sort by

23 publications mentioning rno-mir-101a

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-101a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 289
The following evidence support this hypothesis: First, the expression of miR-101 is negatively correlated with Sox9 expression, and the decreased Sox9 expression is due to the overexpression of miR-101 by targeting its 3'UTR. [score:11]
miR-101 mediate IL-1β -induced down-regulation of collagen type II and aggrecan, probably by targeting Sox9We have shown that overexpression of miR-101 decreases the level of ECM gene expression as well as synthesis of collagen type II and aggrecan. [score:10]
Combined with the abovementioned results, the miR-101-mediate IL-1β -induced down-regulation of collagen type II and aggrecan was probably achieved by regulating its target gene Sox9. [score:7]
Furthermore, overexpression of miR-101 reduced Sox9 expression, whereas silencing of miR-101 increased Sox9 expression, whether the cells were treated with IL-1β or not (Figure 4A and 4B). [score:7]
miR-101 repressed the Sox9 expression, whereas the inhibition of miR-101 increased the Sox9 expression at both mRNA and protein levels in rat chondrocytes (Figures 2D and 2E). [score:7]
However, inhibiting miR-101 expression also increased collagen type II in the untreated chondrocytes (Figure 3A), indicating that the untreated chondrocytes have already expressed miR-101. [score:7]
We demonstrate that miR-101 mediate IL-1β -induced down-regulation of Sox9, and its known down-stream genes collagen type II and aggrecan; however, silencing miR-101 can reverse the IL-1β -induced down-regulation of these two genes as well as the degradation of the ECM proteins, collagen type II and sGAG. [score:7]
miR-101 is involved in IL-1β -induced down-regulation of collagen type II and aggrecan, and its inhibition can prevent IL-1β -induced chondrocyte ECM degradation. [score:6]
Combined with the luciferase assay results, we proposed that only miR-101 directly targets Sox9, thereby negatively regulating Sox9 expression. [score:6]
In addition, silencing miR-101 expression could reverse the down-regulation of Sox9 that was caused by IL-1β (Figure 4A and 4B). [score:6]
In this study, we selected six miRNAs from public miRNA databases; these miRNAs were predicted to target the Sox9 gene and demonstrated the direct targeting of Sox9 mRNA by miR-101. [score:6]
Second, Sox9 is a target of miR-101, and can directly promote ECM gene expression and ECM synthesis [9- 11]. [score:6]
miR-101 mediate IL-1β -induced down-regulation of collagen type II and aggrecan, probably by targeting Sox9. [score:6]
This result indicates that silencing miR-101 in chondrocytes can reverse the IL-1β -induced down-regulated expression of collagen type II and aggrecan. [score:6]
Site-directed mutagenesis of the miR-101 target-site in the Sox9 3'UTR was carried out using a site-directed mutagenesis kit (Takara Shuzo, Kyoto, Japan), with pmiR-Sox9-wt as a template. [score:5]
To verify Sox9 a target of miR-101 in primary chondrocytes, chondrocytes were transfected with the miRNA mimic and miRNA inhibitor. [score:5]
The expression of miR-101, miR-30b, miR-30c, miR-30d and miR-27b was detected (Figure 1D) but miR-1 and miR-30e expression was not (data not shown). [score:5]
However, the expression of these two genes increased after miR-101 inhibitor transfection, regardless IL-1β treatment (Figure 3A and 3B, respectively). [score:5]
The expression of Sox9 was significantly reduced by siSox9, and the increased Sox9 level post miR-101 inhibitor transfection was reduced by co-transfection with siSox9 (Figure 4E). [score:5]
It has been reported that p38 can regulate Sox9 [35], but miR-101 did not affect the p38 level (Figure S5C in Additional file 1), suggesting that the effect of miR-101 on Sox9 may be mainly through the direct targeting. [score:5]
