sort by

78 publications mentioning rno-mir-9a-3

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-9a-3. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 285
These results support the hypothesis that the sNPFR1 and NPY2R mRNAs are legitimate targets of miR-9a/miR-9. To further support our hypothesis that miR-9a inhibits growth and suppresses insulin signalling via its target sNPFR1, we simultaneously overexpressed both miR-9a and sNPFR1 in the Drosophila IPCs. [score:11]
These results support the hypothesis that the sNPFR1 and NPY2R mRNAs are legitimate targets of miR-9a/miR-9. To further support our hypothesis that miR-9a inhibits growth and suppresses insulin signalling via its target sNPFR1, we simultaneously overexpressed both miR-9a and sNPFR1 in the Drosophila IPCs. [score:11]
To further verify the expression of miR-9a in larval and adult IPCs, we examined Tubulin–GFP–miR-9a sensor lines 9 (Fig. 2d) whose ubiquitous expression of GFP is suppressed in miR-9a -expressing cells. [score:9]
In the IPCs, miR-9a is likely mediating its effects by targeting the known positive regulator of insulin expression sNPFR1 as miR-9a [−/−] null mutants express elevated levels of sNPFR1 (Supplementary Fig. 7). [score:8]
Dilp2 expression is restored in miR-9a [E39/J22] null mutants by simultaneous IPC-specific miR-9a overexpression (miR9a [−/−] +Dilp2>miR-9a), but Dilp3 expression is further reduced. [score:7]
IPC-specific overexpression of miR-9a also reduces body size, while knockdown of miR-9a via expression of a miR-9a sponge increases body size. [score:6]
These results indicate that miR-9a modulates body growth and metabolism by regulating IPC insulin expression and consequently insulin signalling in peripheral target tissues. [score:6]
This effect is likely caused by modulation of insulin expression, as miR-9a overexpression reduces Dilp2 levels, while miR-9a knockdown enhances Dilp2 levels (Fig. 3). [score:6]
miR-9 in mammals is expressed in both the brain and the pancreatic beta cells where it has been shown to regulate glucose levels via its targets onecut2 and sirt1 (refs 18, 19). [score:6]
miR-9a regulates growth and insulin signallingWe next increased miR-9a expression in the IPCs using UAS-miR-9a (Dilp2>miR-9a) and reduced miR-9a expression in the IPCs using UAS-miR-9a sponge (Dilp2>miR-9a sponge). [score:6]
When miR-9a expression is suppressed outside the IPCs (Dilp2-G80 [ts] ; Tub>miR-9a sponge, 18 °C), body length is significantly reduced compared with the Dilp2-G80 [ts] ; Tub-Gal4 control but Dilp2 expression is unchanged (Fig. 5b,c). [score:6]
Simultaneous sNPFR1 overexpression rescues the phenotypes induced by miR-9a overexpression. [score:5]
Of the candidate miR-9a targets predicted by Targetscan (www. [score:5]
In addition, we show that IPC-specific miR-9a overexpression rescues the Dilp2 expression of the null mutant (Fig. 4c–e; Supplementary Fig. 4b,d,f). [score:5]
We next increased miR-9a expression in the IPCs using UAS-miR-9a (Dilp2>miR-9a) and reduced miR-9a expression in the IPCs using UAS-miR-9a sponge (Dilp2>miR-9a sponge). [score:5]
When miR-9a is suppressed everywhere by shifting the Dilp2-G80 [ts] ; Tub>miR-9a sponge flies to the restrictive temperature, body length is also reduced and Dilp2 expression is increased like the phenotype we observed in miR-9a [−/−] null mutant flies (compare Fig. 5b,c with Fig. 4a,c). [score:5]
sNPFR1 and its orthologue NPY2R are targets of miR-9aSince the sequence of mature miR-9a is well-conserved from flies to humans (Fig. 1c), we reasoned that the miR-9a target responsible for the growth control phenotype may also be conserved. [score:5]
Although manipulation of miR-9a does not alter larval Dilp5 expression, IPC overexpression of miR-9a (Dilp2>miR-9a) reduces larval Dilp2 and Dilp3 mRNA levels, while reduction of miR-9a (Dilp2>miR-9a sponge) significantly increases larval Dilp2 mRNA levels (Fig. 3d–f). [score:5]
In further confirmation of our findings, Dilp2 expression in miR-9a [−/−] null mutant flies is increased like in flies whose IPCs express the miR-9a sponge (Fig. 4c). [score:5]
IPC-specific miR-9aoverexpression rescues Dlip2 expression of the miR-9a null mutant. [score:5]
When Dilp2-Gal80 [ts] is inactivated at 29 °C and miR-9a is ubiquitously suppressed (Dilp2-G80 [ts] ; Tub>miR-9a sponge), body length is less significantly reduced but Dilp2 expression is increased. [score:5]
As expected, the changes in wing cell size and number induced by miR-9a overexpression in the IPCs are rescued by simultaneous overexpression of sNPFR1 (Dilp2>miR-9a+sNPFR1) (Fig. 7f,g). [score:5]
The elevated concentration and development time required for the adult in situ may indicate either lower expression or some degree of probe degradation, but the staining was clearly specific as the miR-9a null mutant brains stained at the same time and under the same conditions were blank. [score:4]
We have uncovered a novel function for miR-9a in the regulation of insulin signalling and body growth through its target sNPFR1 in the Drosophila brain IPCs. [score:4]
Thus, miR-9a in the IPCs seems to regulate body growth via modulation of insulin expression. [score:4]
We next asked whether reduced sNPFR1 dosage (sNPFR1 [minos−/+] heterozygote) can restore body length and Dilp2 expression in the background of miR-9a knockdown via miR-9a sponge. [score:4]
In addition, the levels of haemolymph glucose and trehalose rise with miR-9a overexpression and fall with miR-9a knockdown (Supplementary Fig. 6a). [score:4]
Contrary to expectations, we found that while sponge -mediated knockdown of miR-9a in the IPCs increases body size, miR-9a [−/−] null mutants and flies in which miR-9a is suppressed in non-IPCs show reduced body size. [score:4]
sNPFR1 heterozygous rescues the body length and Dilp2 expression by IPC-specific knockdown of miR-9a. [score:4]
These results confirm that miR-9a in IPCs regulates insulin signalling and body growth via its target sNPFR1 (Fig. 9). [score:4]
How to cite this article: Suh, Y. S. et al. Genome-wide microRNA screening reveals that the evolutionary conserved miR-9a regulates body growth by targeting sNPFR1/NPYR. [score:4]
Larval IPC-specific miR-9a overexpression (Dilp2>miR-9a) reduces activated pAKT, while miR-9a knockdown (Dilp2>miR-9a sponge) increases activated pAKT. [score:4]
We found miR-9a overexpression in the IPCs (Dilp2>miR-9a) reduces body length, wing length and pupal volume, while miR-9a knockdown in the IPCs (Dilp2>miR-9a sponge) increases body length, wing length and pupal volume (Fig. 3a–c; Supplementary Fig. 3a). [score:4]
Similar to our findings in Dilp2>miR-9a sponge flies, pAKT levels are increased and 4E-BP levels are decreased in the insulin target tissues of miR-9a [−/−] null mutants (Fig. 4f–h; Supplementary Fig. 5b). [score:3]
To further support the differential effects of miR-9a in the IPCs and in non-IPCs on body growth, we generated a Dilp2-Gal80 [ts] line that suppresses Gal4 activity in the IPCs at the 18 °C permissive temperature but not at the 29 °C restrictive temperature. [score:3]
sNPFR1 and its orthologue NPY2R are targets of miR-9a. [score:3]
This allowed us to visualize miR-9a expression in larval and adult brains. [score:3]
The sNPFR1 heterozygote also restores Dilp2 expression in the miR-9a sponge and miR-9a [−/−] null mutant backgrounds (Dilp2>miR-9a sponge+sNPFR1 [minos−/+]or miR-9a [−/−] +sNPFR1 [minos−/+]) (Fig. 8b,d). [score:3]
We were able to verify that miR-9a is endogenously expressed in the larval and adult IPCs via LNA in situ hybridization against the mature miRNA and via miR-9a sensor lines (Fig. 2; Supplementary Fig. 2). [score:3]
miR-9a is expressed in the insulin-producing cells. [score:3]
This defect can be rescued by simultaneous sNPFR1 overexpression (Dilp2>miR-9a+sNPFR1). [score:3]
Consistently, IPC overexpression of miR-9a (Dilp2>miR-9a) also reduces Dilp2, 3 and 5 mRNA levels, while reduction of miR-9a (Dilp2>miR-9a sponge) significantly increases Dilp2 mRNA levels (Supplementary Fig. 4a,c,e) in adult heads. [score:3]
Similar to the known miR-9a/miR-9 targets senseless 13 and Foxg1 (ref. [score:3]
In a miRNA overexpression screen using the IPC driver Dilp2-Gal4, we found that miR-9a and the closely related miR-9b dramatically reduce wing size (Fig. 1). [score:3]
The largest and most significant reductions in wing length are induced by overexpression of miR-9a, miR-9b and miR-79, which are all members of the conserved miR-9 miRNA family (Fig. 1c). [score:3]
miR-9a is expressed in the insulin-producing cells of brains. [score:3]
Thus, both our in situ hybridization and Tubulin–GFP–miR-9a sensor results demonstrate miR-9a expression in both larval and adult IPCs. [score:3]
Since UAS-miR-9a significantly reduces wing length via overexpression of a single miRNA, simplifying subsequent analyses, we focused the rest of our efforts on miR-9a. [score:3]
As expected, overexpression of miR-9a in the IPCs (Dilp2>miR-9a) reduces the level of pAKT in both larvae (Fig. 3g,h) and adults (Supplementary Fig. 5a) and increases the level of 4E-BP in adults (Fig. 3i). [score:3]
Although this staining seems to be widespread, its absence in the miR-9a mutants is consistent with some level of endogenous miR-9a expression in the IPCs of both larvae and adults (Fig. 2; Supplementary Fig. 2). [score:3]
Since the sequence of mature miR-9a is well-conserved from flies to humans (Fig. 1c), we reasoned that the miR-9a target responsible for the growth control phenotype may also be conserved. [score:3]
Transfection of miR-9a leads to enrichment of sNPFR1 and NPY2R mRNAs just like known target mRNAs senseless and foxg1 when normalized to rp49 and GAPDH levels. [score:3]
Indeed, overexpression of sNPFR1 rescues the reduced body and wing length phenotypes of Dilp2>miR-9a flies (Fig. 7a,b). [score:3]
Compared with the control (Dilp2-Gal4/+), overexpression of miR-9a in the IPCs (Dilp2>miR-9a) reduces both wing cell size and number, while knockdown of miR-9a (Dilp2>miR-9a sponge) increases wing cell size and number. [score:3]
miR-9a regulates growth and insulin signalling. [score:2]
Here we show that both fly sNPFR1 and mammalian NPY2R are targets of miR-9a/miR-9 by demonstrating direct binding of miR-9a/miR-9 to the sNPFR1 and NPY2R 3′-UTRs using an in vitro binding assay and a CLIP assay (Fig. 6). [score:2]
miR-9a regulates growth and insulin signalling. [score:2]
miR-9a regulates the insulin modulator sNPFR1 and its mammalian orthologue NPY2R. [score:2]
The body length, wing length and pupal volume of miR-9a [−/−] null mutants, however, are all reduced (Fig. 4a,b; Supplementary Fig. 3b), in seeming contrast with the results we observed in the Dilp2>miR-9a sponge flies. [score:1]
Dilp5 levels remain unchanged by miR-9a manipulation. [score:1]
To determine whether miR-9a directly binds to sNPFR1 and NPY2R mRNA, we designed primers to amplify fragments of their 3′-UTRs that include the predicted miR-9a seed sequence matches (Supplementary Table 4). [score:1]
In addition, miR-9a [−/−] null mutant flies produce significantly more sNPFR1 protein than the wild-type control strain (Supplementary Fig. 7). [score:1]
We performed a cross-linking immunoprecipitation (CLIP) assay to determine whether miR-9a binds directly to the sNPFR1 and NPY2R 3′-UTRs. [score:1]
An in situ hybridization with an LNA probe specific to the mature miR-9a sequence stains the IPCs in the w [1118] control genotype (b), but not in miR-9a [E39/J22] null mutant (miR-9a [−/−]) brains (c). [score:1]
We transfected the cells with either synthetic scrambled miR-9a or miR-9a duplex (Bioneer, Korea) (final concentration 80 μM) using Xtremegene HP (Roche, USA). [score:1]
In other words, loss of miR-9a in the IPCs alone increases growth while ubiquitous or non-IPC loss of miR-9a reduces growth (Figs 3a, 4a and 5b). [score:1]
The sNPFR1 heterozygote restores body length significantly in the miR-9a sponge (Dilp2>miR-9a sponge+sNPFR1 [minos−/+]) and slightly in the miR-9a [−/−] null mutants (miR-9a [−/−] +sNPFR1 [minos−/+]) (Fig. 8a,c). [score:1]
Compare with the Dilp2>miR-9a sponge, Dilp2-Gal4/+ and Dilp2-Gal4; sNPFR1 [minos−/+] controls. [score:1]
After transfection with either biotinylated miR-9a or a scrambled miRNA, we isolated the biotin–miRNA–RISC–mRNA complex with streptavidin beads. [score:1]
It will thus be interesting to see if the relationship we have uncovered between the miR-9, NPY, insulin signalling and body growth extends to in vivo mammalian mo dels despite the differences in anatomical location and embryonic origin of the IPCs. [score:1]
We found, however, that the level of Dilp2 mRNA is increased in both Dilp2>miR-9a sponge and miR-9a [−/−] null mutant flies and the level of the downstream signalling protein pAKT is significantly increased in the miR-9a mutants (Figs 3d,g and 4c,f). [score:1]
WT, sNPFR1 [minos−/+] and miR9a [−/+] +sNPFR1 [minos−/+] are the controls. [score:1]
This activation of insulin signalling in both the miR-9a sponge flies and the miR-9a [−/−] null mutants suggests that miR-9a has positive effects on growth in non-IPCs that are able to mask its negative effect on growth in the IPCs. [score:1]
We used a DIG -labelled miR-9a-specific LNA probe purchased from Exiqon (#88078-15) at 50 nM for larval brains and 250 nM for adult brains. [score:1]
Glucose and trehalose are also reduced in miR-9a [−/−] null mutant haemolymph as in the Dilp2>miR-9a sponge flies (Supplementary Fig. 6b). [score:1]
14), we found that miR-9a binds to and enriches sNPFR1 mRNA over RP49 control RNA in Drosophila S2 cells and NPY2R mRNA over GAPDH control RNA in rat insulinoma INS-1 cells (Fig. 6b,e). [score:1]
miR-9a inside and outside the IPCs differentially affects body growth. [score:1]
The larval and adult IPCs in the Tubulin–GFP–miR-9a sensor flies, here identified by a Dilp2-specific antibody, exhibit less GFP staining than surrounding cells (Fig. 2e,f). [score:1]
miR-9a sponges were provided by D. Van Vactor (Havard medical school, USA). [score:1]
These data reveal that miR-9a in the IPCs and in non-IPCs affect body growth differently. [score:1]
This suggests that miR-9a in non-IPCs may affect body growth differently than miR-9a in the IPCs. [score:1]
The UAS-miR-9a sponge contains 10 × miR-9a binding sites and tissue specifically reduces miR-9a levels by soaking up endogenous miR-9a molecules 10. [score:1]
Reduction of miR-9a in the IPCs (Dilp2>miR-9a sponge) increases the level of pAKT in larvae (Fig. 3g,h). [score:1]
Dilp2-Gal4 was provided by E. Rulifson (University of California San Francisco, USA), and miR-9a [J22] and miR-9a [E39] mutants were provided by F. B. Gao (University of Massachusetts Medical School, USA). [score:1]
We observed staining associated with miR-9a probe binding in both the larval (Supplementary Fig. 2) and adult PI regions in a control genotype (w [1118]) (Fig. 2b; Supplementary Fig. 2b), but not in homozygous miR-9a [−/−] null mutant brains stained under identical conditions (Fig. 2c; Supplementary Fig. 2c). [score:1]
Transfection with a scrambled version of miR-9a (Supplementary Table 3) causes no such enrichment. [score:1]
We were able to observe several two to six nucleotide deletions in the miR-9a seed sequence matches of random sNPFR1 and NPY2R 3′-UTR clones from both cell types transfected with miR-9a (Fig. 6a,d; Supplementary Table 5). [score:1]
Tubulin–GFP–miR-9a sensor was provided by E. Lai (Sloan-Kettering Institute, USA). [score:1]
This confirms that miR-9a binds to the 3′-UTRs of sNPFR1 and NPY2R. [score:1]
miR-9a is expressed in the insulin-producing cells of brainsTo investigate the mechanism by which miR-9a alters growth, we used a locked nucleic acid (LNA) probe specific to the mature form of miR-9a in an in situ hybridization experiment. [score:1]
Our results suggest an evolutionarily conserved relationship between the miR-9 family and the sNPF/NPY receptors (Fig. 9). [score:1]
[1 to 20 of 91 sentences]
2
[+] score: 272
Importantly, miR-9 expression has been downregulated in the brain of patients with Huntington's disease [38] and upregulated in the patients with Alzheimer's disease [39], suggesting that abnormal expression of miR-9 may be involved at least partially in the processes of neurodegenerative diseases. [score:17]
However, binding-site mutation or miR-masks failed to influence Navβ2 expression as well as Nav1.1/Nav1.2 trafficking process, indicating that Navβ2 is a potential target for miR-9. Lentivirus -mediated miR-9 overexpression also inhibited Navβ2 expression and elicited translocation deficits to cell membrane of Nav1.1/Nav1.2 in rats, whereas injection of lentivirus -mediated miR-9 knockdown could reverse the impaired trafficking of Nav1.1/Nav1.2 triggered by 2VO. [score:13]
To verify the transcriptional mechanism of miR-9 on Navβ2, the target protector technique was applied and the results showed that the SCN2B target protector (oligodeoxynucleotides (ODNs)-miR) of miR-9 (the position of 336–358 of SCN2B CDS) attenuated the reduction in Navβ2 levels induced by miR-9 (Fig.   4e, P < 0.01), implying that the SCN2B shows a great potential as the target for miR-9. Fig. 4MiR-9 downregulates the expression of Navβ2 proteins. [score:12]
AMO-9 rescued the downregulation of Navβ2 elicited by overexpression of miR-9 and scrambled negative control of microRNA failed to affect the protein levels, suggesting that miR-9 predominantly suppresses SCN2B translation (Fig.   4b, d). [score:10]
Negative regulation of miR-9 on Navβ2 protein -mediated trafficking defects of Nav1.1/Nav1.2 in vivoMore importantly, our in vivo study supports the data collected from our in vitro observations that the upregulation of miR-9 induced by both CBH and lenti-pre-miR-9 could also disturb the trafficking of both Nav1.1/Nav1.2 by downregulation of Navβ2 expression. [score:10]
More importantly, our in vivo study supports the data collected from our in vitro observations that the upregulation of miR-9 induced by both CBH and lenti-pre-miR-9 could also disturb the trafficking of both Nav1.1/Nav1.2 by downregulation of Navβ2 expression. [score:9]
