sort by

29 publications mentioning rno-mir-93

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-93. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 53
As shown in Table II, 21 (ASH versus C16) and 11 (AFL versus C12) differentially expressed miRNAs were identified through the SAM algorithm, where miR-129 and miR-199a-3p exhibited the highest degrees of upregulation and downregulation between the ASH and the respective control groups, and miR-200c and miR-93 exhibited the highest upregulation and downregulation between the AFL and the respective control group. [score:15]
Five upregulated and eight downregulated miRNAs were observed in the AFL group compared with the expression levels in the control group, where miR-200c and miR-93 exhibited the greatest upregulation and downregulation, respectively, of the miRNAs. [score:14]
The unique miRNA expression patterns distinguishing the ASH group from the control group were composed of six downregulated (miR-199a-3p, miR-214, miR-93, miR-146a, miR-191 and let-7b) and six upregulated (miR-129, miR-490, miR-21, miR-503, miR-183 and miR-185) miRNAs. [score:9]
Similarly, the specific miRNA profile of AFL consisted of five downregulated (miR-93, miR-451, miR-221, miR-17-5p and miR-146a) and three upregulated (miR-200c, miR-490 and miR-195) miRNAs, in comparison to the control group. [score:7]
miR-93 is able to suppress proliferation and colony formation of human colon cancer stem cells (31). [score:3]
Wiskott-Aldrich syndrome protein family member 1 (Wasf1), which was found to be regulated by miR-17-5p, miR-93, miR-191, miR-451, miR-146a and miR-140, has been shown to be a protective alcohol-responsive gene in the prefrontal cortex of human alcoholics (38). [score:2]
Protein kinase, X-linked (PRKX), which was determined to be regulated by miR-93 in the present study, is a catalytic subunit of cyclic AMP -dependent protein kinases and may be important in the liver through mediation of endothelial cell proliferation, migration and vascular-like structure formation (35). [score:2]
Among the dysregulated miRNAs, miR-490 exhibited an increment in the ASH and AFL groups, while miR-140, miR-7a, miR-451, miR-93, miR-146a and miR-191 levels exhibited a decline in the ASH and AFL groups compared with the respective controls (Table II). [score:1]
[1 to 20 of 8 sentences]
2
[+] score: 46
Since the down-regulation of microRNAs may cause the up-regulation of targeted genes, we hypothesized that the presence of IGF-1 triggers the expression of certain genes by down -regulating key microRNAs (miR-1224, miR-125a-3p, miR-214, miR-22, miR-320, miR-708, and miR-93), which in turn enhance NPCs proliferation and survivability. [score:12]
miR-93, a microRNA frequently associated with TGF-β signaling in controlling cell cycle arrest [26], cell proliferation, and differentiation [27], was also down-regulated in both Groups A and B. Moreover, we discovered that miR-1224 and miR-125a-3p, which were initially up-regulated in Group A, became down-regulated at day 3 and 5 in Group B post -induced with IGF-1. Both miR-1224 and miR-125a-3p play important roles in maintaining cell proliferation and survivability. [score:10]
However, BMSC-derived NPCs with addition of IGF-1 showed 12 microRNAs which include miR-22, miR-1224, miR-125a-3p, miR-214, miR-320, miR-708 and miR-93 were consistently down-regulated and only miR-496 remained up-regulated compared to Group C from Day 1 to Day 5. The let-7 family (let-7b, let-7c, let-7d, let-7e and let-7i) were constantly down-regulated in both groups. [score:9]
It has been reported that up-regulation of miR-93 stimulated cell proliferation and inhibited apoptosis through Akt pathway by targeting Pten and Cdkn1a [46]. [score:8]
Shi J. Zhuang Y. Liu X. K. Zhang Y. X. Zhang Y. TGF-β induced RBL2 expression in renal cancer cells by down -regulating miR-93 Clin. [score:4]
MiR-1224, miR-708 and miR-93 were excluded from analysis since there is no mRNA associated with negative regulation of apoptosis. [score:2]
