sort by

49 publications mentioning rno-mir-34b

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-34b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 204
To re-confirm this upregulation of miR-34b-5p discovered in the array data, we performed quantitative stem-loop polymerase chain reaction (qRT–PCR) in the hippocampus tissue samples collected at different time points and successfully validated the significant upregulation of miR-34b-5p in hippocampus tissues from rats treated with flurothyl (Fig.   1e, P < 0.0001). [score:7]
Interestingly, the Bcl-2 mRNA level remains stable in response to treatment with miR-34b-5p mimics or inhibitors, but the effects of miR-34b-5p on suppressing Bcl-2 mRNA translation efficiency have been proved by luciferase activity experiments and western blots (Figs.   3d, f, 4a, b). [score:7]
from the in vitro experiments further demonstrated that miR-34b-5p directly targeted Bcl-2 mRNA, translationally repressed Bcl-2 protein, and thus modulated cell apoptosis by influencing Bcl-2, Bax, and Caspase-3. Our findings prove microRNAs play a role in mediating recurrent convulsions -induced astrocyte death and further indicate that miR-34b-5p could acts as a regulator for astrocyte apoptosis induced by recurrent seizures. [score:7]
f Quantitative PCR result: miR-34b-5p upregulated after 100 μM kainic acid treatment (n = 5, t [8] = 9.775, *** P < 0.0001) Fig.  3miR-34b-5p promotes KA -induced astrocytes apoptosis by targeting Bcl-2. a Representative images of three repeated staining experiments on cultured astrocytes. [score:6]
Conversely, miR-34b-5p inhibitor treatment alone inhibited cell death by reducing pro-caspase cleavage. [score:5]
The astrocytes are pre -treated with of miR-34b-5p mimics, inhibitors, mimics negative control (mNC), and inhibitors negative control (i NC), followed by KA treatment; scale bar 50 μm. [score:5]
a, b analysis for Bcl-2, Bax, pro-caspase-3, and cleaved caspase-3. Cell lysates were prepared from astrocytes treated with vehicle control, mimics negative control (m NC) or inhibitors negative control (i NC), miR-34b-5p mimics or inhibitors. [score:5]
Cell lysates were prepared after astrocytes were treated with control siRNA, Bcl-2 siRNA, miR-34b-5p inhibitors and Bcl-2 siRNA together, and miR-34b-5p inhibitors alone. [score:5]
Our findings demonstrate a crucial role for miR-34b-5p in seizure -induced brain damage and the possibility that miR-34b-5p could serve as a novel therapeutic target for treating various neurological diseases. [score:5]
These results indicated that Bcl-2 3′-UTR could be targeted by miR-34b-5p mimics which affected the stability or the translation efficiency of Bcl-2 mRNA. [score:5]
cn/), we screened potential targets for miR-34b-5p based on sequence targeting analysis. [score:5]
Given that preventing neuronal death in early disease stages would greatly improve therapeutic outcomes, therapies targeting miR-34b-5p may be beneficial [40]. [score:5]
Thus, we think that the Bcl-2 protein suppression caused by miR-34b-5p is not achieved through affecting mRNA stability of Bcl-2 but that it could be achieved through translational repression mechanisms. [score:5]
Interestingly, our results revealed that miR-34b-5p regulated Bcl-2 protein without interfering with its mRNA stability in a certain time window, indicating that miR-34b-5p represses translation of Bcl-2 mRNA before moving it towards RISC -dependent degradation. [score:4]
Our array data showed that the miR-34b-5p level was upregulated seven fold in the hippocampus tissues of rats treated with flurothyl. [score:4]
In this paper, we discovered that one subtype of miR-34bmiR-34b-5p—mediated astrocyte apoptosis caused by recurrent flurothyl -induced seizures in the way in which they directly targeted Bcl-2. The rat mo del of recurrent convulsions was established by exposing rats to flurothyl. [score:4]
MiR-34b, miR-34c, which locate in the same transcriptional unit as miR-34b, were moderately upregulated. [score:4]
Sano et al. [23] also demonstrated the upregulation of micro-34a during seizure -induced neuronal death, further indicating the involvement of miR-34 family in seizure pathology. [score:4]
Given the fact that the upregulation of miR-34b-5p was observed and the previous study showing an association between astrocyte apoptosis and convulsions, we hypothesised that miR-34b-5p functionally contributed to astrocyte apoptosis in recurrent convulsions [27]. [score:4]
More surprisingly, this upregulation occurred concurrently with accumulating astrocyte apoptosis, indicating the involvement of miR-34b-5p in seizures caused astrocyte apoptosis. [score:4]
We found that miR-34b-5p was upregulated in astrocytes treated with kainic acid and discovered that the pro-apoptotic function of miR-34b-5p was Bcl-2 dependent. [score:4]