Further study showed that overexpression of miR-9 inhibited the Navβ2 expression by targeting on its coding sequence (CDS) domain by dual luciferase assay. [score:8]
Silent mutations introduced into both two predicted targets at the positions of 336–358 and 575–597 of SCN2B CDS, MutSCN2B-1 & 2 disrupted the ability of miR-9 to repress the translation of the SCN2B-CDS, strongly suggesting that miR-9 uniquely targets at the position of 336–358, rather than 575–597, of SCN2B CDS. [score:8]
MiR-9 inhibited the SCN2B-CDS luciferase activity compared with scrambled negative control (Fig.   3b, P < 0.01), however, scrambled negative control and inhibitor of miR-9 had no effect on luciferase activity compared with control group (Fig.   3b, P > 0.05), and the difference of luciferase activity between inhibitor of miR-9 and scramble negative inhibitor control was also not detected (Fig.   3b, P > 0.05). [score:7]
In addition, our important finding here is that miR-9 regulates endogenous Navβ2 expression by targeting its coding sequence (CDS) region rather than not 3’UTR of SCN2B (Fig. 4). [score:6]
It has been documented in the literature that miR-9 is elevated in hippocampus [39] and temporal lobe cortex [54] of AD patients, whereas, the opposite observation is also presented in AD patients [55] from others,which was then demonstrated downregulation of miR-9 due to overexpression of Aβ in hippocampal cultures [56]. [score:6]
Silent mutations introduced into the predicted targets at the position of 336–358 of SCN2B CDS disrupted the ability of miR-9 to repress the translation of the SCN2B-CDS (Fig.   3c, P < 0.01). [score:6]
Further study has shown that the increased miR-9 negatively regulated the expression of Navβ2 protein by binding to the target in CDS region of SCN2B gene. [score:6]
We conclude that miR-9 may play a key role in regulating the process of Nav1.1/Nav1.2 trafficking via targeting on Navβ2 protein in 2VO rats at post-transcriptional level, and inhibition of miR-9 may be a potentially valuable approach to prevent Nav1.1/Nav1.2 trafficking disturbance induced by CBH. [score:6]
MiR-9 plays a key role in regulating the process of Nav1.1/Nav1.2 trafficking via targeting on Navβ2 protein in 2VO rats at post-transcriptional level, and inhibition of miR-9 may be a potentially-valuable approach to prevent the Nav1.1/Nav1.2 trafficking disturbance induced by CBH. [score:6]
MIMAT0000781)); that of miR-NC is 5’-UUCUCCGAACGUGUCACGUAA-3’; the sequence of the antisense 2’-O-methyl (2’-O-Me) oligonucleotide for miR-9 is 5’-UCAUACAGCUAGAUAACCAAAGA-3’, that of inhibitor-NC is 5’UUCUCCGAACGUGUCACGUTT-3’; HEK293T cells (plated at 40 % ~ 50 % confluence) were transfected with 20 μmol/l miR -9, AMO-miR -9, or negative control siRNAs (NC) as well as 0.5 μg of psi-CHECK [TM]-2-target DNA (firefly luciferase vector) and 1 μl blank plasmid using lipofectamine 2000 (Invitrogen,USA) transfection reagent according to the manufacturer’s instructions. [score:5]
However, simultaneous introduction of silent mutations at the position of 575–597 of SCN2B CDS did not abolish the downregulation of SCN2B by miR-9 (Fig.   3c, P > 0.05). [score:5]
This observation provides a novel mechanism to modify the reduction in Nav1.1/Nav1.2 membrane trafficking, and careful monitoring the changes in miR-9 level and the expression for Nav1.1/Nav1.2 and targeted gene are considerably necessary during CBH. [score:5]
Our study provides strong evidences that miR-9 increases in both hippocampi and cortices, and inhibited the expression of Navβ2, which in turn blocked the trafficking of Nav1.1 and Nav1.2 from cytoplasm to plasma membrane (Figs.   3, 4 and 5). [score:5]
In the present study, though we have demonstrated the regulation effect of miR-9 on the trafficking of Nav1.1/Nav1.2 by inhibiting the expression of Navβ2 both in vitro and in vivo, we did not provide evidence whether these changes could induce abnormal sodium channel currents and its dynamics characteristics in hippocampi and cortices of 2VO rats. [score:4]
Dajas-Bailador F, Bonev B, Garcez P, Stanley P, Guillemot F, Papalopulu N: microRNA-9 regulates axon extension and branching by targeting Map1b in mouse cortical neurons. [score:4]
However, why the total Nav1.1/Nav1.2 protein levels increase in cultured neuron following miR-9 treatment and how 2VO triggers Nav1.1/Nav1.2 total protein up-regulation remain unclear. [score:4]
In the present study, The major finding is that miR-9 is significantly up-regulated under CBH conditions in animal mo del (Fig.   2d). [score:4]
MiR-9 -mediated post-transcriptional regulation of Navβ2 expression. [score:3]
To our interest, the decreased expression of Navβ2 was also reversed by lenti-pre-AMO-miR-9 treatment in the same brain regions (Fig.   7b, P < 0.01). [score:3]
The surface expressions of both Nav1.1 and Nav1.2 proteins were markedly reduced in both hippocampi and cortices of rats with lenti-pre-miR-9 treatment, which was reversed by lenti-pre-AMO-miR-9 (Fig.   6c-f, P < 0.05), even though the total protein levels of Nav1.1 and Nav1.2 were increased in both hippocampi and cortices of rats with lenti-pre-miR-9 treatment, which were reversed by lenti-pre-AMO-miR-9 (Fig.   6c- f, P < 0.05). [score:3]
Intriguingly, miR-9 suppressed, while AMO-miR-9 enhanced, the trafficking of Nav1.1/Nav1.2 from cytoplasm to cell membrane. [score:3]
On the contrary, lenti-pre-AMO-miR-9 injection into hippocampus markedly prevents the abnormal trafficking of both Nav1.1 and Nav1.2 following either CBH or lenti-pre-miR-9 treated normal rats accompanied by increased Navβ2 expression. [score:3]
Therefore, whether and how miR-9 participates in the abnormal expression or trafficking of Nav1.1/Nav1.2 induced by CBH is worth to be explored. [score:3]
A merged image depicting double positivity (yellow) is shown on the bottom after transfection with miR-9 mimics or/and AMO-miR-9, negative control, n = 3. e, Repression of Navβ2 by miR-9 using the miRNA-masking antisense oligodeoxynucleotides (ODNs) techniques in NRNs determined by analysis, n = 3 batches of cells for each group, mean ± s. e. m, ** P < 0.01 vs NC; [##] P < 0.01 vs miR-9, ODN1 (oligodeoxynucleotides, which masks the binding sites of miR-9, located in the position 336–358 of SCN2B CDS region); ODN-2 (oligodeoxynucleotides, which masks the binding sites of miR-9, located in the position of 575–597 of SCN2B CDS region) To test the trafficking effect of miR-9 on Nav1.1/Nav1.2, the protein expressions of Nav1.1 and Nav1.2 after pretreatment of NRNs with miR-9 were detected by both and immunofluorescence techniques. [score:3]
de/rnahybrid/) and found that the CDS domain of SCN2B is likely to serve as potential targets for miR-9. We next identified whether there are binding sites for miR-9 on the CDS domain of SCN2B gene at the position of 336–358 and 575–597 with highly conservative regions (Fig.   3a). [score:3]
An understanding of miR-9 -Navβ2-Nav1.1/Nav1.2 trafficking pathway could yield to the potential therapeutic targets for the prevention of abnormal electrical activation induced by CBH. [score:3]
Cells were transfected with luciferase-target motif chimeric vector alone, miR-9, AMO-9, or scramble negative control (NC) using lipofectamine 2000. [score:3]
Using the BLOCK-iT polII miR -RNAi expression vector with the EmGFP kit from invitrogen, three single-stranded DNA oligonucleotides were designed as follows: (1) pre- miR-9 (“top strand” oligo: TGCTGTcTTTggTTaTcTagcTgTaTgaGTTTTGGCCACTGACTGACTcaTacagagaTaaccaaaga) and its complementary chain (“bottom strand” oligo: CCTGTcTTTggTTaTcTcTgTaTgaGTCAGTCAGTGGCCAAAACTcaTacagcTagaTaaccaaagaC); (2) pre-AMO-miR-9 (“top strand” oligo: TGCTGTcaTacagcTagaTaaccaaagaGTTTTGGCCACTGACTGACTcTTTggTTcTagcTgTaTga) and its complement (“bottom strand” oligo: CCTGTcaTacagcTagaaccaaagaGTCAGTCAGTGGCCAAAACTcTTTggTTaTcTagcTgTaTgaC); (3) negative control (“top strand” oligo: tgctgAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT) and its complement (“bottom strand” oligo: cctgAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc). [score:3]
c- f, Nav1.1 (C-D), Nav1.2 (E-F) total and surface protein expressions in hippocampi and cortices tissues after treatment by lenti-pre-miR-9, lenti-pre-miR-9 + lenti-pre-AMO -miR-9, or NC for 8 weeks. [score:3]
A merged image depicting double positivity (yellow) is shown on the bottom after transfection with miR-9 mimics or/and AMO-miR-9, negative control MiR-9 -induced disturbances of Nav1.1/Nav1.2 trafficking in vivoTo verify the functional role of miR-9 on Nav1.1/Nav1.2 trafficking in vivo, miR-9 oligonucleotide carried by lentivirus vector (lenti-pre-miR-9) was injected directly into CA1 region of bilateral hippocampus of each rat and significantly higher expression of miR-9 in both hippocampi and cortices was observed at 8 weeks after injection compared with the negative control oligonucleotide (NC, Fig.   6a). [score:3]
Mutagenesis nucleotides were carried out using direct oligomer synthesis for the CDS region of Navβ2 -binding site 1 and Navβ2 -binding site 2. Point mutations were introduced into a possible miR-9 binding site located in the coding region of SCN2B (position 336–358 and position 575–597 of SCN2B CDS). [score:3]
Since the protein level of Navβ2 was reduced in both hippocampi and cortices in 2VO rats, which is discrepancy with the unchanged SCN2B expression, the alternation of miR-9 is highly expected in this process. [score:3]
In this study, our data provide strong evidence that miR-9 regulates Nav1.1/Nav1.2 trafficking by post-transcriptional regulating SCN2B gene under CBH status. [score:3]
microRNA-9 Chronic brain hypoperfusion Sodium channel Since voltage-gated sodium channel (VGSC) is necessary in the initiation and propagation of action potentials in neurons, it is a valuable therapeutic target for neurological disorders, such as epilepsy and chronic neuropathic pain [1– 3]. [score:3]
b, Navβ2 protein expressions in hippocampi and cortices tissues in 2VO rats with or without lenti-pre-AMO -miR-9 treatment, or NC for 8 weeks. [score:3]
A merged image depicting double positivity (yellow) is shown on the bottom after transfection with miR-9 mimics or/and AMO-miR-9, negative control To verify the functional role of miR-9 on Nav1.1/Nav1.2 trafficking in vivo, miR-9 oligonucleotide carried by lentivirus vector (lenti-pre-miR-9) was injected directly into CA1 region of bilateral hippocampus of each rat and significantly higher expression of miR-9 in both hippocampi and cortices was observed at 8 weeks after injection compared with the negative control oligonucleotide (NC, Fig.   6a). [score:3]
These results combination with our in vitro data suggested that the inhibition of miR-9 in hippocampi and cortices in CBH mo del rats would be a way to prevent sodium channel dysfunction after CBH. [score:3]
c- f, Nav1.1 (C-D), Nav1.2 (E-F) total and surface protein expressions in 2VO rats with or without lenti-pre-AMO -miR-9 treatment, or NC for 8 weeks. [score:3]
The results showed that miR-9 significantly increased the expression of of Nav1.1 (Fig.   5a, P < 0.05) and Nav1.2 (Fig.   5b, P < 0.05) total protein. [score:3]
Importantly, the expression of Navβ2 was also significantly decreased at meantime in lenti-pre-miR-9 group compared with control group, which was reversed by lenti-pre-AMO-miR-9 (Fig.   6b, P < 0.01). [score:2]
Negative regulation of miR-9 on Navβ2 protein -mediated trafficking disturbance of Nav1.1/Nav1.2 in vitro. [score:2]
MicroRNA-9 (miR-9), enriched in central nerve system (CNS) [28], contributes likely to multi-pathological processes including the neurogenesis [29], proliferation [30], migration and differentiation of neural progenitor cells [31], drug adaption [32], adult brain plasticity [33], neural cell fate [34], the migration and proliferation of glioma cells [35], axon extension and branching [36], spinal motor neuron development [37] under physiological status. [score:2]
However, the mRNA level of Navβ2 was not changed in the presence of miR-9 (Fig.   4c), which may ascribed to transcriptional regulation. [score:2]
And furthermore, the surface protein expression of Nav1.1 was increased and the total protein of Nav1.1 level was decreased by lenti-pre-AMO-miR-9 compared with that in 2VO control rats (Fig.   7c, d, P < 0.05). [score:2]
MiR-9 is enriched in CNS, and increases in the brain of the patients with Alzheimer's disease (AD) [39]. [score:2]
Negative regulation of miR-9 on Navβ2 protein -mediated trafficking defects of Nav1.1/Nav1.2 in vivo. [score:2]
Therefore, our goal in the present study was to examine the role of microRNA-9 (miR-9) in regulating Nav1.1/Nav1.2 trafficking under CBH generated by bilateral common carotid artery occlusion (2VO). [score:2]
Synthesis of miR-9, AMO (anti-microRNA antisense oligodeoxyribonucleotide)-miR-9 and other various oligonucleotides. [score:1]
a, Verification of uptake of miR-9 by NRNs after transfection, * P < 0.05 vs NC,  [#] P < 0.05,  mean ± s. e. m, n = 3 independent RNA samples for each group. [score:1]
Rats were transfected with lenti-pre- miR-9, lenti-pre-miR-9 + lenti-pre-AMO -miR-9, or NC. [score:1]
These data suggested that miR-9 plays an important role in trafficking and cellular distribution of Nav1.1/ Nav1.2. [score:1]
Fig. 7AMO-miR-9 prevented the disturbed trafficking of Nav1.1/Nav1.2 induced by 2VO. [score:1]
Thirty pmol/mL miR-9 and/or AMO-9, ODNs or NC siRNAs were transfected into neonatal hippocampal and cortical neurons with X-treme GENE siRNA transfection reagent (Cat. [score:1]
Rat SCN2B CDS and mutSCN2B CDS sequences were shown as following: SCN2B CDS sequences (bold nucleotide showed the putative binding sequences for miR-9): ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTGTTTTTCTCTTTGGTGCCCTCGGGGCGGAGCATGGAAGTCACAGTCCCCACCACTCTTAGTGTCCTCAACGGGTCTGATACCCGCCTGCCCTGTACCTTCAACTCCTGCTATACCGTGAACCACAAGCAGTTCTCTCTGAACTGGACTTACCAGGAGTGTAGCAATTGCTCAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATCAACCTGAAGCTGGAGCGGTTTGGAGACCGCGTAGAGTTCTCGGGGAACCCCAGTAGTACGACGTGTCAGTGACTCTAAAGAA(CGTGCAGCTAGAA GACGAAGGC)ATTTACAACTGCTAATCACCAACCCTCCAGACCGCCACCGTGGCCATGGCAAGATCTACCTGCAGGTCCTTCTAGAAGGCCCCCAGAGCGGGACTCCACGGTGGCAGTCATCGTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGGAGGAAAAAAGAGCAGAAGCTGAGC(ACGGATGACCTGAA GACCGAAGA)GGAAGGCAAGACGGATGGCGAGGGCAACGCGGAAGATGGCGCCAAGTAACCGGAAGCTTGCCCTGAAGCCCCTTCCTGTGTCCTGTCTCCTCTCACTCTCTGCCCTGT; mutSCN2B CDS (bold nucleotide): ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTGTTTTTCTCTTTGGTGCCCTCGGGGCGGAGCATGGAAGTCACAGTCCCCACCACTCTTAGTGTCCTCAACGGGTCTGATACCCGCCTGCCCTGTACCTTCAACTCCTGCTATACCGTGAACCACAAGCAGTTCTCTCTGAACTGGACTTACCAGGAGTGTAGCAATTGCTCAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATCAACCTGAAGCTGGAGCGGTTTGGAGACCGCGTAGAGTTCTCGGGGAACCCCAGTAAGTACGACGTGTCAGTGACTCTAAAGAA(CGTGCAGCTAGAA ATCGATCGC)ATTTACAACTGCTACATCACCAACCCTCCAGACCGCCACCGTGGCCATGGCAAGATCTACCTGCAGGTCCTTCTAGAAGTGCCCCCAGAGCGGGACTCCACGGTGGCAGTCATCGTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGGAGGAAAAAAGAGCAGAAGCTGAGC(ACGGATGACCTGAA ATCGATCGA)GGAAGGCAAGACGGATGGCGAGGGCAACGCGGAAGATGGCGCCAAGTAACCGGAAGCTTGCCCTGAAGCCCCTTCCTGTGTCCTGTCTCCTCTCACTCTCTGCCCTGT The sequence of miR-9 mimic is 5’-UCUUUGGUUAUCUAGCUGUAUGA-3’ (synthesized based on the sequence of rno miR-9 (miRBase Accession No. [score:1]
The discrepancies imply that the changes in miR-9 in AD depend presumably upon the variants inducers. [score:1]
org/), we found that SCN2B has a poorly conservative ‘seed’ sequence of miR-9 in its 3’UTR and the length of 3’UTR of SCB2B in rat was very short based on the database of the University of California Santa Cruz (UCSC) and the National Center for Biotechnology Information (NCBI) Genome Browsers. [score:1]
Similarly, lenti-pre-AMO-miR-9 effectively improved the impaired trafficking of Nav1.2 from cytoplasm to cell membrane under the same experimental condition (Fig.   7e and f, P < 0.05). [score:1]
Rat SCN2B CDS and mutSCN2B CDS sequences were shown as following: SCN2B CDS sequences (bold nucleotide showed the putative binding sequences for miR-9): ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTGTTTTTCTCTTTGGTGCCCTCGGGGCGGAGCATGGAAGTCACAGTCCCCACCACTCTTAGTGTCCTCAACGGGTCTGATACCCGCCTGCCCTGTACCTTCAACTCCTGCTATACCGTGAACCACAAGCAGTTCTCTCTGAACTGGACTTACCAGGAGTGTAGCAATTGCTCAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATCAACCTGAAGCTGGAGCGGTTTGGAGACCGCGTAGAGTTCTCGGGGAACCCCAGTAGTACGACGTGTCAGTGACTCTAAAGAA(CGTGCAGCTAGAA GACGAAGGC)ATTTACAACTGCTAATCACCAACCCTCCAGACCGCCACCGTGGCCATGGCAAGATCTACCTGCAGGTCCTTCTAGAAGGCCCCCAGAGCGGGACTCCACGGTGGCAGTCATCGTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGGAGGAAAAAAGAGCAGAAGCTGAGC(ACGGATGACCTGAA GACCGAAGA)GGAAGGCAAGACGGATGGCGAGGGCAACGCGGAAGATGGCGCCAAGTAACCGGAAGCTTGCCCTGAAGCCCCTTCCTGTGTCCTGTCTCCTCTCACTCTCTGCCCTGT; mutSCN2B CDS (bold nucleotide): ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTGTTTTTCTCTTTGGTGCCCTCGGGGCGGAGCATGGAAGTCACAGTCCCCACCACTCTTAGTGTCCTCAACGGGTCTGATACCCGCCTGCCCTGTACCTTCAACTCCTGCTATACCGTGAACCACAAGCAGTTCTCTCTGAACTGGACTTACCAGGAGTGTAGCAATTGCTCAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATCAACCTGAAGCTGGAGCGGTTTGGAGACCGCGTAGAGTTCTCGGGGAACCCCAGTAAGTACGACGTGTCAGTGACTCTAAAGAA(CGTGCAGCTAGAA ATCGATCGC)ATTTACAACTGCTACATCACCAACCCTCCAGACCGCCACCGTGGCCATGGCAAGATCTACCTGCAGGTCCTTCTAGAAGTGCCCCCAGAGCGGGACTCCACGGTGGCAGTCATCGTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGGAGGAAAAAAGAGCAGAAGCTGAGC(ACGGATGACCTGAA ATCGATCGA)GGAAGGCAAGACGGATGGCGAGGGCAACGCGGAAGATGGCGCCAAGTAACCGGAAGCTTGCCCTGAAGCCCCTTCCTGTGTCCTGTCTCCTCTCACTCTCTGCCCTGTThe sequence of miR-9 mimic is 5’-UCUUUGGUUAUCUAGCUGUAUGA-3’ (synthesized based on the sequence of rno miR-9 (miRBase Accession No. [score:1]
Cells were transfected with miR-9, AMO-9, miR-9 + AMO-9, or NC. [score:1]
P > 0.05 vs Sham, mean ± s. e. m, n = 3. d, miR-9 level detected by TaqMan real-time PCR in hippocampi and cortices from sham and 2VO rats after normalization to U6 levels. [score:1]
Reversal effect of AMO-miR-9 on trafficking defects of Nav1.1/Nav1.2 induced by 2VO. [score:1]
2VO rats were transfected with lenti-pre-AMO -miR-9, or NC. [score:1]
To test potential involvement of miR-9 in CBH -mediated 2VO rats, we also evaluated the expression of miR-9 in hippocampi and cortices of 2VO rats. [score:1]