Liu S. Patel S. H. Ginestier C. Ibarra I. Martin-Trevino R. Bai S. McDermott S. P. Shang L. Ke J. Ou S. J. MicroRNA93 regulates proliferation and differentiation of normal and malignant breast stem cells PLoS Genet. [score:1]
[1 to 20 of 7 sentences]
3
[+] score: 46
Unexpectedly, miR-93 miR-204 and miR-302d, which target Nurr1 long 3’ UTR mRNA variant, are expressed in the vmDNA mesencephalon while miR-93 and miR-302d, but not miR-204 express in dmDNA (Fig 4B). [score:7]
The longest 3’UTR variant of Nurr1 mRNA expresses in the mesencephalon during development along with miR-204, miR-302d and miR-93, which specifically regulate this variant of Nurr1. [score:5]
The above results prompted us to study a potential role of miR-204, miR-93 and miR-302d regulating Nurr1 expression in dopamine neurons. [score:4]
D. Effect of miR-204, miR-93, miR-17, miR-302d, miR-455, miR-212 or miR-30a overexpression on Nurr1 3’ UTR long. [score:3]
F. Effect of miR-204 or miR-93 overexpression on Nurr1 3’UTR short. [score:3]
Conversely, miR-204, miR-93 and miR-302d transfected along with the reporter fused to the long 3’UTR Nurr1 mRNA variant, significantly decreased luciferase expression (Fig 3D). [score:3]
B. Stem-loop RT-PCR showing the expression of miR-93, miR-204 and miR-302d in the developing mesencephalon. [score:3]
As shown in Fig 3F, miR-204 and miR-93 did not change luciferase activity indicating the specificity of their effect controlling the expression of Nurr1 mRNA long variant. [score:3]
Taken together these results indicate that the Nurr1 3’UTR long mRNA variant is specifically regulated by the miR-204, miR-93 and miR-302d. [score:2]
F. Primary culture cells of E18 were transfected with control vector (Control) or an equivalent molar amount of miR-93, miR-204 and miR-302d (miRNAs) at DIV1 and were analyzed at DIV3 (48 hrs after transfection) or DIV4 (72 hrs after transfection) by indirect immunofluorescence. [score:2]
In conclusion, Nurr1 mRNA with the longest 3'UTR undergoes a specific regulation by miR-204, miR-93 and miR-302d. [score:2]
The precursor sequences of the miR-145, miR-302d, miR-130a, miR-204, miR-93, miR-17, miR-455, miR-212 and miR-30a were cloned on pEGP-CE vector, acquired from Cell Biolabs Inc (7758 Arjons Drive San Diego, CA 92126 USA). [score:1]
miR-93, miR-204 and miR-302d decrease Nurr1 protein in dopamine neurons. [score:1]
miR-204, miR-93 and miR-302d decrease Nurr1 protein levels in cultured dopaminergic neurons. [score:1]
Seven miRNAs were selected: miR-17, miR-204, miR-455, miR-30a, miR-212, miR-302d and miR-93. [score:1]
Therefore, to test the effect in a gain of function approach, a mix of the 3 miRNAs (miR-204, miR-93 and miR-302d) were transfected to cultured dopamine neurons. [score:1]
Co-transfection of miR-204, miR-302d and miR-93 in primary culture of mesencephalon dopamine neurons resulted in a significant reduction of Nurr1 protein. [score:1]
The intersection of these 3 databases gave 14 miRNAs in common and we choose miR-204, miR-30a, miR-302d, miR-212, miR-93, miR-17 and miR-455 for further experimentation. [score:1]
The seed sites of miRNAs selected for the specific part of the long 3’UTR are: miR-204 in nucleotide 870, miR-212 in nucleotide 1014, miR-93 and miR-302d in nucleotide 1063, miR-17 in nucleotide 1070, miR-455 in nucleotide 1177 and miR-30a in nucleotide 1279. [score:1]
Briefly, about 10 ng of small RNA was subjected to reverse transcription using MMLV-RT, a universal primer: 5’-ATACTCCAGCTGAGTCTCAACTGGTGTCGTGGAGTC-3’ and a specific reverse primer for each target miRNA: miR-93: 5’- ACACTCCAGCTGGGGGAAGTG CTAGCTCAGCAGTAGG-3’, miR-204: 5’-ACACTCCAGCTGGGCCAGTGATGACAA TTGAACG-3’ and miR-302d: 5’-ACACTCCAGCTGGGCATGCAGTGGCACACAAAG-3’. [score:1]
[1 to 20 of 20 sentences]
4
[+] score: 44
The expression levels of RB1 and PTEN were downregulated following miR-106b and miR-93 transfection in both BRL and RH-35 cells, while the levels of CEBPA and KAT2B were downregulated after miR-25 transfection. [score:9]
