR-141, miR-98 and let-7. Plxna4 reportedly promotes tumour progression and tumour angiogenesis by enhancing VEGF and basic fibroblast growth factor signalling [44]. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 9
Experimentally, over -expression of let-7 can inhibit lung cancer cell growth in vitro. [score:5]
The reduction in the expression of let-7 in human lung cancers is correlated to increased death rates in patients [62]. [score:3]
This discovery shows that let-7 may have potential clinical value in treating lung cancers. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 9
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We speculate that some of the developmentally regulated microRNAs we describe in this report play roles in the control of mammalian brain development, possibly by controlling developmental timing, by analogy to the roles of the lin-4 and let-7 microRNAs in C. elegans. [score:5]
In C. elegans, lin-4 and let-7 act in developmental timing, and the microRNA lsy-6 controls neuronal asymmetry [19]. [score:2]
A second heterochronic gene, let-7, encodes another small non-coding RNA that is conserved in flies and mammals [5]. [score:1]
Like the lin-4 and let-7 genes, other microRNAs encode 21-25-nucleotide RNAs derived from longer transcripts that are predicted to form stem-loop structures. [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 9
On the one hand, previous studies have suggested that let-7 can suppress the expression of MOR [43], and our previous results suggest miR-365 can modulate morphine tolerance by targeting the beta-arrestin 2 protein [11]. [score:7]
Among ncRNAs, some studies have reported that miRNAs are involved in the development of morphine tolerance [7, 8], including the let-7 family, miR-23b [9], miR-133b, miR-339 [10], miR-365 [11] and miR-219-5p [12]. [score:2]
[1 to 20 of 2 sentences]
35
[+] score: 9
MicroRNA let-7 and its family members have been reported to participate in many diseases including kidney diseases. [score:5]
Also, let-7 family members regulated collagen expression in glomerular mesangial cells under diabetic conditions [20]. [score:4]
[1 to 20 of 2 sentences]
36
[+] score: 8
Metformin treatment has been shown to inhibit c-myc expression by up -regulating let-7 family (tumor suppressor) [11]. [score:8]
[1 to 20 of 1 sentences]
37
[+] score: 7
All let-7 family members show anti-viral properties during flavivirus infection [34], and in human cell culture, let7-c targets IL-10 to reduce IL-10 expression levels [39]. [score:5]
Most have not been associated with virus infection; however three, miR-122, miR-324 and let-7, have been identified in studies of host responses to viruses [34– 36]. [score:1]
Let-7 family miRNAs have also been shown to have immunomodulatory function. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 7
Because the target genes of let-7 (MOR) and miR-23b (MOR1) interact with the target gene of miR-365 (β-arrestin 2), we cannot rule out that there may be a relationship between these miRNAs and miR-365. [score:5]
Previous studies have reported that multiple miRNA -based pathways, such as let-7 and miR-23b, contributed to morphine tolerance 10 27, and some of these show the same deregulation pattern of miR-365. [score:2]
[1 to 20 of 2 sentences]
39
[+] score: 7
Our previous study has reported that after sciatic nerve injury, the differentially expressed let-7 miRNAs regulate SC phenotype by directly targeting NGF and affect sciatic nerve regeneration 20. [score:7]
[1 to 20 of 1 sentences]
40
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
In breast cancer cells, over -expression of miR-221, miR-222, let-7 and miR-20b is associated with reduced of ERα protein content, signaling and expression of ERα target genes [47- 49]. [score:7]
[1 to 20 of 1 sentences]
41
[+] score: 7
Three miRNAs (upregulated miR-483 and downregulated let-7e and miR-199a) exhibited significantly fold changes (Fig.   1). [score:7]
[1 to 20 of 1 sentences]
42
[+] score: 7
Wang S Let-7/miR-98 regulate Fas and Fas -mediated apoptosisGenes Immun. [score:2]
Su J Chen P Johansson G Kuo ML Function and regulation of let-7 family microRNAsMicrorna. [score:2]
