sort by

54 publications mentioning rno-mir-26a

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-26a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 330
Other miRNAs from this paper: rno-mir-30c-1, rno-mir-30c-2
Interestingly, miR-26a also down-regulated Snail1 expression; however, miR-26a did not directly down-regulate Snail1 luciferase activity, suggesting that Snail1 is not a direct target of miR-26a. [score:13]
Notably, the TGFβ1 -mediated up-regulation of fibrotic marker genes and proteins was enhanced by the individual miR-26a and miR-30c inhibitors compared with the NC+TGFβ1 group; furthermore, co -inhibition with the miR-26a and miR-30c inhibitors showed a stronger pro-fibrotic effect (Fig. 4A–I). [score:9]
Transfection with both miR-26a and miR-30c inhibitors (each at half the dose) markedly increased Col-I and α-SMA expression but reduced E-cadherin expression at the protein level; FN expression was also increased, but this effect was not significant. [score:9]
Interestingly, miR-26a mimic+TGFβ1 also decreased Snail1 mRNA and protein expression, even though Snail1 3′-UTR does not contain a miR-26a target site; however, the inhibitory effect was significantly less than that of miR-30c mimic+TGFβ1. [score:7]
Here, we showed that silencing CTGF or Snail1 did not influence the expression of the other gene and that co-silencing both targets did not synergistically suppress TGFβ1 -induced EMT in NRK-52E cells, implying that CTGF and Snail1 are independent transcription factors that cannot explain the coordinated roles of miR-26a and miR-30c. [score:7]
However, treatment with a combination of miR-26a and miR-30c mimics decreased Snail1 mRNA and protein expression to the same level as miR-26a or miR-30c alone, indicating that no synergy exists between these two miRNAs in suppressing Snail1 expression. [score:7]
For the miRNA silencing experiment, 150 nM miR-26a inhibitor, 150 nM miR-30c inhibitor or 75 nM each of miR-26a and miR-30c inhibitor (RiboBio, Guangzhou, China) was used. [score:7]
Interestingly, TGFβ1 treatment down-regulated the expression of CTDSP2 and CTDSPL, which are the miR-26a host genes, and of NF-YC, which is the miR-30c host gene. [score:6]
These data demonstrate that CTGF is a genuine target of miR-26a/30c and that miR-30c also directly targets Snail1. [score:6]
Notably, in the presence of TGFβ1 and either the miR-26a or miR-30c mimic, the expression of FN, Col-I and α-SMA was markedly reduced, but E-cadherin expression was markedly increased compared with the NC+TGFβ1 group; the miR-26a and miR-30c mimics had a similar inhibitory effect on EMT. [score:6]
The miR-26a/30c inhibitors efficiently suppressed their expression by approximately 90% compared with the scrambled control (Supplementary Fig. 3C,D). [score:6]
In the absence of TGFβ1, transfection of NRK-52E cells with the miR-26a inhibitor decreased E-cadherin expression at the mRNA level but not at the protein level compared with the NC group; NRK-52E cells transfected with the miR-26a mimic showed a trend towards enhanced EMT marker expression at the mRNA and protein levels, but this change was not significant. [score:6]
In summary, we present a new regulatory mo del in renal tubular epithelial cells (Fig. 7), in which miR-26a and miR-30c form an miRNA network that synergistically modulates the TGFβ1 -mediated fibrotic response via coordinated inhibition of CTGF -dependent pathways and further inhibits the ERK1/2 and p38 MAPK signaling pathways. [score:6]
The up-regulation of the fibrotic marker genes FN, Col-I and α-SMA by miR-26a/30c inhibitors was diminished by siCTGF, regardless of the presence of TGFβ1 (Fig. S4C–F). [score:6]
Interestingly, miR-26a expression was up-regulated in urinary extracellular vesicles from DN patients but was decreased in TGFβ1 treated renal tubular epithelial cells and the kidney cortex of OLETF rats. [score:6]
miR-26a and miR-30c directly co-target CTGF, and miR-30c targets Snail1. [score:6]
The results presented in this study indicate that miR-26a, which targets CTGF, and miR-30c, which targets CTGF and Snail1, provide significant renal protection in renal tubular epithelial cells. [score:5]
miR-26a and miR-30c coordinately inhibit CTGF expression, leading to decreased phosphorylation of ERK1/2 and p38. [score:5]
Similar to our in vitro findings, miR-26a/30c expression was down-regulated in the renal cortices of OLETF rats compared with LETO rats. [score:5]
In our study, miR-26a and miR-30c synergistically suppressed CTGF and further inhibited the ERK1/2 and p38 MAPK signaling pathways. [score:5]
CTGF is targeted by miR-26a and miR-30c, and Snail1 is targeted by miR-30c. [score:5]
However, in another study, miR-26a inhibited TGFβ1 -induced ECM protein expression in podocytes 25. [score:5]
One potential mechanism is that miR-26a directly targets HMGA2 41, which directly binds to the Snail1 promoter 42. [score:5]
In one study, enhanced miR-26a expression induced mesangial cell hypertrophy and increased matrix protein expression 40. [score:5]
First, the CTGF 3′-UTR containing the two putative miR-26a and miR-30c target sites and the Snail1 3′-UTR containing the putative miR-30c target site were cloned into the pMIR-REPORT plasmid. [score:5]
These findings could further explain how TGFβ1 directly down-regulates miR-26a and miR-30c. [score:5]
miR-26a expression was significantly increased by four-fold in extracellular vesicles after TGFβ1 treatment, but miR-30c expression did not change (Supplementary Fig. 6). [score:5]
We performed a loss-of-function study by knocking down miR-26a and miR-30c alone or in combination using miRNA inhibitors. [score:4]
miR-26a and miR-30c are down-regulated in the renal cortices of diabetic OLETF rats. [score:4]
Luciferase reporter plasmids were generated to assess the direct effects of miR-26a and miR-30c on their putative target sites in the 3′-UTRs of CTGF and Snail1 mRNA. [score:4]
miR-26a is up-regulated in urinary extracellular vesicles of DN patients. [score:4]
Thus, determining whether CTGF and Snail1 collaboratively suppress TGFβ1 -induced EMT was also important for explaining the potential mechanism of miR-26a/30c co-regulation. [score:4]
In addition, we explored whether miR-26a and miR-30c regulate fibrosis by targeting CTGF and Snail1. [score:4]
Notably, compared to the NC group, transfection with the miR-26a/miR-30c mimics combination markedly decreased FN, Col-I and α-SMA expression, but not E-cadherin expression, at the protein level. [score:4]
Co-treatment with the miR-26a and miR-30c mimics suppresses TGFβ1 -induced EMT. [score:3]
The potential mechanism by which miR-26a and miR-30c synergistically suppress TGFβ1 -induced EMT. [score:3]
miR-26a and miR-30c mimics synergistically suppress TGFβ1 -induced EMT. [score:3]
Hence, inhibitor -induced repression of miR-26a and miR-30c levels may not drastically affect basal mRNA or protein levels. [score:3]
Bioinformatic analyses revealed that the miR-26a and miR-30c target sites in the 3′-UTR of CTGF are non-overlapping (Supplementary Fig. 1). [score:3]
Therefore, we hypothesized that miR-26a and miR-30c synergistically inhibit CTGF and then restrain phosphorylation activity within the ERK1/2 and p38 MAPK signaling pathways. [score:3]
Furthermore, co-treatment with the miR-26a/miR-30c mimics further enhanced the inhibitory effect (Fig. 5B–D). [score:3]
Co-treatment with the miR-26a and miR-30c inhibitors enhances TGFβ1 -induced EMT. [score:3]
When transfected with the miR-26a or miR-30c mimic, the cellular miR-26a and miR-30c expression levels increased approximately 50- to 80-fold (Supplementary Fig. 3A,B). [score:3]
Under diabetic nephropathy conditions, the TGFβ1 level is increased, resulting in reduced miR-26a and miR-30c expression. [score:3]
For the miRNA overexpression experiment, 50 nM miR-26a mimic, 50 nM miR-30c mimic or 25 nM each of miR-26a and miR-30c mimic (RiboBio, Guangzhou, China) was used. [score:3]
These data show that the miR-26a and miR-30c inhibitors coordinately increase TGFβ1 -induced EMT in NRK-52E cells. [score:3]
The computational program TargetScan predicted that the 3′-UTR of CTGF harbors two predicted binding sites for miR-26a and miR-30c. [score:3]
Decreased miR-26a and miR-30c expression in TGFβ1 -treated NRK-52E cells. [score:3]
We hypothesize that miR-26a influences other signaling pathways to decrease Snail1 expression. [score:3]
Hence, miR-26a and miR-30c effectively and synergistically inhibited the TGFβ1 -induced activation of MAPKs in TGFβ1 -treated NRK-52E cells. [score:3]
An examination of several CTGF-related miRNAs revealed that miR-26a and miR-30c expression levels were the highest. [score:3]
There have been no previous reports on the expression of miR-26a/30c in urinary extracellular vesicles in DN. [score:3]
A recent report indicated that miR-26a and miR-30c were among the top 10 highly expressed miRNAs in urinary extracellular vesicles 39. [score:3]
Furthermore, miR-26a and miR-30c were consistently down-regulated compared with control conditions (Fig. 1D). [score:3]
NRK-52E cells were co -transfected with a combination of miR-26a/30c inhibitors and siCTGF. [score:3]
Urinary extracellular vesicle miR-26a expression may be associated with DN progression, and miR-26a may become a new DN diagnostic marker. [score:3]
To explore whether TGFβ1 influences miR-26a and miR-30c expression in extracellular vesicles, we isolated this compartment from NRK-52E cell supernatants. [score:3]
Changes in miR-26a and miR-30c expression in the renal cortices of 40-week-old diabetic OLETF rats. [score:3]
We speculate that miR-26a may indirectly regulate Snail1 via HMGA2. [score:3]
Urinary extracellular vesicle expression of miR-26a and miR-30c. [score:3]
miR-26a and miR-30c inhibitors collaboratively enhance TGFβ1 -induced EMT. [score:3]
To explore the in vivo correlation between miR-26a/30c and DN, we compared the expression of CTGF/Snail1 and miR-26a/30c in the renal cortices of 40-week-old OLETF rats (diabetic) and LETO rats (non-diabetic). [score:2]
These changes paralleled the decreases in the expression of miR-26a and miR-30c in the kidney cortex of OLETF rats compared with non-diabetic LETO rat controls (Fig. 6D). [score:2]
In the absence of TGFβ1, miR-26a mimic transfection into NRK-52E cells showed a trend of ameliorating EMT marker expression at both the mRNA and protein levels, but this effect was not significant compared to the NC group. [score:2]
Next, we examined whether CTGF is necessary for the coordinated regulation of EMT by miR-26a and miR-30c. [score:2]
Here, we showed that miR-26a plays a protective role by down -regulating CTGF in renal tubular epithelial cells. [score:2]