Two microliters (10,000 Tu/μl) lenti-pre-miR-9 and/or Lenti-pre-AMO-miR-9 were injected into CA1of the hippocampus using a 5 μl Hamilton syringe with a 33-gauge tip needle (Hamilton, Bonaduz, Switzerland). [score:1]
a, Detection of miR-9 in hippocampi and cortices tissues after stereotaxic injection 8 weeks using qRT-PCR. [score:1]
a, b Effects of miR-9 on total protein levels of endogenous Nav1.1 (a), Nav1.2 (b), in NRNs, using western blot analysis and. [score:1]
a, Complementarity between miR-9 seed-matched sequence and the region coding for Navβ2 predicted by a computational and bioinformatics -based approach using RNA22/RNAhybrid. [score:1]
MiR-9 mimics (sense: 5’-UCUUUGGUUAUCUAGCUGUAUGA-3’; antisense: 5’-AUACAGCUAGAUAACCAAAGAUU-3’) and AMO-miR-9 (5’-UCAUACAGCUAGAUAACCAAAGA-3’) were synthesized by Shanghai GenePharma Co. [score:1]
Navβ2 masking antisense-ODN-1 was 5’-ATGCCTTCGTCTTCTAGCTGC-3’, which masks the binding sites of miR-9, located in the position 336–358 of SCN2B CDS (coding sequence) region; Navβ2 masking antisense-ODN-2 was 5’TCCTCTTCGGTCTTCAGGTCA-3’ , which masks the binding sites of miR-9, located in the position of 575–597 of SCN2B CDS region. [score:1]
The successful transfection of miR-9 was identified (Fig.   4a) by qRT-PCR and Navβ2 protein levels were significantly decreased in the presence of miR-9 (Fig.   4b). [score:1]
b, Effects of miR-9 on protein levels of endogenous Navβ2 in primary cultured neonatal rat neurons (NRNs), using western blot analysis. [score:1]
[1 to 20 of 77 sentences]
3
[+] score: 263
[43, 44] However, the current study reported that in knee OA tissues, upregulated NF-kB expressions because of inhibited miR-9 expressions were associated with increased knee OA cell proliferation. [score:10]
[14, 35– 37] Furthermore, our study discovered that miR-9 mimics suppressed the NF-κB1 protein expression level in knee OA chondrocytes and the downregulation of miR-9 could trigger an increase in NF-κB1 expressions occurred at both gene and transcription levels in chondrocytes. [score:10]
[5– 7] Certain noncoding RNA molecules (microRNAs), such as miR-9, miR-22 (Gene ID: 407004), and miR-146 (Gene ID: 406938), have been reported to modify target gene expressions by targeting their mRNA 3′untranslated regions (UTR). [score:9]
[9] Besides, miR-9 has been ascertained to negatively regulate NF-kB1 expressions, thereby indicating that downregulated miR-9 would accelerate NF-kB expressions and restrain cell proliferation. [score:9]
Upregulation of miR-9 or downregulation of NF-κB1 could promote cell proliferation and suppress cell apoptosis. [score:9]
Thus, this study displayed that reduced expressions of IL-6 and MMP-13 were attributed to regulated NF-κB1expressions targeted by miR-9. Interestingly, multiple studies have documented that NF-kB could turn on genes that keep cells proliferating. [score:8]
These findings indicated that miR-9 could inhibit the apoptosis of chondrocytes and downregulation of NF-κB1 also could suppress the apoptosis of chondrocytes. [score:8]
Hence, we concluded that the expression of NF-κB1 at both mRNA and protein levels were modulated by miR-9. Besides, the interaction between miR-9 and NF-κB1 was hypothesized to suppress apoptosis during chondrogenesis,[9] since the caspase-3 experiments conducted in this study[38] exhibited that higher caspase-3 levels along with increased apoptosis were observed in cells transfected with miR-9 inhibitors, whereas lower caspase-3 activity accompanied by decreased apoptosis were present in cells transfected with miR-9 mimics and p50 siRNA. [score:7]
Previous studies showed that miR-9 modulated the secretion of MMP-13[10] and that miR-9 was able to inhibit tumorigenesis by suppressing the activity of IL-6. [39] In addition, NF-κB1, IL-6, and catabolic marker protein MMP-13, which is the matrix-degrading enzyme, were also overexpressed in patients with knee OA. [score:7]
Conclusively, downregulated miR-9 can facilitate proliferation and antiapoptosis of knee OA chondrocytes by directly binding to NF-kB1, implying that stimulating miR-9 expressions might assist in treatment of knee OA. [score:7]
3.6The expression levels of NF-κB1 were significantly inhibited by miR-9 mimics and increased by miR-9 inhibitor. [score:7]
The expression levels of NF-κB1 were significantly inhibited by miR-9 mimics and increased by miR-9 inhibitor. [score:7]
However, one expression profiling asserted that miR-9 was upregulated in OA cartilages and OA bones. [score:6]
[8] Interestingly, Song and his colleagues[9] found that miR-9 expressions were significantly decreased in OA chondrocytes in comparison to normal ones, and chondrocytes’ apoptosis was thereby regulated due to miR-9's targeting protein (PRTG, Gene ID: 283659). [score:6]
Since the NF-κB1 signaling pathway is involved in the apoptosis and proliferation of tumor cells, we suspected that miR-9 may promote the proliferation of chondrocytes and suppress the apoptosis of human pituitary knee OA chondrocytes through regulating the NF-κB1 signaling pathway by targeting NF-κB1 and this is consistent with the results from the western blotting. [score:6]
Besides that, the protein levels of IL-6 and MMP-13 were suppressed by miR-9 mimics and NF-κB1 siRNA, while they were promoted by miR-9 inhibitor (Fig. 7). [score:5]
Figure 3NF-κB1is a target gene of miR-9. (A) Binding of miR-9 to NF-κB1 3′-UTR predicted by Target Scan. [score:5]
Western blot showed that miR-9 could suppress the NF-κB1 expression to decrease the NF-κB1 signaling pathway related proteins including IL-6 and MMP-13 in human knee OA chondrocytes. [score:5]
The targeting of miR-9 to NF-κB1 may enhance proliferation and suppress apoptosis of knee OA chondrocytes through modification of IL-6 and MMP-13. [score:5]
In fact, miR-9 was documented to be lowly expressed in the knee OA chondrocytes and its low expression was correlated to increased chondrocyte apoptosis. [score:5]
Targeting NF-κB1 by miR-9. MiR-9 targeted NF-κB1 to promote chondrocytes proliferation. [score:5]
MiR-9 targeted NF-κB1 to inhibit cell apoptosis. [score:4]
In conclusion, miR-9 exhibited significantly lower expressions in knee OA tissues when compared with normal tissues, while NF-κB1, IL-6, and MMP-13 expressions were relatively higher in knee OA tissues. [score:4]
Subsequently, assessment of rat mo dels also demonstrated reduced miR-9 expressions (Fig. 2A) as well as increased NF-κB1, IL-6, and MMP-13 expressions (Fig. 2B, C) in OA rats’ cartilage tissues when compared with normal rats’ cartilage tissues. [score:4]
[21– 23] Nonetheless, so far deficient studies can explain clearly how miR-9 regulates NF-κB1 and whether the regulation could influence development of knee OA. [score:4]
Figure 5The apoptosis of chondrocytes was inhibited by miR-9. The apoptosis ability of chondrocytes at 48 hours after transfection was detected by the flow cytometric analysis. [score:3]
In retrospect, such miRNAs as miR-9, miR-27 (Gene ID: 407018), miR-140 (Gene ID: 406932), and miR-146 have been indicated to be abnormally expressed in OA patients. [score:3]
2.5Chondrocytes were divided into 4 different groups, including the scramble group, miR-9 mimics group, miR-9 inhibitor group, and NF-κB1 siRNA group. [score:3]
They were transfected with scramble miRNA mimics as the negative control, miR-9 mimics, miR-9 inhibitor, and NF-κB1siRNA, respectively (purchased from Gene Pharma, Shanghai, China). [score:3]
A putative conserved binding site for miR-9 at nucleotide position 29–35 of human NF-κB13′UTR is predicted using the Target Scan. [score:3]
Figure 1The relative expressions of miR-9 and related genes (NF-κB1, IL-6, and MMP-13) detected in human knee OA and normal cartilage tissues. [score:3]
Figure 2The relative expressions of miR-9 and related genes (NF-κB1, IL-6, and MMP-13) detected in knee OA and normal cartilage tissues of rat mo dels. [score:3]
Chondrocytes were divided into 4 different groups, including the scramble group, miR-9 mimics group, miR-9 inhibitor group, and NF-κB1 siRNA group. [score:3]
As a result, miR-9 and NF-κB1 could potentially serve as diagnostic biomarkers and therapeutic targets for patients with knee OA. [score:3]
3.2A putative conserved binding site for miR-9 at nucleotide position 29–35 of human NF-κB13′UTR is predicted using the Target Scan. [score:3]
chondrocyte IL-6 knee osteoarthritis miR-9 MMP-13 NF-kappaB1 pathway Osteoarthritis (OA) is classified as a degenerative disease that affects both cartilage and its adjacent issues. [score:3]
According to results from human OA samples and rat OA mo dels, miR-9 was significantly downregulated in knee OA cartilage tissues compared with normal cartilage tissues (P < 0.01). [score:3]
In addition, it was demonstrated that miR-9 could suppress proliferation and invasion of diverse cancer cells (e. g., nasopharyngeal carcinoma, ovarian cancer, and gastric cancer), by binding to corresponding genes, such as C-X-C motif chemokine receptor 4 (CXCR4, Gene ID: 7852), talin 1 (TLN1, Gene ID: 7094), and nuclear factor kappa-B1 (NF-κB1, Gene ID: 4790). [score:3]
Figure 7 The effect of miR-9 on the NF-κB1 signaling pathway via the inhibition of NF-κB1. [score:3]
The expression of miR-9 in knee OA cartilage tissues was significantly lower than that in normal tissues (P < 0.01). [score:3]
Both RT-PCR and western blot assays showed that the expression levels of NF-κB1 mRNA and protein were significantly decreased in the miR-9 mimics group and increased in the miR-9 inhibitor group when compared with the scramble group (P < 0.05) (Fig. 3C, D). [score:3]
Figure 6The analyzed caspase-3 activity in cells after 48-hour transfection with scramble sequence, miR-9 mimics, miR-9 inhibitor, or NF-κB1 siRNA. [score:3]
Knee OA chondrocytes were transfected with miR-9 mimics, miR-9 inhibitor, and NF-κB1 siRNA, respectively, and changes in cellular proliferation and apoptosis were detected via and flow cytometric analysis, respectively. [score:3]
The apoptosis rate in the miR-9 inhibitor group was 16.01 ± 2.23%, which was significantly higher than those in the other three groups (all P < 0.01) (Fig. 5). [score:3]
Therefore, the present study was designed to systematically clarify the potential correlations of miR-9/NF-κB1 and knee OA development, which may be conducive to exploitation of novel diagnostic and therapeutic strategies for knee OA. [score:2]
Dual luciferase reporter gene assay showed that miR-9 could bind to the 3′UTR of NF-κB1 and significantly inhibit the luciferase activity by 37% (P < 0.01). [score:2]
Thus, 2 [−ΔΔCt] was considered equal to the fold of expressions of miR-9 or NF-κB1 RNA or IL-6 RNA or MMP-13 RNA and those of U6 snRNA. [score:2]
It has been suggested that microRNA-9 (miR-9) is associated with the development of knee osteoarthritis (OA). [score:2]
Finally, animal mo dels with knockout of specific genes (e. g., miR-9 and NF-κB1) could also be the following research focus. [score:2]
The proliferation of chondrocytes was significantly decreased after they were transfected with miR-9 inhibitor for 48 hours compared with the other three groups (all P < 0.05) (Fig. 4). [score:2]
The caspase-3 activity of cells transfected with miR-9 inhibitor was 2.33 ± 0.24, exhibiting significant difference when compared with those of the other three groups (all P < 0.01). [score:2]
In addition, more exploration of NF-κB1 pathway with aid of Ingenuity Pathway Analysis would make roles of miR-9 and NF-κB1 in development of knee OA more convincible. [score:2]
MiR-9 expressions in both knee OA cartilage and normal cartilage samples were detected using quantitative real-time PCR. [score:2]
MiR-9 and related genes expression in knee OA clinical specimens and knee OA rat mo dels. [score:2]
Real-time quantitative RT-PCR assay was conducted using the ABI7500 quantitative PCR instrument (Applied Biosystems, Foster City, CA, USA) in order to detect the relative expression levels of miR-9 and mRNA of NF-κB1, IL-6, and MMP-13. [score:2]
The dual-luciferase reporter assay in this study displayed that NF-κB1 expressions were modulated by miR-9 in chondrocytes, which was consistent with results drawn from uveal melanoma cells, ovarian cancer cells, and gastric adenocarcinoma cells. [score:2]
To elucidate effects of miR-9 and NF-κB1 on downstream molecules, expressions of IL-6 and MMP-13 were also compared between normal tissues and knee OA tissues. [score:2]
3.5The caspase-3 activity of cells transfected with miR-9 inhibitor was 2.33 ± 0.24, exhibiting significant difference when compared with those of the other three groups (all P < 0.01). [score:2]
from flow cytometric analysis revealed that the apoptosis rate (mean ± SD) of cells transfected with miR-9 mimics and NF-κB1 siRNA were 4.46 ± 0.58% and 4.34 ± 0.62% without significant difference (P > 0.05). [score:1]
Moreover, both IL-6 and MMP-13 were significantly decreased after chondrocytes were transfected with NF-κB1 siRNA, which was consistent with the trend observed in the miR-9 mimics group. [score:1]
[10] The controversy enabled us to further explore inherent correlations between miR-9 and OA chondrocytes. [score:1]
Perfect base pairing was observed between the seed sequence of mature miR-9 and the 3′UTR of NF-κB1 mRNA (Fig. 3A). [score:1]
Quantitative real-time PCR was used to evaluate the expression level of miR-9 in 25 knee OA cartilage tissues and 10 normal cartilage tissues (Fig. 1A). [score:1]
All in all, the molecular mechanism of miR-9 and NF-κB1 pathway with respect to the formation and progression of knee OA should be further studied. [score:1]
MiR-9 regulated the NF-κB1 signaling pathway. [score:1]
The relative expression level of miR-9 and mRNA of p50, IL-6, and MMP-13 were calculated using the 2 [−ΔΔCt] method. [score:1]
The caspase-3 activities of cells transfected with miR-9 mimics and NF-κB1siRNA were 0.57 ± 0.05 and 0.53 ± 0.06 with no significant difference (P > 0.05), while they were significantly lower than that in the scramble group (1.00 ± 0.10) (P < 0.01) (Fig. 6). [score:1]
[33, 34] Hence, the current study was aimed to build internal relations among miR-9, NF-κB1, IL-6, and MAP-13 in knee OA cartilages. [score:1]
3.1Quantitative real-time PCR was used to evaluate the expression level of miR-9 in 25 knee OA cartilage tissues and 10 normal cartilage tissues (Fig. 1A). [score:1]
3.4Results from flow cytometric analysis revealed that the apoptosis rate (mean ± SD) of cells transfected with miR-9 mimics and NF-κB1 siRNA were 4.46 ± 0.58% and 4.34 ± 0.62% without significant difference (P > 0.05). [score:1]
Although the relationship between miR-9 and NF-κB1 with respect to knee OA formation has been demonstrated, this study has a small sample size which is the main limitation. [score:1]
However, miR-9 mimics or NF-κB1 siRNA did not have significant effect on promoting cell proliferation (P > 0.05). [score:1]
[26] In particular, we determined the Ct values of all studied samples to calculate ΔCt, which equaled the difference between Ct-value of target mRNAs (miR-9 or mRNAs of NF-κB1, IL-6, and MMP-13) and that of U6 snRNA. [score:1]
This study was aimed to investigate the association between the mechanism of miR-9 targeting nuclear factor kappa-B1 (NF-κB1) and the proliferation and apoptosis of knee OA chondrocytes. [score:1]
[1 to 20 of 74 sentences]
4
[+] score: 253
Recently, microRNA-9 (miR-9) has been reported to have the potential of suppressing inflammatory response induced by lipopolysaccharide (LPS) through inhibiting the expression of NF-κB1/p50 gene in human polymorphonuclear neutrophils (PMN) and monocytes 31– 34. [score:7]
In this study, we observed that the expressions of PTF1 in necrotized pancreatic tissues were significantly up-regulated by pri-miR-9-BMSCs and miR-9 agomir, suggesting pancreatic regeneration. [score:6]
But the expressions of IL-10, SOD [1], IκBα and IκBβ of pancreatic tissues in SAP+PBS group were significantly lower than that in NC group, which could be significantly up-regulated by miR-9a-5p agomir (Fig.   4A–D). [score:6]
The up-regulation of miR-9 could inhibit the inflammatory response in PBMC and PMN as described by Bazzoni et al. [34]. [score:6]
Consequently, it can be concluded that the up-regulation of miR-9 expression in SAP may be the compensatory mechanism which antagonizes the uncontrolled inflammatory response and prevents the deterioration of SAP. [score:6]
Besides, the pancreatic IL-1β expression was much higher in SAP+PBS group than that in NC group, which could be significantly down-regulated by pri-miR-9-BMSCs (Fig.   3A,B,E,F). [score:6]
AP, acute pancreatitis, H&E, hematoxylin eosin, NC, normal control, NaT, sodium taurocholate, SD, standard deviation, miR-9, microRNA-9. (G) miR-9, produced by infused BMSCs, can target NF-κB1/p50 gene and suppress the activation of NF-κB signaling pathway in PBMC/Macrophage to reduce the release of the pro-inflammatory cytokines and prevent the occurrence of SIRS and MODS, which can promote the repair and regeneration of necrotized pancreatic tissues. [score:5]
More than 70% of bone marrow-derived mesenchymal stem cells (BMSCs) were infected by pri-miR-9-1- or Empty- lentivirus expressing green fluorescent protein (GFP) and the expression of miR-9 in pri-miR-9-BMSCs was significantly higher than that in Empty virus-BMSCs (Fig.   1A–E). [score:5]
Figure 6BMSCs could transfer exogenous miR-9 to PBMC, which inhibited the expression of NF-κB1/p50 gene. [score:5]
The expression of NF-κB1/p50 in PBMC could be markedly repressed by miR-9a-5p transient overexpression (Fig.   6M,P,Q and K). [score:5]
Interestingly, compared with Caerulein, the expression of miR-9 was significantly up-regulated by 3% NaT. [score:5]
In this study, we explored the possible mechanism of BMSCs in repairing SAP by over -expressing (pri-miR-9-BMSCs) or antagonizing (TuD-BMSCs) the expression of miR-9 and the results suggested that the damaged pancreatic tissues were repaired by pri-miR-9-BMSCs and miR-9 agomir. [score:5]