The inhibition of miR-101 increased the expression of Sox9, collagen type II and aggrecan, and could also prevent chondrocyte from IL-1β -induced ECM degradation. [score:5]
The expression levels of miR-101 exhibited a decrease at 4 h and 6 h of IL-1β treatment compared to the levels at 2 h, although miR-101 expression remained higher than at 0 h. This finding may indicate that the reduced Sox9 level was not completely regulated by miR-101. [score:5]
We found that the increasing miR-101 expression had an IL-1β concentration -dependent effect on chondrocytes at 6 h and was correlated with Sox9 expression (Figure S2 in Additional file 1). [score:5]
We have shown that overexpression of miR-101 decreases the level of ECM gene expression as well as synthesis of collagen type II and aggrecan. [score:5]
Moreover, an increase in sGAG content was observed after transfection with the miR-101 inhibitor alone; however, there was a remarkable decrease in sGAG content after co-transfection with miR-101 inhibitor and siSox9 (Figure 4F), thereby suggesting that Sox9 might be a functional mediator of the miR-101 -mediated changes in sGAG concentration. [score:5]
Inhibiting miR-101 expression notably resulted in increased collagen type II synthesis in untreated chondrocytes. [score:5]
These results suggested a correlation between the increased expression levels of miR-101, miR-30b, miR-30c, and miR-30d, as well as the decreased Sox9 expression level. [score:5]
To further analyze the effect of miR-101 on IL-1β -induced ECM degradation, the chondrocytes were transfected with miR-Scr, miR-101 mimic (mimic), or miR-101 inhibitor (inhibitor with a complementary sequence of miR-101). [score:5]
These further validate the abovementioned finding that miR-101 directly targets Sox9. [score:4]
miR-101 probably functions by directly targeting Sox9 mRNA. [score:4]
Down -regulating miR-101 expression can prevent the IL-1β -induced ECM degradation in chondrocytes. [score:4]
The expression of Sox9 was likewise negatively regulated by miR-101 in rat chondrocytes. [score:4]
These results suggested that miR-101 mediate IL-1β -induced down-regulation of collagen type II and aggrecan, thereby affecting the changing concertrations of collagen type II and sGAG. [score:4]
Secondly, chondrocytes were first transfected with the miR-101 inhibitor and then transfected with siSox9, miR-Scr and siScr were used as negative controls. [score:3]
Similarly, the expression of collagen type II and aggrecan decreased after miR-101 transfection (Figure 3A and 3B, respectively). [score:3]
Further analysis indicated that the Sox9 3'UTR contained the miR-101 target site, and these binding regions were conserved in different species (Figure 2B). [score:3]
This phenomenon may indicate that chondrocytes have already expressed miR-101. [score:3]
Overexpression of miR-101 decreased collagen type II and sGAG concentrations, regardless of IL-1β treatment (Figures 3C, 3D and 3E). [score:3]
Furthermore, silencing miR-101 inhibits these effects. [score:3]
Six miRNAs (miR-1, miR-101, miR-30b, miR-30c, miR-30d, and miR-30e) were selected to potentially target Sox9 (Figure 1A). [score:3]
Primary rat chondrocytes were transfected with miR-Scr, miR-101 mimic, and miR-101 inhibitor, and then treated with or without IL-1β 12 h post-miRNA transfection in the same manner as mentioned above. [score:3]
However, silencing of miR-101 maintained collagen type II and sGAG content, which inhibited the effects of IL-1β (Figures 3C, 3D and 3E). [score:3]
The average miR-101 expression level post-miR-101 mimic transfection reached 300-fold that of the miR-Scr group. [score:3]
The increasing expression of miR-101, miR-30b, miR-30c, and miR-30d emerged at different time points after IL-1β treatment (Figure 1D). [score:3]
Furthermore, we examined miR-101 and Sox9 expression level at different concentrations of IL-1β. [score:3]
Primary rat chondrocytes were transfected with miR-Scr, miR-101 mimic, and miR-101 inhibitor, and then treated with or without IL-1β 12 h post-miRNA transfection. [score:3]