How to cite this article: Zheng, Z. et al. The coordinated roles of miR-26a and miR-30c in regulating TGFβ1 -induced epithelial-to-mesenchymal transition in diabetic nephropathy. [score:2]
In the presence or absence of TGFβ1, CTGF mRNA and protein levels were markedly reduced after treatment with either miR-26a or miR-30c mimic alone; treatment with both mimics strengthened the suppressive effects on CTGF compared with treatment with either miR-26a or miR-30c mimic alone (Fig. 2D,F). [score:2]
Moreover, co-transfection of NRK-52E cells with the miR-26a/miR-30c mimic combination significantly inhibited EMT compared with transfection with either mimic alone, as determined by mRNA and protein levels (Fig. 3A–I). [score:2]
miR-26a and miR-30c regulate TGFβ1 -induced EMT via CTGF/Snail1. [score:2]
Because the origin of miR-26a in urinary extracellular vesicles is complex, we could not verify whether miR-26a secreted by renal tubular epithelial cells was the primary contributor to the increased presence in urinary extracellular vesicles. [score:1]
However, there was no difference between the miR-30c mimic group and the combination miR-26a/miR-30c mimics group. [score:1]
Consistent with our expectations, luciferase activity was significantly decreased when cells were treated with either miR-26a or miR-30c mimic alone. [score:1]
The correlation between miR-26a levels and UAER was close to reaching significance (p = 0.057); perhaps the limited number of patients hindered this analysis (Supplementary Table 2). [score:1]
As expected, activation of the ERK1/2 and p38 MAPK signaling pathways due to TGFβ1 treatment (30 min) was markedly attenuated by the individual miR-26a and miR-30c mimics. [score:1]
Then, cells were co -transfected with the synthetic CTGF 3′-UTR plasmid, control plasmid (β-gal), and miR-26a or miR-30c mimic alone, a combination of miR-26a/30c mimics (each at half the dose for the single mimic treatment) or negative control mimic. [score:1]
These data show that the miR-26a and miR-30c mimics synergistically ameliorate TGFβ1-stimulated EMT in NRK-52E cells. [score:1]
A subsequent experiment found that the miR-26a level was significantly increased in extracellular vesicles from NRK-52E cell supernatants after TGFβ1 treatment. [score:1]
Hence, mimic -induced promotion of miR-26a and miR-30c levels may not drastically affect basal mRNA or protein levels. [score:1]
The coordinated roles of miR-26a and miR-30c are complicated and require detailed study. [score:1]
miR-26a levels were higher in DN patients than in DM patients (Table 1). [score:1]
We explored the concentrations of miR-26a/30c in urinary extracellular vesicles and assessed the potential of urinary extracellular vesicle miR-26a/30c levels as a DN marker. [score:1]
This result indicated that urinary extracellular vesicle miR-26a levels might be a new marker for DN. [score:1]
The results further confirmed that CTGF, Snail1 and miR-26a/30c play important roles in DN. [score:1]
Co-treatment with the miR-26a/miR-30c mimic combination showed a trend towards ameliorating ERK1/2 and p38 MAPK phosphorylation, but this effect was not significant. [score:1]
This result may partly explain the coordinated roles of miR-26a and miR-30c in DN. [score:1]
To ascertain the impact of miR-26a and miR-30c on the ERK1/2 and p38 MAPK signaling pathways, 50 nM miR-26a mimic, 50 nM miR-30c mimic or 25 nM each of miR-26a and miR-30c mimic (RiboBio, Guangzhou, China) was applied to the cells 30 min after TGFβ1 or control treatment. [score:1]
Mutated plasmids were constructed to contain two mutated seed sequences for miR-26a and miR-30c (from ACTTGA to GACGTC for the miR-26a binding site and from TGTTTAC to GACGAGT for the miR-30c binding site). [score:1]
TGFβ1 induces pro-fibrotic changes and reduces miR-26a and miR-30c levels in NRK-52E cells. [score:1]
Luciferase activity was also significantly decreased by the combination of the miR-26a and miR-30c mimics (Fig. 2B). [score:1]
The role of miR-26a in DN remains debatable. [score:1]
Taken together, these results describing the coordination of miR-26a/30c in renal fibrosis provide new insights into the progression of DN, and co-silencing miR-26a and miR-30c could be a novel renoprotective therapy for DN patients. [score:1]
Hence, the mimic -induced promotion of miR-26a and miR-30c levels may not drastically affect basal ERK1/2 and p38 MAPK phosphorylation levels. [score:1]
The mechanisms underlying the coordinated roles of miR-26a and miR-30c may stem from the cooperation between the CTGF and Snail1 transcription factors. [score:1]
Interestingly, this trend was even more dramatic with the combination of miR-26a and miR-30c mimics (Fig. 2B). [score:1]
We investigated the synergistic effect of miR-26a and miR-30c overexpression in NRK-52E cells with or without TGFβ1 treatment. [score:1]
To further validate miR-26a as a new diagnostic biomarker, a larger sample size in a prospective experiment is needed. [score:1]
The two regions of the predicted binding sites for miR-26a and miR-30c were separated by the interval AAAAAA (Sangon Biotech, Shanghai, China). [score:1]
In contrast, no repression was observed for the construct containing the CTGF 3′-UTR with a mutated miR-26a/30c binding site (Fig. 2B). [score:1]
Cells were also co -transfected with the synthetic Snail1 3′-UTR plasmid, control plasmid (β-gal), and miR-26a or miR-30c mimic alone, a combination of miR-26a/30c mimics (each at half the dose for the single mimic treatment) or negative control mimic. [score:1]
Luciferase activity was significantly decreased when cells were transfected with the miR-30c mimic alone but did not change when the cells were transfected with the miR-26a mimic. [score:1]
Further analysis showed that there was no significant correlation between cystatin, urinary albumin excretion rate (UAER), serum creatinine (Scr), estimated glomerular filtration rate (eGFR) or HbA1C% and the levels of miR-26a and miR-30c. [score:1]
However, the function of miR-26a has not been previously explored in renal tubular epithelial cells, another important component of the kidney. [score:1]
To further explore the relevance of our findings in vivo, we investigated CTGF, Snail1 and miR-26a/30c expression in the renal cortices of 40-week-old OLETF rats. [score:1]
TGFβ1-miR-26a/30c signaling network leading to kidney fibrosis in diabetic nephropathy. [score:1]
[1 to 20 of 105 sentences]
2
[+] score: 329
Expression of tlr3 and miR-26a was monitored in PIA rat spleens and the results showed that tlr3 mRNA expression was sharply upregulated 3-fold (P <0.01), whereas miR-26a expression significantly decreased by 60% on average. [score:10]
These findings demonstrate that miR-26a regulates the TLR3 signaling pathway by targeting TLR3 expression, and implicates miR-26a as a drug target for inflammatory suppression in arthritis therapy. [score:10]
Microarray -based miRNA expression profiling found that MYC oncogene could repress miR-26a [35], Trastuzumab could induce mir-26a and hence, produces therapeutic actions in human epidermal growth factor receptor-2 (HER2) -positive breast cancer cells [36], C/EBP-α can directly activate mir-26a expression during mechanical stretch, which leads to hypertrophy of human airway smooth-muscle cells [37], and menin, a transcriptional factor has been demonstrated by chromatin immunoprecipitation (ChIP) to occupy the mir-26a gene promoter, thus inducing its expression, and confirming its role as a positive regulator of mir-26a [38]. [score:9]
In the mean time, western blotting results of TLR3 protein expression showed that 10nM miR-26a mimics were able to significantly suppress TLR3 protein expression by approximately 30% on average compared with the mock (P <0.05) or the NC group (P <0.05), and 10nM miR-26a inhibitors sharply increased TLR3 protein expression by 100% compared with the mock (P <0.05) or by 70% compared with the NC (P <0.05) (Figure 2C). [score:8]
TLR3 mRNA expression results showed that miR-26a mimics hardly affected tlr3 mRNA expression, however miR-26a inhibitors were able to raise tlr3 mRNA expression level by 3.7- or 1.9-fold respectively compared with the mock (P <0.05) or the NC (P <0.05) group (Figure 2B). [score:8]
TLR3 is intrinsically expressed in rodent macrophages, hence, in this work we chose the rat macrophage cell line NR8383 to explore the expression regulation of the TLR3 gene after miR-26a mimics or inhibitors were transfected into the cells. [score:8]
The present study was performed to find the potential miRNAs that can target the TLR3 molecule itself, verifying both the miRNA and TLR3 expression in macrophages during differentiation and pristane stimulation, as well as in the spleen of PIA rats, and observing the effects of an miR-26a mimic on TLR3 expression and arthritis severity in PIA rats. [score:7]
MiR-26a expression was downregulated as tlr3 expression was decreased in spleens of PIA rats, and both were rescued after MTX treatment in arthritic rats. [score:7]
At the end of this study, the miR-26a administration in PIA rats demonstrated that miR-26a overexpression can suppress TLR3 protein expression in vivo. [score:7]
MiR-26a was downregulated and TLR3 was upregulated during the induction of rat BMDM. [score:6]
In addition, upregulated miR-26a promotes myogenesis by post transcriptional repression of Ezh2, a known suppressor of skeletal muscle cell differentiation [34]. [score:6]
MiR-26a regulation on TLR3 gene expression was determined using and after miR-26a mimics and inhibitors were transfected into rat macrophage line NR8383 cells. [score:6]
In pristane-primed NR8383 cells, enhanced expression of tlr3 mRNA (P <0.05) and protein expression approximately 2-fold compared with the medium control, whereas miR-26a expression decreased by 40% on average (P <0.05) after 24 h pristane stimulation (Figure 4A and B). [score:6]
Our finding not only discloses the deregulation of miR-26a in TLR3 expression, but also offers a novel and reliable mechanism for abnormal TLR3 overexpression in experimental arthritis. [score:6]
Responding to this increasing miR-26a expression, TLR3 protein expression displayed dose -dependent inhibition by approximately 30%, 50% and 70% respectively, compared with the NC group (Figure 2D). [score:6]
The cells were transfected with miR-26a inhibitors and miR-26a expression was suppressed by 99% compared with the NC (P <0.05) or mock (P <0.05) group, suggesting that a gain or loss of miR-26a function occurred (Figure 2A). [score:6]
We found reduction of miR-26a expression in rat macrophages during BMDM induction, pristane stimulation and in spleens of PIA rats in which TLR3 was overexpressed. [score:5]
Sequences from 5′ to 3′ end are listed as follows: NC mimics sense UUCUCCGAACGUGUCACGUTT, anti-sense ACGUGACACGUUCGGAGAATT; miR-26a mimics sense UUCAAGUAAUCCAGGAUAGGCU, anti-sense CCUAUCCUGGAUUACUUGAAUU; NC inhibitor CAGUACUUUUGUG UAGUACAA (2′Ome -modified), miR-26a inhibitor AGCCUAUCCUGGAUUACUU GAA (2′Ome -modified). [score:5]