To further prove the above result, we conducted two other tests which showed that miR-9 reduced the activity of firefly luciferase with a dose -dependent effect by binding to 3′UTR of NF-κB1/p50 gene, which could be rescued by TuD or mutUTR plasmids and BMSCs could deliver exogenous miR-9 to PBMC, which could inhibit the expression of NF-κB1/p50 gene. [score:5]
Besides, the activity of firefly luciferase inhibited by miR-9 could be rescued by anti-miR-9 (TuD) or the mutation of 3′UTR of NF-κB1/p50 gene (Fig.   6F,G). [score:4]
To further confirm that miR-9a-5p can target the NF-κB1/p50 gene, we constructed the vectors of dual luciferase reporter, wild-type (wtUTR) or mutation (mutUTR) of NF-κB1 3′UTR harboring predicted binding sites of miR-9a-5p (Fig.   6B–D). [score:4]
Meanwhile, it had been investigated that the expressions of miR-9 in pancreatic tissues could be up-regulated by pri-miR-9-BMSCs and miR-9 agomir. [score:4]
Meanwhile, Regenerating Islet-Derived Protein 4 (Reg4), able to repair and regenerate damaged pancreatic tissue [38], was also significantly up-regulated by pri-miR-9-BMSCs and miR-9 agomir. [score:4]
The pancreatic miR-9 expression in pri-miR-9-BMSCs group was significantly higher than that in NC, SAP, SAP+PBS, BMSCs, or Empty Virus-BMSCs groups, but showed no distinctive difference with TuD-BMSCs group (Figs  1P,Q and 2H,K). [score:3]
To further clarify how pri-miR-9-BMSCs and miR-9a-5p agomir reduce SAP, we detected cell apoptosis by and the expressions of superoxide dismutase (SOD, antioxidant enzyme), inflammatory cytokines, and NF-κB signaling molecules by PCR, Western-blotting and Immunohistochemistry. [score:3]
Figure 3pri-miR-9-BMSCs could inhibit the local inflammatory response. [score:3]
Empty virus-BMSCs stably expressing GFP were transfected by Lipo2000 with Cy3- miR-9a-5p mimics (50 nM) or miR-9a-5p control (50 nM) as previously described [64]. [score:3]
The pancreatic miR-9 expression in SAP+PBS group was much lower than that in NC group (Figs  1P,Q and 2H,K). [score:3]
Thus, it is concluded that pri-miR-9-BMSCs and miR-9 agomir repair SAP resulting from the miR-9’s inhibitory effect on the NF-κB signaling pathway. [score:3]
Moreover, the expressions of MPO, TNF-α, CD68, p-P65, NF-κB1/p50 of pancreatic tissues in pri-miR-9-BMSCs group were significantly lower than that in SAP, SAP+PBS, BMSCs, Empty Virus-BMSCs or TuD-BMSCs groups (Fig.   3A–F). [score:3]
We verified the expressions of miR-9 in pancreatic tissues. [score:3]
Therefore, we propose that miR-9 may be a small RNA molecule involved in the occurrence and progression of AP, and infused MSCs deliver miR-9 to the pancreas so as to inhibit the inflammatory response and repair the necrotized pancreatic tissues. [score:3]
The transcript of NF-κB1/p50 gene and the sequence of miR-9 have eight bases pairing at both putative target sites (Fig.   6A). [score:3]
Taken together, the above results indicated that NF-κB1/p50 was the target gene of miR-9a-5p. [score:3]
NF-κB1/p50 was validated as the target of miR-9a-5p. [score:3]
The results were intersected by MatchMiner [60], suggesting that the NF-κB1/p50 gene was a potential target gene of miR-9. Total RNA was extracted by TRIzol or TRIzol LS Reagent from the cells, frozen pancreatic specimens or serum. [score:3]
The pancreatic miR-9 expression in miR-9a-5p agomir group was higher than that in either SAP+PBS or miR-9a-5p control group (Figs  2F,G and 2H,K). [score:3]
Interestingly, the expression of miR-9 in 3% NaT group was significantly higher than that in Caerulein group (Fig.   7C–E). [score:3]
To verify whether the pancreatic regeneration was induced by pri-miR-9-BMSCs or miR-9a-5p agomir, we detected the expressions of related regenerative genes including Pancreas Transcription Factor 1 (PTF1) [37], Regenerating islet-derived protein 4 (Reg4) [38] and Pancreatic and Duodenal Homeobox 1 (PDX1) [39]. [score:3]
Moreover, NF-κB1/p50 has been identified as a target gene of miR-9 35, 36. [score:3]
The results showed that the mild systematic inflammatory response could induce the expression of miR-9 as observed in Sham group without showing any pancreatic injury. [score:3]
The expressions of IL-1β, IL-6, TNF-α, MPO, p-P65, P50, and CD68 were significantly decreased by miR-9a-5p agomir. [score:3]
In Situ HybridizationTo analyze the expressions of miR-9 in paraffin-embedded pancreatic tissues, we designed a probe of 5′-digoxigenin-labeled oligonucleotide (5′- ATACAGCTAGATAACCAAAGA-3′) for hybridizing with miR-9 in situ by using Enhanced Sensitive ISH Detection Kit (Boster biology company, Wuhan, Hubei Province, China) following the manufacturer’s instructions as previously described [68]. [score:3]
To analyze the expressions of miR-9 in paraffin-embedded pancreatic tissues, we designed a probe of 5′-digoxigenin-labeled oligonucleotide (5′- ATACAGCTAGATAACCAAAGA-3′) for hybridizing with miR-9 in situ by using Enhanced Sensitive ISH Detection Kit (Boster biology company, Wuhan, Hubei Province, China) following the manufacturer’s instructions as previously described [68]. [score:3]
The expressions of pro-inflammatory cytokines(IL-1β, IL-6, TNF-α, and MPO), NF-κB proteins (p-P65, P50) and CD68 were significantly decreased by pir-miR-9-BMSCs. [score:3]
pri-miR-9-BMSCs and miR-9a-5p agomir attenuate local inflammation response, inhibit the overactivation of NF-κB signaling pathway and decrease cell apoptosis. [score:3]
Further, we found that the expression of miR-9 was markedly decreased in injured pancreas and serum showing a negative correlation with AP, which was consistent with the result of microRNA microarray (GSE61741). [score:3]
The result showed that the scores of pancreatic edema, infiltration, hemorrhage and necrosis in 3% NaT group were significantly higher than that in NC, Sham and Caerulein groups (Fig.   7A,B) and the expression of miR-9 in NC or Sham groups was significantly higher than that in Caerulein or 3% NaT groups in pancreatic tissues and serum (Fig.   7C–E). [score:3]
Figure 7The expression of miR-9 in injured pancreas was negatively correlated with the severity of AP. [score:3]
In addition, the expression of miR-9 in PBMC could be induced by LPS (Fig.   6M,N). [score:3]
The expressions of IL-1β, TNF-α, IL-6, MPO, CD68, p-P65 and NF-κB1/p50 of pancreatic tissues in SAP+PBS group were significantly higher than that in NC group, which could be significantly decreased by miR-9a-5p agomir (Fig.   4A–F). [score:3]
The results indicated that the expressions of PTF1, Reg4 and PDX1 of pancreatic tissues in pri-miR-9-BMSCs group were significantly higher than that in SAP, SAP+PBS, BMSCs, Empty Virus-BMSCs or TuD-BMSCs groups (Fig.   5A,B). [score:3]
Therefore, miR-9 may function as a factor of anti-inflammatory response by targeting the NF-κB1/p50 gene to reduce the heterodimeric complex of p50-p65 (NF-κB). [score:3]
To sum up, BMSCs ameliorate SAP and promote the regeneration of necrotized pancreatic tissue by releasing miR-9 to injured pancreas and inhibiting the NF-κB signaling pathway (Fig.   7G). [score:3]
Finally, the mRNAs were exacted and the expressions of miR-9 were detected by gPCR and qRT-PCR. [score:3]
In contrast, the expressions of pancreatic IL-10 and superoxide dismutase (SOD [1] and SOD [2]) in pri-miR-9-BMSCs group were significantly higher than that in SAP+PBS or TuD-BMSCs groups (Fig.   3A,B). [score:3]
Besides, miR-9a-5p agomir could also significantly promote the expressions of pancreatic PTF1, PDX1 and Reg4 compared with SAP+PBS or miR-9a-5p control groups (Fig.   5C,D). [score:2]
The expressions of pancreatic regenerative proteins (Reg4, PTF1, and PDX1) were significantly promoted by pri-miR-9-BMSCs (A,B) or miR-9a-5p agomir (C,D), compared with SAP, SAP+PBS, BMSCs, TuD-BMSCs, or miR-9a-5p control groups. [score:2]
Bazzoni F Induction and regulatory function of miR-9 in human monocytes and neutrophils exposed to proinflammatory signalsProc. [score:2]
Inversely, the expressions of SOD [1], SOD [2], IκBα, and IκBβ were significantly increased by miR-9a-5p agomir, compared with SAP+PBS or miR-9a-5p control group, by gPCR (A,B), Western-blot (C,D) and IHC (E,F). [score:2]
On the contrary, the expressions of superoxide dismutase (SOD [1] and SOD [2]) and anti-inflammatory proteins (IκBα and IκBβ) were significantly increased by pir-miR-9-BMSCs, compared with SAP, SAP+PBS, BMSCs, or TuD-BMSCs groups by gPCR (A,B), Western-blot (C,D) and IHC (E,F). [score:2]
In addition, the expressions of IκBα and IκBβ in pancreatic tissues were significantly increased by pri-miR-9-BMSCs, compared with SAP, SAP+PBS, BMSCs, Empty Virus-BMSCs or TuD-BMSCs groups (Fig.   3A–D). [score:2]
Meanwhile, the pancreatic IL-6 expression was also significantly decreased by pri-miR-9-BMSCs, compared with SAP, SAP+PBS, Empty Virus-BMSCs or TuD-BMSCs (Fig.   3A,B). [score:2]
What’s more, we validated that NF-κB1/p50 gene was the target gene of miR-9 by performing the dual luciferase reporter assay. [score:2]
Consequently, it was suggested that miR-9 was a key regulatory factor of BMSCs in treating SAP. [score:2]
Interestingly, pancreatic and duodenal homeobox 1(PDX1), a protein involved in the regeneration of islets and pancreatic development 51, 54, was also significantly increased by pri-miR-9-BMSCs and miR-9 agomir. [score:2]
Rats were randomly injected by the tail vein with pri-miR-9-BMSCs, Empty virus-BMSCs, TuD-BMSCs or BMSCs (1 × 10 [7] cells/kg) at postoperative day 1 as previously described [26] and thus divided into NC (n = 6), Sham (n =  6), SAP (n =  6), SAP+PBS (PBS treatment) (n =  6), BMSCs (n =  6), pri-miR-9-BMSCs (n =  6), Empty virus-BMSCs (n =  6), TuD-BMSCs (n =  6). [score:1]
Introducing pri-miR-9-BMSCs and miR-9a-5p agomir repair necrotized pancreatic tissues and reduce systematic inflammatory response. [score:1]
Interestingly, miR-9a-5p agomir could also mimic the roles of pri-miR-9-BMSCs and reduce cell apoptosis (Fig.   2D and E). [score:1]
In this study, we found that a lot of Cy3-miR-9 was released from BMSCs and accumulated in pancreatic lymph node rather than pancreatic parenchyma. [score:1]
Transfection with Cy3-miR-9a-5p mimics and detection of NF-κB Activity. [score:1]
The construction of miR-9 and anti-miR-9 vectors. [score:1]
Taken together, the result indicated that there was a significant negative correlation between miR-9 and AP (Fig.   7F). [score:1]
Besides, we also validated the relationship between miR-9 and AP. [score:1]
BMSCs could deliver exogenous miR-9 to the damaged pancreas and PBMC. [score:1]
In brief, the decoy sequence of anti-miR-9 was designed as follows: 5′ -TCATACAGCTAG ATCT ATAACCAAAGA-3′ and 5′ -TCTTTGGTTAT AGAT CTAGCTGTATGA-3′ and synthesized by Beijing Genomics Institute. [score:1]
Taken together, these results indicate that miR-9 released by BMSCs can mimic the roles of BMSCs to repair SAP, as a result of which it is not necessary for BMSCs migrating to the injured pancreas. [score:1]
The distribution of Cy3-miR-9a-5p transfected Empty virus-BMSCs in vivo. [score:1]
Then, the amplified fragment and PCDH-CMV-MSCs-EF1-GFP-T2A-Puro vector (PCDH) (System Biosciences, CA, USA) were digested by Nhe I and BamH I enzymes to produce the sticky ends respectively and connected by T4 DNA ligase at 16 °C overnight to generate the recombinant plasmid (pri-miR-9-PCDH). [score:1]
Besides, in vitro, we observed that BMSCs delivered exogenous miR-9 to PBMC, which repressed the activity of NF-κB signaling pathway. [score:1]
Besides, whether miR-9 is involved in the process of transplanted MSCs repairing AP remains unknown. [score:1]
Interestingly, we found that a lot of Cy3-miR-9 accumulated in pancreatic lymph node (Supplementary information Figure  8/Supplementary picture). [score:1]
Besides, we constructed the plasmid of anti-miR-9 by adopting RNA tough decoy (TuD) technique as previously described [61]. [score:1]
Moreover, the amount of cells migrating to injured pancreas were similar among BMSCs, pri-miR-9-BMSCs, Empty virus BMSCs and TuD-BMSCs groups. [score:1]
Besides, we investigated that the expression of miR-9 in 3% NaT -induced severe AP was significantly higher than that in Caerulein -induced mild AP. [score:1]
pri-miR-9-BMSCs migrate to the injured pancreas at day 3 after transplantation, but the cell number is very few and much less than that in lung tissues. [score:1]
Recombinant lentivirus encoding miR-9 or TuD was produced by lentivirus packaging system (System Biosciences, CA, USA) following the manufacturer’s instructions. [score:1]
miR-9 was a protective molecule of severe AP. [score:1]
In addition, to reveal the relationship between miR-9 and AP, we established several AP mo dels as follows: NC (n =  3), Sham (n =  3), Caerulein (n =  3), 3% NaT (n =  3). [score:1]
The new finding helps us understand how miR-9 could repair SAP, which may be related with modulation of local/systematic inflammatory/immune response. [score:1]
The results showed that the relative activity of firefly luciferase in HEK293T cells not only significantly declined after the transfection of miR-9a-5p mimics, but also presented a downtrend as the concentration of miR-9a-5p mimics increases (Fig.   6E). [score:1]
The distribution of Cy3-miR-9a-5p transfected Empty virus-BMSCs in vivo The liver, heart, spleen, lung, pancreas, kidney, duodenum were collected at day 3 after the transplantation of Cy3-miR-9a-5p transfected Empty virus-BMSCs, and fixed in 4% paraformaldehyde for 24 hr. [score:1]
Besides, we found that BMSCs could deliver miR-9 to the injured pancreas or PBMC, which could repress the NF-κB signaling pathway. [score:1]
The number of cells migrating to the damaged pancreas had no difference among BMSCs, pri-miR-9-BMSCs, Empty-virus-BMSCs and TuD-BMSCs groups, but less than those of migrating to lung at day 3 after transplantation. [score:1]
Moreover, we observed that transplanted BMSCs could deliver miR-9 to the liver, spleen, lung and pancreas, suggesting that it is possible to repair SAP through the secretions of BMSCs. [score:1]
First, the vectors of pri-miR-9-PCDH, PL KO. [score:1]
Figure 5pri-miR-9-BMSCs and miR-9a-5p agomir promote the regeneration of damaged pancreas mainly depending on the paracrine. [score:1]
Furthermore, the number of cells migrating to damaged pancreatic tissues has no statistical difference among pri-miR-9-BMSCs, BMSCs, Empty virus-BMSCs and TuD-BMSCs groups (Fig.   5E,F). [score:1]
pri-miR-9-BMSCs and miR-9a-5p agomir promote the regeneration of necrotized pancreatic tissues. [score:1]
Chakraborty, S., Zawieja, D. C., Davis, M. J. & Muthuchamy, M. MicroRNA Signature of Inflamed Lymphatic Endothelium and Role of miR-9 in Lymphangiogenesis and Inflammation. [score:1]
In our study, we investigated that miR-9 could be delivered by pri-miR-9-BMSCs and miR-9 agomir to the injured pancreas, which could inhibit the activation of NF-κB signaling pathway, decrease the levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6, and HMBG1) and increase the levels of anti-inflammatory cytokines (IL-4, IL-10, and TGF-β). [score:1]
The result showed that Cy3-miR-9a-5p could be released by GFP-BMSCs to the liver, lung, spleen, and pancreas, of which the amount in liver and spleen was more than that in lung and pancreatic parenchyma (Fig.   1X). [score:1]
The liver, heart, spleen, lung, pancreas, kidney, duodenum were collected at day 3 after the transplantation of Cy3-miR-9a-5p transfected Empty virus-BMSCs, and fixed in 4% paraformaldehyde for 24 hr. [score:1]
The expressions of miR-9 were measured by qRT-PCR and gPCR. [score:1]
These above results strongly suggested that miR-9 could promote the regeneration of damaged pancreatic tissues, which also explained why SAP was alleviated significantly by pri-miR-9-BMSCs and miR-9 agomir. [score:1]
PBMC was firstly co-cultured with BMSCs of miR-9a-5p transfection for 24 hr and then co -transfected by Lipo2000 with NF-κB-Luc reporter vector (0.1 µg) and Renilla luciferase (pRL-TK, 0.1 µg). [score:1]
In AP, the role of miR-9 has not been studied. [score:1]
However, SAP could not be repaired by TuD-BMSCs or miR-9 agomir control. [score:1]
Thus, miR-9 can be regarded as a anti-inflammatory molecular. [score:1]
Moreover, to demonstrate that miR-9 could reduce SAP, we administrated miR-9a-5p agomir (1 µM) and miR-9a-5p control (1 µM) (Biotend Company, Shanghai, China) to SAP rats through the tail vein following the manufacturer’s instructions (http://www. [score:1]
Figure 1pri-miR-9-BMSCs could attenuate SAP. [score:1]
The plasmid of wtUTR (1 μg) or mutUTR (1 μg) and miR-9a-5p mimics (50 nM) were co -transfected into HEK293T cells by Lipo2000. [score:1]
[1 to 20 of 106 sentences]
5
[+] score: 223
MiR-9 levels were increased three days after knockdown of HDAC4 (Fig. 3A), supporting a hypothesized inhibitory role for HDAC4 on the expression of miR-9-2. Direct interaction of Mef2C and HDAC4 was confirmed by co-immunoprecipitation following transfection of both expression clones into N2a cells (Fig. 3B). [score:9]
Cells becoming neurons (bottom) switch to a state where miR-9 inhibits production of HDAC4, allowing a pro-transcriptional binding of MEF2C upstream of miR-9-2. The identification of miRNA transcriptional control elements that are regulated during neurogenesis and modulated by the same miRNA targeting a potential inhibitory element demonstrates a powerful scheme for promoting the canalization of neuronal fate. [score:8]
MiR-9 suppresses Nr2e1 (also known as TLX) expression to negatively regulate neural stem cell proliferation and accelerate neural differentiation [28] and this is likely an indirect effect of let-7d regulation [49]. [score:8]
To confirm that this inhibition is partially regulated by miR-9 the HDAC4 3′UTR plasmid was co -transfected with expression vectors for miR-9 (cloned into pSI and/or Block-it) into HeLa cells. [score:6]
With HDAC4 shown to bind with Mef2C and to enrich the predicted Mef2 sites upstream of miR-9-2, and knockdown of HDAC4 reducing expression of miR-9, we conclude that HDAC4 attenuates miR-9 expression, likely through its interaction with Mef2C. [score:6]