By contrast, chondrocytes maintained their spherical shape after transfection of the miR-101 inhibitor. [score:3]
Indeed, real-time PCR and northern blot analysis confirmed that the untreated chondrocytes expressed miR-101 (Figure S3B and S3C in Additional file 1). [score:3]
Functional analysis showed that miR-101 could aggravate chondrocyte ECM degradation, whereas miR-101 inhibition could reverse IL-1β -induced ECM degradation. [score:3]
The expression of Sox9 was reduced in the chondrocytes that were co -transfected with miR-101 mimic and Sox9 full-length vector. [score:3]
The level of miR-101 was lower than that of huh7 cells but higher than that of HeLa cells; both cell lines have been documented to have the basal miR-101 expression [32]. [score:3]
Thus, miR-101 may serve as a new target for preventing the IL-1β -induced chondrocyte ECM degradation. [score:3]
Figure S3: miR-101 and the pri-miR-101 expression level. [score:3]
Third, the increased content of sGAG caused by silencing miR-101 expression was significantly decreased by co-transfection with siSox9. [score:3]
Furthermore, miR-101 may have other targets in these processes. [score:3]
As expected, we found that untreated chondrocytes had already expressed miR-101 (Figure S3B and S3C in Additional file 1). [score:3]
The effect of miR-101 on the IL-1β -induced chondrocyte ECM degradation is probably achieved through Sox9 regulation. [score:2]
However, miR-101 has no effects on the other aspects of Sox9 regulation, such as p38. [score:2]
For analysis of miR-101 expression, reverse transcription and PCR were carried out using Bulge-Loop™ miRNA qPCR Primer Set (RiboBio) according to the manufacturer's instructions. [score:2]
We also found that miR-101 could be induced by IL-1β, which is a direct effect demonstrated as a concentration -dependent effect on the endogenous miR-101 level (Figure S2A, S2B and S2C in Additional file 1). [score:2]
The regulation of IL-1β on miR-101 is at transcriptional level, because IL-1β can lead to an increased level of pre-miR-101 (Figure S3D in Additional file 1). [score:2]
To confirm if the effects of miR-101 were achieved by regulating Sox9, firstly, chondrocytes were co -transfected with miR-101 mimic or miR-Scr together with Sox9 vector with (Sox9 full length) or without (Sox9 CDS) the 3'UTR sequence. [score:2]
The functional analysis demonstrated that miR-101 could aggravate chondrocyte ECM degradation. [score:1]
Figure S2: miR-101 has an IL-1β concentration dependent effect in primary chondrocyte. [score:1]
However, the average miR-101 level was 0.56-fold that of the miR-Scr group (Figure S3A in Additional file 1). [score:1]
Figure 3 Effects of miR-101 on IL-1β -induced chondrocyte extracellular matrix (ECM) degradation. [score:1]
Interestingly, the morphological changes and decreased cell density of the chondrocytes were likewise seen after miR-101 mimic transfection, regardless of whether they were treated with IL-1β or not (Figure S4 in Additional file 1). [score:1]
Effects of miR-101 on IL-1β -induced ECM degradation. [score:1]
The miR-101 mimic significantly reduced the luciferase activity in the wild-type Sox9 3'UTR reporter but not in the mutant reporter (Figure 2C). [score:1]
The effect of miR-101 was partly reversed in the chondrocytes co -transfected with Sox9 CDS vector without 3'UTR for miR-101 binding (Figure 4C and 4D). [score:1]
All subsequent work was then focused on miR-101. [score:1]
Figure S5: Effect of miR-101 transfection on the components of IL-1β signaling. [score:1]
Our findings provide evidence that miR-101 might participate in inflammation and cause chondrocyte ECM degradation. [score:1]
The underlined sequences indicate a sequence complementary in miR-101 to a specific binding site within the 3'UTR of Sox9. [score:1]
Thus, we examined the basal levels of miR-101 in primary chondrocytes. [score:1]