The incubation with miR-26a mimics/inhibitors was performed for a further 24 h and pristane stimulation for another 24 h to confirm the target repression of TLR3 signaling by miR-26a in macrophages. [score:5]
In this case, endogenous miR-26a might be sufficient for buffering TLR3 expression fluctuation in inactivated macrophage so that miR-26a inhibitor treatment exhibits a more powerful function than its mimics. [score:5]
Different doses of miR-26a mimics were transfected into NR8383 cells to confirm the translational suppression. [score:5]
Modifications of miR-26a function by transfection of miR-26a mimics and inhibitors exhibited corresponding repression and augmentation of TLR3 and its signaling downstream cytokine expressions in NR8383 cells. [score:5]
MiR-26a negatively regulates TLR3 signaling via targeting of TLR3 itself in rat macrophages, and this finding provides a novel insight into abnormal TLR3 overexpression during experimental arthritis. [score:5]
The alteration of miR-26a expression was negatively related with TLR3 expression during BMDM induction, in pristane-primed NR8383 cells and PIA rat spleens. [score:5]
To find out whether miR-26a could control TLR3 signaling, NR8383 were incubated with 10 nM mimics or inhibitors for 24 h prior to activation of TLR3 signaling by poly I:C stimulation for another 24 h, and then harvested for expression analysis. [score:5]
Along with macrophage induction, tlr3 mRNA was upregulated 5- and 9-fold, whereas the miR-26a expression declined by 60% and 70% respectively on days 3 and 6 compared with day 0 after BMDM induction (Figure 3A). [score:5]
The miR-26a mimic treatment displayed the depression of TLR3 expression and ameliorated the disease severity in the rats with pristane induced arthritis. [score:5]
Direct target relationship between miR-26a and tlr3 mRNA in rats was confirmed. [score:4]
In addition, miR-26a was verified to be involved in the negative regulation of TLR3 signaling by targeting TLR3 itself in macrophages, and modifications of miR-26a function exhibited corresponding repression or augmentation of TLR3 signaling. [score:4]
MiR-26a -mimic administration also could lead to suppression of TLR3 protein expression and ameliorate arthritis in PIA rats. [score:4]
TLR3 protein expression in the spleen was significantly suppressed in the PIA + miR-26a group compared with the PIA + NC group or PIA + saline group (Figure 6G). [score:4]
The mutated tlr3 3′UTR element containing site mutations at numbers 2, 4, and 6 in the putative miR-26a: tlr3 seed-pair region was obtained using the PCR-directed mutation method and cloned into the same vector, namely the mutated pMIR-TLR3 vector. [score:4]
Successful transfection was confirmed by miR-26a expression monitored by, and the results showed that alteration of miR-26a function could regulate TLR3 signaling after pristane stimulation in macrophages. [score:4]
MiR-26a mimic was administrated to PIA rats, and the results showed that TLR3 protein expression was suppressed, and the arthritis severity alleviated. [score:4]
For example, it has been reported that miR-26a plays a crucial role in regulating mouse hepatocyte proliferation during liver regeneration [32], and it could also modulate osteogenic differentiation of human adipose tissue-derived stem cells by targeting SMAD1 transcription factor [33]. [score:4]
Similarly, TNF-α protein concentration in the cell supernatant was detected using ELISA, and the results showed that it was significantly suppressed (P <0.05) after miR-26a mimic treatment, and enhanced (P <0.05) after inhibitor treatment compared with the mock or NC group (Figure 4E). [score:4]
In BMDM induction and pristane-stimulated NR8383 cells, miR-26a reduction was found to be responsible for TLR3 overexpression in rat macrophages. [score:3]
ELISA results also showed that the TNF-α protein concentration in the cell supernatant was also significantly suppressed after miR-26a mimic treatment compared with the NC (P <0.05), and enhanced after inhibitor treatment compared with both the mock and NC groups (both P <0.05) (Figure 2G). [score:3]
In bioinformatics, we found that miR-26a targets TLR3 in the rat, mouse, rabbit, bushbaby and armadillo; however, the binding pattern of TLR3:miR-26a disappears in the human genome with two nucleotide mutations at the seed region compared with the rat genome. [score:3]
These results indicated that miR-26a mimic finely controlled TLR3 protein expression and ameliorated arthritis severity in the PIA rats. [score:3]
Briefly, both the firefly pMIR-Report™ Luciferase (Ambion) and renilla pRL-TK (Promega) vectors (90 ng:10 ng per well) were transfected into Hela cells (2 × 10 [4] cells per well seeded for 24 h before transfection) simultaneously with 10 nM miR-26a mimic/inhibitor (GenePharma, Shanghai, China) or negative control (NC) using Lipofectamin 2000™ (Invitrogen, Carlsbad, USA) transfection reagents in a 48-well culture plate. [score:3]
Bioinformatics results showed that miR-26a and miR-340-5p were candidate miRNAs for targeting rat TLR3 (Figure 1A). [score:3]
To sum up, we predicted miR-26a to be a candidate to target TLR3 in rats and many other mammals. [score:3]
However, both tlr3 excess expression and miR-26a reduction after MTX treatment surprisingly recovered to the levels of control rats (Figure 5C). [score:3]
Dual luciferase reporter assay was used to validate the direct interaction between miR-26a (a candidate miRNA to target tlr3 mRNA) and tlr3 3′UTR. [score:3]
MiR-26a mimics exhibited corresponding repression of TLR3 protein by 40% and 25% compared with the NC or mock group, whereas miR-26a inhibitors increased TLR3 expression 1.6-fold compared with the NC or mock (Figure 4D). [score:3]
results showed that miR-26a and miR-340-5p were candidate miRNAs for targeting rat TLR3 (Figure 1A). [score:3]
Figure 4 miR-26a and toll-like receptor (TLR)3 expression in rat macrophages after pristane stimulation in vitro. [score:3]
Figure 1 Putative target relationship between miR-26a and toll-lke receptor (TLR)3 in rats. [score:3]
After pristane activation, miR-26a mimics repressed tlr3 mRNA by 30% and protein by 40%, and its inhibitors also increased tlr3 mRNA by 40% and protein 1.6-fold. [score:3]
To observe whether miR-26a overexpression in vivo can influenze arthritis severity, PIA rats were treated with miR-26a mimic, NC mimics and saline four times until rats were sacrificed (Figure 6A). [score:3]
Expressions of TLR3 and miR-26a were detected during rat bone marrow derived macrophage (BMDM) induction, in pristane stimulated NR8383 cells and spleens from methotrexate (MTX) treated PIA rats. [score:3]
Figure 5 miR-26a and toll-like receptor (TLR)3 expression in pristine -induced arthritis (PIA) rats with and without treatment with methotrexate (MTX). [score:3]
MiR-26a expression in spleens from the PIA + miR-26a group remained 2.5 times higher than in the NC group, even after the last mimic administration four days previously (Figure 6F). [score:3]
Attached cells on days 0, 3 and 6 were harvested for miR-26a and TLR3 expression analyses. [score:3]
Figure 3 miR-26a and toll-like receptor (TLR)3 expression during bone marrow-derived macrophage (BMDM) induction. [score:3]
On the contrary, the miR-26a inhibitor significantly elevated (P <0.05) the luciferase activity of pMIR-TLR3 vector by 70% on average compared with the NC inhibitor or by 80% compared with the empty pMIR vector. [score:3]
In previous reports, miR-26a was on the list of the top 10% of miRNAs constitutively expressed at a high level in rat spleen [30], and also found to be considerable abundant in rat articular cartilage using Solexa sequencing from our previous study [31]. [score:3]
Target relationship between tlr3 mRNA 3′UTR and miR-26a was analyzed by dual luciferase reporter assay, pMIR-REPORT™ Luciferase vectors with or without tlr3 mRNA 3′UTR element (pMIR-TLR3 or pMIR empty vectors) were transfected into Hela cells, and pRL-TK vector was used as an internal control reporter in all conditions for normalization. [score:2]
Mir-26a genes are present on chromosome 3p22.2 and 12q14.1 in the human genome and 8q32 in the rat genome, and mir-26a itself could be regulated. [score:2]
In the inactivated phase, miR-26a mimics hardly affected tlr3 mRNA, yet repressed its protein by 30%, whereas miR-26a inhibitors increased tlr3 mRNA 1.9-fold, and protein by 70% on average compared with the NC. [score:2]
The negative regulation of the TLR3 gene from miR-26a was revealed in inactive NR8383 macrophages, further in primary macrophages during BMDM induction, and also in pristine-stimulated NR8383 macrophages, confirming that miR-26a could control TLR3 signaling in rat macrophages. [score:2]
miR-26a mimics and inhibitors, respectively, caused a 30% reduction in 40% increase of tlr3 mRNA (P <0.05), a 30% reduction or 60% increase in ifn-β mRNA (P <0.05), and a 45% reduction or 2.5-fold increase in tnf-α mRNA (P <0.05) compared with the NC group (Figure 4C). [score:2]
MiR-26a also putatively targets TLR4 in humans, and in the chimpanzee, rhesus monkey, horse, elephant, tree shrew and tenrec. [score:2]
This putative targeting relationship between miR-26a and TLR3 was further confirmed by dual reporter gene assay. [score:2]
Putative targeting relationship between miR-26a and TLR3 in rats was confirmed by dual luciferase reporter gene assay. [score:2]
MiR-26a and TLR3 expression displayed an opposite trend in rat macrophages after pristane stimulation. [score:2]
Both double-stranded mimics and single-stranded inhibitors of miR-26a or the NC could activate tlr3 and ifn-β mRNA compared with the mock (P <0.05). [score:2]
To confirm whether TLR3 is the target of miR-26a, the firefly and renilla dual luciferase reporter assay was performed in Hela cells (Figure 1B). [score:2]
MiR-26a could negatively regulate TLR3 signaling by intervening in miR-26a function in macrophages. [score:2]
To further verify this specific binding, a mutated pMIR-TLR3 vector with a three-nucleotide mutation in the putative seed -binding site was constructed and transfected together with miR-26a mimics and pRL-TK into Hela cells (Figure 1C). [score:2]
Rescued miR-26a reduction and TLR3 overexpression in spleens from MTX -treated PIA rats compared with saline -treated ones also suggested the implication of miR-26a in rat arthritis. [score:2]
Previous studies on miR-26a have provided much evidence of this miRNA as an important regulator in cell proliferation and differentiation. [score:2]
The results showed that miR-26a mimics caused a 60% reduction, whereas inhibitors caused a 1.5-fold increase of TLR3 protein on average compared with both the NC and mock group (Figure 2E). [score:2]