We also demonstrate that the promoter region for miR-9-2 contains two binding sites for Mef2 and show that specific inhibition of Mef2c decreases promoter activity of miR-9-2. Additionally, we identify that miR-9 negatively regulates HDAC4, a known repressor of Mef2c and reduction of HDAC4 by shRNA enhances the expression of miR-9. The repression of HDAC4 by miR-9 reinforces a positive feedback loop which enhances the neurogenic capacity of neural precursor cells. [score:6]
Also, miR-9 is expressed in neural progenitor cells of X. tropicalis, and its knockdown results in an inhibition of neurogenesis along the anterior-posterior axis. [score:6]
Thus, miR-9 has the capacity to reduce the inhibitory activity of HDAC4, stabilizing its own expression in a reinforcing, positive feedback mechanism which enhances the neurogenic capacity of neural precursor cells (Fig. 5). [score:5]
Since we predict that Mef2C and miR-9 are coordinately involved in neurogenesis and HDAC4 opposes this mechanism, we searched for potential feedback networks between Mef2C and miR-9. We used TargetScanS [42], [43] to determine if any of these mRNAs were potential targets of miR-9. The 3′UTR of HDAC4 contained four predicted miR-9 response elements (RE) including one closest to the coding sequence (Fig. 4A) that is conserved with mouse and humans. [score:5]
In late embryonic zebrafish brains, miR-9 expression shows spatial specificity, avoiding expression in the midbrain-hindbrain boundary (MHB) region, a non-neurogenic boundary zone containing a pool of progenitor cells that contributes neurons to the midbrain-hindbrain domains. [score:5]
Levels of miR-9 were increased by transfecting HeLa cells with either a plasmid vector expressing rat genomic sequences surrounding miR-9 (pSI miR-9) or a synthetic miR-9 gene constructed in the Block-IT expression vector (Life Technologies). [score:5]
The reduced luciferase expression at Day 3 correlates with increased miR-9 expression upon FGF withdrawal -induced differentiation. [score:5]
The requirement of the Mef2 transcription factor binding sites to achieve full transcription activity, combined with the dramatic effect of Mef2C knockdown on the expression of luciferase in this assay supports the hypothesis that Mef2C binding to the upstream region of miR-9-2 is capable of affecting the expression of miR-9 and suggests that Mef2C and miR-9 cooperatively interact to promote the neuronal phenotype HDAC4 is a known repressor of Mef2 factors [36], [38], [52]– [60]. [score:5]
In contrast, increased expression of luciferase in the miR-9-2 -transfected L2.2 cells suggests that this promoter is active; supporting the conclusion that miR-9-2 is the only regulated miR-9 family member during neuronal differentiation in L2.2. [score:4]
MiR-9 regulates Hes1, which is expressed in an oscillatory fashion during neural progenitor proliferation but switches to increased miR-9 and less Hes1 as differentiation proceeds [29], [50]. [score:4]
MiR-9 over -expression was shown to promote premature neuronal differentiation in the MHB, meanwhile, knockdown of miR-9 with modified antisense oligonucleotides (morpholino) had the opposing effect by increasing the MHB area size and region specific markers [45]. [score:4]
Amongst these miRNAs was miR-9. Studies have detected the expression of miR-9 in differentiating neural progenitor cells and mature mouse neurons, so we chose to focus on regulation of miR-9 in this study. [score:4]
In another study, Zhao et al. showed that knock down of miR-9 in adult mouse NSCs caused a small increase in proliferating cells (1.37-fold) and that over -expression of miR-9 leads to a decrease in proliferation of precursor cells and an increase in both glial and neuronal differentiation [28]. [score:4]
We sought to understand the mechanisms regulating miR-9 expression during neurogenesis. [score:4]
The anti miR-9 oligo was able to reverse the inhibition caused by miR-9 (*p<0.05, Fig. 4E), illustrating the specificity of miR-9 in this regulatory mechanism. [score:4]
Mo del of Mef2c/HDAC4 regulation of miR-9 expression during neurogenesis. [score:4]
Gain and loss of function experiments have shown that miR-9 regulates differentiation of Cajal-Retzius cells in the medial pallium by targeting Foxg1 [48]. [score:4]
Furthermore, during differentiation, Mef2C activates miR-9-2 by binding upstream regulatory sites, resulting in increased miR-9 expression. [score:4]
To confirm this inhibitory role, we knocked down HDAC4 with shRNAs, expecting to see an increase in miR-9 levels due to a derepression of Mef2C. [score:4]
miR-9 targets HDAC4 mRNA. [score:3]
Cells becoming neurons (bottom) switch to a state where miR-9 inhibits production of HDAC4, allowing a pro-transcriptional binding of MEF2C upstream of miR-9-2. Figure S1 Evolutionary expansion of the miR-9 family of microRNAs. [score:3]
Ectopic over -expression of a miR-9 mimic enhances the neurogenic differentiation capacity of a neural precursor cell. [score:3]
This increase in inhibition correlates with an increase in the levels of miR-9 upon L2.2 differentiation (Fig. 1A). [score:3]
Increased miR-9 levels in turn serve to attenuate the Mef2 inhibitor HDAC4. [score:3]
We further confirmed that miR-9 was directly responsible for the post-transcriptional regulation of HDAC4 by testing the activity of one of the miR-9 response elements in the HDAC4 3′UTR (Fig. 4A). [score:3]
These also potentially have roles in regulating the transcriptional activity of the miR-9-2 promoter and could serve to initiate miR-9 transcription in order to start the regulatory scheme. [score:3]
While this list of miR-9 targets is substantial, there are likely to be many more nodes in the network of miR-9 and neurogenesis. [score:3]
We show that ectopic over -expression of a miR-9 mimic enhances the neurogenic differentiation capacity of rat NPCs. [score:3]
Several transcription factor pathways have been identified as targets of miR-9 during neurogenic differentiation. [score:3]
To confirm that the inhibition in luciferase activity seen by RE1 is caused by miR-9, the RE1 reporter plasmid was nucleofected into L2.2 cells along with either a miR-9 anti-miR (Ambion) or a negative control oligo. [score:3]
To confirm the expression profile of miR-9 in differentiating L2.2 cells, we performed quantitative real-time PCR (qPCR) (Fig. 1A). [score:3]
Mutating the miR-9 RE derepresses luciferase expression, with or without FGF (p = 0.029 for RE1 vs. [score:3]
However, in neural progenitor cells derived from human ESCs, loss of miR-9 has been shown to suppress proliferation and promote migration of neural progenitors, but has no effect on differentiation [47]. [score:3]
We identified miR-9-2 as the primarily-regulated miR-9 locus in differentiating neuronal precursors. [score:2]
We conclude that miR-9 regulation is mediated, at least in part, by Mef2C binding to the miR-9-2 promoter and that HDAC4 can serve as a repressor of MEF2C in NSCs. [score:2]
However, less is known about the factors that regulate miR-9 transcriptional activity. [score:2]
Data from these assays indicate that miR-9 is capable of targeting the HDAC4 3′UTR (Fig. 4C). [score:2]
Each of the miR-9 genomic loci produces a unique primary transcript that can be processed into identical, functional miR-9. It is this mature molecule which is detected by microarrays or qPCR, and therefore this assay is unable to determine the genomic origin of the mature molecule whose expression increases during neurogenesis. [score:2]
MiR-9 increases retinoic acid induced neuronal differentiation in neuroblastoma cells by inhibiting the neuronal differentiation repressor ID2 [26]. [score:2]
In NPCs derived from mouse ESCs, miR-9 knockdown causes a reduction in the number of differentiating neurons accompanied by a slight increase in GFAP [+] astrocytes [27]. [score:2]
One potential regulator of miR-9 transcription is Mef2C. [score:2]
In this study, we identified miR-9-2 as the primarily regulated miR-9 locus in differentiating neuronal precursors. [score:2]
MiR-9 is expressed in proliferating and differentiating neural cells [24], [25]. [score:2]
Mef2 binding sites within a 5 Kb upstream region of isoforms of the brain-enriched microRNAs miR-9 and miR-124 are enriched as compared to a random set of expressed microRNA upstream regions. [score:2]
MiR-9 showed a significant increase in expression upon differentiation over time following bFGF withdrawal (p<0.001, ANOVA). [score:2]
Mef2C is regulated during neurogenesis, in turn contributing to miR-9 induction. [score:2]
In this study, we report that miR-9 enhances the neurogenic differentiation capacity of NPCs. [score:1]
pMir vector containing the miR-9 RE1 was transfected into L2.2 cells. [score:1]
If miR-9 functions in a neurogenic role during differentiation, then it should increase the percentage of neuronal cells produced during differentiation of a rat multipotential NPC clone. [score:1]
PremiRs (Life Technologies) for miR-9 were nucleofected into L2.3 cells using Rat Neuron 96-well Nucleofector Kit (VHPG-1003) in conjunction with an amaxa 96-well shuttle system (Lonza, Cologne, Germany). [score:1]
miR-9 increases during neurogenesis through transcriptional induction of the miR-9-2 locus. [score:1]
A survey of the 5 kb upstream region of each of the miR-9 isoforms was conducted for known core promoter elements and putative transcription factor binding sites using high quality vertebrate position weight matrices (PWMs) from the Transfac 10.2 database [41]. [score:1]
indicated that while primary transcripts were detectable for all three miR-9 genes, only the transcripts (primary and precursor) from the 2q11 region, corresponding to the miR-9-2 variant, were significantly increased during neurogenesis in L2.2 cells (p<0.05). [score:1]
0094348.g004 Figure 4 (A) The wild-type version of the miR-9 response element 1 (RE1) of the HDAC4 3′UTR aligned with the miR-9 sequence and the mutated form (RE1mt). [score:1]
To explore the evolutionary relationship between these three paralogs, 78 select miRNA precursor sequences for members of the miR-9 family (File S1; miRBase v20) were aligned using ClustalW, and a phylogenetic tree was constructed from the multiple sequence alignment using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) method on the Jukes-Cantor genetic distances between aligned pairs (Fig. S1). [score:1]
While this could be due to differential cell death, we conclude that increased levels of miR-9 are sufficient to enhance neuronal pathways in uncommitted neural precursor cells. [score:1]
These findings support a key role for miR-9 during neurogenesis. [score:1]
0094348.g003 Figure 3(A) Infection of multipotential L2.3 cells with lentiviral-encoded shRNA specific for HDAC4 leads to increased miR-9 levels. [score:1]
B) Mature rat miR-9 can be derived from multiple potential genomic loci, two of which are immediately adjacent to known Mef2-encoding genes. [score:1]
A phylogenetic analysis of the evolutionary relationships between miR-9 genes shows that there have been several duplication events within the miR-9 family throughout the course of evolution (Fig. S1). [score:1]
Both Mef2C and Mef2D are found adjacent to separate miR-9 paralogs. [score:1]
Although the origin of the ancestral miR-9 gene cannot be determined from this analysis, it is clear that both the miR-9-2 and miR-9-3 genes arose from duplication events that also allowed for duplication of neighboring genes. [score:1]
To our surprise we identified a series of putative miR-9 response elements in the 3′UTR of HDAC4 mRNAs. [score:1]
To test this hypothesis, we transfected miR-9 mimics into the multipotential NPC clone L2.3, which upon bFGF withdrawal produces a mix of neurons and glia [40]. [score:1]
The repression of HDAC4 by miR-9 reinforces a positive feed-back scheme that enhances the neurogenic capacity of neural precursor cells. [score:1]
It should be noted that we did not rule out a cell-type-specific cell death following treatment with a miR-9 mimic. [score:1]
The phylogeny of miR-9 was explored using the Sanger registry v9.0. [score:1]
At 72 hrs following electroporation of the miR-9 mimic, FACS analysis demonstrated a significant increase in the percentage of TuJ1 [+] cells (Fig. 1B & C; p<0.05, Student's t-test). [score:1]
The differences among studies can partially be attributed to differences in the mo del systems or growth conditions, but, these discrepancies also raise the possibility that the function of miR-9 in neurogenesis and proliferation is dependent on timing and/or anatomy. [score:1]
MiR-9 knockdown caused a reduction of Cajal-Retzius neurons but did not affect progenitor cells [48]. [score:1]
File S1 78 select miRNA precursor sequences for members of the miR-9 family (miRBase v20). [score:1]
0094348.g001 Figure 1(A) miR-9 miRNA levels increase over time following withdrawal of bFGF from L2.2 cells. [score:1]
One miRNA with the potential to contribute to differentiation from a NSC to a mature neuron is miR-9 [23]. [score:1]
This distinction is significant here due to the singular role played by the miR-9-2 locus in increasing the cellular levels of mature miR-9 during differentiation of L2.2 cells. [score:1]
In mammals, the mature form of miR-9 may be transcribed from one or more of three distinct genomic loci, miR-9-1, miR-9-2, or miR-9-3, likely derived from a common evolutionary ancestor gene. [score:1]
Brain-enriched miRNAs such as miR-9, miR-124a, miR-125, and numerous others are induced in primary neural tissues and differentiating primary neurons [20]– [22]. [score:1]
Anti-miR-9 or scrambled negative control RNA (Life Technologies) were nucleofected into L2.2 cells. [score:1]
A) Cladogram describing the differences between 78 selected members of the miR-9 gene family (see File S1) across all species present in miRBase v20. [score:1]
[1 to 20 of 83 sentences]
6
[+] score: 173
According to the qRT-PCR analysis, we observed that the expression of myocardin was efficiently down-regulated by miR-9 mimic and up-regulated by miR-9 inhibitor (Fig. 4A and B). [score:11]
HPS rat serum up-regulated miR-9 expression, down-regulated myocardin mRNA and protein levels and induced phenotypic modulation in rat PASMCs. [score:9]
As shown in Figure 5B and C, inhibition of miR-9 or overexpression of myocardin also repressed HPS rat serum -induced down-regulation of SM-α-actin and SM-MHC. [score:8]
Wang et al. demonstrated that miR-9 inhibits cardiac hypertrophy by suppressing the expression of myocardin in cardiomyocytes 35. [score:7]
Moreover, we observed that miR-9 is significantly up-regulated under HPS rat serum stimulation and contributes to the HPS rat serum -induced PASMC phenotypic switch and excessive proliferation by targeting myocardin. [score:6]
Our findings suggest that up-regulation of miR-9 is critical for the phenotypic modulation of PASMCs in response to HPS rat serum exposure, leading to dedifferentiation of PASMCs by suppressing differentiation genes of PASMCs and enhancing proliferation. [score:6]
As demonstrated by Western blot analysis, transfection with miR-9 inhibitor significantly repressed HPS rat serum -induced down-regulation of myocardin and phenotype markers SM-α-actin and SM-MHC (Fig. 3A– C). [score:6]
These results suggest that myocardin serves as a functional target gene of miR-9. Figure 4miR-9 directly targets MYOCD 3′-UTR in PASMCs. [score:6]
These results suggest that myocardin serves as a functional target gene of miR-9. Figure 4miR-9 directly targets MYOCD 3′-UTR in PASMCs. [score:6]
To further investigate whether the attenuated effect of miR-9 inhibitor on HPS rat serum -induced PASMC phenotypic modulation is associated with myocardin, we applied MYOCD expression plasmids using a transient transfection to overexpress myocardin in PASMCs. [score:5]
Ectopic expression of miR-9 in cultured PASMCs was achieved by transfection with miR-9 mimics or inhibitors (Qiagen). [score:5]
Interestingly, both miR-9 inhibitor and MYOCD expression plasmids efficiently repressed the HPS rat serum -induced increase in [3]H-TdR incorporation and absorbance of CCK-8 at each time-point (Fig. 5D and E). [score:5]
We also determined the potential regulatory role of miR-9 in regulating myocardin expression and the HPS rat serum -induced phenotypic modulation and excessive proliferation of PASMCs. [score:5]
Knockdown of miR-9 reverses the HPS rat serum -induced down-regulation of myocardin and differentiation markers in PASMCs, as demonstrated by Western blot analysis. [score:5]
N: Non -transfected group; E: empty vector group; T: transfected group; NM: normal rat serum stimulation; HPS: HPS rat serum stimulation; HPS+MI: miR-9 inhibitor transfection + HPS rat serum stimulation; HPS+M: myocardin expression plasmids transfection + HPS rat serum stimulation. [score:5]
Next, PASMCs were transfected with either miR-9 inhibitor or MYOCD expression plasmids and treated with HPS rat serum for 48 hrs. [score:5]
As was expected, both knockdown of miR-9 and overexpression of myocardin reversed HPS rat serum -induced PASMC phenotypic modulation and excessive proliferation. [score:4]
miR-9 efficiently regulates myocardin expression in cultured PASMCs under the condition of HPS rat serum. [score:4]
Our recent research has shown that myocardin levels decrease in PASMCs treated with HPS rat serum, and further studies identified myocardin as a direct target of miR-9 and demonstrated its involvement in mediating miR-9 effects on HPS rat serum -induced PASMC phenotypic modulation and proliferation. [score:4]
These results suggest that miR-9 may play a role in HPS rat serum -induced PASMCs phenotypic modulation by negatively regulating myocardin expression. [score:4]
In this study, we investigated the effect of HPS rat serum on miRNAs predicted to target myocardin and identified miR-9 as the most significantly up-regulated miRNA in cultured PASMCs. [score:4]
NM: normal rat serum stimulation; HPS: HPS rat serum stimulation; HPS+SCR: HPS rat serum stimulation + scramble control; HPS+MI: miR-9 inhibitor transfection + HPS rat serum stimulation. [score:3]
To confirm the effect of miR-9 on myocardin expression was because of its binding to the complementary sites within 3′-UTR of myocardin mRNA, we fused the MYOCD 3′-UTR region, including the predicted miR-9 recognition site, into a luciferase reporter plasmid, designated as PGL3-MYOCD-LUC [wt]. [score:3]