In this paper, we utilised a flurothyl -induced recurrent convulsions mo del, explored whether microRNAs control astrocyte death, and discovered miR-34b-5p connected to astrocyte apoptosis by affecting Bcl-2 mRNA translation. [score:3]
More importantly, in accord with our results from the in vivo rat mo del, we detected increased miR-34b-5p expression in KA treated astrocytes (t [8] = 9.775, P < 0.0001; Fig.   2f). [score:3]
With the aim of validating whether Bcl-2 was targeted by miR-34b-5p, we transfected astrocytes with luciferase reporter constructs containing either wild type Bcl-2 3′-UTR or mutant Bcl-2 3′UTR. [score:3]
CNS central nervous system HCC hepatocellular carcinoma KA kainic acid qPCR quantitative real time PCR SE status epilepsy in situ terminal deoxynucleotidyltransferase mediated dUTP nick end labeling of fragmented DNA miR-34b-5p m NC miR-34b-5p mimics negative control miR-34b-5p i NC miR-34b-5p inhibitors negative control LQL, LJL and DAM conceived and designed the project. [score:3]
We also applied an in vitro mo del in which primary astrocytes were exposed to kainic acid to verify the targets of miR-34b-5p identified in the animal mo del. [score:3]
MiR-34b-5p mimics (100 nM, Ribobio, Guangzhou, China); miR-34b-5p inhibitors (100 nM, Ribobio, Guangzhou, China); Bcl-2 siRNA (50 nM) (Qiagen, Hilden, Germany); and controls including miR-34b-5p m NC, miR-34b-5p i NC, and control siRNA were transfected into primary astrocytes when they reached 60–70 % confluence. [score:3]
in rats treated with flurothyl and the induction of miR-34b-5pGiven the existence of neuron apoptosis in several CNS diseases and the accumulated evidence showing that microRNAs mediate cell apoptosis in the CNS, we decided to explore microRNA transcriptome using an array -based microRNA profiling technique [30, 31]. [score:3]
f Quantitative analysis for results in E (one-way ANOVA, pro-caspase-3 group, n = 5, F [3,16] = 211.6, *** P < 0.0001; Caspase-3-19KD group, n = 5, F [3,16] = 98.36, *** P < 0.0001; Caspase-3-17 KD group, F [3,16] = 158.7, *** P < 0.0001; *** on top of bars, comparing with control within same group; *** on top of lines, comparing between the individual bars the line covers, ** P < 0.01, *** P < 0.0001) Finally, to confirm that the pro-apoptotic function of miR-34b-5p depends on Bcl-2, we performed co-transfection of Bcl-2 siRNA and miR-34b-5p inhibitors in primary astrocytes. [score:3]
In contrast, pre-treating primary hippocampal astrocytes to miR-34b-5p inhibitors before KA treatment caused significant reduction in miR-34b-5p levels, and the percentage of apoptotic cells was greatly lowered, to less than 5 % (difference among groups: F [4,20] = 67.45, P < 0.0001, Fig.   3a, c). [score:3]
Conversely, miR-34b-5p inhibitors caused accumulation of Bcl-2 and pro-caspase-3 in astrocytes but reduction of Bax and cleaved caspase-3 (Fig.   4b). [score:3]
Transfection of miR-34b-5p mimics and inhibitors affected miR-34b-5p level correspondently (Additional file 2: Fig.  2B, Fig.   3b). [score:3]
MiR-34b-5p mimics and inhibitors as well as miR-34b-5p i NC and miR-34b-5p m NC were designed by Ribobio, Guangzhou, China. [score:3]
Then, to validate whether miR-34b-5p mediates apoptotic signaling by modulating Bcl-2, we evaluated the protein levels of Bcl-2, Bax, pro-caspase-3, and cleaved caspase-3 in primary astrocytes treated with miR-34b-5p mimics, miR-34b-5p inhibitors, and the respective control mimics or inhibitors. [score:3]
Among the hits we identified, Bcl-2 was a potential target for miR-34b-5p (Fig.   3e). [score:3]
Among these candidates, miR-34b-5p attracted our attention because of previous studies about the miR-34 family in CNS diseases. [score:3]
This expression patent of miR-34b-5p delineates its involvement in modulating neuronal damage in the early stage of convulsion-caused damage. [score:3]
f Quantitative analysis for results in E (one-way ANOVA, pro-caspase-3 group, n = 5, F [3,16] = 211.6, *** P < 0.0001; Caspase-3-19KD group, n = 5, F [3,16] = 98.36, *** P < 0.0001; Caspase-3-17 KD group, F [3,16] = 158.7, *** P < 0.0001; *** on top of bars, comparing with control within same group; *** on top of lines, comparing between the individual bars the line covers, ** P < 0.01, *** P < 0.0001)Finally, to confirm that the pro-apoptotic function of miR-34b-5p depends on Bcl-2, we performed co-transfection of Bcl-2 siRNA and miR-34b-5p inhibitors in primary astrocytes. [score:3]
To further confirm the correlation between miR-34b-5p level and KA -induced astrocyte apoptosis, we manipulated miR-34b-5p levels by treating primary astrocytes either with miR-34b-5p mimics or with miR-34b-5p inhibitors, followed by KA treatment. [score:3]
Astrocytes treated with vehicle and miR-34b-5p mimic controls or inhibitor controls have the same levels of Bcl-2, Bax, pro-caspase-3, and cleaved caspased-3. However, miR-34b-5p mimic treatment reduced the endogenous level of Bcl-2 but increased the Bax level (Fig.   4a). [score:3]