The oligonucleotide probes used to detect miR-101 and U6 snRNA are: miR-101, 5'- TTCAGTTATCACAGTACTGTA and U6, 5'-AACGCTTCACGAATTTGCGT, as previously reported [24]. [score:1]
miR-101 has been associated with cancer [24, 36, 37] and immune response [38]. [score:1]
Further research is necessary to obtain additional information on miR-101 function. [score:1]
However, miR-101 has no influence on the classic components of IL-1β pathway such as total NF-kB and the nuclear translocation of nuclear factor (NF)-kB (Figure S5D and S5E in Additional file 1). [score:1]
Therefore, our work focused on miR-101. [score:1]
These results indicated that Sox9 participates in the miR-101 function during IL-1β -induced chondrocyte ECM degradation. [score:1]
miR-101 participates in IL-1β -induced chondrocyte ECM degradation. [score:1]
[1 to 20 of 82 sentences]
2
[+] score: 207
Other miRNAs from this paper: rno-mir-140, rno-mir-101b, rno-mir-27b, rno-mir-34a, rno-mir-199a
Interestingly, the miR-101 mimic–expressing cells (GFP, green fluorescence) showed low Sox9 expression (stained in red fluorescence), and low miR-101 mimic–expressing cells showed higher Sox9 expression (Figure 2c), indicating that miR-101 regulated Sox9. [score:10]
Normal rats were divided into four groups: rats were injected with Ad-miR-101 mimic (mimic group), Ad-miR-101 inhibitor (inhibitor group), both Ad-miR-101 mimic and inhibitor (mimic+inhibitor group), and normal rats were used as control (normal group). [score:9]
The mechanism study demonstrated that miR-101 promoted the expression of several ECM degradation-related genes expression, Il-6, Adamts-1, Adamts-5, and Postn increased, but not Mmp-13 and Adamts-4. We also found that Pthlh (parathyroid hormone-like hormone), which can affect collagen type II by regulating Sox9, is a potential target of miR-101 according to the miRNA target prediction databases and luciferase assay. [score:9]
These results demonstrated that exogenous miR-101 mimic could penetrate into the cartilage, express miR-101, and regulate its target- Sox9 expression. [score:8]
The downregulated expression of Sox9 in the cartilage of MIA rats was reversed after the injection of Ad-miR-101 inhibitor (Figure 2f, g). [score:8]
We found that Il-6, Adamts-1, Adamts-5, Postn, and Itga 1 were upregulated, whereas Pthlh was downregulated by miR-101, which was consistent with the microarray data (Figure 6c). [score:7]
Eighty-five of these genes were upregulated, and 21 were downregulated at the presence of miR-101. [score:7]
[19] A recent study has shown that miR-101 aggravates chondrocyte ECM degradation by directly targeting and regulating Sox9 expression. [score:7]
[20] Expression changes in miR-101 and Sox9 after injecting Ad-miR-101 mimic and inhibitor in the cartilage of MIA ratsTo test whether exogenous miR-101 can penetrate into the cartilage, frozen sections of rat knees were examined by confocal microscopy after the injection of green fluorescent protein (GFP)–tagged Ad (adenovirus)-miR-101 mimic, Ad-miR-101 inhibitor, or Ad-Scr (scramble). [score:7]
In the present study, Sox9 expression was regulated by injecting Ad-miR-101 mimic and inhibitor in the cartilage of MIA rats. [score:6]
Our previous report demonstrated that downregulated miR-101 expression prevented the IL-1β–induced ECM degradation in chondrocytes. [score:6]
This result indicates that the inhibitory effect is via suppression of endogenous miR-101 (Figure 2e). [score:5]
The rats in the MIA group were injected with physiological saline; the Scr group was injected with Ad-Scr; the mimic group was injected with Ad-miR-101 mimic; and the inhibitor group was injected with Ad-miR-101 inhibitor. [score:5]
Expression changes in miR-101 and Sox9 after injecting Ad-miR-101 mimic and inhibitor in the cartilage of MIA rats. [score:5]
miR-101 expression increased in the cartilage of MIA rats and was reversed after the injection of Ad-miR-101 inhibitor. [score:5]