By using the Quick-change Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA), we conducted mutagenesis of the seed sequence present in the 3′-UTR to prevent binding of miR-9. The mutations were sequence-verified. [score:3]
24 hrs after the same number of PASMCs was seeded, cells were transfected with either miR-9 inhibitor or Myocd, and incubated with DMEM containing different sera for the indicated time. [score:3]
The inhibitory effect of miR-9 mimic on luciferase activity was abrogated in the mutated reporter group. [score:3]
Figure 1HPS rat serum induces an increase in miR-9 expression level and a decrease in myocardin in cultured PASMCs at each time-point. [score:3]
To further explore the relationship between miR-9 and myocardin in PASMCs under the condition of HPS rat serum, we transfected cultured PASMCs with miR-9 mimic and inhibitor, respectively, and then treated with HPS rat serum for 48 hrs. [score:3]
After 24 hrs of synchronous growth, cells were transfected with either miR-9 inhibitor or Myocd according to the manufacturer’s instructions. [score:3]
These findings suggest that myocardin not only is a functional target gene of miR-9 but also mediates the effects of miR-9 on HPS rat serum -induced excessive proliferation of PASMCs. [score:3]
These findings suggest that myocardin not only is a functional target gene of miR-9 but also mediates the effects of miR-9 on HPS rat serum -induced PASMC phenotypic modulation. [score:3]
As a result, repression of miR-9 or restoration of myocardin could have important implications for the clinical management of HPS or other proliferative vascular diseases. [score:3]
To investigate whether miR-9 functions as a direct regulator of the HPS rat serum -induced PASMC phenotypic switch, miR-9 inhibitor was transfected into cultured PASMCs, and then treated with HPS rat serum for 48 hrs. [score:3]
In conclusion, we described the novel mechanism of miR-9 in regulating HPS rat serum -induced PASMC phenotypic modulation and proliferation via the miR-9/myocardin axis. [score:2]
These findings indicate that miR-9 functions as a potent regulator in HPS rat serum -induced PASMC phenotypic modulation. [score:2]
By co-transfecting the miR-9 with this construct into HEK293 cells, we observed that miR-9 mimic effectively repressed luciferase activity, but mutations in the putative binding site eliminated miR-9 -mediated repression of luciferase activity (Fig. 4C and D). [score:2]
For luciferase reporter assay, HEK293 cells were cotransfected with the constitutively active Renilla reniformis luciferase-producing vector pRL, miR-9 or non -targeting pre-miR -negative control and luciferase WT or mutated 3′-UTR vectors for MYOCD using the Siport NeoFX transfection reagent, according to the manufacturer’s instructions. [score:2]
Myocd mediates the effects of miR-9 on HPS rat serum -induced PASMC phenotypic modulation. [score:1]
The [3]H-TdR and CCK-8 were performed to further validate the functional role of myocardin in mediating miR-9 effects on HPS rat serum induced PASMCs excessive proliferation. [score:1]
Therefore, we began this study with myocardin as the focus molecule and profiled four selected miRNAs, including miR-1, miR-9, miR-128 and miR-186 which were predicted by miRanda (http://www. [score:1]
Myocd mediates the effects of miR-9 on HPS rat serum -induced excessive proliferation of PASMCs. [score:1]
In the present study, we confirmed the link between HPS rat serum, miR-9 and myocardin. [score:1]
In addition, our previous study found that miR-9 plays an important role in hypoxia -induced PASMCs phenotypic modulation and identified myocardin as a downstream molecule 36. [score:1]
Figure 5Myocd mediates the effects of miR-9 on HPS rat serum -induced PASMC phenotypic modulation and excessive proliferation. [score:1]
Our present work is the first to reveal that miR-9 and myocardin constitute an axis, which is involved in HPS rat serum -induced PASMC phenotypic modulation and excessive proliferation. [score:1]
Moreover, myocardin is identified as a key molecule in miR-9 -mediated effects on the HPS rat serum -induced PASMC phenotypic switch and excessive proliferation. [score:1]
[1 to 20 of 46 sentences]
7
[+] score: 130
It should be mentioned that miR-9-5p and miR-9-3p are abundantly expressed not only in neural progenitors but also in postmitotic neurons [17, 31];hence the importance of studying the potential role of miR-9 in adulthood and neurological diseases. [score:5]
Reduction of miR-9-5p in vivo rescues learning and memory impairments in CCH ratsTo understand the effects of miR-9-5p increment in the pathogenesis of VaD, we artificially suppressedthe expression of miR-9-5p in the brains of theCCH ratswith rno-miR-9-5p antagomirat 3 months after the surgery (Figure 3A). [score:5]
These data suggested that suppression of miR-9-5p inhibits the oxidative stress level in CCH rats. [score:5]
To understand the effects of miR-9-5p increment in the pathogenesis of VaD, we artificially suppressedthe expression of miR-9-5p in the brains of theCCH ratswith rno-miR-9-5p antagomirat 3 months after the surgery (Figure 3A). [score:5]
Inhibition of miR-9-5p rescued the LTP inhibition in CCH rats. [score:5]
miR-9-5p is upregulated in patients with VaD and CCHrats. [score:4]
In an independent study, asynergistic effectof miR-9 and miR-124 has been reportedin the regulation of dendritic branching via the AKT/GSK3β pathway by targeting the Rap GTP -binding proteinRap2a [37]. [score:4]
In this study, we reported that miR-9-5p is upregulatedin both the serum and cerebrospinalfluid of patients with VaD and in the hippocampus of CCH rats. [score:4]
These data strongly suggested that miR-9-5p is upregulatedin patients with VaD and CCH rats. [score:4]
In the current study, we demonstratedan abnormal upregulation of miR-9-5p in both the serum and CSF of patientswith VaD, suggesting thepotential role of miR-9-5p in VaD progression. [score:4]
These results strongly implied that the in vivo suppression of miR-9-5p is able to reverse the synaptic impairments in CCH rats. [score:3]
Indeed, in the postmortem brains of patients withHuntington's disease, the level of miR-9 was decreased [32]. [score:3]
Reduction of miR-9-5p inhibits the oxidative stress level in CCH rats. [score:3]
Inhibition of miR-9-5p restored the neuronal loss in CCH rats. [score:3]
MiR-9-5p is upregulated in the serum and CSF of patientswith VaD. [score:3]
Inhibition of miR-9-5p rescued the dendritic spines abnormalities in CCH rats. [score:3]
Recently, in primary culture neurons, Giusti et al. [48] showed that the inhibition of miR-9-5p using the sponge technique impairs dendritic growth and excitatory synaptic transmission. [score:3]
Inhibition of miR-9-5p rescued the spatial learning memory impairments of CCH rats. [score:3]
Inhibition of miR-9-5p rescued the cholinergic dysfunction in CCH rats. [score:3]
Inhibition of miR-9-5p attenuated the oxidative stress in CCH rats. [score:3]
Moreover, we found that suppression of miR-9-5pby anta-miR-9-5p in CCH rats elevated AChlevelsand ChAT activity, butdecreased AChE activity. [score:3]
The pre-administrated ofanta-miR-9-5p strongly improved theCCH -inducedspinogenesisinhibition. [score:3]
In our study, we found that the administration of miR-9-5p antagomir restores the dendritic spines loss and the synaptic plasticity inhibition in the CCH rats. [score:3]
The above results indicated that suppression of miR-9-5p is able to reverse the memory deficits in CCH rats. [score:3]
Inhibition of miR-9-5p rescued the fear memory impairments of CCH rats. [score:3]
For example, miR-9 knock-out mice, in which both miR-9-5p and miR-9-3p are reduced, displayed obvious defects in neurogenesisand abnormal telencephalicstructures [30]. [score:2]
To date, several functional studies on miR-9 have emphasizeditsrole in neuronal development and neurogenesis [29]. [score:2]
Previous studies suggested that miR-9 is enriched in the brain, especially during development [17]. [score:2]
We first analyzed the miR-9-5p level in the serum and cerebrospinalfluid (CSF) of patients with VaD as described above. [score:1]
Our results demonstrated that miR-9-5p is critically involved in VaD and that blocking miR-9-5p is sufficientto rescue the learning and memory impairments observed ina VaDrat mo del. [score:1]
No obvious difference was detectedbetween the Conand Anta-miR-9-5prats (Figure 3D-3F). [score:1]
Treatingthe rats with anta-miR-9-5p improved the searching strategy (Figure 3B). [score:1]
After one week of acclimatization, rats were randomly divided into four groups, (1) control rats with the sham operation and vehicle injection (Con), (2) 2VO surgery and vehicle injection (CCH), (3) 2VO surgery with anta-miR-9-5p injection (CCH+Anta-miR-9-5p), and (4) anta-miR-9-5p injection alone (Anta-miR-9-5p). [score:1]
Reduction of miR-9-5p in vivo reduces the neuronal loss in CCH ratsIt was reported that neuronal loss resulting from apoptotic or necroticneuronal cell death is a common feature of VaD [22]. [score:1]
No significant differences were found between the Conand anta-miR-9-5p groups (Figure 7A-7C). [score:1]
These data suggested a discrepancy inthe in vivo and in vitro roles of miR-9-5p in dendritic spines and synaptic plasticity. [score:1]
However, the role of miR-9 in the progression of memory impairment induced by vascular factors hasnot been studied yet. [score:1]
Administration of anta-miR-9-5p significantly restored the activities of SOD and GSH-pxand decreased the levels of MDA and T-ROS in the CCH rats (Figure 9A-9D). [score:1]
No significant differences were found between the Conand Anta-miR-9-5p groups. [score:1]
Among them, miR-9, which is a highly conserved miRNAlocated on chromosome 3 in the mouse genome, is of particularinterest. [score:1]
The mortality was 1/17 (5.9%) in the Con group, 3/19 (15.8 %) in the CCH group, 2/15 (13.3 %) in the CCH+Anta-miR-9 group, and 1/14 (7.1 %) in the Anta-miR-9 group. [score:1]
The miR-9-5p gene is evolutionary well conserved. [score:1]
In the test period, CCH rats showed obviously a shorter latency than control rats, whileanta-miR-9-5pextended the latency of CCH rats (Figure 4A). [score:1]
Reduction of miR-9-5p in vivo rescues the synaptic impairments in CCH rats. [score:1]
Therefore, we measured the effect of suppression of miR-9-5p on AChlevelsand activity of AChE and ChAT in the hippocampus of CCH rats. [score:1]
Reduction of miR-9-5p in vivo reduces the neuronal loss in CCH rats. [score:1]
Furthermore, reduction of miR-9-5p by antagomirsrescued the learning and memory ability, synaptic plasticity, dendritic spines, cholinergic neurons, oxidative stress level, and neuronal loss induced by CCH. [score:1]
We found that in the serum of patientswith VaD, the level of miR-9-5p increased to about 2.4 folds of age-matched controls (Figure 1A). [score:1]
Treatment withanta-miR-9-5pelevated the declined LTP induced by CCH (Figure 5A, 5B). [score:1]
The antagomir of miR-9-5p (200 nM in aCSF) was administered through stereotaxic brain injection to the DG area (AP -2.0 mm, ML 1.5 mm, DV 2.0 mm) once at3 monthsafter the surgery. [score:1]
We further examined the miR-9-5p level in the hippocampi and corticestissues of rats at 3 monthafter the 2VO surgery. [score:1]
Quantitative analysis suggested that CCH induces a dramatic neuronal loss in the hippocampuswhile pre-administrationofanta-miR-9-5p strongly restored the number ofneurons in CCH rats (Figure 8A, 8B). [score:1]
Reduction of miR-9-5p in vivo rescues learning and memory impairments in CCH rats. [score:1]
Interestingly, the miR-9-3p sponge had no effect on dendritic growth of cultured neurons [36]. [score:1]
Reduction of miR-9-5p in vivo rescues the synaptic impairments in CCH ratsPrevious studies suggested that synaptic plasticity is the basis for learning and memory. [score:1]
These data support the behavioral results and suggest that reduction of miR-9-5p may exert its neuroprotective effectsby restoring thecholinergic function. [score:1]
Reduction of miR-9-5p in vivo reduces the cholinergic system in CCH ratsPrevious studies suggested that the central cholinergic system dysfunction is involved in memory impairments inCCH rats [20]. [score:1]
Reduction of miR-9-5p in vivo reduces the cholinergic system in CCH rats. [score:1]
The level of miR-9-5p and miR-16 in the serum (A) and CSF (B) were detected by Q-PCR. [score:1]
In the probe trial, rats in the CCH group displayed less crossing times to the platform region and less duration and distance in the target quadrantthan the sham group, while treatment with Anta-miR-9-5p improved thesemeasuresinCCH rats (Figure 3D-3F). [score:1]
We also examined whether the reduction of miR-9-5p in vivo could reverse the neuronal loss in CCH rats by using the. [score:1]
Moreover, miR-9-5p antagomir did not alter the dendritic spines and LTP in normal rats. [score:1]
[1 to 20 of 62 sentences]
8
[+] score: 50
In contrast to that description of miRNA formation, our data showed that E [2] treatment not only increased the expression of mature miR-9 in aged females, but it also increased the expression of the miR-9a passenger strand, miR-9-3p (current study, and [46]). [score:5]
Specifically, E [2] significantly decreased pre-mir-9 expression at 1 week post OVX, but then significantly increased its expression at 12 weeks post OVX (Figure 4d, gray line, *). [score:5]
Because both strands of the miR-9 duplex are derived after dicer processing of the same precursor molecule, these results provide strong evidence that E [2] can regulate miRNA expression at the level of molecular stabilization. [score:4]
Specifically, E [2] treatment significantly regulated the expression of mature miR-7a, miR-9, miR-9-3p, and miR-181a at 1 week post-OVX, which was consistent with our previously published data, [46], but not at any other time point (Figure 2a–2d, 2f), demonstrating a clear timing effect. [score:4]
Experiment 1: Expression of E [2]-responsive mature miRNAs in the hypothalamus of ovarian intact animals changes with ageOur previous studies showed that E [2] regulated a subset of mature miRNAs (let-7i, miR-7a, miR-9, miR-9–3p, miR-125, miR-181a, and miR-495) in an age- and brain-region dependent manner [46]. [score:4]
Figure 3d–3f depicts results from pri-miR-9. Analysis of the primary miR-9 expression showed that E [2] treatment significantly increased pri-mir-9-1 and pri-mir-9-2 at 1-week post OVX, as well as pri-mir-9-2 at 4 weeks post OVX (Figure 3d, 3e, gray line, *). [score:3]
Further, there was a statistically significant difference in the expression of mature miR-7a, miR-9a-3p, and miR-181a between ovarian intact and OVX+veh treated animals at later time points (i. e. 19, 20, and 21 months). [score:3]
, Figure 3d), yet miR-9-3p expression significantly increased at 19 mo. [score:3]
miR-9: Similar to let-7i, we observed no changes in miR-9 expression across all time points in ovarian intact animals (Figure 2c), but there was a significant increase over time in OVX+veh animals. [score:3]
Also, it is important to note that two of the mature miRNAs, miR-7a and miR-9, are transcribed from multiple chromosomes, allowing for unique regulation of biogenesis at each locus. [score:2]
Our previous studies showed that E [2] regulated a subset of mature miRNAs (let-7i, miR-7a, miR-9, miR-9–3p, miR-125, miR-181a, and miR-495) in an age- and brain-region dependent manner [46]. [score:2]
Our previously published data, and also replicated here in Experiment 2, showed that E [2] significantly regulated both the guide and passenger strands of mature miR-9 [46]. [score:2]
Interestingly, E [2] treatment also increased the expression of miR-9-3p compared to intact animals, but not OVX+veh treated animals (Figure 2d). [score:2]
Our previously published observations, as well as replicated data herein, demonstrated that E [2] significantly increased both the guide (miR-9) and passenger (miR-9-3p) strands of mature miR-9 after 1 week of E [2] deprivation in aged animals. [score:1]
It is also important to note that miR-9 (guide strand) and miR-9-3p (passenger strand) are derived from the same primary and precursor transcripts, which are located on two different loci on chromosome 1 (pri-miR-9-1, pri-miR-9-2) and one locus on chromosome 2 (pri-miR-9-3). [score:1]
Finally, E [2], PPT, and DPN all significantly increased mature miR-9 and miR-9-3p, but DPN increased each to a greater degree (Figure 9f, 9g). [score:1]
miR-9-3p: Interestingly, miR-9-3p was similar in all groups at one week post OVX (i. e. 18 mo. [score:1]
Notably, E [2] tended to increase pri-miR-9, and decrease pre-miR-9, but neither effect was statistically significant. [score:1]
While the primary transcript of miR-9 is transcribed from three different loci (hence, pri-miR-9-1, pri-miR-9-2, and pri-miR-9-3), the precursor hairpins generated from each primary transcript are too similar to be able to differentiate them using qRT-PCR. [score:1]
However, both PPT and DPN significantly decreased the pri-miR-9 and pre-miR-9 forms of this miRNA (Figure 9d, 9e). [score:1]
The effects of PPT and DPN on miR-9 were particularly interesting. [score:1]
[1 to 20 of 21 sentences]
9
[+] score: 39
KWV treatment reduced the phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2), increased mRNA expression levels of the cyclin -dependent kinase inhibitor p21, reduced notch1 and hes1 transcription and up-regulated the miRNAs including miR-9, miR-29a and miR-181a. [score:9]
Assessment of the miRNA expression levels in 2.5 μM of KWV -treated NSCs in the presence of mitogens using RT PCR showed that miR-9, miR-29a, and miR-181a expression were significantly up-regulated (1.44-, 1.51- and 1.34-fold, vs. [score:8]
A potential mechanism for KWV -induced neurogenesis is down-regulated expression of notch1 and hes1, which, in turn, relieves the repression of miR-9 transcription. [score:6]
Indeed, we found that KWV treatment led to both a significant decrease in hes1 and notch1 transcript expression and an increase in miR-9 expression in NSCs. [score:5]