Fig.  1Cell apoptosis and miR-34b-5p expression induced in rat hippocampus after flurothyl treatments. [score:3]
These data suggested that miR-34b-5p affected Bcl-2 and Bax protein levels and presented a pro-apoptotic function by modulating Bax/Bcl2 ratio expression (difference among five treatment groups, F [4,20] = 123.8, P < 0.0001; Fig.   4c). [score:3]
By day 3 and day 7, the expression level of miR-34b-5p gradually decreased to normal. [score:3]
But the function and regulation of miR-34b and miR-34c remain poorly understood, especially regarding their roles in the CNS. [score:2]
However, astrocytes with miR-34b-5p treatment in the context of Bcl-2 siRNA silencing increased active caspase-3 level compared with the group treated with miR-34b-5p inhibitors alone, proving that miR-34b-5p induced cell apoptosis was Bcl-2 dependent (Fig.   4d–f). [score:2]
MiR-34b-5p mediates cell apoptosis by targeting Bcl-2. Discussion. [score:2]
e Graphic picture shows miR-34b-5p sequence match with rat Bcl-2 mRNA 3′-UTR. [score:1]
We discovered that miR-34b-5p is induced by recurrent seizures in a rodent mo del of recurrent convulsions and illustrated how miR-34b-5p mediates Bcl-2 dependent caspase-3 activation and cell apoptosis. [score:1]
Luciferase activity is indicated by the ratio of firefly luciferase activity to Renilla luciferase activity (Between miR-34b-5p mimics treated with WT-UTR or MUT-UTR, n = 3, t [4] = 7.10, ** P = 0.0021). [score:1]
10.1186/s12868-016-0291-6 A Astrocytes was transfected with WT Bcl-2 3′-UTR or Mutant Bcl2 3′-UTR followed by treating either with control or miR-34b-5p mimics. [score:1]
In our study, we explored the mechanisms of association of miR-34b-5p level with cell death in recurrent-seizure hippocampus. [score:1]
These two results strongly support our hypothesis that miR-34b-5p mediates astrocyte apoptosis in response to KA treatment in vitro. [score:1]
b Relative miR-34b-5p levels after different treatments; (one-way ANOVA, n = 5, F 4,20 = 866.9, *** P < 0.0001). [score:1]
The miR-34b-5p level was successfully increased upon mimics transfection (Additional file 2: Fig.  2A). [score:1]
By day 1 when most pro-caspase-3 was cleaved into active caspase-3, a peak sevenfold induction in miR-34b-5p level was observed. [score:1]
By 2 h after the 6-day flurothyl treatment, a fivefold increase of miR-34b-5p was observed. [score:1]
The miR-34 family is composed of three mature non-coding microRNAs-miR-34a, miR-34b, and miR-34c-found at three different loci across the genome. [score:1]
On the other hand, luciferase activity of mutant Bcl-2 3′-UTR was not affected by treatment with miR-34b-5p mimics (main difference between mimics treatment and control treatment in MUT Bcl-2 3′-UTR: t [4] = 0.9156, P = 0.4117; Fig.   3d). [score:1]
Astrocytes was transfected with WT Bcl-2 3′-UTR or Mutant Bcl2 3′-UTR followed by treating either with control or miR-34b-5p mimics. [score:1]
One observation, that the trend of miR-34b-5p level was similar to the trend of cleaved caspase-3 across all post-seizure time points we studied, indicated that the initiation of cell apoptosis events could be correlated with the changes of miR-34b-5p level (Fig.   1a, e). [score:1]
We discovered that miR-34b-5p, a member of the miR-34 family, increased significantly in flurothyl -treated rat hippocampus tissue. [score:1]
Here, we tested whether miR-34b-5p mediated KA induced astrocyte apoptosis in vitro. [score:1]
We observed that induction of miR-34b-5p began at 2 h after the recurrent convulsions mo del was established, remaining high till 1 day after the establishment of recurrent seizure mo del, then returning to normal after 3 days. [score:1]
MicroRNA transcriptome in rats treated with flurothyl and the induction of miR-34b-5p. [score:1]
Though the majority of cell death we observed involved astrocytes, a small population of hippocampus neurons also underwent cell death in our mo del, signifying the potential role of miR-34b-5p in neuron death as well. [score:1]
f Quantitative PCR shows Bcl-2 mRNA level in response to different treatments (one-way ANOVA, n = 5, F [4,20] = 0.4576, P = 0.7658) Based on the results above, we further asked the question of how miR-34b-5p mediated astrocyte apoptosis. [score:1]
Taken together, these results show that miR-34b-5p functions as a pro-apoptotic factor in astrocytes by mediating Bcl-2 protein levels. [score:1]
e Relative level of miR-34b-5p. [score:1]
MiR-34b-5p mimics efficiently increased miR-34b-5p levels six-fold (difference among groups: F [4,20] = 866.9, P < 0.0001; Fig.   3b). [score:1]
Next, we treated those transfected astrocytes with either miR-34b-5p mimics or control mimics. [score:1]
Here, we focused primarily on miR-34b-5p. [score:1]