The miR-101 mimic, inhibitor, and Scr templates were inserted into the miRNA expression plasmid pDC316-siRNA (kl626) (Genechem, Shanghai, China). [score:5]
Our previous study revealed that miR-101 targets Sox9 in regulating ECM synthesis. [score:4]
The expression levels of cytokines were significantly increased after the injection of miR-101 mimic but decreased after the injection of miR-101 inhibitor compared with the control group (Scr; P < 0.05), including cartilage-related genes: IL-1α, IL-2, IL-13, MMP-2, TIMP-2, TIMP-3, TGF-β2, TGF-β3, VEGF (Figure 7), and other cytokines (Supplementary Table S2). [score:4]
To elucidate the feasibility of using miR-101 as a therapeutic target, several factors should be studied. [score:3]
To study the mechanism of miR-101 on cartilage degradation, cartilage samples from the mimic group and inhibitor group at 1 day were examined by microarray. [score:3]
Immunnohistochemical assessment of the cartilage in MIA rats with miR-101 mimic and inhibitor treatment. [score:3]
Potential target sites of Pthlh and miR-101 predicted by databases. [score:3]
The expression of these genes relative to 18s RNA and that of miR-101 relative to U6 (RiboBio) were determined using the 2 [−ΔΔ]CT method. [score:3]
The expression of miR-101 can penetrate into whole layer of cartilage (Figure 2a, 7– 9). [score:3]
After the cotransfection of these DNAs, homologous recombination occurred to generate three recombinant Ads, namely, Ad-miR-101 mimic, Ad-miR-101 inhibitor, and Ad-miR-Scr. [score:3]
The expression of miR-101 significantly increased 1 day after the injection and lasted for 6 days (Figure 2b, d). [score:3]
[20] Another study found that miR-101 expression is higher in OA chondrocytes than that in normal chondrocytes. [score:3]
According to the sequences on miRbase (MI0000886), miR-101 mimic, inhibitor, and Scr were designed and synthesized by Genechem (Shanghai, China). [score:3]
The rats' knee joints were first injected with Ad-Scr, Ad-miR-101 mimic, and Ad-miR-101 inhibitor. [score:3]
We also found that IL-1α, IL-2, IL-13, MMP-2, TIMP-2, TIMP-3, TGF-β2, TGF-β3 and VEGF increased after the injection of miR-101 mimic and decreased after the injection of miR-101 inhibitor. [score:3]
The rats were injected with Ad-miR-101 mimic (M) or Ad-miR-101 inhibitor (I), and Ad-miR-scr was used as a negative control (N). [score:3]
Expression patterns of miR-101 and Sox9 in the cartilage of MIA rats. [score:3]
By contrast, miR-101 inhibition reduced cartilage degradation in vivo. [score:3]
Sox9, a target of miR-101, significantly decreased at both the mRNA (Figure 1b) and protein levels (Figure 1c). [score:3]
Subsequently, miR-101 mimic or inhibitor was injected into the knees of MIA rats as a therapeutic reagent. [score:3]
[20] To test whether exogenous miR-101 can penetrate into the cartilage, frozen sections of rat knees were examined by confocal microscopy after the injection of green fluorescent protein (GFP)–tagged Ad (adenovirus)-miR-101 mimic, Ad-miR-101 inhibitor, or Ad-Scr (scramble). [score:3]
Expression patterns of miR-101 and Sox9 in the cartilage of MIA ratsTo examine whether miR-101 participates in the cartilage degradation of MIA rats, the cartilage was harvested and analyzed after mono-iodoacetate injection at 24 hours. [score:3]
The expression of miR-101 significantly increased (Figure 1a). [score:3]
We found that the administration of miR-101 could sufficiently cause cartilage degradation, whereas miR-101 inhibitor caused recovery. [score:3]
Ad-miR-101 mimic and Ad-miR-101 inhibitor were injected 3 days (concentration = 1 × 109 pfu, 50 μl per knee, once per 3 days) after the injection of mono-iodoacetate and continued until the rats were sacrificed. [score:3]
22, 23, 24 The expression of miR-101 increased and that of Sox9 decreased in the cartilage of MIA rats compared with those of normal rats. [score:2]