miR-9 is highly expressed in the developing and adult vertebrate brain as a versatile regulator of neurogenesis [63]. [score:4]
Hes1, which is involved in NSC maintenance, is a target of miR-9 and miR-9 transcription is negatively regulated by Hes1 [64, 65]. [score:4]
The miScript PCR system (Qiagen) was used to analyze the expression of miRNAs, including rno-miR-9, rno-miR-29a, rno-miR-124 and rno-miR-181a, according to the manufacturer’s instructions. [score:3]
[1 to 20 of 7 sentences]
10
[+] score: 39
Inhibition of FGF signaling through SU5402 -treated primitive streak regions of chick embryos identified up-regulation of let-7b, miR-9, miR-19b, miR-107, miR-130b, miR-148a, miR-203, and miR-218 and down-regulation of miR-29a and miR-489 (Bobbs et al. 2012). [score:9]
In contrast, expression of miR-9 and miR-203 was induced by FGF2 in lens, although they were induced via inhibition of FGF receptors in the embryonic chick mo del (Bobbs et al. 2012). [score:5]
Figure 11Analysis of miR-9, -143, -301a, -381, and -455 expression pattern during embryonic and postnatal lens development. [score:4]
To determine whether the aforementioned miRNAs identified in rat lens explant system are also expressed during mammalian lens development in vivo, we conducted ISH analysis of miR-9, miR-143, miR-155, miR-301a, miR-381, and miR-455 in E14.5 and newborn (P0) lenses. [score:4]
The current data suggest that multiple miRNAs, including miR-9, miR-137, miR-155, miR-301a, miR455, and miR-543 (Figure 7A and Figure 8A), regulate c-Maf expression through its 3′-UTR. [score:4]
We conclude that miR-9, miR-137, miR-200c, miR-381, miR-455, miR-495, and miR-543 represent an FGF2 -dependent system of multiple miRNAs that target specific genes operating in pathways and processes related to the lens differentiation (via c-Maf, Med1/PBP, N-myc, and Nfat5), miRNA-regulated RNA processing (via Cpsf6 and Tnrc6b) and nuclear/chromatin -based processes (via Med1/PBP, As1l, and Kdm5b/Jarid1b/Plu1). [score:4]
At E14.5, the miR-9 (A), -143 (C), -301a (E), -381 (G), and -455 (I) expression domain included the monolayer of lens epithelial cells, the proliferating lens cells, the migrating lens cells, and the differentiating lens cells. [score:3]
We found that seven miRNAs, including miR-9, miR-137, miR-200c, miR-381, miR-455, miR-495, and miR-543, target at least two “early” genes examined (i. e., c-Maf, N-Myc, and Nfib). [score:3]
At postnatal day P0, the distribution of both miR-9 (B) and miR-143 (D) is largely maintained in all the lens cells previously described for the E14.5 lens, whereas miR-301a (F) is not detected. [score:1]
Seven miRNAs, including miR-9, miR-137, miR-200c, miR-381, miR-455, miR-495, and miR-543, and connections to specific functional groups of genes are shown. [score:1]
The most connected miRNA identified here through the 12 top-ranking transcripts, including miR-495, miR-200c, miR-543, miR-381, and miR-9 (Figure 6A), retained their high-connectivity positions as identified by independent analysis shown earlier in Figure 6A. [score:1]
[1 to 20 of 11 sentences]
11
[+] score: 32
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These candidate miRNAs included representatives that exhibited regulated patterns of expression from each of the two primary classes detected, namely: those with highest expression in the caput (let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p), or highest expression in the cauda (miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:8]
0135605.g008 Fig 8In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
It also highlighted the caput-specific expression of miR-9-5p, and confirmed a significant up-regulation of miR-486-5p and miR470c-5p between the caput and corpus epididymis. [score:6]
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 5 sentences]
12
[+] score: 29
With exception of miRNA-155, down-regulated in serum of AMD patients and in serum of Aβ injected rats, six miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-126) showed an up-regulation in serum of AMD patients. [score:7]
MicroRNA expression in human retinal pigment epithelial (ARPE-19) cells: increased expression of microRNA-9 by N-(4-hydroxyphenyl)retinamide. [score:5]
Analysis of these 13 miRNAs revealed that 7 miRNAs showed a significant up-regulation in serum of AMD patients in comparison to control group (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-155, and miR-126). [score:4]
In particular, up-regulation of miR-9, miR-23a, miR-27a, miR-34a, miR-126, and miR-146a was found in serum of AMD patients. [score:4]
In conclusion, the modified miRNA levels we found in rat retina (miR-27a, miR-146a, miR-155) and serum of AMD patients (miR-9, miR-23a, miR-34a, miR-126, miR-27a, miR-146a, miR-155) suggest that, among others, miR-27a, miR-146a, and miR-155 have an important role in AMD and could represent suitable biomarkers and appealing pharmacological targets. [score:3]
The following groups of miRNAs were analyzed: miR-27a, miR-146a, miR-155 miR-9, miR-23a, miR-27a, miR-34a, miR-126,miR-146a, miR-155 miR-155 GraphPad Prism (version 4.0; GraphPad Software, San Diego, CA, USA) was used for statistical analysis and graphical representation of miRNA differential expression data. [score:3]
Incidentally, we showed that changes in circulating levels of some miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-126, miR-146a, miR-155) as found in AMD patients are associated to Alzheimer's disease and modulate genes involved in neurodegenerative and inflammatory pathways. [score:3]
[1 to 20 of 7 sentences]
13
[+] score: 29
Interestingly, miR-9, miR-124a, miR-99a/b and miR-181b/c up-regulation during early cortical neurogenesis was negatively correlated with the expression level of their predicted targets, consistent with reports that have found a negative expression correlation between tissue-enriched miRNAs and their putative targets [17, 18]. [score:12]
One of these mRNAs was Cxcr4, which is down-regulated 2.4-fold and is predicted to be targeted by miR-9, which was up-regulated over a hundred fold. [score:9]
Among the miRNAs identified as up-regulated, there were several that have previously been found to be expressed in neuronal progenitors, including miR-9 and miR-124a. [score:6]
These include miR-7, miR-9, miR-124a, miR-125a/b, miR-181b/c and miR-99a/b. [score:1]
A number of brain-enriched miRNAs have been identified including miR-9 and miR-124a [12- 14]. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 29
The expression levels of miRNAs miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 expression levels were down-regulated in the serum of diabetic rats and IOMe -injected rats (A). [score:8]
0172429.g005 Fig 5 The expression levels of miRNAs miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 expression levels were down-regulated in the serum of diabetic rats and IOMe -injected rats (A). [score:8]
Interestingly, miR-9, which is responsible for neuronal differentiation, neurogenesis and development of brain, is highly expressed in hippocampus while it is down-regulated in AD brains. [score:7]
The expression levels of miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 were significantly down regulated in the blood serum of diabetic and IOMe -injected rats (Fig 5A) whereas, the expression levels of these miRNAs are normally high. [score:6]
[1 to 20 of 4 sentences]
15
[+] score: 28
Hence, mir-9 expression levels were assayed only in some of our expression analyses, which are presented as Supplemental Fig. 1. Lin28a and Lin28b mRNAs displayed low testicular expression during the neonatal period, increasing markedly during infantile period. [score:6]
Hence, mir-9 expression levels were assayed only in some of our expression analyses, which are presented as Supplemental Fig. 1. Lin28a and Lin28b mRNAs displayed low testicular expression during the neonatal period, increasing markedly during infantile period. [score:6]
Notably, bioinformatic predictions also suggest that mir-9 might negatively regulate Lin28; yet, this miRNA is more abundantly expressed in the hypothalamus, whereas its expression levels are low in the rat testis (our unpublished observations). [score:6]
For instance, during neonatal period, Lin28a/Lin28b mRNA expression was minimum and (especially for Lin28b) increased thereafter, whereas let-7 and also mir-132, mir-9 and mir-145 miRNAs abundance was maximal on PND1, decreasing progressively along postnatal maturation. [score:3]
In Experiment 1, the expression profiles of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-9, mir-145 and mir-132 miRNAs were determined in the testis of rats at different age-points during postnatal maturation: neonatal (PND-1), infantile (PND-15), juvenile (PND-30), early pubertal (PND-38), pubertal (PND-45) and adult (>PND-75) ages, in keeping with previous references 38; size = 7–8 per group. [score:3]
However, while let-7a, mir-132 and mir-9 decreased sharply after PND1, let-7b increased between the neonatal and infantile age, to decline thereafter until puberty, whereas mir-145 levels remained elevated during infantile period and dropped during the juvenile transition. [score:1]
In contrast, let-7a, let-7b and mir-145 miRNA levels (Fig. 3) were significantly higher than in controls, while mir-132 (Fig. 3) and mir-9 (Suppl. [score:1]
Let-7a, let-7b, mir-132, and mir-145 (Fig. 1), as well as mir-9 (Suppl. [score:1]
On the other hand, mir-9 diminished after HPX, and its levels were recovered only by FSH treatment (Suppl. [score:1]
[1 to 20 of 9 sentences]
16
[+] score: 19
Although miRNA profiling showed an increase miR-9 expression in 6-hour group (Fig. 2), our quantitative qPCR assay showed that the expression of miR-9 was downregulated in this group (Fig. 3). [score:7]
We found that miR-146a, miR-9, miR-143 and let-7d might be connected with learning and memory ability through review of the literature and prediction of the target gene[16, 17, 18]. [score:3]
Four of the differentially expressed miRNAs (miR-9, miR-143, miR-146a, and let-7d) were selected for qPCR validation. [score:3]
Compared to the other 2 groups, 21 miRNAs are upregulated in 6-hour group as shown in the upper portion of Fig. 2, miR-9, miR-204, miR-335, miR-23a, miR-708, miR-146a, miR-325-5p, miR-106b, miR-143, miR-140, miR-376b-3p, miR-7a, miR-541, miR-185, miR-499, miR-127*, miR-320, miR-140*, miR-145*, miR-423*, miR-378. [score:3]
Four of the differentially expressed miRNAs (miR-9, miR-143, miR-146a, let-7d) were validated independently in samples from these 3 groups. [score:3]
[1 to 20 of 5 sentences]
17
[+] score: 18
Althogether these studies strongly suggest that an up-regulation of most, if not all, members of the let-7 and miR-7 families and of the miR-132/212 cluster marks hypothalamus development while miR-9, miR-124a, miR-145 and miR-219 displayed nucleus-specific regulations of expression. [score:8]
Let-7b, miR-124a and miR-9 displayed no expression differences in MPN between P15 and P30 while let-7a, miR-7, miR-132, miR-145 and miR-219 displayed up-regulations. [score:6]
miR-9 displayed a transient down-regulation at P21. [score:4]
[1 to 20 of 3 sentences]
18
[+] score: 16
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
These miRNAs were chosen as representative of the different patterns that were observed: up-regulation (miR-9a-5p) or down-regulation (miR-598-5p) during latency, down-regulation in the late latency - first spontaneous seizure period (miR-381-3p) and down regulation in the chronic stage (miR-142-5p). [score:11]
The major hits identified in this study, like miR-9a-3p, should be now challenged in other epilepsy mo dels in which only a subset of animals develop spontaneous seizures, in order to verify that they can actually stratify subjects that will or will not develop the disease. [score:3]
Although it is impossible, at the current stage of knowledge, to speculate on the biological significance of changes in plasma, it can nonetheless be proposed that those miRNAs that are altered in plasma before the first spontaneous seizure, like miR-9a-3p, are putative biomarkers of epileptogenesis. [score:1]
MiR-9a-3p and miR-142-3p were chosen for validation in the same cohort of samples, displaying the same patterns observed in the microarray, even if they did not reach statistical significance. [score:1]
[1 to 20 of 4 sentences]
19
[+] score: 16
Wang et al. (2010) evidenced that miR-9 can suppress myocardin expression, a transcriptional cofactor of NFATc3 expressed at a relatively low level in cardiomyocytes under physiological conditions. [score:7]
We observed a diminished miR-9 expression on both MI procedures compared to control, corroborating the data presented by Wang et al. (2010), whereas miR-9 suppression might increase cardiac hypertrophy by NFATc3 stimulation. [score:4]
miR-9 and NFATc3 regulate myocardin in cardiac hypertrophy. [score:2]
The mir-9 expression detected was similar between occlusion and ablation and different when compared to control, whereas both diminished. [score:2]
Administration of miR-9 could attenuate cardiac hypertrophy and ameliorate cardiac function. [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 15
Target prediction of cell cycle genes targeted by miR-503, miR-330 and miR-9 included CCNE1, CCNE2, CCND1, CDC14A, E2F1-3, CDKN1A, CDC25A, CHEK1, WEE1 and EP300 (Supplementary Fig.   8) 25, 26. [score:5]
RT-PCR validation of these 9 miRNAs confirmed the high expression of 7 miRNAs, of which 3 (miR-503, miR-330 and miR-293) were exclusively expressed in dnIKK2-Treg-EV, while the remaining 4 miRNAs (miR-297c, miR-207, miR-9, miR-484) were faintly detected in Tact-EV and Trest-EV too (Fig.   5A). [score:5]
Namely, miR-503, miR-330 and miR-9, which affect the transcription of genes encoding proteins crucial to the regulation of cell cycle progression, were exclusively present or were up-regulated in dnIKK2-Treg-EV compared to Tact-EV and Trest-EV. [score:4]
This analysis highlighted 3 miRNAs (miR-503, miR-330 and miR-9) potentially affecting 16 pathways (Supplementary Table  3) among which cell cycle was the most closely related to anti-proliferative effects of dnIKK2-Treg-EV. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 14
They found that these miR-9 family members regulate the proliferation and differentiation of neural progenitor cells in telencephalon through inhibitory actions on regulator proteins important for neurogenesis, including the homeobox protein Meis2 and the transcription factor Forkhead box protein G1 (FOXG1) (Shibata et al., 2008, 2011). [score:5]
MicroRNA-9 modulates Cajal-Retzius cell differentiation by suppressing Foxg1 expression in mouse medial pallium. [score:4]
MicroRNA-9 regulates neurogenesis in mouse telencephalon by targeting multiple transcription factors. [score:3]
Convergent repression of Foxp2 3′UTR by miR-9 and miR-132 in embryonic mouse neocortex: implications for radial migration of neurons. [score:1]
MicroRNA-9 directs late organizer activity of the midbrain-hindbrain boundary. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 14
As well characterized examples, miR-9 has been shown to regulate embryonic neurogenesis by targeting the transcription factor TLX [8]; miR-219 [9] and miR-338 [10] have been identified as regulators of oligodendrocyte differentiation; miR-124 have been shown to promote neuronal differentiation and regulate adult neurogenesis [11, 12]; and miR-134 have been shown to regulate dendritic spine morphology through inhibiting the local translation of Limk1 [13]. [score:9]
Recently, exogenous expression of miR-9/9* and miR-124 in human fibroblasts was shown to convert these cells into neurons [51, 52], suggesting the wide application potential of miRNAs. [score:3]
The expression patterns of some miRNAs observed in our study are consistent with what were observed in previous studies by using the blot-array and Northern blot assays, i. e. miR-125b, miR-9, and miR-181a [6], as well as miR-29a, miR-138 and miR-92 [53]. [score:2]
[1 to 20 of 3 sentences]
23
[+] score: 13
Other miRNAs from this paper: rno-mir-9a-1, rno-mir-9a-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2
Numerous microRNAs (miRNAs) were downregulated in response to A β, including miRNA-9, a synapse-enriched miRNA that is decreased in Alzheimer's disease. [score:6]
Interestingly, Hes1 has been identified as a direct target of miRNA-9 [30]. [score:4]
It has been found that miRNA-9 attenuated A β -induced synaptotoxicity by targeting CAMKK2 [29]. [score:3]
[1 to 20 of 3 sentences]
24
[+] score: 12
For instance, the up-expressed miR-143 and miR-138 can, respectively, target the genes, HK2 and HK1, which are the crucial enzymes in glycolysis and so that lead to potential glycemia [28, 29]; miR-9 and miR-204 were reported that they can regulate the insulin secretion by targeting the gene, SIRT1 [30– 32], while miR-96 can decrease the expression of NOC2 which is involved in the insulin secretion [33]. [score:10]
Among the 24 specific miRNAs, 13 of them, such as miR-182/196a/381/499a/99a [6], miR-183 [6, 23], miR-409 [23], miR-146b [6, 24], miR-143 [6, 24], miR-148a [24, 25], miR-204 [5], and miR-9 [6], have been reported to involve in T2D process in mouse or rat. [score:1]
Four microRNAs, including miR-9, miR-1285-3p, miR-424-3p, and miR-182-5p, were filtered in all three comparisons. [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 11
The potential involvement of miRNAs in alcohol intake was suggested by the following two recent reports: In cultured rodent neurons, alcohol is found to be able to up-regulate the miR-9 and down-regulate the expression of its target gene, alpha subunit of BK channel, which is a molecule related to the alcohol addiction (Pietrzykowski et al, 2008). [score:11]
[1 to 20 of 1 sentences]
26
[+] score: 11
In fact, our data suggest that a downregulation of miR-9 and miR-199 may contribute to inflammation by reducing the inhibition of NF-κB pathway genes, namely, p50NFκB or ikkβ [89], [90], [91]. [score:6]