The luciferase activity of WT Bcl-2 3′-UTR was significantly lowered by treatment with miR-34b-5p mimics (main difference between mimics treatment and control treatment in WT Bcl-2 3′-UTR: t [4] = 7.10, P = 0.0021). [score:1]
miR-34b-5p level after transfection was shown to validate the transfection efficiency. [score:1]
B Electrophoresis picture shows the miR-34b-5p level in respond to different treatment, demonstrating the transfection of all the plasmids. [score:1]
[1 to 20 of 74 sentences]
2
[+] score: 51
b Expression levels of Notch signaling proteins and effects of miR-34 siRNA in control (C) and folate -deficient (MDD) H19-7 cells at 13 h after induction of differentiation (Si− = non -targeting siRNA, Si+ = miR-34 -targeted siRNA). [score:7]
Cells are colabeled with antibodies against actin (green) and NF68 (red) and their nuclei counterstained by Dapi (blue) The Notch receptor ligand delta-like 1 (dll1) is a target of miR-34, and during morphogenesis of the central nervous system, differentiation of neural progenitors is known to be inhibited by hairy and enhancer of split homolog 1 (Hes1), whereas it is stimulated by mammalian achaete-scute complex homolog 1 (Mash1) [46]. [score:5]
Cells are colabeled with antibodies against actin (green) and NF68 (red) and their nuclei counterstained by Dapi (blue) The Notch receptor ligand delta-like 1 (dll1) is a target of miR-34, and during morphogenesis of the central nervous system, differentiation of neural progenitors is known to be inhibited by hairy and enhancer of split homolog 1 (Hes1), whereas it is stimulated by mammalian achaete-scute complex homolog 1 (Mash1) [46]. [score:5]
While it cannot fully prevent early-occurring NTDs such as spina bifida, maternal supplementation with folic acid during the period corresponding to the last trimester of pregnancy in women appeared to help preserve a normal development, at least partly through restoring let-7 and miR-34 normal expression. [score:4]
Early Methyl Donor Deficiency Alters the Expression Pattern of a Wide Range of Genes Influenced by Let-7 and miR-34 and Involved in Various Aspects of Development. [score:4]
Methyl Donor Deficiency Increases Expression Levels of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
Fig. 7Effects of methyl donor deficiency and folic acid supplementation on Notch signaling proteins, targets of miR-34. [score:3]
c Expression levels of miR-34 in the midbrains of control and deficient rat embryos, and effects of folic acid supplementation. [score:3]
Methyl Donor Deficiency Affects Protein Expression Levels of Known Downstream Pathways of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
Among the subset of miRNAs known to be regulated by methylation [28], let-7 (lethal 7) and miR-34 are believed to exert a requisite role at various steps of cerebral development, while they would influence the occurrence of NTDs [27, 29]. [score:3]
Most importantly, folic acid supplementation helped restoring the levels of let-7 and miR-34 and their respective targets. [score:3]
Fig. 3Effects of methyl donor deficiency on the expression of let-7 and miR-34: influence of folic acid supplementation. [score:3]
Taken together, our data therefore suggest that the alterations observed in let-7 and miR-34 pathways in response to methyl donor deficiency may participate to a disruption of the proliferation/differentiation balance, resulting in improper development of the central nervous system, and influencing the occurrence of NTDs. [score:2]
Products of RT reaction (1.33 μL) were used in a real-time PCR reaction, which also included 10 μL of the TaqMan Universal Master Mix II, and 1 μL TaqMan miRNA assay containing the sequence-specific primers of either the target miRNA (let-7: UGAGGUAGUAGGUUGUAUAGUU, miR-34: UGGCAGUGUCUUAGCUGGUUGU) or the U6SnoRNA (CACGAATTTGCGTGTCATCCTT) used as an endogenous control for normalization. [score:1]
By using the microarray approach, the identification of new putative target genes affected in response to methyl donor deficiency via let-7 and miR-34 warrants further investigations. [score:1]
In order to identify further mechanisms underlying the effect of maternal B-vitamin status on neural tube and brain development, in line with potential epigenetic dysregulations, we investigated the participation of let-7 and miR-34 as well as their related pathways in the consequences of methyl donor deficiency both in vivo on a validated rat mo del of maternal deficiency [30, 31] and in vitro in hippocampal progenitors [32]. [score:1]
[1 to 20 of 16 sentences]
3
[+] score: 40
Assessment of normalized expression data for all miRNAs in skin samples obtained from both aGvHD and control rats showed significant differential expression of three miRNAs, with upregulation of miR-34b (2.7-fold change, p = 0.013) and miR-3596d (2.4-fold change, p = 0.006) and downregulation of miR-326 (−2.6-fold change, p = 0.009) in aGvHD samples (Figures 1A,B). [score:11]