MiR-98 is one of the members of the let-7 miRNA family, which is first discovered to control the developmental timing of cell differentiation and proliferation in C. elegans 12, 13. [score:2]
Therefore, let-7/miR-98 miRNAs are considered as an oncomir family crucial in regulating cell cycle and apoptosis [15]. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 7
Both in silico analyses using a variety of prediction algorithms, as well a large body of experimental literature [35]– [42] indicated that Let-7 and miR1 target multiple components of the IGF signaling cascade, ranging from mRNA binding proteins that coordinate the translation of IGFs to members of the IGF family, their receptors and downstream signaling pathways. [score:5]
Our two presumptive IGF pathway interacting miRNAs, Let-7 and miR1 as well as our control, miR124, represent three members of a small family of five miRNAs that have been conserved throughout bilaterian evolution (from invertebrates to mammals) [47], and the functions of the Let7 family, in particular, exhibit strong evolutionary conservation [43]. [score:1]
J Cell Mol Med 43 Roush S Slack FJ 2008 The let-7 family of microRNAs. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 7
Interestingly, a recent study demonstrated that loss of let-7 up-regulates EZH2 in prostate cancer with the acquisition of cancer stem cell signatures [60], suggesting that let-7 functions to promote cell differentiation through repression of EZH2 in prostate cancer. [score:4]
For example, many target genes of miRNAs let-7, mir-1, and mir-145 were hypermethylated in cells cultured under AR-inducing conditions for 3 days compared to 1 day (Table S6), suggesting a promoting role of these microRNAs in secretory differentiation of prostatic epithelial cells. [score:2]
Our results indicate that let-7 may play a similar role in normal prostatic epithelial cells. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 7
miR-448, let-7b, miR-540, miR-296, miR-880, miR-200a, miR-500, miR-10b, miR-336, miR-30d, miR-208, let-7e, miR-142-5p, miR-874, miR-375, miR-879, miR-501, and miR-188 were upregulated, while miR-301b, miR-134, and miR-652 were downregulated in TMH group (Table 5). [score:7]
[1 to 20 of 1 sentences]
46
[+] score: 6
Frost and Olson (24) demonstrated that both global and pancreas-specific overexpression of let-7 in mice resulted in impaired glucose tolerance and reduced glucose -induced pancreatic insulin secretion. [score:3]
Inhibition of the let-7 family prevents impaired glucose tolerance in mice with diet -induced obesity, partially by improving insulin sensitivity in the liver and muscle (24). [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 6
Although it has been reported that brain-specific miR-124, miR-125b and let-7 are expressed in mouse and rat eye lenses [27– 30], no studies have involved the spatial and temporal expression profiles of miRNAs in lens development and cataractogenesis. [score:6]
[1 to 20 of 1 sentences]
48
[+] score: 6
The let-7 family was the second miRNA family identified as a regulator of developmental timing and cell proliferation; however, it is becoming more apparent that they also mediate immune responses and adjust inflammation [41]. [score:3]
Guo et al. have reported that let-7b, a member of the let-7 family, has differential expression patterns in inflamed tissues compared with healthy controls [43]. [score:2]
Pobezinsky et al. discovered that the let-7 miRNA is pivotal for the terminal differentiation and cytokine effector function of natural killer T cells [42]. [score:1]
[1 to 20 of 3 sentences]
49
[+] score: 6
27, 28 Kallen et al. [29] reported that the increased expression of paternally imprinted H19 lncRNA may act as a sponge for let-7, thereby explaining the downregulation of this miRNA in non-small-cell lung cancer types. [score:6]
[1 to 20 of 1 sentences]
50
[+] score: 6
On the other hand, corresponding ethanol effects in the ventral striatum revolved around cell death processes with inhibition of RNAs including MAP3K2 and upregulation of RNAs like let-7 (Figure 5, left). [score:6]
[1 to 20 of 1 sentences]
51
[+] score: 5