MiR-26a and TLR3 expression was monitored after rat BMDM was induced for 0, 3 and 6 days. [score:2]
It seems that miR-26a regulation may transition from TLR3 to TLR4 in many other species. [score:2]
More interestingly, after TLR3 signaling activation, this negative regulation from miR-26a seemed to be amplified. [score:2]
PIA rats were divided into three groups: PIA + saline, PIA + negative control (NC) and PIA + miR-26a. [score:1]
The arthritis clinical score showed that miR-26a could not prevent the occurrence of arthritis from the beginning, but could significantly restrain the arthritis severity after the third injection on day 15 till the rats were sacrificed on day 23 (Figure 6B). [score:1]
According to miRBase [29], an authoritative miRNA database, miR-26a belongs to one of the miRNA families broadly conserved with perfectly identical sequences among vertebrates. [score:1]
pMIR-REPORT™ Luciferase vector carrying a TLR3 mRNA 3′UTR element with the putative binding site of miR-26a was transfected into Hela cells (upper panel). [score:1]
Implication of miR-26a found in PIA rat spleens. [score:1]
Figure 2 Effects of miR-26a on toll-like receptor (TLR)3 signaling by gain or loss of miR-26a function in NR8383. [score:1]
Arthritis was induced in rats using pristane at day 0 and then rats were treated with miR-26a mimic, NC mimics or saline (150 μg/kg, equal to 11.4 nmol/kg molecules dissolved in saline each time) through i. p. injection four times, on days 8, 12, 15 and 19. [score:1]
MiR-26a miR-Up™ agomir molecule, which was cholesterol -modified at the 3′ end, with two phosphorthioations at the 5′ end and four at the 3′ end, and methylation for all skeletons, was purchased from the company (GenePharma, China) and used as a miR-26a mimic. [score:1]
miR-26a inhibitors caused a 60% increase of ifn-β mRNA compared with both (P <0.05) the NC and mock, and a 100% increase of tnf-α mRNA compared with the NC (P <0.05) (Figure 2F). [score:1]
There was no significant difference in the organ-/body-weight ratio in the spleen, inguinal lymph nodes, heart, liver, lung or kidney, indicating therapy in both the NC and miR-26a miRNA (Additional file 1). [score:1]
Ankle (Figure 6C) and food-pad perimeter (Figure 6D) in the PIA + miR-26a group was significantly lower than in the PIA + saline or PIA + NC group on day 23, indicating relief of joint-swelling after miR-26a mimic treatment (Additional file 1). [score:1]
Click here for file Figure showing other arthritis-parameter changes after miR-26a mimic treatment in pristine -induced arthritis (PIA) rats. [score:1]
The ELISA test also showed that the plasma TNF-α in PIA + miR-26a rats was lower than in the PIA + saline rats (Figure 6H). [score:1]
A 198-bp-long tlr3 3′UTR element containing the putativebinding site of miR-26a (miR-26a sequence: 5′-UUCAAGUAAUCCAGGAUAGGCU-3′) was cloned downstream of the luciferase gene between the SacI and HindIII sites within the pMIR-Report™ Luciferase (Ambion, Austin, USA) vector to construct a pMIR-TLR3 vector. [score:1]
Figure showing other arthritis-parameter changes after miR-26a mimic treatment in pristine -induced arthritis (PIA) rats. [score:1]
Schematic diagram of pairing relationship between miR-26a and wild-type or mutated pMIR-TLR3 vector indicates that three nucleotides have been altered in the mutated pMIR-TLR3 vector (lower panel). [score:1]
This study was performed to determine the relationship between miR-26a and TLR3 in rat macrophages and to observe effects of miR-26a mimic on pristane induced arthritis (PIA) in rats. [score:1]
The rat tlr3 mRNA 3′UTR sequence contains a putative binding site of miR-26a analyzed by the bioinformatics software [28]. [score:1]
[1 to 20 of 95 sentences]
3
[+] score: 264
The inhibitory effects of miR-26a on PDGF-BB -induced VSMC proliferation and migration were partially reversed by overexpression of MAPK6, suggesting that the inhibitory effect of miR-26a on VSMC proliferation and migration was, at least partly, mediated by directly targeting MAPK6. [score:10]
More importantly, up-regulation of miR-26a inhibited VSMC proliferation and migration and reduced vein graft neointimal hyperplasia, consistent with a previous report showing that ectopic expression of miR-26a inhibited endothelial cell proliferation, migration and angiogenesis 20. [score:10]
MiR-26a expression was substantially down-regulated in proliferative rat jugular vein VSMCs, and restoration of its expression markedly inhibited both VSMC proliferation and migration in response to PDGF-BB stimulation. [score:9]
Interestingly, in our study, the expression of miR-26a in jugular veins was significantly down-regulated (Fig. 1B) at week 1, 2, and 4 after autologous jugular vein graft, but down-regulation was most significant at week 2. Similar results were found 24 h after treatment with PDGF-BB in VSMCs (Fig. 1D). [score:9]
To determine whether miR-26a directly binds to the 3′-UTR sequence of rat MAPK6 mRNA and affects its expression, the 3′-UTR sequence of MAPK6 containing the putative binding site of miR-26a was cloned into a pmirGLO Dual-Luciferase miRNA Target Expression vector. [score:8]
Further analysis revealed that miR-26a suppresses the expression of MAPK6 and its downstream targets PCNA, Cyclin D1, MMP-2 and MMP-9. Thus, our study identified miR-26a as a novel key regulator that plays an important role in rat jugular vein VSMC biology. [score:8]
This study revealed that knockdown of MAPK6 or overexpression of miR-26a inhibited proliferation and migration of VSMC by reducing expression of PCNA, cyclin D1, MMP2 and MMP9. [score:8]
Neointimal lesions of the rat jugular vein were induced (Fig. 1A), and the expression of miR-26a in jugular veins was significantly down-regulated (Fig. 1B) at week 1, 2, and 4 after autologous jugular vein graft, suggesting that miR-26a may be a critical regulator for VSMCs in the vascular wall. [score:7]
Furthermore, we found that miR-26a expression in VSMCs was significantly down-regulated after treatment with PDGF-BB in a dose -dependent and time -dependent manner (Fig. 1C and D). [score:6]
Down-regulation of miR-26a expression is linked to proliferation of rat jugular vein VSMCs. [score:6]
The overexpression of miR-26 in two human ATC-derived cell lines significantly decreased thyroid carcinogenesis, suggesting a crucial role for miR-26 down-regulation in thyroid carcinogenesis 29. [score:6]
Down-regulation of miR-26a expression in the proliferation of rat jugular vein VSMCs. [score:6]
Taken together, these results suggest that miR-26a inhibits jugular vein graft -induced neointimal formation in vivo by suppressing MAPK6 -mediated VSMC proliferation. [score:5]
Overexpression of miR-26a reduced the MAPK6 expression at both the protein and mRNA levels. [score:5]
For example, miR-26a was down-regulated in breast cancer specimens and cell lines, and it initiated apoptosis through endogenous and exogenous pathways activated by caspase8 and caspase9 as well as through direct binding to the 3′-UTR of MTDH and EZH2. [score:5]
Thus, miR-26 exerts diverse effects on cellular function, either inhibiting or promoting cell proliferation in different cell types 24. miRNAs are evolutionarily conserved and act at the post-transcriptional level as “fine tuners” and/or “safeguards” to balance dramatic environmentally induced alterations in gene expression and maintain organism homeostasis 33. [score:5]
In this study, miR-26a was identified as a novel modulator involved in rat jugular vein VSMC proliferation and migration because miR-26a was significantly down-regulated in rat proliferative VSMCs and grafted veins, and miR-26a regulated VSMC proliferation and migration in vitro and neointimal formation in vivo. [score:5]
MAPK6 (mitogen-activated protein kinase 6) was a potential miR-26a target based on its mRNA 3′-UTR, which was complementary to miR-26a as determined by TargetScanHuman 6.2 and microrna. [score:5]
Overexpression of miR-26a markedly decreased the expression of MAPK6 in both basal and PDGF-BB -induced conditions. [score:5]
Taken together, these results indicated that miR-26a selectively binds to the 3′-UTR of rat MAPK6 mRNA and inhibits its expression in VSMCs. [score:5]
MiR-26a was also shown to be abundantly expressed in stretch -induced hypertrophic human airway smooth muscle cells (HASMCs), and enforced expression of miR-26a induced HASMC hypertrophy 38. [score:5]
In addition, MMP-2 and MMP-9, which are implicated in VSMC migration 22, were significantly inhibited in VSMCs overexpressing miR-26a (Fig. 3E). [score:5]
In summary, our study identified miR-26a as a novel regulator of rat jugular vein VSMCs by targeting, at least partly, the MAPK6 pathway. [score:4]
How to cite this article: Tan, J. et al. MicroRNA-26a targets MAPK6 to inhibit smooth muscle cell proliferation and vein graft neointimal hyperplasia. [score:4]
The role of miR-26a in VSMCs by directly targeting MAPK6. [score:4]
Furthermore, mutation of the miR-26a binding site in the 3′-UTR of MAPK6 significantly decreased the inhibitory effects of miR-26a on the luciferase activity (Fig. 4B). [score:4]
In the current study, we showed that miR-26a was down-regulated by PDGF-BB in VSMCs and grafted veins. [score:4]
The effect of miR-26a on VSMC proliferation was further confirmed by the significantly attenuated expression of PCNA and Cyclin D1, regulators of VSMC proliferation (Fig. 2G and H), in VSMCs transfected with miR-26a agomir after stimulation with PDGF-BB. [score:4]
These results indicate that miR-26a is an inhibitor of VSMC in vitro wound repair. [score:3]
In this study, the MAPK6 gene was identified as a direct target of miR-26a in rat jugular vein VSMCs as shown by luciferase reporter assays. [score:3]
Total RNAs were extracted, and the expression of miR-26a was detected by (n = 4). [score:3]
The expression of miR-26a in rat jugular vein transduced with LV3-NC was undetectable (ND). [score:3]
Accordingly, the cell proliferation induced by PDGF-BB was significantly inhibited in VSMCs transfected with miR-26a agomir (Fig. 2C and E). [score:3]
miR-26a inhibits vascular neointimal formation in a rat mo del of autogenous jugular vein graft. [score:3]
To confirm the role of miR-26a in inhibiting VSMC proliferation, VSMCs were transfected with miR-26a agomir, miR-26a antagomir or negative controls. [score:3]
The lentivirus expressing miR-26a (LV3-miR-26a) was generated using a GM Easy [TM] Lentiviral Packaging Kit (Genomeditech, China) according to the manufacturer’s instructions. [score:3]
Inhibition of VSMC in vitro wound repair by miR-26aFurthermore, miR-26a was associated with VSMC migration. [score:3]