Further validation by qRT-PCR analysis of skin samples obtained from the same and another independent transplantation experiment showed trends toward increased expression of miR-34b and decreased expression of miR-326 (Figure 1C). [score:5]
miR-326 and miR-34b Are Dysregulated in Skin and May Potentially Target Notch1 and Inflammatory Cytokine Genes. [score:4]
The miR-34 family was recently shown to be upregulated in the gut of patients during severe aGvHD (18). [score:4]
, which incorporates existing data on genes regulated by miRNAs from the literature, indicated that both miR-34b and miR-326 may share at least two target genes, Notch1 and Snai1 (21– 24). [score:4]
This analysis demonstrated that both miR-326 and miR-34b may converge on at least two gene targets, Notch1 and Snai1 (Figure 2A), although these genes were not differentially expressed in skin tissues from aGvHD rats compared to controls (Figure 2B). [score:4]
We searched for predicted gene targets for miR-326 and miR-34b using QIAGEN’s IPA software. [score:3]
We did not detect differential expression of miR-34b or miR-326 in intestinal tissues of rats, and this may reflect the more severe pathology that is observed in skin rather than intestines of rats but also differences in tissue pathology. [score:3]
In the skin, NanoString analysis indicated differential expression of miR-34b and miR-326 in rats with aGvHD compared to controls, although only a trend was observed by qRT-PCR. [score:2]
[1 to 20 of 9 sentences]
4
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
Similarly, miR-34, an established p53 effector that is typically downregulated in malignant lung cancer [105], was upregulated in microadenomas but not in adenomas, as demonstrated in the present study. [score:7]
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
Thus, maintenance of miR-34 expression is a prerequisite to avoid the passage from benign to malignant cancer lesions in lung tissue. [score:3]
The identity, fold-change variation, direction of alteration, and biological function of these miRNAs are reported in Table 2. In mice bearing adenomas, 5 miRNAs (miR-34b, miR-106a, miR-499, miR-466, and miR-493) were altered in the blood serum but not in lung. [score:2]
[1 to 20 of 5 sentences]
5
[+] score: 20
Furthermore, point mutation of the miR-34 binding site rescued inhibition induced by miR-34a, but not miR-34c. [score:4]
However, the miR-34 family genes are differentially expressed and regulated. [score:4]
Regulation of Arc by miR-34 and miR-326 is attenuated by point mutations and deletion of the microRNA seed region. [score:3]
miR-34 family microRNAs (miR-34a, -34b, -34c) share a common seed sequence and therefore share many of the same targets in many cell types. [score:3]
Interestingly miR-19, miR-34 and miR-326 are all dysregulated in multiple sclerosis patients [62]. [score:2]
The miR-34 family has three members, miR-34a, -34b and -34c, that are predicted to bind the same sites. [score:1]
Three nucleotides in the seed -binding region of miR-34, -193, -326, -378 and -512_5p were mutated in the Arc 3′UTR and the whole seed binding region was removed for miR-19. [score:1]
miR-34b and -34c are co-transcribed from the same cluster distinct from the miR-34a gene. [score:1]
While little is currently known about mir-193a and miR-19a, new studies have shed light on miR-34 and miR-326 function in the nervous system. [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 17
Previous studies showed that inhibition of miR-34 expression in vivo using LNA -based antimiRs or antagomiRs improved cardiomyocyte survival after MI and thereby preserved cardiac contractile function [35, 36]. [score:5]
Therefore, increased expression of miR-29 and miR-24 and reduced expression of miR-34, miR-130 and miR-378 may be responsible for the beneficial effects exerted by MSC-Exo. [score:5]
We found that the expression of miR-130, miR-378, and miR-34, which negatively regulate cardiac functions, was relatively low. [score:4]
Moreover, our results showed that the expression of miR-34 was decreased in both MSC-Exo and MSCs. [score:3]
[1 to 20 of 4 sentences]
7
[+] score: 16
Intriguingly, miR-34 and HMGA1 generate an intricate regulatory loop since HMGA1 is able to negatively regulate the expression of miR-34 (Puca, unpublished observations) and p53 (61), being the latter able to induce the expression of miR-34. [score:7]
In this process, HMGA1 has a central role since, upon its overexpression, alters miR-34 pathway by acting directly and indirectly on it, through the repression of p53 (Figure 1C). [score:5]
MicroRNAs of the miR-34b family have been found regularly underexpressed in human carcinomas and the attempt to restore their physiological levels in cancer cells currently would represent an innovative and fascinating cancer therapy (60). [score:3]