As positive controls, differentiation miRNA let-7 showed lower expression while miR-17 showed higher expression in c-kit(+) progenitors (Figure 1E). [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 5
It was found to be a putative target for let-7 family members, miR-26ab, miR-181 family, miR-150, miR-27b, miR-23ab, miR-425, miR-125a-5p, and miR-128ab. [score:3]
According to our in silico analysis, Ppar γ is likely regulated by microRNAs like let-7 family members, miR-30 family members, miR-27b, miR-23ab, miR-93, miR-25, miR-128ab, miR-320, and miR-135. [score:2]
[1 to 20 of 2 sentences]
53
[+] score: 5
In the PH-group, 49 miRNAs were significantly deregulated (e. g., rno-miR-26a/b, rno-miR-125b-5p and various members of the let-7 family), showing an expression change to at least ≤ 0.8 or ≥ 1.2 compared to normal healthy liver [6], while 45 miRNAs showed significant expression changes in liver samples of animals undergoing SL (Table 1). [score:5]
[1 to 20 of 1 sentences]
54
[+] score: 5
Given that let-7 family members are normally ascribed a tumor suppressor function, the authors speculated that a high let-7a/low miR-206 ‘signature’ might designate colon tumors with a unique phenotype in terms of cancer progression, compartmentalization, or microenvironment [33]. [score:3]
Loss of let-7a, and of other let-7 family members, coincided with changes in other high-abundance miRNAs in the heterocyclic amine -induced rat colon tumors examined here [24]. [score:1]
In a recent investigation of carcinogen -induced rat colon tumors [24], we identified a loss of multiple let-7 family members coinciding with increased expression of miRNA -binding proteins Lin28A/Lin28B, as well as the stem-cell factors c-Myc, Sox2, Oct-3/4, and NANOG. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 5
For example, Let-7 binds to 3′-UTR of MOR to repress its expression [12]. [score:2]
In a previous study, we demonstrated the deregulation of nine different miRNAs in rat spinal cord after chronic morphine injection, including let-7, miR-365 and miR-219-5p (miR-219) [4]. [score:2]
In addition to let-7 and miR-23b, other miRNAs involved in morphine tolerance include miR-124, miR-190, miR-103 and miR-93-5p [14– 17]. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 5
These comparisons revealed that the highly expressed miRNAs from our study were also reported in the study by Timo Brandenburger et al. [20]; they showed that miR-124, the let-7 family and miR-34b-3p belonged to the group of highly expressed miRNAs in the rat spinal cord. [score:5]
[1 to 20 of 1 sentences]
57
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
They demonstrated that there is a relationship between the expression profiles and the staged embryo temporal regulation of a large class of miRNAs, such as members of the let-7 family. [score:4]
[1 to 20 of 1 sentences]
58
[+] score: 4
For example, evidence indicate that let-7, miR-140 and miR-92a are crucial for skeletal development [4– 5]; and deficiency of these miRNAs suppress the proliferation as well as the differentiation of growth plate chondrocytes, leading to a dramatic growth defect [4– 5]. [score:4]
[1 to 20 of 1 sentences]
59
[+] score: 4
Murakami et al. reported that 11 miRNAs including miR-34, miR-199a-5p, miR-199, miR-200, and let-7e were up-regulated in a CCl [4] -induced fibrosis mo del mouse [31]. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 4
Recent studies have partially verified this hypothesis; e. g., let-7 miRNA expression can be observed in ESC and progenitor cells, but is absent in breast cancer stem cells. [score:3]
The reintroduction of let-7 into these cells causes differentiation and reduction of proliferation and tumor-forming ability. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 4
Worringer KA Rand TA Hayashi Y Sami S Takahashi K Tanabe K The let-7/LIN-41 pathway regulates reprogramming to human induced pluripotent stem cells by controlling expression of prodifferentiation genesCell Stem Cell. [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
David Baulcombe who discovered let-7 miRNA in plants [148] (see also http://www. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 4