In fact, according to previous studies [17], [18], [19], [21], [22], highly expressed microRNAs in the spinal cord or the CNS, such as miR-125b, miR-29a, miR-30b, and miR-9*, show sustained, high levels of expression before and after injury (see file S1), suggesting an overall preservation of the cell populations in the spinal cord. [score:5]
[1 to 20 of 2 sentences]
27
[+] score: 11
miR-146a-5p, miR-155-5p, miR-147b, and miR-223-3p were downregulated, while miR-182-5p, miR-183-5p, and miR-9-3p were upregulated. [score:7]
The complete dynamic profiles of the levels of each miRNA are summarized in Table 1 and Figure 2. Generally, the expression of miR-9-3p, miR-182-5p, and miR-183-5p tended to increase from day 7 after immunization onwards and peaked at day 10 after immunization. [score:3]
The eight miRNAs studied were miR-155b-5p, miR-21-5p, miR-146a-5p, miR-9-3p, miR-147b, miRNA-183-5p, miRNA-182-5p, and mi -RNA-223-3p. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 11
In the DRGs, 6 miRNAs (miR-9, miR-320, miR-324-3p, miR-672, miR-466b, and miR-144) were significantly downregulated in the entrapment group and 3 miRNAs (miR-9, miR-320, and miR-324-3p) were significantly downregulated in the decompression group. [score:7]
In the DRGs, 6 miRNAs in the entrapment group (miR-9, miR-320, miR-324-3p, miR-672, miR-466b, and miR-144) and 3 miRNAs in the decompression group (miR-9, miR-320, and miR-324-3p) were significantly downregulated. [score:4]
[1 to 20 of 2 sentences]
29
[+] score: 10
In addition, we observed reduced expression of miR-9 and miR-140 expression consistent with that observed on ethanol exposure [44]. [score:5]
Of these, two (miR-9, adj p = 0.0228 and miR-145, adj p = 0.0298) that were identified as significantly enriched, were also significantly differentially-expressed in the miRNA microarray results. [score:3]
miR-9 has been linked to nicotine and ethanol exposure [44]; however, dysregulation of miR-145 has not previously been reported after administration of any drug of addiction. [score:2]
[1 to 20 of 3 sentences]
30
[+] score: 8
In addition to miR-124a, stroke downregulates miR-9 and miR-139 in neural progenitor cells and these miRNAs have been predicted to target Notch and Hes1 [34] (www. [score:6]
org), suggesting that miR-9 and miR-139 could also regulate the Notch signaling pathway after stroke. [score:2]
[1 to 20 of 2 sentences]
31
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Comparison of miRNA expression profiles among tissues revealed that very few miRNAs expression was tissue specific (e. g., miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle). [score:5]
Our comparison of miRNA expression across 11 tissues from bovine revealed a few tissue specific miRNAs: miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle, which had been previously reported in mouse and human [13, 27]. [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 8
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, a study analyzing miRNA expression profiles of ovarian adenocarcinomas demonstrated that two similarly expressed miRNAs (miR-9 and miR-223) regulate two independent targets of a common pathway involved in ovarian metastatis [38]. [score:8]
[1 to 20 of 1 sentences]
33
[+] score: 7
Other miRNAs from this paper: rno-mir-9a-1, rno-mir-9a-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2
Electroacupuncture inhibits inflammatory injury by targeting the miR-9 -mediated NF-κB signaling pathway following ischemic stroke. [score:5]
A previous study suggests that EA applied to Quchi (LI11) and Zusanli (ST36) acupoints regulated the miR-9 -mediated NF-κB signaling pathway and reduced secretion of TNF-α and IL-1β after ischemic stroke (Liu et al., 2016b). [score:2]
[1 to 20 of 2 sentences]
34
[+] score: 7
The let-7a and miR-9 miRNAs were also among those identified in the random control set, and we excluded them as their dysregulation might be related to a more general cell proliferation/differentiation mechanism relevant in several disease processes, but not specifically related to BOS. [score:4]
In comparison with lung recipients without BOS, clear dysregulation of miR-34a, miR-193b, miR-9 and miR-15a, likewise present in the VTM list in Fig 5, was also detected in peripheral mononuclear cells obtained from BOS patients in a RT-PCR evaluation of miRNA expression by Xu at al. [3]. [score:2]
The factors present in both lists were: let-7a, miR-34a, miR-21 and miR-9 family. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 7
Zhao et al. reported that EGF and bFGF trigger the expression of miR-9, which targets the nuclear receptor TLX controlling NSC proliferation and fate determination [41]. [score:5]
Zhao C. Sun G. Li S. Shi Y. A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination Nat. [score:2]
[1 to 20 of 2 sentences]
36
[+] score: 7
The bifunctional microRNA miR-9/miR-9* regulates REST and CoREST and is downregulated in Huntington’s disease. [score:7]
[1 to 20 of 1 sentences]
37
[+] score: 7
It is noteworthy that miR-1, miR-133, miR-30, miR-208a, miR-208b, mir-499, miR-23a, miR-9 and miR-199a have previously been shown to be functionally involved in cardiovascular diseases such as heart failure and hypertrophy [40], [41], [42], [43], [44], and have been proposed as therapeutic- or disease-related drug targets [45], [46]. [score:7]
[1 to 20 of 1 sentences]
38
[+] score: 6
In presenilin-1 null mice, miR-9 has been shown to be down-regulated, leading to severe brain developmental defects [38]. [score:5]
A brain-specific miRNA, miR-9, has been identified by our microarray as well as by microarrays from other groups. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
In them, four miRNAs (miR-9, miR-124, miR-128a and miR-128b) were previously reported to be specifically expressed in the cortex and hippocampus in rat [18]. [score:3]
Moreover, miR-200b is enriched in zebrafish olfactory bulb; miR-124 and miR-9 expression are detected throughout adult brain [16]. [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 6
There are several other miRNAs, such as miR-7, miR-124a, miR-9, miR-34a and miR-195, that play a role in the regulation of insulin secretion and β cell development [17]. [score:3]
Some of the diabetes -associated miRNAs were below the detection limit in our study, such as miR-9, miR-96 and miR-148, indicating that back-translation from humans to ZDF rats may be difficult for these markers. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 6
Hydrogen regulates expressions of miR-9, miR-21, and miR-199, and modifies expressions of IKK-β, NF-κB, and PDCD4 in LPS-activated retinal microglia cells [64]. [score:6]
[1 to 20 of 1 sentences]
42
[+] score: 6
35 rno-miR-383-5p 820-826 7mer-1A −0.11 rno-miR-409a-5p 639-645 7mer-1A −0.19 rno-miR-433-3p 1044-1050 7mer-m8 −0.14 rno-miR-449c-3p 674-680 7mer-m8 −0.13 rno-miR-503-5p 763-769 7mer-1A −0.22 rno-miR-505-5p 111-117 7mer-1A −0.14 rno-miR-7a-5p 572-578 7mer-1A −0.01 rno-miR-880-3p 586-592 7mer-1A −0.11 rno-miR-9a-3p 272-278 7mer-1A −0.1 Figure 1Effects of the predicted 45 miRNAs on the reporter gene expression of the pmiR-FSHb-3′UTR-WT vector. [score:3]
35 rno-miR-383-5p 820-826 7mer-1A −0.11 rno-miR-409a-5p 639-645 7mer-1A −0.19 rno-miR-433-3p 1044-1050 7mer-m8 −0.14 rno-miR-449c-3p 674-680 7mer-m8 −0.13 rno-miR-503-5p 763-769 7mer-1A −0.22 rno-miR-505-5p 111-117 7mer-1A −0.14 rno-miR-7a-5p 572-578 7mer-1A −0.01 rno-miR-880-3p 586-592 7mer-1A −0.11 rno-miR-9a-3p 272-278 7mer-1A −0.1 Figure 1Effects of the predicted 45 miRNAs on the reporter gene expression of the pmiR-FSHb-3′UTR-WT vector. [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 6
Interestingly, in 2014, Fu et al. reported that let-7a, miR-9, and miR-129-5p each had two target sites in FOXP2, and three mutant luciferase reporter constructs with mutations in one or two target sites were made. [score:6]
[1 to 20 of 1 sentences]
44
[+] score: 6
As shown in Table 1 and Table 2, rno-miR-9a-5p was the miRNA that exhibited the greatest up-regulation in the plasma from the hyperoxia rats compared to the normal controls; these differences was an approximately a six-fold change. [score:3]
To confirm the deep sequencing results, we used qRT-PCR to assess the expressions of 10 of the miRNAs (miR-183-5p, miR-9a-5p, miR-199a-5p, miR-351-5p, miR200b-3p, miR-191a-3p, miR-181c-3p, miR-330-5p, miR-126a-5p and miR-351-3p) in the 12-pair plasma samples from the hyperoxia rats and controls. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 5
Numerous miRNAs have been reported to have roles in pancreatic beta-cells: MiR-124a targeting Foxa2 [7], [8] and miR-9 controlling insulin exocytosis via its target Onecut-2 [9]. [score:5]
[1 to 20 of 1 sentences]
46
[+] score: 5
Of these, miR-9 was among the highest expressed miRNAs in the dog atlas (Additional file 3: Figure S2). [score:3]
Four dog brain HTE miRNAs (cfa-miR-9, -124, -128, and -219) share sequence homology with rat and human, and are cross-species biomarker candidates for brain injury. [score:1]
Rat studies identified numerous enriched brain miRNA, including miR-9, -124, -128, -184, and -219 [5, 9, 30]. [score:1]
[1 to 20 of 3 sentences]
47
[+] score: 5
After normalizing the signal intensities for all miRNA expression levels, miR-124-3p, miR-9a-3p, miR-34a-5p, miR-9a-5p, miR-125b-5p, miR-let-7c-5p, miR-29a-3p, miR-23b-3p, miR-451-5p, and miR-30c-5p were the miRNAs expressed at the highest levels (Figure  1). [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
In line with studies in mice and zebra fish, we found that especially miR-124a and miR-29a were highly abundant in all regions, whereas the expression levels for miR-9 were more moderate (data not shown) [7], [41]– [45]. [score:3]
Some studies have shown an involvement of miRNAs (e. g. miR-9a and miR-124) in neuronal development and differentiation [8]– [10]. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 5
Moreover, three miRNA (miRNA-7, miRNA-9, and miRNA-106b) were found to be associated with neurodegenerative diseases and only one, namely miRNA-9, with intellectual disability (Doxakis, 2010; Wang et al., 2010; Xu et al., 2011; Hu et al., 2017). [score:3]
FXR1P but not FMRP regulates the levels of mammalian brain-specific microRNA-9 and microRNA-124. [score:2]
[1 to 20 of 2 sentences]
50
[+] score: 4
Similarly, miR-215 expression decreased after FO compared to OO and PO diets and miR-26b-5p expression decreased after FO compared with PO diet and miR-9a-5p after FO compared with SO diet. [score:2]
Compared to all other treatments, miR-215 expression was significantly induced by FO consumption, while miR-10b and miR-9a were induced by LO (Fig. 3A). [score:2]
[1 to 20 of 2 sentences]
51
[+] score: 4
Zhou S MiR-9 inhibits Schwann cell migration by targeting Cthrc1 following sciatic nerve injuryJ. [score:4]
[1 to 20 of 1 sentences]
52
[+] score: 3
In particular, using murine mo dels, miR-9 and miR-375 are reported to be involved in regulation of insulin secretion [16, 17], while miR-124a2 has recently been implicated in pancreatic beta-cell development and function [18]. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
SIRT1 were observed to be regulated by miR-9 in stem cells [28]. [score:2]
Similar observation were also found in miR-27a, miR-101, miR-9, miR-667. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 3
The deficiency of let-7 can stimulate DNA replication and cell division [27], so it suggested that let-7, miR-125, and miR-9 were the key regulators of retinal progenitor cells in the early to late developmental stages [28, 29]. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 3
Suppression and epigenetic regulation of MiR-9 contributes to ethanol teratology: evidence from zebrafish and murine fetal neural stem cell mo dels. [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 3
We identified a group of mRNA and microRNA previously associated with amyloid-ß induced toxicity (e. g. Frp2 and Ppif), or implicated in Alzheimer’s disease processes, (miR-29 and miR-9) [35- 47], (Table  4). [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
MiRNA-21 (A), miRNA-199a (B), miRNA-130b (C), miRNA-138-1 (D), miRNA-9 (E), miRNA-27a (F), miRNA-125a (G), and miRNA-320 (H) expression was not validated at 3 days after treatment with BM-MSC. [score:3]
[1 to 20 of 1 sentences]
58
[+] score: 3
For instance, miR-9, -27, -34a, and -140 were found aberrantly expressed in osteoarthritis patients [6], while miR-21, -23a, -24, -100, and -125b were significantly increased both in serum and bone tissues of osteoporosis patients [7]. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 3
Jones et al. found that mir-9 and mir-98 were identified to be overexpressed in human osteoarthritic tissue [14]. [score:3]
[1 to 20 of 1 sentences]
60
[+] score: 3
For example, miR-9 has been demonstrated to play a role in controlling neurogenesis timing via targeting of progenitor-promoting and cell-cycle exit-promoting genes [14]. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Recently, miR-9 was shown to be involved in the inhibition of embryonic stem cell self-renewal and neural differentiation following exposure to the inhaled anesthetic isoflurane [24]. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
The luciferase values were further normalized to the average luciferase value obtained after transfecting a panel of microRNAs not predicted to target the rat Arc 3′UTR (rno-miR-370, rno-miR-150, rno-miR-342, rno-miR-30b, rno-miR-105, rno-miR-145 and rno-miR-9). [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 2
Initially identified as brain-specific, miRNA-9 is a highly functional miRNA in brain development, which has been involved in the fine-tuning of nuclear factor Kappa-B- (NF- κB-) dependent inflammatory response [35]. [score:2]
[1 to 20 of 1 sentences]
64
[+] score: 2
MiR-9 promotes the neural differentiation of mouse bone marrow MSCs via targeting zinc finger protein 521 [26]. [score:2]
[1 to 20 of 1 sentences]
65
[+] score: 2
Monoz et al. demonstrated that miRNA-9 could be transferred from MSCs to cancer cells through MSC-derived exosomes [31]. [score:1]
Munoz J. L. Bliss S. A. Greco S. J. Ramkissoon S. H. Ligon K. L. Rameshwar P. Delivery of functional anti-mir-9 by mesenchymal stem cell-derived exosomes to glioblastoma multiforme cells conferred chemosensitivity Mol. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 2
Pietrzykowski AZ, Friesen RM, Martin GE, Puig SI, Nowak CL, Wynne PM, et al. Post-transcriptional regulation of BK channel splice variant stability by miR-9 underlies neuroadaptation to alcohol. [score:2]
[1 to 20 of 1 sentences]
67
[+] score: 2
miR-124a and miR-9 are able to regulate ES cell differentiation toward neuronal or glial lineages [3], and brain-specific miR-9 is critical in modulating the cellular behaviour of stem cell-derived neural progenitor cells (NPCs) [4]. [score:2]
[1 to 20 of 1 sentences]
68
[+] score: 2
The miRNAs differentially regulated by prenatal stress includes miR-23a (up), miR-129-2 (up), miR-361 (down), let-7f (up), miR-17-5p (down), miR-98 (up), miR-425 (down), miR-345-5p (down), miR-9 (up), miR216-5p (up), miR-667 (up), and miR-505 (down) (Figure 3A). [score:2]
[1 to 20 of 1 sentences]
69
[+] score: 2
And Mir375 is one of a number of involved in insulin synthesis and secretion (for instance Mir9 and Mir29a/b/c), insulin sensitivity in target tissue (Mir143 and Mir29) or glucose and lipid metabolism (Mir103/107 and Mir122) and thus, having potential roles in diabetes [see for instance, [52], [53]. [score:2]
[1 to 20 of 1 sentences]
70
[+] score: 2
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ hybridization and immunostaining In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 2
The authors investigated the expression of seven diabetes-related miRNAs (miR-9, miR-29a, miR-30d, miR-34a, miR-124a, miR-146a and miR-375), four (miR-29a, miR-30d, miR-175 and miR-146a) of which were also found to be dysregulated in our study. [score:2]
[1 to 20 of 1 sentences]
72
[+] score: 1
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The probes used were: EAM119 (miR-29b), EAM125 (miR-138), EAM224 (miR-17-5p), EAM234 (miR-199a), EAM131 (miR-92), EAM109 (miR-7), EAM150 (miR-9) and EAM103 (miR-124a). [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
In the 16 week colonic biopsies, we observed that while all miRNAs trended to increase (versus age-matched saline treated animals) although only 7 miRNAs (miR-34a, miR-21, miR-18, miR-376a, miR-19a, miR-9 and miR-29b) achieved statistical significance (fold inductions of 1.73, 2.72, 2.15, 2.26, 2.18, 1.53, and 1.71,respectively) (Table 2). [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
For example, during neurogenesis, the levels of both miR-124 and miR-9 are greatly increased, and both of them were indicated involving in neuronal differentiation in vitro experiments [44, 48]. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
Most changes were modest in magnitude, with two–thirds showing a fold change less than ±0.40 and only four miRNA (miR-181c-5p, miR-19b-3p, miR-218a-5p, miR-9a-5p) showing more than a twofold change. [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
Gangisetty O Jabbar S Wynne O Sarkar DK MicroRNA-9 regulates fetal alcohol -induced changes in D2 receptor to promote prolactin productionJ. [score:1]
[1 to 20 of 1 sentences]
77
[+] score: 1
It is important to note that mir-9 has well-established roles in neurogenesis [reviewed in Ref. [score:1]
[1 to 20 of 1 sentences]
78
[+] score: 1
5 mmu-miR-214 -1.7 -6.1 -10.9 mmu-miR-137 -31.7 -6.8 -144.8 mmu-miR-29c -1.8 -10.5 -10.7 rno-miR-532–5p -2.0 -59.1 -126.9 mmu-miR-466d-3p -2.7 -4.2 -9.9 mmu-miR-466d-5p -23.2 -64.7 -105.7 mmu-miR-22 -1.6 -4.6 -9.9 mmu-miR-582–5p -21.3 -59.4 -97.1 mmu-miR-690 -1.9 -2.1 -9.7 rno-miR-421 -21.3 -59.3 -97.0 mmu-miR-193 -4.9 -3. 5 -8.1 mmu-miR-369–5p -20.9 -58.3 -95.3 mmu-miR-27b* -2.1 -2.9 -8.0 mmu-miR-684 -20.8 -58.1 -94.9 mmu-miR-378 -1.6 -4.6 -7.7 mmu-miR-375 -20.6 -57.6 -94.2 mmu-miR-9* -1.9 -18.4 -7.7 mmu-miR-337–5p -20.5 -57.4 -93.8 mmu-miR-204 -2.5 -5.3 -7.5 mmu-miR-15a* -20.3 -56.8 -92.8 mmu-miR-28* -1.9 -3.2 -6.5 mmu-miR-532–5p -19. [score:1]
[1 to 20 of 1 sentences]