MiR-26 may play crucial roles in growth and development of normal tissues and the pathogenesis of non-tumor diseases and tumor formation 24. [score:3]
However, the effects of miR-26a on VSMC function were opposite to the findings discovered by Leeper et al., who showed that overexpression of miR-26a enhanced human aortic SMC proliferation 37. [score:3]
Inhibition of VSMC proliferation by miR-26a. [score:3]
Overexpression of miR-26a in a murine glioma mo del revealed that miR-26a effectively repressed endogenous PTEN protein by binding to 3 potential binding sites in the PTEN 3′-UTR in a relevant glioma mo del system, promoting tumorigenesis. [score:3]
Figure 2A and B show that the expression of miR-26a was increased in a dose -dependent manner in the VSMCs transfected with miR-26a agomir, whereas endogenous levels of miR-26a were substantially reduced in the VSMCs transfected with miR-26a antagomir. [score:3]
Inhibition of VSMC in vitro wound repair by miR-26a. [score:3]
For miR-26a overexpression, miR-26a agomir (GenePharma, China) was added to the complexes at final concentrations of 50 nM. [score:3]
Overexpression of miR-26a via transfection with agomir delayed the wound closure in a scratch mo del of VSMC monolayers under both basal and PDGF-BB-stimulated conditions (Fig. 3A and B). [score:3]
Transduction of the jugular vein with LV3-miR-26a inhibited the jugular vein graft -induced neointimal formation up to 30%, which was associated with decreases in the intima-to-media ratio (Fig. 7B) in LV3-miR-26a -treated jugular veins. [score:3]
Figure 4B shows that the luciferase activity was inhibited in the cells transfected with the miR-26a agomir but not in the cells with agomir NC. [score:3]
These results may reflect the biologically context -dependent expression pattern of miR-26a in autologous-grafted jugular veins and VSMCs treated with PDGF-BB. [score:3]
Briefly, the pGMLV vector and GM Easy [TM] Lentiviral Mix plasmid were co -transfected with the pCDH1 -expressing vector containing the miR-26a sequence into HEK293 cells using HG Transgene [TM] Reagent (Genomeditech, China). [score:3]
MiR-26a functions in VSMCs by directly targeting MAPK6. [score:3]
MiR-26 is overexpressed in high-grade glioma and is frequently amplified at the DNA level in a subset of human high-grade gliomas. [score:2]
These results indicated that miR-26a may be a critical regulator of VSMC proliferation. [score:2]
The expression of miR-26a in the grafted-jugular vein was markedly increased compared with the LV3-GFP -treated group 4 weeks after transduction (Fig. 7C). [score:2]
Together, these results indicate that miR-26a plays an important role in regulating the proliferation of VSMCs from the jugular veins of rats. [score:2]
For miR-26a knockdown, the miR-26a antagomir (GenePharma, China) was added to the complexes at final concentrations of 100 nM. [score:2]
Moreover, the number of MAPK6 -positive cells was also substantially reduced in the LV3-miR-26a-transduced jugular veins (Fig. 7F and G). [score:1]
Interestingly, miR-26a is also involved in neointimal formation in the rat autogenous jugular vein graft mo del 4 weeks after grafting. [score:1]
MiR-26, a functional miRNA, has received much attention from researchers in recent years. [score:1]
The constructed vector was then co -transfected with either the miR-26a agomir or agomir negative control (agomir NC) into HEK293 cells. [score:1]
miR-26a attenuates neointimal formation in a rat mo del of autogenous jugular vein graft. [score:1]
Furthermore, miR-26a was associated with VSMC migration. [score:1]
Rats were randomly divided into 3 groups: the LV3-miR-26a -treated group, LV3-NC group and the Sham group. [score:1]
Then, 200 ng of each construct or vehicle control was co -transfected with miR-26a agomir or negative control (50 nM) into HEK293 cells using Lipofectamine 2000 according to the recommended protocol. [score:1]
In contrast, cell proliferation was promoted in VSMCs transfected with miR-26a antagomir in response to low-dose PDGF-BB (Fig. 2D and 2F). [score:1]
Role of miR-26a in the migration of VSMCs. [score:1]
The grafted-jugular vein was transduced with either LV3-miR-26a (10 [8] pfu/mL) or LV3-GFP. [score:1]
Vein segments were immersed in 500 μl lentivirus solution (either LV3-miR-26a or LV3-NC, 10 [8] pfu/ml) for 5 min. [score:1]
Figure 4A shows that rat MAPK6 mRNA has a potential miR-26a binding site in its 3′-UTR. [score:1]
These results indicate that the diverse effects of miR-26 on VSMC are species-specific and depend on the external stimuli. [score:1]
Both basal and PDGF -induced VSMC migration was augmented in VSMCs transfected with miR-26a antagomir (Fig. 3Cand D). [score:1]
Lentiviral vector -mediated miR-26a mimic delivery into the vein grafts. [score:1]
Representative Elastica van Gieson -stained jugular veins from rats treated with LV3 or LV3-miR-26a 4 weeks after autogenous jugular graft. [score:1]
MAPK6 3′-UTR fragments with wild type (WT) or mutant miR-26a binding sites were cloned by PCR. [score:1]
To further verify that MAPK6 is a functional target gene of miR-26a in rat VSMCs, VSMCs were transfected with either agomir NC or miR-26a agomir (50 nmol/L), and MAPK6 levels were measured by both qRT–PCR (Fig. 4C) and western blot (Fig. 4D and E). [score:1]
For local delivery of the lentiviral vector -mediated miR-26a mimics (LV3-26a) and negative controls (LV3-NC) into grafted veins, we used an established local delivery mo del with Pluronic F-127 gel (Sigma) as previously described 58. [score:1]
In contrast, the cells transfected with the miR-26a antagomir showed increased luciferase activity. [score:1]
[1 to 20 of 76 sentences]
4
[+] score: 107
Other miRNAs from this paper: rno-mir-10a, rno-mir-103-2, rno-mir-103-1, rno-mir-495
Therefore, the goals of this study were to provide a potential mechanistic explanation for EtOH -induced effects on gene expression by quantifying the expression of EtOH sensitive miRs (miR-10a-5p, miR-26a, miR-103 and miR-495) during normal pubertal development in the male rat hippocampus, and then elucidate how peri-pubertal binge EtOH exposure alters the expression of those miRs. [score:8]
Therefore, we identified putative target genes of miR-10a-5p, miR-26a, miR-103 and miR-495 that were relevant to known dorsal and ventral hippocampus functions using target prediction software programs, Targetscan and MirDB. [score:7]
Previous studies have also shown that regulation of BDNF expression is mediated by miR-26a targeting the conserved BDNF 3′UTR sequence [61]. [score:6]
Therefore, mid/peri-pubertal disruption of miR-26a and miR-495 expression by binge EtOH exposure could result in altered BDNF expression throughout pubertal development. [score:6]
Therefore, we quantified the expression of miR-10a-5p, miR-26a, miR-103, and miR-495 in the ventral hippocampus across pubertal development in untreated rats to determine if there were region specific miR expression patterns in the hippocampus. [score:6]
Consistent with our hypothesis, decreased expression of miR-26a and miR-495 correlated with increased BDNF gene expression in the dorsal hippocampus immediately following mid/peri-pubertal binge EtOH exposure and this increase remained significantly elevated up to one-month post EtOH exposure. [score:5]
Therefore, we first quantified the normal developmental expression profile of miR-10a-5p, miR-26a, miR-103 and miR-495 in the rat hippocampus at three time points in pubertal development (early, mid/peri, and late). [score:5]
Taken together our data revealed that the expression of each miR tested (miR-10a-5p, miR-26a, miR-103 and miR-495) is dynamic across pubertal development and that the developmental profiles for each miR are distinct between the dorsal and ventral hippocampus. [score:5]
org) [40], [41], [42], we identified brain-derived neurotrophic factor (BDNF) as a target gene of miR-10a-5p, miR-26a, miR-103 and miR-495, and sirtuin 1 (SIRT1) as a target gene of miR-26a, miR-103 and miR-495. [score:5]
Overall, our data reveal novel findings about the age and brain-region specific expression of miR-10a-5p, miR-26a, miR-103, and miR-495 during pubertal development in male rats. [score:4]
Moreover, mid/peri-pubertal binge EtOH exposure altered normal pubertal development expression patterns of miR-10a-5p, miR-26a, miR-103, miR-495, Dicer, Drosha, BDNF and SIRT1 in an age- and brain region -dependent manner. [score:4]
Therefore, we first determined the normal developmental profile of mature miR-10a-5p, miR-26a, miR-103 and miR-495 expression in the dorsal hippocampus using untreated male Wistar rats. [score:4]
Importantly, both BDNF gene variants and miR-26a expression have been implicated in the vulnerability and onset of schizophrenia, alcohol abuse and mood disorders in both human patients and rodent mo dels [61], [62], [63], [64], [65], [66]. [score:3]
Our analysis of potential targets for each EtOH-sensitive miR identified a single putative binding site in the 3′UTR of BDNF for each miR-10a-5p, miR-26a, and miR-103 (Fig. 5). [score:3]
Our results demonstrated a significant main effect of EtOH treatment on the expression of miR-26a and miR-495 and there was also a significant interaction between age and treatment, demonstrating that the effects of EtOH were age dependent (Table 1). [score:3]
The histone deacetylase sirtuin 1 (SIRT1) was also predicted by computer algorithms to be a putative gene target of miR-26a, mir-103 and miR-495. [score:3]
0083166.g003 Figure 3 miR-10a-5p (A), miR-26a (B), miR-103 (C), and miR-495 (D) expression levels in untreated (solid line) and EtOH -treated (dashed line) pubertal male rats. [score:3]
For instance, BDNF was identified as a putative target gene for miR-10a-5p, miR-26a, miR-103 and miR-495. [score:3]
Genome-wide miR expression profiles revealed that the miRs investigated in this study, miR-103 and miR-26a, are among the top 15 most abundantly expressed miRs in the rodent hippocampus [59]. [score:3]
0083166.g002 Figure 2 miR-10a-5p (A), miR-26a (B), miR-103 (C), and miR-495 (D) expression levels in untreated (solid line) and EtOH -treated (dashed line) pubertal male rats. [score:3]
Mature miR-10a-5p, miR-26a, miR-103, and miR-495 expression levels in the ventral hippocampus of untreated male rats are age -dependent. [score:3]
Mature miR-10a-5p, miR-26a, and miR-495 expression levels in the dorsal hippocampus of untreated male rats are age dependent. [score:3]
By contrast, miR-26a expression did not change between early and mid/peri-puberty, but significantly decreased at late puberty (Fig. 2B, solid line). [score:3]
Repeated adolescent binge EtOH exposure differentially alters expression of miR-10a-5p, miR-26a, miR-103 and miR-495 in the ventral hippocampus. [score:3]