Moreover, Pthlh was predicted to be a target of miR-101 based on microRNA databases and luciferase assay (Supplementary Figure S3), suggesting that an interesting target of miR-101 needs further investigation. [score:2]
Further analysis by microarray showed that several cartilage degradation–related genes were regulated by miR-101, and cartilage-related cytokines in the joint synovial fluid were changed. [score:2]
In the present study, injected miR-101 was observed in both cartilage and synovium, indicating that miR-101 could directly penetrate cartilage or may do so through infected synovium secretions. [score:2]
Under fluorescent microscopy, GFP was observed in the cartilage and synovium (Figure 2a, 1– 6), indicating that miR-101 could penetrate both the synovium and cartilage. [score:1]
Cartilage degradation was aggravated at 7 and 14 days after the first injection of miR-101 mimic. [score:1]
Immunnohistochemical assessment of the cartilage in normal rats after miR-101 treatment. [score:1]
To examine whether miR-101 participates in the cartilage degradation of MIA rats, the cartilage was harvested and analyzed after mono-iodoacetate injection at 24 hours. [score:1]
Moreover, injecting miR-101 mimic worsened cartilage degradation, whereas silencing miR-101 reduced it in MIA rats. [score:1]
These rats were used to assess whether the injection of miR-101 mimic is sufficient to cause cartilage degradation. [score:1]
This study investigated the feasibility of joint injection of miR-101 mimic or inhibitor to prevent cartilage degradation in MIA rats. [score:1]
Collectively, the injection of miR-101 affected not only the cartilage degradation–related genes but also the cytokine secretion of the synovium. [score:1]
[21] Therefore, studies should be conducted to determine whether miR-101 functions in animal OA pathogenesis in vivo and investigate the feasibility of using miR-101 as a potential therapeutic target. [score:1]
Silencing of microRNA-101 prevents IL-1β -induced extracellular matrix degradation in chondrocytes. [score:1]
Moreover, miR-101 silencing prevents IL-1β–induced chondrocyte ECM degradation in vitro. [score:1]
However, whether or not locked nucleic acid–modified miR-101 inhibition can be used to prevent cartilage degradation in OA needs further investigation. [score:1]
To our knowledge, this study is the first to evaluate the therapeutic effect of miR-101 inhibition on cartilage degradation in MIA rats. [score:1]
Effect of miR-101 treatment on cartilage degradation in MIA rats. [score:1]
Mechanism study of miR-101 treatment on cartilage degradation. [score:1]
Interestingly, we found that the secretions of aggrecan (Figure 5b) and collagen type II (Figure 5c) in the mimic group were significantly decreased among the four groups after the injection of Ad-miR-101 mimic at 14 days, although no difference was found in the structure of cartilage from HE staining (Figure 5a). [score:1]
[1 to 20 of 60 sentences]
3
[+] score: 24
[66] Epigenetic associated genes DNMT3A and DNMT 3B, targets of miR-101a, 124, 29a, 30e, have been found to be upregulated in the PFC of depressed suicide subjects. [score:6]
[57] Another synaptic plasticity-related gene CREB is a target of multiple miRNAs (miR-101a, miR-203, miR-218, miR-721, miR-409-5p). [score:3]
[50] MiR-101a, miR-124, miR-721, miR-181c and miR-365 target ERK/MAPK1, a gene involved in several physiological functions in brain including cell proliferation, differentiation and cell survival. [score:3]
As listed in Supplementary Table 6, these genes were predicted targets of miR-124, miR-101, miR-29a, miR-30e, miR-181c, miR-365 and miR-218. [score:3]
Several components of PI3 kinase signaling such as AKT3, PTEN, PIK3C2A and PIK3C2, which play critical roles in neurotrophin -mediated signaling and cell survival, [62] are targets of miR-29a, miR-101a, miR-124, miR-181c and miR-678. [score:3]
[63] A large number of cyclic AMP-specific PDEs are also targets of multiple miRNAs (miR-101a, miR-124, miR-721, miR-137, miR-19b, miR-30e, miR-365). [score:3]
