sort by

82 publications mentioning rno-mir-132

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-132. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 274
Other miRNAs from this paper: rno-mir-103-2, rno-mir-103-1, rno-mir-139, rno-mir-214, rno-mir-487b
Exposure to the clinostat up-regulates miR-132-3p expression levels in osteoblasts in vitroTo further validate whether the differentially expressed miRNAs keep the corresponding variation in osteoblasts exposed to simulated microgravity conditions, prOB cells were cultured in a Rotating Wall Vessel Bioreactor (RWVB) clinostat and tested after rotating for 48 h. The effects of clinorotation were assessed by observing ALP activity and expression level of Runx2, the transcription factors critical for osteoblast differentiation (data not shown). [score:10]
Thus, our results demonstrate that miR-132-3p directly targets Ep300 and inhibits osteoblast differentiation in part by decreasing Ep300 expression, which, in turn, leading to suppression of the synergistic activity and acetylation of Runx2. [score:10]
Our experimental data demonstrated that miR-132-3p overexpression results in down-regulation of Ep300 at the protein level, whereas functional inhibition of miR-132-3p by its anti-miRNA results in an increase in Ep300, strongly suggesting that Ep300 is regulated by miR-132-3p. [score:9]
Our in vitro experiments demonstrated that up-regulation of miR-132-3p in prOB cells significantly promoted the expression levels of Runx2, ALP and Osx, whereas down-regulation of miR-132-3p had an opposite effect on these markers. [score:9]
Down-regulation of endogenous miR-132-3p expression partly attenuates inhibition of osteoblast differentiation by clinorotation in vitro. [score:8]
To test whether miR-132-3p directly inhibits Ep300 protein translation by binding to a predicted target site in the 3′ UTR, a dual luciferase reporter system was constructed containing either the wild-type Ep300 3′ UTR sequence (WT) or an Ep300 3′ UTR mutant sequence (MUT) (Fig. 5a). [score:8]
By contrast, Runx2, Osx and ALP gene expression (Fig. 3b, anti-miR group), ALP protein activity (Fig. 3c, anti-miR group), and Runx2, Osx protein levels (Fig. 3e) were all increased when miR-132-3p was down-regulated by transfection of anti-miR, suggesting that inhibition of miR-132-3p could promote osteoblast differentiation. [score:8]
Thus, according to our studies and previous reports, up-regulation of miR-132-3p induced by simulated microgravity can decrease the acetylation and transcriptional activity of Runx2 by inhibiting expression of the histone acetyltransferase Ep300. [score:8]
To obtain further insight into the molecular mechanisms of the regulation mediated by miR-132-3p, we identified the potential targets of miR-132-3p that are related to osteoblast differentiation using the miRNA target prediction algorithms TargetScan and PicTar, which have low false positive rates. [score:8]
Our data show that down-regulation of endogenous miR-132-3p expression partially attenuates the inhibition of osteoblast differentiation by simulated microgravity in vitro. [score:8]
Further testing demonstrated that miR-132-3p mainly suppressed protein translation of Ep300 (Fig. 5d) but had little effect on gene expression (Fig. 5c). [score:7]
ALP activity (Fig. 3c miR -mimic group) and protein expression of Runx2 and Osx (Fig. 3d) also decreased, suggesting that overexpression of miR-132-3p inhibited osteoblast differentiation. [score:7]
In our study, overexpression of miR-132-3p decreased the transcriptional activity of Runx2 and was coordinated with the change during silencing of Ep300 expression by targeted siRNA. [score:7]
To study the molecular mechanisms by which miR-132-3p regulates osteoblast differentiation, we predicted the potential targets of miR-132-3p by using miRNA target prediction software. [score:6]
miR-132-3p directly inhibits Ep300 protein expression in prOB cells exposed to a simulated microgravity environment. [score:6]
To our knowledge, this is the first report demonstrating that miR-132-3p serves as a negative regulator of the osteoblast differentiation in simulated microgravity by hindering translation of Ep300, which in turn, results in suppression of the synergistic activity and stability of Runx2. [score:6]