Rats were administered our repeated binge-pattern EtOH exposure paradigm (see methods) and dorsal hippocampal miR expression of miR-10a-5p, miR-26a, miR-103 and miR-495 was compared with untreated rats/water -treated rats immediately following binge EtOH exposure and one-month post-EtOH exposure. [score:2]
Also, in contrast to the dorsal hippocampus miR-26a significantly decreased at mid/peri-puberty, but this change did not persist and was equivalent to early pubertal levels by late puberty (Fig. 3B, solid line). [score:1]
There were no potential binding sites in the 3′UTR of SIRT1 for miR-10a-5p, but there was a single potential binding site for each of the other miRs tested (miR-26a, miR-103 and miR-495; Fig. 5). [score:1]
Similar to miR-26a, miR-495 was significantly decreased as a result of binge EtOH exposure at mid/peri-puberty. [score:1]
There was no observed statistical effect of mid/peri-pubertal EtOH treatment on miR-26a. [score:1]
[1 to 20 of 29 sentences]
5
[+] score: 68
Other miRNAs from this paper: rno-mir-148b, rno-mir-21, rno-mir-25, rno-mir-133a, rno-mir-148a
However, the expression of miR-26a in the plasma did not correlate with the expression of miR-26a in the lung and spleen. [score:5]
*: p < 0.05, **: p < 0.01, ***: p < 0.001 In order to determine whether circulating miR-21 and miR-26a change in the development of airway inflammation, we studied the level of expression of miR-21 and miR-26a in rats with antigen -induced pulmonary inflammation. [score:4]
There was also no difference in the expression of miR-26a in blood cells between any groups of the validation samples (Additional file 1: Figure S2). [score:3]
Plasma miR-21 and miR-26a levels were not significantly correlated with various leukocyte counts or miRNA expression in blood cells. [score:3]
There was no difference in the plasma level of miR-21 and miR-26a between different age groups of wheezing + LRI children, and gender did not influence on plasma level of expression of miR-21 and miR-26a (Fig.   1c). [score:3]
The positive correlation between BALF miR-21 or miR-26a expressions and BALF cell count indicated that the cell-free miR-21 or miR-26a may originate from infiltrated inflammatory cells in airways. [score:3]
While there was no change in the expression level of miR-26a in plasma, the expression level of miR-26a was higher in lungs (10.5 fold increase, p < 0.001) and spleens (2.4 fold increase, p < 0.01) in the chronic group compared with that of control group, and also compared with that of acute group (p < 0.05 for lungs, p < 0.01 for spleens). [score:3]
In addition, plasma miR-21 and miR-26a levels did not correlate with total IgE, various counts of different types of leukocyte or miRNA expression in corresponding blood cells. [score:3]
Fig. 3MiR-21 and miR-26a expression in blood of wheezing children. [score:3]
Content of circulating miR-21 and miR-26a was not correlated with the corresponding intracellular expression or various cell counts in blood. [score:3]
In a set of wheezing + LRI patients (n = 20) and age- and gender-matched LRI control children (n = 20), miR-21, miR-25, miR-26a, miR-133a and miR-148 showed potential statistical differences between the patient and control groups (p < 0.10) (Fig.   1a). [score:1]
MiR-21 and miR-26a in blood cells from 19 indifferent control, 35 LRI control and 70 wheezing + LRI children were detected using RT-qPCR. [score:1]
The results showed that plasma level of both miR-21 and miR-26a were not correlated with those blood components. [score:1]
ROC plots of plasma miR-21, miR-26a and total IgE as the potential wheezing index were obtained using MedCalc software. [score:1]
b ROC curves of plasma total IgE, plasma miR-21 and miR-26a for differentiation of childhood wheezing. [score:1]
Firstly, the increase of plasma miR-21 and miR-26a was screened out and validated in wheezing children. [score:1]
However, little is known about miR-26a in such process, and both miRNAs hardly intersected with each other during inflammation. [score:1]
In summary, this study demonstrated the increase of circulating miR-21 and miR-26a and their clinical potential in pediatric recurrent wheezing, and also found that these circulating miRNAs increased in plasma and bronchoalveolar lavage fluid from animals under inflammatory stress. [score:1]
Fig. 2Clinical implication of plasma miR-21 and miR-26a in childhood wheezing. [score:1]
a- b miR-21 (a) and miR-26a (b) in plasma, BALF, spleens and lavaged lungs of rats from control, acute and chronic AIPI rats. [score:1]
c Scattered dot plots of plasma miR-21 and miR-26a in wheezing + LRI children of different ages and genders. [score:1]
MiR-26a expression of the acute AIPI rats increased in BALF (p < 0.05) and lungs (2.8 fold increase, p < 0.01) compared with that of the control group, but remained unchanged in plasma and spleen. [score:1]
MiR-21 and miR-26a significantly increased in plasma from wheezing children. [score:1]
It is known that miR-26a and miR-21 are induced during mechanical stretch in human smooth muscle cells [14, 28]. [score:1]
Circulating miR-21 and miR-26a increase in wheezing children and AIPI rats. [score:1]
Secondly, ROC results showed that plasma miR-21 was more preferable to plasma miR-26a and plasma total IgE as biomarker, and were of potential clinical significance. [score:1]
Table S5: correlation analysis of plasma miR-21 or miR-26a and various leukocyte counts. [score:1]
Moreover, circulating miR-21 and miR-26a levels were highly positively correlated with infiltrated cell counts in bronchoalveolar lavage fluid of AIPI rats. [score:1]
e Scatter dot plots of correlation between BALF miR-21 (miR-26a) and BALF cell counts. [score:1]
Increasing miR-21 and miR-26a were found in plasma and bronchoalveolar lavage fluid of AIPI rats. [score:1]
Fig. 4MiR-21 and miR-26a level in body fluids and solid organs from rats with antigen induced pulmonary inflammation. [score:1]
Hence, in this situation, plasma miR-21 and miR-26a can be used to identify some recurrent wheezing children with high asthma risk. [score:1]
*: p < 0.05, **: p < 0.01, ***: p < 0.001 Firstly, the increase of plasma miR-21 and miR-26a was screened out and validated in wheezing children. [score:1]
Circulating miR-21 and miR-26a in BALF were strongly correlated with the infiltrated inflammatory cell numbers. [score:1]
In the present study, we showed that plasma miR-21 and miR-26a are strongly implicated in childhood wheezing and airway inflammation. [score:1]
In addition, BALF miR-21 (r = 0.468, p < 0.01) and miR-26a (r = 0.524, p < 0.01) were both highly positively correlated with BALF cell counts (Fig.   4e-f). [score:1]
Area under curve (AUC) reflects preferable index for variable separation, and our data showed that plasma miR-21 (AUC of 0.802, p < 0.001) was more preferably than plasma miR-26a (AUC = 0.769, p < 0.001), and plasma total IgE (AUC = 0.688, p < 0.01) (Fig.   2b). [score:1]
Both the miR-21 and miR-26a levels sharply decreased in chronic AIPI rat BALF. [score:1]
Plasma miR-21 was more preferable to miR-26a and total IgE for diagnosis. [score:1]
Fig. 1Differential levels of miR-21 and miR-26a in plasma from wheezing children. [score:1]
b RT-qPCR results of miR-21, miR-25, miR-26a, miR-133a and miR-148 in plasma from 35 indifferent control, 35 LRI control and 70 wheezing + LRI children. [score:1]
These findings on intracellular miR-21 and miR-26a combined with our findings on extracellular ones might provide more clues on their potential as indicators for lung inflammation. [score:1]
AUC values for the combination of plasma total IgE and plasma miR-21, as well as the combination of plasma total IgE, plasma miR-21 and miR-26a were 0.814 and 0.830 respectively. [score:1]
The increase of plasma miR-21 and miR-26a was screened out from 11 candidate miRNAs and validated in wheezing children. [score:1]
Correlation analyses were performed between plasma miR-21 (miR-26a) and 14 various indexes for blood components including total leukocytes and platelet numbers, absolute and relative cell counts of monocytes, neutrophils, basophils, lymphocytes, eosinophils and miR-21/miR-26a (Additional file 1: Table S5). [score:1]
[1 to 20 of 45 sentences]
6
[+] score: 49
Up-regulation of miR-26a promotes apoptosis in rat neonatal cardiomyocytes via the caspase-3 pathway [42] while down-regulation of miR-26a antagonizes apoptosis by targeting MTDH and EZH2 in breast cancer [43]. [score:9]
The down-regulated miRNAs included miR-24, miR-26a, miR-126, and Let-7a, b, c, f. The up-regulated miRNAs were composed of miR-344, miR-346, miR-99a, miR-127, miR-128b, miR-135b, and miR-30a/b. [score:7]
Interestingly, the down-regulated miRNAs, miR-26a and Let-7abcf family in our were inversely related to the expression of Apc and Sod2 which were involved in regulation of apoptosis. [score:7]
miR-99a and miR-30b were confirmed to be the up-regulated miRNAs in ARDS, while miR-126 and miR-26a were confirmed to be down-regulated miRNAs in ARDS (Figure  2). [score:7]
Moreover, we found that the down-regulated miRNAs, miR-26a, miR-24, and miR-Let-7abcf family, were inversely related to their predicted mRNA targets, Sod2, and Ebf1. [score:6]
The down-regulated miRNAs included miR-24, miR-26a, miR-126, and Let-7 family members. [score:4]
miR-26a, miR-346, miR-135b, miR-30a/b, miR-344, and miR-18a targeted multiple altered mRNAs. [score:3]
Interestingly, miR-26a was inversely correlated with the expression of Apc. [score:3]
For example, miR-26a-APC pair was experimentally validated [39]. [score:1]
Apc and Sod2 were inversely correlated with miR-26a. [score:1]
While Sod2 was inversely correlated with Let-7a, b, c, f., Ebf1 and Apc were inversely correlated with miR-24 and miR-26a, respectively. [score:1]
[1 to 20 of 11 sentences]
7
[+] score: 33
Interestingly, miR-22, miR-1224 and miR-125-3p were initially up-regulated under EGF and bFGF treatment, but reversed their quantitative expression in the presence of IGF-1. In addition, miR-214 and miR-708 were expressed inconsistently in Group A while their expression went down in Group B. To validate the microRNA microarray expression data, a qRT-PCR assay was conducted to confirm the expression levels of three randomly selected microRNAs (let 7-b, miR-181a, and miR26a). [score:13]
The expression of let-7b was down-regulated on both Day 3 (Figure 3C) and Day 5 (Figure 3D) after induction whereas miR-181a and miR-26a remained up-regulated. [score:9]
Of these, let-7b was from the down-regulated list, and miR-26a and miR-181a were from the up-regulated list. [score:7]
The qRT-PCR analysis confirmed that let-7b, miR-181a, and miR-26a were significantly up-regulated on Day 1 after differentiation (Figure 3B). [score:4]
[1 to 20 of 4 sentences]
8
[+] score: 31