In details, miR-101a was down-regulated, and it decreased cell number in the G2-M phase with consistently increases in cell number in the G1 or S phases; meanwhile, miR-92a, miR-25, miR-93, and miR-106b were up-regulated, and they decreased the G1 cell population while concomitantly increasing the accumulation of cells in the S and G2 phases. [score:7]
As we expected, miR-106b, miR-93, miR-25 and miR-92a were significantly up-regulated at 24 and 36 hours after 2/3 PH, and miR-101a was down-regulated at 12, 24 and 36 hours after 2/3 PH (Supplementary Figure 5). [score:7]
As shown in Fig. 8C, miR-106b and miR-93 expression significantly reduced the luciferase activities of RB1 reporters by 48% and 44%, respectively, and miR-25 reduced luciferase expression of KAT2B reporters by 41%. [score:5]
BRL cells transfected with a vector harboring the AAV9-miR-106b~25 cluster expressed more miR-25, miR-93, and miR-106b than cells transfected with the AAV9 cluster control vector, as assessed using real-time PCR (Fig. 6B). [score:3]
The miR-106b~25 cluster vector (pAOV-mCherry-cluster, Fig. 6D) expressed mCherry, miR-25, miR-93 and miR-106b. [score:3]
Of them, PTEN was confirmed as a target of miR-93 and miR-106. [score:3]
Thus, these significantly altered miRNAs were analyzed for their role in the cell cycle; these analyses showed that miR-25, miR-93, and miR~106b were associated with faster entry into the S and G2 phases. [score:1]
Interestingly, miR-25, miR-93, and miR-106b are members of the miR-106b~25 cluster located within about 0.5 kb on chromosome 12 (Fig. 6A). [score:1]
We found that miR-106b, miR-93, and miR-25 levels remained higher after PH in the livers of rats injected with miR-cluster than in the livers of control rats; and miR-106b, miR-93 and miR-25 were significantly lower in the miR-sponge -treated rats than that in the controls, especially at 24h and 36 h after 2/3PH (Supplementary Figure 6). [score:1]
As demonstrated above, miR-92a, miR-25, miR-93, and miR-106b are associated with faster entry into the S and/or G2 phases. [score:1]
In control rats, we found that miR-106b, miR-93, and miR-25 levels also increased after 2/3 PH (Supplementary Figure 6). [score:1]
AAV9-miR-106b~25 sponges are transcripts with 6 repeated miRNA antisense sequences of miR-25, miR-93 and miR-106b (Fig. 6C). [score:1]
A total number of 11 and 16 miRNA–mRNA pairs were identified for miR-25 and miR-93 (miR-106b), respectively. [score:1]
[1 to 20 of 14 sentences]
5
[+] score: 41
Therefore, we speculate here that downregulation of miR-93 and miR-130b can result in elevated expression of tumor suppressor TP53INP1, which in turn can cause growth arrest of AR42J-B13 cells leading to transdifferentiation. [score:8]
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
Total RNA extracted from Dex/OSM treated AR42J-B13 cells (7 Days) and mock controls were used for Northern blot analysis using antisense probes against down-regulated miRNAs (miR-93, miR-106b and miR-130b) and up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Interestingly, Yeung et al. reported that miR-93 and miR-130b have a potential to target tumor suppressor protein p53 -induced nuclear protein 1 (TP53INP1) in HTLV-1 infected/transformed cells [39]. [score:5]
Mature miRNA of miR-93, miR-106b, miR-130b, miR-21, miR-22 and miR-182 were differentially expressed after transdifferentiation. [score:3]
The pattern of coordinated reduction in expression of miR-25, miR-93, and miR-106b (Table 1) is due to the clustering of these three miRNA genes at intron 12 of Mcm7 on chromosome 12. [score:3]
As shown in Table 1, both miR-93 and miR-130b were reduced in transdifferentiated hepatocytes. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 36
It was found that 8 miRNAs were significantly and consistently down-regulated in the hypertonic dialysate group (miR-31, miR-93, miR-100, miR-152, miR-497, miR-192, miR-194 and miR-200b), and within which miR-192, miR-194 and miR-200b were also down-regulated in the normal saline group (Table  3). [score:7]