It can be concluded that simulated microgravity can inhibits osteoblast differentiation partly by up -regulating the expression of miR-132-3p. [score:6]
Exposure to the clinostat up-regulates miR-132-3p expression levels in osteoblasts in vitro. [score:6]
Therefore, we hypothesized that the suppression of Ep300 expression by miR-132-3p in prOB cells could decrease the stability and acetylation levels of Runx2. [score:5]
Importantly, our results demonstrate that functional inhibition of miR-132-3p can accelerate osteogenic differentiation and effectively attenuate the negative effect of clinorotation on in vitro osteoblast differentiation, suggesting that therapeutic approaches targeting miR-132-3p may be useful for enhancing bone formation and may be protective against microgravity -induced bone loss. [score:5]
miR-132-3p was up-regulated both in bone tissue and prOB cells after simulated microgravity exposure, suggesting its possible regulatory effects on osteoblast function. [score:5]
Inhibition of Ep300 expression by miR-132-3p decreases the stability and acetylation levels of Runx2. [score:5]
Inhibition of Ep300 expression by miR-132-3p significantly decreases the stability and acetylation levels of Runx2. [score:5]
How to cite this article: Hu, Z. et al. miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity. [score:5]
Additionally, there are more than a hundred of predicted targets for miR-132-3p in TargetScan and PicTar algorithms. [score:5]
of qRT-PCR showed that expression of miR-132-3p was significantly up-regulated compared with other miRNAs during clinorotation (Fig. 2c), displaying a similar variation in bone tissue. [score:5]
miR-132-3p inhibits Ep300 protein expression in prOB cells exposed to a simulated microgravity environment. [score:5]
Primary rat osteoblast cells at 30–50% confluence cultured in by the DMEM normal serum media were shifted to serum-free OPTI-MEM media and transfected with oligonucleotides, including mimics and inhibitors of miR-132-3p (RiboBio), siRNA targeting Ep300 GenePharma (Shanghai, China) and their respective negative controls using the Lipofectamine 2000 reagent (Invitrogen) for 6 h according to the manufacturer’s instructions. [score:5]
Specifically, miR-132-3p was up-regulated by simulated microgravity and functioned as a negative regulator of osteoblast differentiation. [score:5]
This result suggests that Ep300 is a direct target of miR-132-3p. [score:4]
Up-regulation of miR-132-3p both in the bone tissue of HU rat femurs and prOB cells cultured in simulated microgravity. [score:4]
Silencing of miR-132-3p expression partially attenuates the negative effects of simulated microgravity on osteoblast differentiation in vitroTo test whether therapeutic inhibition of miR-132-3p could rescue the osteoblast differentiation decrease caused by simulated microgravity, prOB cells were transfected with the anti-miR of miR-132-3p for 12 h and then exposed to simulated microgravity for 48 h. miR-132-3p significantly decreased in the group transfected with anti-miR compared with the miR-N. C. group at the end of clinorotation (Fig. 4a). [score:4]
Whether these undisclosed target genes could participate in the miR-132-3p -mediated osteoblast differentiation is not known. [score:3]
Silencing of miR-132-3p expression partially attenuates the negative effects of simulated microgravity on osteoblast differentiation in vitro. [score:3]
Notably, the 3′ UTR of Ep300 possesses a 7-nt perfect match site for the miR-132-3p seed region predicted by both the TargetScan and PicTar algorithms. [score:3]
Sequences below indicate putative miR-132-3p target sites on the wild type 3′ UTR, the mutated derivative, and the pairing regions of miR-132-3p. [score:3]
To study the effects of miR-132-3p on osteoblast differentiation, prOB cells were transfected with either a miR-132-3p mimic (miR -mimic, 60 nM), an inhibitor (anti-miR, 80 nM) or its homologous miRNA negative control (miR-N. C. ). [score:3]
Cells were co -transfected with the pre-miR-132, inhibitor or a negative control (miR control) (RiboBio) at a concentration of 20 nM, respectively. [score:3]