Following 10 days of bedrest, 15 miRs were downregulated in biopsies from the vastus lateralis, including miR-23a and miR-206, and let-7 family members [13]. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 3
A previous study demonstrates that signal transducers and activators of transcription 3 (STAT3)-coordinated Lin-28-let-7-HMGA2 and miR-200-ZEB1 circuits initiate and maintain oncostatin M -driven EMT 5. The interplay of these EMT activators, such as HMGA2 and ZEB1 6– 8, represses E-cadherin expression. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
Qian P et al also observed that the p44/42 MAPK-matrix metalloproteinase (MMP)-2/MMP-9 pathway can be used to enhance mammary carcinoma cell migration and invasion consequent to let-7 g depletion by increasing the expression of Gab2 and fibronectin1 (40). [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
Guo WT Wang XW Yan YL Li YP Yin X Zhang Q Suppression of epithelial-mesenchymal transition and apoptotic pathways by miR-294/302 family synergistically blocks let-7 -induced silencing of self-renewal in embryonic stem cellsCell Death Differ. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Other miRNAs shown to regulate neuronal lineage commitment include members of the let-7 family and miR-125b (Leucht et al., 2008; Rybak et al., 2008). [score:2]
A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 3
Let-7 miRNA have been predicted or experimentally confirmed in a wide range of species including human to C. elegans. [score:1]
The hsa-miR-mit-2 has three matches with let-7 human miRNA, that is, hsa-let-7i, hsa-let-7b, and hsa-let-7g. [score:1]
The miRNA let-7 family was well represented. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 3
Four of the 18 novel miRNAs were among the 50 most highly expressed miRNAs in the rat DRG (mmu-miR-486-5p, rnoH-miR-148a-3p, rnoH-let-7 g and rnoH-miR-676-3p, set in italics in Additional file 1: Table S1). [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Other miRNAs that were abundantly expressed after FNS include the let-7 family members. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Temporal lobe epilepsy induces differential expression of hippocampal miRNAs including let-7e and miR-23a/b. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Members of the let-7 family of miRNAs (7a, 7c, 7f, and 7b) exhibit the highest expression levels throughout the life span. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
2) Some miRNAs, including let-7 family (let-a, -b and -c), miR-16, miR-23b, miR-26, miR-31 and miR-375, were always highly expressed either before or after transdifferentiation (data not shown). [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 2
Circulating let-7 levels in plasma and extracellular vesicles correlate with hepatic fibrosis progression in chronic hepatitis c. Hepatology 64, 732– 745. [score:1]
Identification of blood let-7e-5p as a biomarker for ischemic stroke. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 2
Li S Let-7 microRNAs regenerate peripheral nerve regeneration by targeting nerve growth factorMol. [score:2]
[1 to 20 of 1 sentences]
76
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 2
Mir-98 is a member of the let-7 family, highly conserved across species in sequence and function and involved in the developmental timing of cell fates (reviewed [40]). [score:2]
[1 to 20 of 1 sentences]
78
[+] score: 2
In cancer cells, miR-326 [17], miR-34a [18], miR-206 [19], let-7 [35] have been shown to regulate the Notch signaling pathway. [score:2]
[1 to 20 of 1 sentences]
79
[+] score: 2
MiR-195, let-7e, miR-15, miR-133a, and miR-30 did not show any significant difference between burn rats and sham rats (Figure 1A) (P>0.05). [score:1]
We assessed the levels of let-7b, let-7e, miR-194, miR-15, miR-133a, miR-15, and miR-195 (as a non-specific control) by real-time PCR. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 2
Several candidate therapeutic miRNAs have progressed into clinical and preclinical development; for example, antisense miR-122 is being developed as a treatment for hepatitis C virus, miR-208/499 for chronic heart failure, miR-195 for myocardial infarction and miR-34 and let-7 for cancer 10, 11. [score:2]
[1 to 20 of 1 sentences]
81
[+] score: 2