b The short peptide, ERAP, and the natural product derived from medical plants, xanthohumol, could disrupt the PHB2/BIG3 interaction directly and lead to the translocation of PHB2 from cytoplasm to nucleus, thereby, induce cell growth arrest in some estrogen -dependent cancers a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:8]
Fig. 4 a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:7]
In glioma cells, PHB1 expression is down regulated by miR-26a, which interferes with the regulation of PHB1 on expression levels of HIF-1 and VEGF, as well as tumor growth 65, 66. [score:7]
Interestingly, miR-26a also binds directly to the 3′-UTR of PHB1, inhibiting its expression in glioma cells [66]. [score:6]
Qian X MicroRNA-26a promotes tumor growth and angiogenesis in glioma by directly targeting prohibitinCNS Neurosci. [score:3]
[1 to 20 of 5 sentences]
9
[+] score: 21
The NTR sample expressed ALP ~3 nmol/ µg/min after 7 days of induction in osteogenic medium, which was significantly increased to ~8 nmol/ µg/min following miR-26a transfection (Fig. 2B). [score:3]
As expected, all the genes measured in the present study were markedly upregulated following transfection of miR-26a (Fig. 2A). [score:2]
Taken together, the results suggest that miR-26a can be applied to enhance the osteogenic capacity of ASCs. [score:1]
The combination of miR-26a-enhanced ASCs and an HA scaffold can significantly improve new bone formation, and thus may be used as a bone substitute for repairing bone defects. [score:1]
In conclusion, the present study demonstrated that miR-26a can markedly increase the osteogenic differentiation ability of ASCs without apparent cytotoxicity in vitro. [score:1]
RT-qPCR andIn order to analyze the promotion of osteogenic differentiation following transfection of miR-26a, RT-qPCR was performed to measure the expression of osteogenic -associated genes. [score:1]
In order to analyze the promotion of osteogenic differentiation following transfection of miR-26a, RT-qPCR was performed to measure the expression of osteogenic -associated genes. [score:1]
In accordance with the RT-qPCR results, ALP production and collagen secretion was abundantly detected in the miR-26a transfection group (Fig. 3). [score:1]
Cy5-labeled miR-26a was able to collocate with cells, which confirmed successful transfection (Fig. 1A). [score:1]
In the present study, it was hypothesized that miR-26a may also modify the function of ASCs incorporated with an HA scaffold to promote new bone generation. [score:1]
Briefly, Lipofectamine 2000, the miR-26a mimic (sense, 5′-UUCAAGUAAUCCAGGAUAGGCU-3′ and antisense, 5′-CCUAUCCUGGAUUACUUGAAUU-3′, denoted as Lipo/miR-26a), the negative control (sense, 5′-UUCUCCGAACGUGUCACGUTT-3′ and antisense, 5′-ACGUGACACGUUCGGAGAATT-3′, denoted as Lipo/NC) or equal volume of RNase-free water (denoted as Lipo) were diluted in Opti-MEM I (Gibco-BRL, Carlsbad, CA, USA) and mixed together. [score:1]
More specifically, miR-26a has been demonstrated to simultaneously promote osteogenesis and angiogenesis in BMSCs (16). [score:1]
The cells spread well with abundant pseudopodia and protuberances in all groups and no particular morphological alterations were observed following miR-26a transfection (Fig. 1B). [score:1]
The miR-26a -modified ASCs were analyzed in vitro and the cell loaded HA scaffold was implanted into tibias with a critical sized defect in order to observe its ability to repair bone tissue. [score:1]
The scaffold pores were filled with abundant ECM, particularly in the Lipo/miR-26a group in which the surface was covered with large collagen fibers and the pores were not visible (Fig. 4). [score:1]
To observe the transfection process, Cy5-labeled miR-26a was used and the cell membrane was stained with 3,3′-dioctadecyloxacarbocyanine perchlorate (Beyotime Institute of Biotechnology, Haimen, China) at the end of transfection. [score:1]
The results demonstrated that the transfection of miR-26a markedly increased the osteogenic differentiation of ASCs in vitro without apparent effects on morphology or viability. [score:1]
In the present study, miR-26a, a novel osteogenic-angiogenic promoting molecule, was transfected into ASCs. [score:1]
[1 to 20 of 18 sentences]
10
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The expression analysis of selected miRNAs using qRT-PCR also showed that miR-26a and -99a were highly expressed in all tissues, while miR-122 and miR-133a were predominantly expressed in liver and muscle, respectively. [score:7]
The expression profiles of the 11 miRNAs across 11 tissues confirmed that miR-26a and -99a expressed at high levels in all tissues, while miR-122 and -133a exclusively expressed in liver and muscle, respectively. [score:7]
The higher expression level of three conserved miRNAs (miR-26a, -99a and -150) in all tested bovine tissues suggest that these miRNA may be more relevant to the highly conserved biological process in mammalians. [score:3]
To validate above miRNA expression patterns, quantitative RT-PCR was performed on tissue-specific miRNAs (miR-122, -133a), high cloning frequency miRNAs (miR-26a, -99a and -150) and low cloning frequency miRNAs (miR-103, -107, -411, -423-5p, -574-3p and -652). [score:3]
[1 to 20 of 4 sentences]
11
[+] score: 19
Other miRNAs from this paper: rno-mir-26b, rno-mir-146a
Finally, we screened two miRNAs: miR-26 highly expressed in the CNS (Smirnova et al., 2005), and miR-146a, an important regulator of innate immune responses in microglia (Rom et al., 2010; Saba et al., 2012; Ponomarev et al., 2013). [score:4]
Although they did not reach statistical significance, we found that compared to expression levels in microglia, miR-26 tended to be 2–3-fold more highly expressed in neurons (P = 0.051) and astrocytes (P = 0.080). [score:4]
miR-26 expression levels were comparable in astrocytes and neurons (P = 0.696). [score:3]
Because miR-26 is reported to be preferentially expressed in astrocytes (Smirnova et al., 2005), we were surprised to find it equally detectable in astrocytes and neurons. [score:3]
However, the astrocyte-specific expression of miR-26 was determined in differentiated murine stem cells in vitro (Smirnova et al., 2005). [score:3]
1 TGC TCG CGA CCT CAA TGT A GGT AGA AGC AGA GCG GAC TT JMJD8 Jmjd8 NM_001014116.1 TGG ACG ATT CGG TCT GCT TT ACT CTG TTT CCA TCC CCC TTC Mina53 Mina53 NM_153309.2 ATG CCA AAG AAA GTG AAG CCC GTA GCT CCT CTT TCA CCT GCT PHF2 Phf2 NM_001107342.1 TCA GAC ACC AGA ATG TCC AGC TCG GGC CAG TAG TTT TCC AC PHF8 Phf8 NM_001108253.1 TTT GGG ACC GTG GAC GTT T GTC AGA AAG GCA GCA ACA AGC UTX Kdm6a NM_009483.1 CCA CCC TGC CTA GCA ATT CA CCA CCT GAG GTA GCA GTG TG UTX Uty NM_009484 ATT ATC TCT CAC TAC TGC TGC CC CGA AGA AGC TGC TGT CTA ATC CAC snoRNA135/Snord65 NR_028541.1 AGT ACT TTT TGA ACC CTT TTC CA snoRNA234/Snord70 NR_028554.1 TTA ACA AAA ATT CGT CAC TAC CA mir-26 NR_029742.1 GGT TCA AGT AAT CCA GGA TAG GCT mir-146a NR_031892.1 TGA GAA CTG AAT TCC ATG GGT T were performed on delta C [T] values using Sigma Plot 11.0 software. [score:1]
1 TGC TCG CGA CCT CAA TGT A GGT AGA AGC AGA GCG GAC TT JMJD8 Jmjd8 NM_001014116.1 TGG ACG ATT CGG TCT GCT TT ACT CTG TTT CCA TCC CCC TTC Mina53 Mina53 NM_153309.2 ATG CCA AAG AAA GTG AAG CCC GTA GCT CCT CTT TCA CCT GCT PHF2 Phf2 NM_001107342.1 TCA GAC ACC AGA ATG TCC AGC TCG GGC CAG TAG TTT TCC AC PHF8 Phf8 NM_001108253.1 TTT GGG ACC GTG GAC GTT T GTC AGA AAG GCA GCA ACA AGC UTX Kdm6a NM_009483.1 CCA CCC TGC CTA GCA ATT CA CCA CCT GAG GTA GCA GTG TG UTX Uty NM_009484 ATT ATC TCT CAC TAC TGC TGC CC CGA AGA AGC TGC TGT CTA ATC CAC snoRNA135/Snord65 NR_028541.1 AGT ACT TTT TGA ACC CTT TTC CA snoRNA234/Snord70 NR_028554.1 TTA ACA AAA ATT CGT CAC TAC CA mir-26 NR_029742.1 GGT TCA AGT AAT CCA GGA TAG GCT mir-146a NR_031892.1 TGA GAA CTG AAT TCC ATG GGT T Statistical analyses were performed on delta C [T] values using Sigma Plot 11.0 software. [score:1]
[1 to 20 of 7 sentences]
12
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
A study identifying miRNAs expressed in myometrial and leiomyoma smooth muscle cells (MSMC and LSMC) using microarray and real time PCR reported that E [2] inhibited the expression of miR-21 in MSMC and LSMC, whereas E [2] increased and inhibited miR-26a in MSMC and LSMC, respectively [210]. [score:9]
In contrast, ICI 182,780 increased the expression of miR-20a and miR-21 in MSMC and LSMC, and miR-26a in MSMC, while inhibiting the expression of miR-26a in LSMC [210]. [score:7]
[1 to 20 of 2 sentences]
13
[+] score: 14
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
[1 to 20 of 2 sentences]
14
[+] score: 9
rno-miR-novel-8, rno-homolog-miR-26, and rno-homolog-miR-199 miRNAs were selected from Tier 1, and rno-miR-sno-57 miRNA was selected from Tier 2. In addition, we analysed the expression of miR-741-3p and miR-743a-3p and found that, in accordance with sequencing data, they were highly expressed in rat PSCs. [score:5]
rno-homolog-miR-26 and rno-homolog-miR-199 miRNAs were expressed in EFs, ESCs and iPSCs, which is consistent with the data obtained from sequencing. [score:3]
Four novel miRNAs with the following coordinates: chrX:−:151288045–151288101 (rno-miR-novel-8); chr7:+:70463555–70463594 (rno-homolog-miR-26); chr3:+:16697111–16697143 (rno-homolog-miR-199); and chr18:−:69422790–69422857 (rno-miR-sno-57) were selected for the validation. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 8
Furthermore, both and BCCAO reduced miR-26 expression but increased IL-6 expression. [score:5]
The miR-26 expression was significantly increased at 3 or 7 days after the LV-26b injection (Figure 7B). [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 7
The results showed that 14 miRNAs (miR-30a-5p, miR-30e-5p, miR-425-5p, miR-142-3p, miR-191a-3p, miR-215, miR-29b-3p, miR-30b-5p, miR-26a-5p, miR-345-5p, miR-361-5p, miR-185-5p, miR-103-3p) were down-regulated but no miRNA was up-regulated among above three altered miRNAs from microarray in OVX serum by normalizing to miR-25-3p (Fig. 3b). [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 7
Since the expression of LOXL2 is also influenced by hypoxia,, and microRNAs (miR-26 and mIR-29), there are also other potential strategies for targeting LOXL2 expression or activity (Wong et al., 2014). [score:7]
[1 to 20 of 1 sentences]
19
[+] score: 7
By comparing the venous plasma microRNA expression profiles from patients with Takotsubo cardiomyopathy or acute myocardial infarction, miR-16 and miR-26a were found to be highly expressed in Takotsubo cardiomyopathy patients, while miR-1 and miR-133a were highly expressed in acute myocardial infarction patients. [score:7]
[1 to 20 of 1 sentences]
20
[+] score: 7
In addition, 6 miRNA downregulated in our analyses (miR-26a, 29a/b/c, 222, and 383, Additional file 4: Table S1) are predicted to bind 3′UTR of Dnmt3B, with miR-222, miR-383 and miR-29b have demonstrated to directly affect Dnmt3B expression [49, 50]. [score:7]