For example, miR-218, miR-324-5p, miR-365 and miR-146a were localized on chromosome 10; miR-764-5p and miR-351 on chromosome X; miR-101 and miR-30e on chromosome 5; miR-582 and miR-137 on chromosome 2; miR-153 and miR-203 on chromosome 6; miR-124 and 181a on chromosome 3 and miR-135a*/miR-135a-3p and let-7i on chromosome 7. Some of the miRNAs that were localized on the chromosome and in close proximity showed the same direction of changes. [score:2]
These include: AKT1 (miR-101a, miR-124, miR-181c, 29a, 365), BCL2 (153, 30e, 365), BDNF (124, 30e, 365), CREB (101a, 124, 721, 181c, 203, 218, 582-5p, 351, 155, 200c), DNMT3A (101a, 29a, 30e), ETS (351, 155, 200c), GABAR1 (101a, 721, 137, 181c, 155, 203), GRIA4 (124, 137, 218), GSK3B (155, 101a, 124, 137, 19b, 218, 29a), MAPK1 (miR-101a, 124, 721, 181c, 365), NR3C1(29a, 30e, 365, 582-5p, 124), phosphodiesterase 4 (PDE4a) (101A, 124, 137, 19B) and PDE4D (101a, 124, 721, 137, 30e, 365). [score:1]
[1 to 20 of 8 sentences]
4
[+] score: 22
The expression levels of miRNAs miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 expression levels were down-regulated in the serum of diabetic rats and IOMe -injected rats (A). [score:8]
0172429.g005 Fig 5 The expression levels of miRNAs miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 expression levels were down-regulated in the serum of diabetic rats and IOMe -injected rats (A). [score:8]
The expression levels of miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 were significantly down regulated in the blood serum of diabetic and IOMe -injected rats (Fig 5A) whereas, the expression levels of these miRNAs are normally high. [score:6]
[1 to 20 of 3 sentences]
5
[+] score: 14
In details, miR-101a was down-regulated, and it decreased cell number in the G2-M phase with consistently increases in cell number in the G1 or S phases; meanwhile, miR-92a, miR-25, miR-93, and miR-106b were up-regulated, and they decreased the G1 cell population while concomitantly increasing the accumulation of cells in the S and G2 phases. [score:7]
As we expected, miR-106b, miR-93, miR-25 and miR-92a were significantly up-regulated at 24 and 36 hours after 2/3 PH, and miR-101a was down-regulated at 12, 24 and 36 hours after 2/3 PH (Supplementary Figure 5). [score:7]
[1 to 20 of 2 sentences]
6
[+] score: 13
A recent study reported that the long non-coding RNA XIST functioned as a competing endogenous RNA to modulate EZH2 expression by mopping up miR-101 in gastric cancer [11], and that XIST is targeted and regulated by miR-92b in Hepatocellular carcinoma (HCC). [score:6]
Chen D. L. Ju H. Q. Lu Y. X. Chen L. Z. Zeng Z. L. Zhang D. S. Luo H. Y. Wang F. Qiu M. Z. Wang D. S. Long non-coding RNA XIST regulates gastric cancer progression by acting as a molecular sponge of miR-101 to modulate EZH2 expressionJ. [score:4]
Moreover, lncRNA-XIST has been found to inhibit the levels of miR-34a-5p in human nasopharyngeal carcinoma (NPC) and miR-101 in gastric cancer [18]. [score:3]
[1 to 20 of 3 sentences]
7
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
miR-101, miR-378 and 143 expression patterns. [score:3]
The expression of miR-101 also varied among the tissues; it could be detected in liver, stomach, salivary glands, pancreas, spleen, lymph node and testes but not in thymus and bladder tissues. [score:3]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 4 sentences]
8
[+] score: 9
Mir-101, which we found up-regulated in normal heart, was found instead down-regulated in patients with atrial fibrillation [85]. [score:6]
Among miRNAs preferentially expressed in the heart (Figure 4) mir-148a, mir-101, and mir-138 are particularly important. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
Among the most up-regulated miRNAs were miR-196b and let-7h, and miR-130c and miR-101a were the most down-regulated. [score:7]
[1 to 20 of 1 sentences]
10
[+] score: 7