Next, a further experiment revealed the time -dependent variation in miR-132-3p expression which was kept a continuous increase upon rotating and peaked at 48 h and then subsequently decreased close to the normal level during a 96 h clinorotation (Fig. 2d). [score:3]
These data strongly suggest that miR-132-3p has a suppressive effect on osteoblast differentiation. [score:3]
The two miR-132-3p target sites within the 3′ UTR of Ep300 are depicted as black boxes. [score:3]
In addition, angiogenic factors, such as VEGF and bFGF, can promote transcription of miR-132-3p in endothelial cells, which further silences p120RasGAP expression and active conformation to induce proliferation 47. [score:3]
Inhibition of miR-132-3p by anti-miR-132-3p effectively attenuated the negative effects of clinorotation on in vitro osteoblast differentiation. [score:3]
These results indicate that miR-132-3p is an inhibitor of osteoblast differentiation. [score:3]
miR-132-3p inhibits osteoblast differentiation in vitro. [score:3]
miR-132-3p may be a promising new therapeutic target to protect against the decreased bone formation induced by microgravity. [score:3]
Indeed, our Ep300 3′ UTR luciferase reporter assay confirmed that Ep300 is a direct target of miR-132-3p. [score:3]
However, the in vivo effects, such as whether silencing of miR-132-3p expression could counter the bone loss observed in HU rats, were not examined. [score:3]
miR-132-3p inhibits osteoblast differentiation in vitroTo evaluate the biological effects of miR-132-3p on osteoblast differentiation, the synthetic miR -mimic (analogue) and anti-miR (inhibitor) of miR-132-3p were transiently transfected into prOB cells to alter intracellular levels of miR-132-3p in vitro (Fig. 3a). [score:3]
To test whether therapeutic inhibition of miR-132-3p could rescue the osteoblast differentiation decrease caused by simulated microgravity, prOB cells were transfected with the anti-miR of miR-132-3p for 12 h and then exposed to simulated microgravity for 48 h. miR-132-3p significantly decreased in the group transfected with anti-miR compared with the miR-N. C. group at the end of clinorotation (Fig. 4a). [score:2]
All of these studies indicate a complicated and comprehensive regulatory role for miR-132-3p in cell proliferation and differentiation. [score:2]
It is notable, however, that some reports have indicated that miR-132-3p functions as a negatively regulator of the differentiation of dopamine neurons 46. [score:2]
To obtain a better understanding of miRNA -based regulatory mechanisms in microgravity, miR-132-3p was studied in more detail. [score:2]
Previously, miR-132-3p has been shown to play an important role in neurological development, synaptic transmission, inflammation, angiogenesis and even cancer. [score:2]
However, the effects of miR-132-3p on osteoblast differentiation, particularly under the simulated microgravity conditions we described in our study, have not been previously reported. [score:1]
These findings suggest that miR-132-3p plays a pivotal role in bone loss induced by simulated microgravity and is therefore a promising candidate for new therapeutic strategies. [score:1]
We examined the function of miR-132-3p in prOB cell differentiation in vitro under simulated microgravity. [score:1]
A one-way repeated measures analysis of variance (ANOVA) was used to compare the time course variables of miR-132-3p expression when exposed to simulated microgravity for different time periods (0 h, 24 h, 48 h, 72 h and 96 h). [score:1]
This angiogenic role could implicate miR-132-3p in the oncogenesis of cancers, such as chronic lymphoblastic leukemia 48, osteosarcoma 49, and breast cancer 50. [score:1]
Moreover, additional experiments demonstrated that silencing miR-132-3p by anti-miR-132-3p effectively attenuated the negative effect of clinorotation on in vitro osteoblast differentiation. [score:1]
To evaluate the biological effects of miR-132-3p on osteoblast differentiation, the synthetic miR -mimic (analogue) and anti-miR (inhibitor) of miR-132-3p were transiently transfected into prOB cells to alter intracellular levels of miR-132-3p in vitro (Fig. 3a). [score:1]