[1 to 20 of 1 sentences]
21
[+] score: 6
Although different technological platforms have been used for miRNA profiling, there is significant overlap between prognostic signatures described in previous work and several miRNAs that were later identified by more than three independent studies as being downregulated in essential hypertension or associated with vascular remo deling (e. g., miR-221, miR-26a, miR-21, miR-296-5p, and miR-204) [21– 24]. [score:4]
Others have been linked to the regulation of vascular smooth muscle cells; these include miR-145, let-7d, miR-24, miR-26a, and miR-146 [13]. [score:2]
[1 to 20 of 2 sentences]
22
[+] score: 5
As an endogenous control, miR-26a-5p (hsa477995_mir) was used since this miRNA was abundantly expressed in the rat renal cortex and the expression levels were not affected with Cd treatment. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 5
Whereas it is wi dely documented that redox signaling can compromise ion channel functioning and calcium homeostasis in cardiomyocytes [67], in our system we observed no influence of H [2]O [2] administration on the regulatory impact of Pitx2 in distinct ion channels such as Scn5a, Kcnj2 and Cacna1c as well as multiple Pitx2-regulated microRNAs such as miR-1, miR-26, miR-29 and miR-200, in which redox impairment impact is less documented [68]. [score:3]
Several lines of evidence have already reported the key regulatory role of miR-1 [60– 62], miR-26 [63], miR-106b [64], miR-133 [65– 66] and miR-200 [64] in arrhythmogenesis. [score:2]
[1 to 20 of 2 sentences]
24
[+] score: 5
Gentilin et al. found that miR-26a could directly target PRKCD and is involved in cell cycle regulation in ACTH-secreting pituitary adenomas [25]. [score:5]
[1 to 20 of 1 sentences]
25
[+] score: 5
In the PH-group, 49 miRNAs were significantly deregulated (e. g., rno-miR-26a/b, rno-miR-125b-5p and various members of the let-7 family), showing an expression change to at least ≤ 0.8 or ≥ 1.2 compared to normal healthy liver [6], while 45 miRNAs showed significant expression changes in liver samples of animals undergoing SL (Table 1). [score:5]
[1 to 20 of 1 sentences]
26
[+] score: 5
miR-26a desensitizes non-small cell lung cancer cells to tyrosine kinase inhibitors by targeting PTPN13. [score:5]
[1 to 20 of 1 sentences]
27
[+] score: 5
Studies also showed that miR-21 [26], miR-26 [27], miR-328 [28], miR-133 and miR-590 [29] participated in the process of AF by controlling the expression of their specific gene targets. [score:5]
[1 to 20 of 1 sentences]
28
[+] score: 4
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-26a-2
Jiang JJ MicroRNA-26a supports mammalian axon regeneration in vivo by suppressing GSK3beta expressionCell Death Dis. [score:4]
[1 to 20 of 1 sentences]
29
[+] score: 4
Figure  2 shows that whilst the expression of miR26a, miR200b, miR214, miR218, and let-7d was not altered in arteries from SHRs compared with NT, a significant increase of miR153 was recorded in SHR MA (8.65, N = 6, P < 0.0001), RA (2.08, N = 6, P < 0.0001), and TA (2.80, N = 6, P < 0.0001). [score:2]
In silico analysis of the 3′ UTR of KCNQ4 revealed seed sequences for miR26a, miR133a, miR200b, miR153, miR214, miR218, and let-7d with quantitative polymerase chain reaction showing miR153 increased in those arteries from SHRs that exhibited decreased Kv7.4 levels. [score:1]
This analysis revealed putative seed sequences in KCNQ4 for miR26a, miR214, miR133a, miR200b, miR153, miR218, and let-7d. [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 4
Other miRNAs from this paper: rno-mir-26b, rno-mir-30a
Brain derived neurotrophic factor (BDNF) expression is regulated by microRNAs miR-26a and miR-26b allele-specific binding. [score:4]
[1 to 20 of 1 sentences]
31
[+] score: 4
Reports have shown that miR-208 and miR-140 affect their host genes 25, 26; however, miR-26 suppresses its host gene to regulate neurogenesis [27]. [score:4]
[1 to 20 of 1 sentences]
32
[+] score: 4
Other miRNAs from this paper: rno-mir-96
Potenza N. Mosca N. Mondola P. Damiano S. Russo A. de Felice B. Human miR-26a-5p regulates the glutamate transporter SLC1A1 (EAAT3) expression. [score:4]
[1 to 20 of 1 sentences]
33
[+] score: 4
MiR-26 was downregulated in hepatocarcinoma (55) and colorectal carcinoma (56), and its loss was significantly linked to the metastatic phenotype. [score:3]
Several recent reports have highlighted the post-transcriptional repression of HMGA proteins by non-coding RNAs and, in particular, numerous miRNAs with this activity have been identified (let-7a, miR-15, miR-16, miR-26a, miR-34b, miR-196a2, miR-326, miR-432, miR-548c-3p, miR-570, miR-603) (53, 54). [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 4
We recently reported that reciprocal inhibition between miR-26a and NF-κB downstream of saturated non-esterified fatty acid (NEFA) signal regulated obesity-related chronic inflammation in chondrocytes [17]. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 4
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-214, hsa-mir-26a-2, rno-mir-214
In particular, microRNAs miR-26a and miR-214 repress EZH2 posttranscriptionally during skeletal muscle cell and ESC differentiation and establish a regulatory loop controlling EZH2 -dependent gene expression during differentiation (Juan et al, 2009; Wong & Tellam, 2008). [score:4]
[1 to 20 of 1 sentences]
36
[+] score: 3
For example, miR-195, miR-497, and miR-30b were found to be enriched in the cerebellum whereas miR-218, miR-221, miR-222, miR-26a, miR-128a/b, miR-138 and let-7c were highly expressed in the HIP. [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
Additional miRNAs involved in the regulation of the AhR include has-mir-26a-5p, hsa-mir-130b-3p, has-mir-124-3p, has-miR-625-5p and has-miR-98-5p with proven experimental evidence for their participation in the regulation of genes coding for lipid transport most notable CD36, fatty acid binding proteins FABP1, FAB6, FAB7, low density lipoprotein receptor, RXRß and others based on miRTarBase data analysis and PubMed searches. [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
Three of these miRNAs, rno-let-7c, rno-mir-23a, and rno-mir-26a, were among the abundantly expressed miRNAs in ZO cardiac tissue. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
Included among the 46 miRNAs with increased expression were 7 (miR-21, miR-16, miR-26a, miR-26b, miR-23a, miR-23b, miR-126) included in surveys of the most abundant miRNAs in human platelets [23, 24] and the miR-126 gene products miR-126-3p and miR-126-5p that are also enriched in vascular endothelial cells and endothelial microparticles [25]. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
Individually, miR-22 has been implicated in the phenylephrine- or angiotensin II -induced hypertrophic reduction in phosphatase and tensin homolog (PTEN) [24]; miR-26a and 30d in calcium dependent cardiac dysfunction [73], and miR-27b in heart development and hypertrophy [74], [75]. [score:2]
In the 3 rat studies 5 common miRNAs were highly detected; rno-miR-26a, 30a, 30c, 30d & 30e. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 3
2) Some miRNAs, including let-7 family (let-a, -b and -c), miR-16, miR-23b, miR-26, miR-31 and miR-375, were always highly expressed either before or after transdifferentiation (data not shown). [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Similarly, transient gain- and loss-function of miR-26a in cardiomyocytes also confirmed that cardiomyocyte hypertrophy was modulated by miR-26a expression [34]. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Some of the deregulated miRNAs (miR-181, miR-26, miR-1, mir-29, miR-214, miR-126, and miR-499) are reported to be related to hypoxia, cell development, and cell growth [1, 5, 7, 25]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 2
Other miRNAs from this paper: rno-mir-10a, rno-mir-10b, rno-mir-26b, rno-mir-146a, rno-mir-146b
Moreover, the endocannabinoid system has come under scrutiny given that several microRNAs such as miR26, miR146, and miR10 are responsible for its gene regulation [28, 29]. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 1
To facilitate the analysis of the array data, identical miRNAs of different species (e. g. bta-miR-126 and hsa-miR-126) were grouped together with miRNAs with the same precursor or closely related mature sequences (e. g. mdo-miR-26, hsa-miR-26a), as long as the seed sequences were still conserved. [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
On the other hand, a few miRs have been found to promote apoptosis of myocardiocytes, such as miR-26 [29], miR-34 [30], and miR-92 [31]. [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
We designed and cloned into the pcPURhU6 vector the hairpin-type RNAs with si-6 sequence (pcPURhU6 si-6) with the 19-21 base pair (bp) stems and with various loops: (1) pcPURhU6 si-6 (21 bp)-miR26, (2) si-6 (19 bp) with 9-nt UUCAAGAGA loop [28], (3) si-6 (21 bp) with 9-nt UUCAAGAGA loop, (4) si-6 (21 bp) with 10-nt CUUCCUGUCA (loop from miRNA23), and (5) si-6 (21 bp) with 19-nt UAGUGAAGCCACAGAUGUA (loop from miRNA30) (see Figure 3). [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
We began by measuring the levels of several miRNAs reportedly associated with cardiovascular diseases, including mir-129, mir-106, mir-26a, mir-20, mir-197, mir-17, mir-27 and mir-30d, 24, 25, 26, 27, 28, 29 in cardiomyocytes under both normal and high-glucose conditions. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
A number of other miRNA species that might affect collagen type-I and -IV synthesis, such as miR-106a/b, miR-20a/b, miR-26a/b, miR-374a/b, miR-186 were also identified by in silico analyses (summarized in Table 1). [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
Li et al also reported local delivery of miR-26a into the defected bone of nude mice could promote bone regeneration [8]. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
MiR-26 and miR-328 control vulnerability of atrial fibrillation [15]. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
[8] These miRNAs include miR-26a, miR-203, miR-22, miR-375, and other. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
We have also noticed that miRNAs previously detected in neurites such as miR-134, miR-25 and miR-26a showed changes at 24 h after contextual conditioning [17], [19]. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
These include rno-miR-195, rno-miR-125a-5p, rno-let-7a, rno-miR-16, rno-miR-30b-5p, rno-let-7c, rno-let-7b, rno-miR-125b-5p, rno-miR-221, rno-miR-222, rno-miR-26a, rno-miR-322, rno-miR-23a, rno-miR-191, rno-miR-30 family, rno-miR-21, rno-miR-126, rno-miR-23b, rno-miR-145 and rno-miR-494. [score:1]
[1 to 20 of 1 sentences]