The results demonstrated that in the hypertonic dialysate group, miR-31, miR-93, miR-100, miR-152, miR-497, miR-192, miR-194 and miR-200b were all significantly down-regulated whereas miR-122 was highly up-regulated (all P <0.05) (Figure  3). [score:7]
The miRNA screen identified 8 significantly down-regulated miRNAs (miR-31, miR-93, miR-100, miR-152, miR-497, miR-192, miR-194 and miR-200b) and one highly up-regulated miRNA (miR-122) in the hypertonic dialysate group. [score:7]
Compared with the control and saline groups, both miRNA microarray and real-time PCR analyses demonstrated that miR-31, miR-93, miR-100, miR-152, miR-497, miR-192, miR-194 and miR-200b were significantly down-regulated, and miR-122 was highly up-regulated in the hypertonic dialysate group. [score:6]
However, miR-93 was found to be up-regulated in patients with renal fibrosis, which is the opposite of our finding in peritoneal fibrosis. [score:4]
In patients with renal fibrosis and IgA nephropathy, the urinary miR-93 level correlated with the degree of glomerular scarring and was regulated by the TGF-β1/SMAD3 pathway [39]. [score:2]
Taken together, these results suggest to us that the miRNA species identified in our miRNA screen (mir-31, mir-93, mir-192, mir-194 and mir-200b) may be critical in the process of mesothelial cell EMT and in the progression of peritoneal fibrosis. [score:1]
The function of miR-93 in tissue fibrosis might be context -dependent and tissue specific. [score:1]
The exact mechanism by which miR-93 regulates the development of progressive renal and peritoneal fibrosis needs further investigation. [score:1]
[1 to 20 of 9 sentences]
7
[+] score: 24
The most regulated genes from MAPK pathway were: platelet derived growth factor receptor beta (PDGFRA), a target for miR-93-5p, 410-3p and 128-3p; MAP kinase-interacting serine/threonine kinase 2 (MKNK2), a target for miR-93-5p and 128-3p; Nuclear factor of activated T-cells 3 (NFATE3), a target for miR-128-3p and 103-3p; transforming growth factor beta receptor 1 (TGFBR1), a target for miR-128-3p and 142-3p; and nemo like kinase (NLK), a target for miR-3068-3p and 410-3p. [score:12]
The most regulated genes from the MAPK pathway were: platelet derived growth factor receptor beta (PDGFRA), a target for miR-93-5p, 410-3p, and 128-3p; MAP kinase-interacting serine/threonine kinase 2 (MKNK2), a target for miR-93-5p and 128-3p; Nuclear factor of activated T-cells 3 (NFATE3), a target for miR-128-3p and 103-3p; transforming growth factor beta receptor 1 (TGFBR1), a target for miR-128-3p and 142-3p; and nemo like kinase (NLK), a target for miR-3068-3p and 410-3p (Figure 3B). [score:12]
[1 to 20 of 2 sentences]
8
[+] score: 21
MiR-335 and miR-93 directly target Hif-1α. [score:4]
MiR-335 and miR-93 directly target Hif-1α In order to establish the direct interaction of the six miRNAs, a luciferase reporter assay was performed. [score:4]
These results further confirmed miR-335 and miR-93 as direct regulators of Hif-1α and also suggested miR-335 as a stronger modulator than miR-93. [score:3]
Loss of the miR-335 and miR-93 recognition sites on the 3’UTR abolished the interactions between the miRNAs and their target (Fig 2C and 2D). [score:3]
Site-directed mutagenesis was performed to further validate the interaction of the newly established regulators, miR-335 and miR-93 with Hif-1α 3’UTR. [score:3]
Independent transfection of HeLa cells with anti miR-17/-20a/-335/-93 exhibited an increase in the relative luciferase activity, whereas introduction of miR-17/-20a/-335/-93 mimics resulted in a reduction in luciferase activity suggesting that, apart from miR-17 and miR-20a, miR-335 and miR-93 are also direct regulators of Hif-1α (Fig 2B). [score:3]
miR-93 was observed to share the same binding site as miR-17 and miR-20a while miR-335 had two binding sites. [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 14
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
[1 to 20 of 2 sentences]
10
[+] score: 12
We found that expression of many miRNAs (miR-24, miR-25, miR-7a, miR-103, miR-17-5p, miR-106b, miR-93, miR-206 and miR-133b) changed significantly during conditions of UPR in cardiomyoblasts. [score:3]