Numerous miRNAs have been identified in nearly all metazoan genomes examined since the discovery of the two first miRNAs, lin-4 and let-7 [12, 15, 16], and many studies have reported that miRNAs can influence hormone regulation. [score:2]
[1 to 20 of 1 sentences]
82
[+] score: 2
The miRNA family, let-7i and let-7 have been found to regulate the key features of breast cancer stem cells like a self-renewal, multipotent differentiation and tumorigenicity [29]. [score:2]
[1 to 20 of 1 sentences]
83
[+] score: 2
B) The level of let-7e, miR-212-3p, miR-546 and miR-710 in exosomes from MIN6B1 treated or not with cytokines for 48 h cells was determined by qPCR. [score:1]
For example, miR-546 and miR-710 were increased in response to cytokines whereas let-7e and miR-212-3p were more abundant in exosomes of untreated MIN6B1 cells (see Additional file 3: Figure S2B for confirmation of these results by qPCR). [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 2
Top and middle panels; Two members of the Let-7 family (Let-7a and Let-7e) were spiked into yeast total RNA and 10 ng of yeast total RNA containing 2*10 [8] copies of the selected miRNA (or 3.3 fmol) were reversed transcribed using the miQPCR. [score:1]
16.5 fmol (equivalent to 1*10 [9] copies) of synthetic miRNAs (Let-7a, Let-7b, Let-7c, Let-7d, Let-7e and Let-7f) were spiked into 50 ng of yeast RNA. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 1
The first two miRNAs, lin-4 and let-7, were discovered in the Caenorhabditis elegans [13], [14]. [score:1]
[1 to 20 of 1 sentences]
86
[+] score: 1
We found four microRNAs (LET-7, MIR-100, MIR-125, and MIR-126) that could detect teratomas and had previously been associated with oncogenic transformations (Gu et al., 2015, Wu et al., 2015). [score:1]
[1 to 20 of 1 sentences]
87
[+] score: 1
In the 3′UTR sequences of the collagen-1 and collagen-4 mRNA, potential binding sites for the members of the let-7 family were detected. [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
Kallen AN The imprinted h19 lncrna antagonizes let-7 micrornasMol. [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
lin-4 and let-7 miRNAs are the apparent exceptions to the generic scheme [7]. [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
For example, the miR-125 and let-7 microRNAs are dramatically induced at puparium formation, in tight temporal synchrony with the 20E primary-response E74A mRNA, but do so in a manner that is independent of either 20E or EcR [24]. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
Recent research showed that hypothalamus let-7, miR-148a, miR-124, miR-107 and miR-370 were confirmed to be related to EA tolerance (Cui et al., 2017). [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
A relatively long, polyadenylated transcript encoded by the Caenorhabditis elegans let-7 gene undergoes trans-splicing to the spliced leader 1 (SL1) RNA to generate a mature microRNA [57]. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
Another mechanism contributing in apoptosis is Let-7/CD95/p53/miR-34a pathway [61]. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Let-7 mutants exhibit temporal misregulation of NMJ maturation 40. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
Analyzing the known examples [18], we and others find that miRNA precursors generally assume simple hairpin structures (except some member of the let-7 family), longer than about 50 nucleotides. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
At present, important genes in the hypothalamus related to the onset of puberty include the Kiss-1/GPR54 system [21, 22], NPY [23, 24], Leptin [25, 26], LIN28B/let-7 [27] and NKB [28– 30]. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
8 -55.3 -90.4 mmu-miR-34c* -3.7 -1.7 -6.5 mmu-miR-709 -2.9 -2.4 -4.3 mmu-miR-326 -3.9 -2.9 -5.6 rno-miR-664 -1.8 -2.2 -3.6 mmu-miR-350 -1.4 -110.5 -5.1 mmu-let-7e 1.4 -7.6 -5.1 mmu-miR-542–5p -1.9 -5.2 -5.1 rno-miR-20b-5p -3.0 -4.5 -5.0 mmu-miR-374 -1.7 -3.7 -4.4 To understand the cardiovascular benefit of resveratrol in ischaemia/repurfusion, we included longevinex, a commercial formulation of resveratrol by gavage to rat. [score:1]
[1 to 20 of 1 sentences]