Tu X MicroRNA-101 suppresses liver fibrosis by targeting the TGFβ signaling pathwayJ. [score:4]
For example, Tu et al. [33] reported that lentivirus -mediated ectopic expression of miR-101 in liver greatly reduced CCl [4] -induced liver fibrosis and Hyun et al. [18] showed that systemic delivery of miR-378a-3p by nanoparticle technology significantly reduced hepatic damage. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 6
Other miRNAs from this paper: rno-mir-101b
According to previous studies, ras-related proteins were associated with cancer cell metastasis [24, 25], and ras-related C3 botulinum toxin substrate 1 was associated with differential roles such as cell proliferation which could be inhibited by miR-101 [26] and signal transduction to upregulate in esophageal squamous cell carcinoma and esophageal adenocarcinoma [27]. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 5
For example, miR-101 and miR-29b both target Mcl-1 to prevent apoptosis 6, 7, while miR-499a impairs myocyte survival by repressing the expression of histone deacetylases [8]. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 5
Overexpression of miR-101 inhibits interstitial fibrosis of infarct hearts [16]. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 5
Future studies will investigate whether UA directly affects the expression of autophagy-related genes or specific miRNAs, such as miR-196, miR-101, and miR30A, which in turn regulate the expression of autophagy-related genes. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 3
Kim J. H. Lee K. S. Lee D. K. Kim J. Kwak S. N. Ha K. S. Choe J. Won M. H. Cho B. R. Jeoung D. Hypoxia-responsive microRNA-101 promotes angiogenesis via heme oxygenase-1/vascular endothelial growth factor axis by targeting Cullin 3 Antioxid. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Mouse miR-124a as well as miR-128, miR-101 and miR-132 have been reported to be expressed specifically in brain [15]. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
Those miRNAs differentially expressed on the microarrays with greatest fold changes, miRNA-101a, miRNA-142-3p, miRNA-433 and miRNA-96, were further analyzed. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Overexpression of miR-133 or miR-101 attenuated cardiac hypertrophy [20] or cardiac fibrosis [21] respectively. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
Regulation of miR-101/miR-199a-3p by the epithelial sodium channel during embryo implantation: involvement of CREB phosphorylation. [score:2]
[1 to 20 of 1 sentences]
20
[+] score: 2
The 7 included one isomiR (of rno-miR-101a-3p, RPM ~ 10), two rRNA fragments, two tRNA fragments and two unidentified. [score:1]
LA rats Small RNA type and sequence Mean RPM Mean RPM SNL-reg diff-reg (canonical miRNA or RNA type)(sham pools)(SNL pools)subtraction method (SNL/sham fold-change )  HALAHALAHALAHA-LA unique-sequence miRNA isoform (isomiR), all pools, and those added by HA_SNL1 pool exclusion *UAUAGUACUGUGAUAACUGACU (rno-miR-101a-3p)11.79.39.911.3−0.167 (−1.182)0.194 (1.215)−0.361 (0.397)CAGUGCAAUGUUAAAAGGGC (rno-miR-130a-3p) *38.041.948.245.00.237 (1.268)0.071 (1.074)0.166 (0.194)UCCCUGAGACCCUAACUUG (rno-miR-125b-5p) *47.830.435.533.1−0.295 (−1.346)0.085 (1.089)−0.380 (0.435)UGGACGGUGUGAGGCC (sha-miR- 5105) *11.015. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 2
Other miRNAs from this paper: rno-mir-101b
The molecular mechanisms involved in the cellular effects of flavonoids reflect a similar diversity: from a change in inner mitochondrial membrane permeability leading to cell death by many flavonoids [4] to selective regulation of the miR-101/MKP-1/MAPK pathway to decrease the inflammatory response [5] by genkwanin. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 1
Similar observation were also found in miR-27a, miR-101, miR-9, miR-667. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
miR-101, etc. ) [score:1]
[1 to 20 of 1 sentences]