In agreement with our previous results we observed reduced expression of all three miRNAs (mir-106b, miR25 and miR-93) belonging to the miR-106b-25 cluster during conditions of UPR in H9c2 cells. [score:3]
The expression of miR-122, miR-93, miR-103, miR-107, miR-206, miR-143, miR-24, and miR-106b were reduced upon treatment with Tg and Tm in H9c2 cells. [score:3]
We observed that changes in the expression of nine miRNAs (miR-24, miR-25, miR-7a, miR-103, miR-17-5p, miR-106b, miR-93, miR-206 and miR-133b) analyzed by qRT-PCR were consistent with those by miRNA microarray at p < 0.05 (Figure 3). [score:3]
[1 to 20 of 4 sentences]
11
[+] score: 10
These results demonstrate that miR-93 negatively regulates RyR2-3′UTR, which could lead to a decreased RyR2 protein expression (Chiang et al., 2014). [score:4]
Similarly, miR-34c and mir-93 expressions were higher expressed in occlusion at 1 week compared to control, and also in occlusion compared to ablation. [score:3]
We observed a decreased miR-301 and miR-93 expressions in occlusion group compared to ablation. [score:2]
Computational analysis of the Homo sapiens and Mus musculus RyR2-3′UTR revealed conserved binding sites for miR-93. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 9
[31] MiR-27a affects the expression of MMP-13 and IGFBP-5. [32] MiR-93 regulates collagen loss by targeting MMP-3, [33] and miR-125b regulates the expression of Adamts-4 in human chondrocytes. [score:9]
[1 to 20 of 1 sentences]
13
[+] score: 8
Li et al. [33] have also shown age -dependent increases in the expression of miR-34a and miR-93, and that these miRNAs target Mgst1, Sirt1, and Nrf2, three genes that encode proteins important in the defense against oxidative stress, a common feature in DILI. [score:5]
Similarly, increased liver expression of miR-93, miR-214, and miR-669c has been correlated with age. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 8
Eleven of the altered miRNAs were downregulated (miR-122, miR-93*, miR-872, miR-7*, miR-146a, miR-342-3p, miR-150, miR-139, miR-30a, miR-30e, miR-320), whereas three miRNAs, namely miR-463*, miR-34c* and miR-1188, were upregulated in the RYGB group. [score:7]
In addition to miR-342-3p and miR-34c*, miR-872*, miR-463*, miR-30e, miR-2183, miR-1971, miR-150, miR-146a, miR-1188 and miR-93* all correlate with liver energy metabolism processes, such as glycolysis and glycogenesis involving glucose, glycogen and lactate. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 7
Other miRNAs from this paper: rno-mir-25, rno-mir-106b
Moreover, injection of 1 nmol of Ant-25 or Scr did not alter expression of miR-106b and miR-93 (Figure 7B, C), whereas at the higher 4.0 nmol dose, all levels of miR-106b∼25 were significantly reduced (Figure 7B, C). [score:3]
In addition, the current study also reveals an interesting effect of different doses of antagomir-25 and its scrambled antagomir on the miRNA levels of miR-25 and the unrelated miR-93 and miR-106b. [score:1]
This cluster is located within an intronic region of the Mcm7 gene and codes for three different mature miRNA species: miR-106b, miR-93 and miR-25. [score:1]
0109267.g007 Figure 7(A– C) A) miR-93, B) miR-106b and C) miR-25 levels in the ischemic cortex after ICV injection of 1 nmol, 2.5 nmol and 4 nmol of Ant-25 or Scr. [score:1]
In fact, miR-106b and miR-93 have the same seed sequence and similar 3′-halves, whereas miR-25-lacking the same sequence-is expected to have a separate function [12]. [score:1]
[1 to 20 of 5 sentences]
16
[+] score: 6
Li N. Muthusamy S. Liang R. Sarojini H. Wang E. Increased expression of miR-34a and miR-93 in rat liver during aging, and their impact on the expression of Mgst1 and Sirt1 Mech. [score:5]
The following miRNAs were found to be altered in aging rats mostly from 48 weeks–132 weeks of age in skeletal muscle, e. g., miR-22 [57], or in murine liver tissues, e. g., miR-669c and miR-709, miR-93 and miR-214 [58, 59]. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 5