Several recent reports have highlighted the post-transcriptional repression of HMGA proteins by non-coding RNAs and, in particular, numerous miRNAs with this activity have been identified (let-7a, miR-15, miR-16, miR-26a, miR-34b, miR-196a2, miR-326, miR-432, miR-548c-3p, miR-570, miR-603) (53, 54). [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 12
Furthermore, 40 of the miRNAs, including miR-34b-3p, miR-25-3p, miR-126-5p, miR-142-5p, and miR-324-5p, were only transiently upregulated (Figure  2A); the other 23 miRNAs, including miR-34a-3p and miR-324-5p, were transiently downregulated on the 3rd day but returned to normal levels by the 14th day (Figure  2B). [score:7]
These comparisons revealed that the highly expressed miRNAs from our study were also reported in the study by Timo Brandenburger et al. [20]; they showed that miR-124, the let-7 family and miR-34b-3p belonged to the group of highly expressed miRNAs in the rat spinal cord. [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 11
Members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [14- 19]. [score:7]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
[1 to 20 of 2 sentences]
10
[+] score: 11
Interestingly, several reports have shown that the miR-34 family is a direct target of p53, and its activation induces apoptosis and cell cycle arrest [31, 32]. [score:4]
In his report, Hermeking described the role of p53 as a mediator of tumor suppression through the activation of miR-34 family members. [score:3]
The ectopic expression of miR-34 genes is known to cause a G1 phase arrest [28]. [score:3]
In addition, the activation of miR34-a by p53 feeds back to p53, and such positive feedback leads to further activation of p53 [30]. [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 11
mir-200a, mir-34, mir-195, and mir-381-3p are usually downregulated in presence of SIRT1 expression, and vice versa low expression of SIRT1 relates to miRNAs upregulation [9, 11, 17, 18, 26– 28]. [score:11]
[1 to 20 of 1 sentences]
12
[+] score: 10
In addition, levels of miR-34b and miR-34c were up-regulated in CCA rats, but down-regulated in CCE rats. [score:7]
Levels of miR-34b and miR-34c, which showed an increase in expression in CCA rats (p < 0.05 vs. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 10
In order to validate the changes in miRNA expression detected by a deep-sequencing, we conducted quantitative real-time PCR analysis to examine expression levels of six miRNAs including rno-miR-378, rno-miR-182, rno-miR-21, rno-miR-34a, rno-miR-34b, and rno-miR34c. [score:5]
rno-miR-881, rno-miR-880, miR-741-3p, miR-511*, miR-187, miR-449a, as well as 6 members of miR-34 family, miR-34a, miR-34a*, miR-34b, miR-34b*, miR-34c, and miR-34c*, showed over 10-fold up-regulation. [score:4]
It was followed by activation of P53 and the binding P53 to the promoter of miR-34a resulted in mir-34 activation [41]. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 9
Other miRNAs from this paper: rno-mir-34c, rno-mir-34a
45, 46 Moreover, inactivation of miR-34 expression has been recently shown to lead to accelerated neurodegeneration and ageing in D. melanogaster, [44] whereas in vertebrates its elevation has been suggested to be either protective or contribute to age -associated events. [score:3]
Interestingly, the peak amplitude of the NMDA current in miR-34a cells was greatly suppressed as compared with control neurons (Figures 3c and d) by normalizing NMDA -induced current to cell capacitance (empty vector cells, 8.2±5.3 pA/pF, n=28; miR-34 A cells, 5.4±2.5 pA/pF n=25; P<0.05; all cells were recorded at 11 DIV). [score:2]
Consistently, recent reports have implicated miR-34 family in regulating genes that mediate the behavioural changes in response to stress. [score:2]
41, 42 miR-34 increases with age in C. elegans and D. melanogaster. [score:1]
Nevertheless, we cannot exclude that other factors may mediate the reduction of DCX by miR-34. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 9
Murakami et al. reported that 11 miRNAs including miR-34, miR-199a-5p, miR-199, miR-200, and let-7e were up-regulated in a CCl [4] -induced fibrosis mo del mouse [31]. [score:4]
Recently, Li et al. reported that 16 miRNAs including miR-34, miR-199a-5p, miR-221, miR-146b, and miR-214 showed progressive up-regulation in rat with hepatic fibrosis caused by dimethylnitrosamine [30]. [score:4]
Among them, miR-34 and miR-199a-5p were common in the two mo dels. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 8
Other microRNAs to have been reported to be related to depression are miR-34 acting as a regulator of CRF signaling, miR-134 and miR-124a levels were significantly downregulated after treatment with duloxetine and miR-144 was found to have an increased expression in both lithium- and valproate -treated animals (Haramati et al., 2011; Hansen and Obrietan, 2013; Pan and Liu, 2015). [score:7]
MicroRNA as repressors of stress -induced anxiety: the case of amygdalar miR-34. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 7
miRNAs that had approximately 2-fold upregulation included members of miR-29 family and miR-34 family and that were downregulated by about 2-fold were members of the miR-181 family and miR-183 family. [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 7
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34b, hsa-mir-34c, rno-mir-34c, rno-mir-34a
Because miR-34a upregulation was only observed in hepatocytes, we wondered how miR-34 functions in liver fibrosis. [score:4]
As shown in Fig 4C, miR-34 significantly induced the apoptosis of L-02 cells in a dose -dependent manner, and the induced apoptosis was then inhibited by SRT1720. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 7
It has been shown that miR-29, miR-15 and miR-107 are upregulated; while miR-124, miR-34 and miR-153 are downregulated in patients with AD (Delay et al., 2012; Lau et al., 2013). [score:7]
[1 to 20 of 1 sentences]
20
[+] score: 6
Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc. [score:3]
Additionally, an increase in phosphorylated AKT after the inhibition of the miR-34 family has been observed [39]. [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 6
Serum was also analyzed by Q-RT-PCR for a panel of 20 tissue enriched and potential miRNA biomarkers, including those identified for liver (cfa-miR-122 and -885), heart/muscle (cfa-miR-1, -133, and -206), testis (miR-34b/c), pancreas (cfa-miR-216), brain (cfa-miR-212), and ubiquitously expressed cfa-miR-193b. [score:3]
Testes enriched cfa-miR-34b/c, and the other testes HTE dog miRNA identified here may be invaluable as biomarkers for an organ that presently lacks a definitive diagnostic test for tissue injury. [score:1]
A total of 22 miRNAs (Additional file 6: Figure S5) were selected for qPCR validation including the following 14 biomarker candidates of organ toxicity: liver (cfa-miR-122 and -885), pancreas (cfa-miR-216a/b); heart (cfa-miR-499); muscle (cfa-miR-206); heart/muscle (cfa-miR-1, -133a/b, and -208); testis (cfa-miR-34b/c); and brain and sciatic nervous tissues (cfa-miR-212, -432, and -885), and 5 miRNAs reported in the literature (cfa-miR-21, -192, -193a/b, and -200). [score:1]
Except for miR-34b/c, which has a role germ cell maturation in murine testes [31, 32], none of these miRNAs have reported associations with testis. [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 5
More recently, hippocampus-expressed miRNAs such as miR-134 and miR-34 have been shown to target the deacetylase sirtuin-1 (SIRT1) and thereby influence learning and memory processes (Gao et al., 2010; Zovoilis et al., 2011). [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 5
It is noteworthy that miR-34a-5p, miR-34b-5p, and miR-34c-5p are members of the same miRNA family, possessing identical seed region and therefore similar potential targets. [score:3]
Moreover, they have shown that suicide idea patients exhibited lower levels of miR-34b-5p and miR-369-3p [38]. [score:1]
However, further studies are needed to define the exact role of miR-34-5p/449-5p family in stress-related pathologies because it has been shown that both resilient animals and depressed patients exhibit increased miR-34 levels. [score:1]
[1 to 20 of 3 sentences]
24
[+] score: 4
Other miRNAs from this paper: rno-mir-34c, rno-mir-34a, rno-mir-208a, rno-mir-208b
MiR-34 family members (miR-34a, -34b, and -34c) are upregulated in the heart in response to stress (i. e. myocardial infarction) and contribute to the age -dependent decline in cardiac function [9, 10]. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 4
Further microRNA-gene networks indicated that the key microRNAs were Homo sapiens (hsa)-miR-570, hsa-miR-122, hsa-miR-34b, hsa-miR-29c, hsa-miR-922 and hsa-miR-185, which negatively regulated ~79 downstream target genes to modulate hepatocyte immune response, inflammatory response and glutathione metabolism (10). [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 4
This decrease was observed to a lower extent with other members of the miR-34 family (Figure 5C) suggesting that miR-34c interacted directly and specifically with the 3′-UTR of Sipa1. [score:2]
Reporter assay experiments further support that Sipa1 mRNA is a target of the miR-34 family, in particular miR-34c (Figure 5). [score:2]
[1 to 20 of 2 sentences]
27
[+] score: 4
Increased striatal adenosine A2A receptor levels is an early event in Parkinson's disease-related pathology and it is potentially regulated by miR-34b. [score:4]
[1 to 20 of 1 sentences]
28
[+] score: 4