hsa-miR-93 and hsa-miR-20a have been found to be overexpressed in a multiple cancer types, induce cell proliferation and deletion of these miRNA clusters, in mice, are lethal, and cause lung and lymphoid cell developmental defects [39]. [score:4]
hsa-miR-mit-3 has two matches with hsa-miR-93 and hsa-miR-20a. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 5
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
First, a subgroup of miRNAs (miR-15b-5p, miR-17-5p, miR-18a-5p, miR-19a-3p, miR19b-3p, miR-20a-5p, miR-20b-5p, miR-21-5p, miR-23b-5p, miR-24-3p, miR-27a-3p, miR-92a-3p, miR-93-5p, miR-142-3p, miR-344b-2-3p, miR-431, miR-466b-5p and miR-674-3p) displayed increased expression levels during latency (4 and 8 days after SE), decreased their expression levels at the time of the first spontaneous seizure and returned to control levels in the chronic phase (Fig. 2, Supplementary Fig. S1). [score:5]
[1 to 20 of 1 sentences]
19
[+] score: 4
The miR-17 microRNA (miRNA) precursor family is a group of small non-coding RNA genes that regulate gene expression, and it includes miR-20a/b, miR-93 and miR-106a/b. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 3
We found that the expression patterns of most of these miRNAs revealed by qPCR were consistent with deep-sequencing results (Figure 2) with the exception of only four miRNAs (rno-miR-296, rno-miR-93, rno-miR-99b and rno-miR-130a), which exhibited minor discrepancy between qPCR and deep-sequencing results at P0. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
We unexpectedly identified miR-17-5p, along with other miRNAs (miR-20a and b, miR-106a and b, and miR-93) sharing the same seed motif as miR-17-5p, as a potential common regulator of Hsp70, Hsc70, CANX, and Golga2 (Figures S2-S5 in File S1). [score:2]
This cluster has two paralogs, miR-106a~363 (miR-106a, miR-18b, miR-19b-2, miR-20b, miR-92a-2 and miR-363, located on the X chromosome) and miR-106b~25 (miR-106b, miR-93, and miR-25, located on human chromosome 7), which are located on different chromosomes but contain individual miRNAs that are highly similar to those encoded by the miR-17~92 cluster [36, 37]. [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 3
One study has shown that serum miR-93, miR-146a, miR-31 are significantly upregulated in VD compared to controls (Dong et al., 2015). [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 2
According to our in silico analysis, Ppar γ is likely regulated by microRNAs like let-7 family members, miR-30 family members, miR-27b, miR-23ab, miR-93, miR-25, miR-128ab, miR-320, and miR-135. [score:2]
[1 to 20 of 1 sentences]
24
[+] score: 2
Other miRNAs from this paper: rno-mir-96, rno-mir-143, rno-mir-206, rno-mir-155
MicroRNA-93 alleviates neuropathic pain through targeting signal transducer and activator of transcription 3. Int. [score:2]
[1 to 20 of 1 sentences]
25
[+] score: 1
Among the spleen-specific miRNAs identified, five of them belong to the mir17 miRNA cluster, which comprise miR-17, miR-18, miR-19a, miR-19b, miR-20, miR-25, miR-92, miR-93, miR-106a, and miR-106b [59]. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Out of a panel of potential reference miRNAs, the miRNAs miR-30a-5p and cel-miR-39-3p for plasma and miR-93-5p for tissue were selected as best performing by GeNorm and NormFinder (GenEx Professional software, MultiD Analyses, Sweden). [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Wang G, Kwan BC-H, Lai FM-M, Chow K-M, Li PK-T, Szeto C-C. Urinary miR-21, miR-29, and miR-93: novel biomarkers of fibrosis. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
In addition to let-7 and miR-23b, other miRNAs involved in morphine tolerance include miR-124, miR-190, miR-103 and miR-93-5p [14– 17]. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Other miRNAs from this paper: rno-mir-338, rno-mir-146a
The internal reference genes of miR-93-5p and Smad5 were U6snRNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) respectively. [score:1]
[1 to 20 of 1 sentences]