Reports showed that miR-34c is induced after acute ischemic damage (Greco et al., 2009), miR-34b and miR-34c belong to an evolutionary conserved miRNA family that plays a fundamental role in the p53 tumor suppressor network (He et al., 2007). [score:3]
Since MI procedures promotes p53 -dependent apoptosis (Fiordaliso et al., 2001), it is tempting to speculate that the p53/miR-34 axis may be involved in a MI -induced death pathway. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 3
In addition, as predicted by the bioinformatics databases, SLC4A1 was the potential target gene of rno-miR-34b, rno-miR-146b, rno-miR-214, rno-miR-223, and rno-miR-351. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Other miRNAs from this paper: rno-mir-34c, rno-mir-34a
miR-34a belongs to one of several evolutionarily-conserved families of miRNAs, namely miR-34, and was originally identified as a TP53 -targeted mRNA [40]. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, rno-mir-34c, rno-mir-34a
Wong KY Yu L Chim CS DNA methylation of tumor suppressor miRNA genes: a lesson from the miR-34 familyEpigenomics. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
The expression level of miR-34a was approximately 29-fold with miR-34 agomir and 0.4-fold with miR-34a antagomir (Figure 5A). [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 3
Finally, we performed RTqPCR for a number of candidate miRNAs chosen from the most expressed miRNA in spermatozoa, including Mir34c and Mir34b [35, 36], and found no differences between groups. [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc. [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 3
Other miRNAs from this paper: rno-let-7d, rno-mir-34c
Preliminary evidence for association of genetic variants in pri-miR-34b/c and abnormal miR-34c expression with attention deficit and hyperactivity disorder. [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
On the other hand, miR-134, miR-138 and miR-34b showed bigger changes in the expression of their primary transcripts than their mature forms (Figure 5F to H). [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 2
MicroRNAs from miR-8 family and miR-34 family were reported to be involved in the regulation of ceramide signaling pathway in the frontal cortex and dopamine signaling pathway in the hippocampus respectively [17]. [score:2]
[1 to 20 of 1 sentences]
38
[+] score: 2
Several candidate therapeutic miRNAs have progressed into clinical and preclinical development; for example, antisense miR-122 is being developed as a treatment for hepatitis C virus, miR-208/499 for chronic heart failure, miR-195 for myocardial infarction and miR-34 and let-7 for cancer 10, 11. [score:2]
[1 to 20 of 1 sentences]
39
[+] score: 2
This is the first report of microRNA regulation following perforant path LTP in awake freely moving rats and is particularly relevant as the seed recognition sequence of the MIR34 family has recently been reported to rescue learning impairment [51]. [score:2]
[1 to 20 of 1 sentences]
40
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 2
At 24 hours, five miRNAs (rno-miR-214, rno-miR-99a, rno-miR-363*, rno-miR-100 and rno-miR-340–5p) and at 48 hrs 6 miRNAs (rno-miR-34b, rno-miR-500, rno-miR-24-1*, rno-miR-29b, rno-miR-199a-3p, rno-let-7a) showed the most prominent dysregulation (P < 0.001) (Fig.   7B). [score:2]
[1 to 20 of 1 sentences]
42
[+] score: 2
Other miRNAs from this paper: rno-mir-34c, rno-mir-34a
Notably for our study, DICER1 has been shown to mediate stress -induced anxiety through its regulation of microRNA-34 in the amygdala [91]. [score:2]
[1 to 20 of 1 sentences]
43
[+] score: 1
On the other hand, a few miRs have been found to promote apoptosis of myocardiocytes, such as miR-26 [29], miR-34 [30], and miR-92 [31]. [score:1]
[1 to 20 of 1 sentences]
44
[+] score: 1
The mature miR-34, a 22-nucleotide microRNA, has three members: miR-34a, miR-34b, and miR-34c. [score:1]
[1 to 20 of 1 sentences]
45
[+] score: 1
MiRNAs such as hsa-let-7f, hsa-miR-499, hsa-miR-373, hsa-miR-372, hsa-miR-371, hsa-miR-369-5p, hsa-miR-34c, hsa-miR-34b, hsa-miR-34a, hsa-miR-29c, hsa-miR-217, and hsa-miR-20a might influence senescence or aging [42]. [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
Many miRNAs, such as miR-122 (Santaris Pharma, Denmark) and miR-34 (Mirna Therapeutics, USA), need to be studied clinically 53. [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
The orphan nuclear receptor NR4A2 is part of a p53-microRNA-34 network. [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
Although they did not reach statistical significance, the microarray data suggested a possible increase of miR-34a, miR-34b and miR-34c in the islets of old animals (ESM Table 4). [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
A different situation exists with other miRNAs such as miR-34c-3p, which is a member of the miR-34 family. [score:1]
[1 to 20 of 1 sentences]