In neural cells, miR-132-3p promotes neuronal outgrowth and sprouting by decreasing the levels of p250GAP, a GTPase activating protein linked to neuronal differentiation 45. [score:1]
The fragment of the Ep300 3′UTR containing the predicted binding site for rno-miR-132-3p was amplified from rat genomic DNA. [score:1]
[1 to 20 of 63 sentences]
2
[+] score: 192
Given the prediction that Mapk1 is a target of miR-132-3p and our observation that miR-132-3p is down-regulated 20 min following LTP, we hypothesized that this would be reflected in a subsequent up-regulation of Mapk1 protein levels. [score:9]
Glucocorticoid attenuates brain-derived neurotrophic factor -dependent upregulation of glutamate receptors via the suppression of microRNA-132 expression. [score:8]
Our data suggest that down-regulation of miRNA, in particular miR-132-3p and miR-34a-5p, releases tonic inhibition and allows the expression of key plasticity-related proteins, including MAP kinase and glutamate receptor subunits which in turn may contribute to the consolidation of LTP. [score:8]
At 24 h post-DBS, a time we previously reported to be associated with a generalized down-regulation of mRNA expression (Ryan et al., 2012), there was no alteration in the expression of either miR-34a-5p (p = 0.67, n = 4, Figure 3A) or miR-132-3p (p = 0.74, n = 4, Figure 3B). [score:8]
While previously we have shown that miR-34a-5p is down-regulated at 5 h post-DBS (Ryan et al., 2012), further analyses showed no significant down-regulation of miR-132-3p at this time-point (p = 0.58, n = 7; Figure 3B), thus suggesting that the peak of its reduction lies closer to 20 min. [score:7]
In striking contrast to the down-regulation of mature miR-132-3p transcript, the miR-132 primary transcript was found to be concurrently up-regulated at 20 min. [score:7]
Having found that miR-34a-5p and miR-132-3p were rapidly down-regulated following LTP induction, we set out to explore the biological significance of this by identifying potential targets for miR-34a-5p and miR-132-3p. [score:6]
In contrast, we found that the primary transcript of miR-132-3p was dramatically up-regulated 20 min post-DBS (p = 0.04, n = 5; Figure 4B). [score:4]
Furthermore, the precise mechanisms underpinning the observed rapid down-regulation, including that of miR-132-3p and miR-34a-5p, are unknown. [score:4]
In contrast, we found a more succinct, transient down-regulation of miR-132-3p, with a concurrent rapid and transient increase in the levels of the miR-132/212 primary transcript, but no alteration in the co-transcribed mature miR-212-3p. [score:4]
VALIDATION OF miR-132-3p TARGETS USINGTo test whether miR-132-3p can bind to these putative target gene transcripts, we carried out dual luciferase assays using the ψCheck-2 plasmid containing synthetic insert sequences (∼60 nucleotides) including the MREs and adjacent sequences from each mRNA 3′UTR (Table 1). [score:4]
As LTP induction is crucially dependent on activation of NMDARs, we tested whether down-regulation of miR-34a-5p or miR-132-3p was dependent on the activation of NMDARs (Abraham and Mason, 1988). [score:4]
A subset of the rapidly down-regulated miRNA (miR-34a-5p, miR-34c-5p, miR-132-3p, miR-181c-5p, miR-214-3p) were chosen for more in-depth analysis by RT-qPCR, based on previous associations with plasticity processes (Wayman et al., 2008; Schonrock et al., 2010; Agostini et al., 2011; Zovoilis et al., 2011; Ryan et al., 2012). [score:4]
By contrast, there was no significant regulation of p44-Mapk, the protein encoded by the Mapk3 transcript that does not have putative miR-132-3p target sites, at 5 h (p = 0.35) or 24 h (p = 0.91). [score:4]
One possible mechanism underlying the LTP -induced down-regulation of miR-34a-5p and miR-132-3p is a reduction in transcription and a concomitant decrease in the levels of their primary transcripts. [score:4]
This rapid down-regulation occurs via post-transcriptional mechanisms, at least for miR-34a-5p and miR-132-3p, and is likely to contribute to the consolidation of LTP at multiple levels, including amplifying the protein response. [score:4]
FUNCTIONAL SIGNIFICANCE OF miR-34a-5p AND miR-132-3p DOWN-REGULATION. [score:4]
RAPID DOWN-REGULATION OF MATURE microRNA, miR-34a-5p AND miR-132-3p, IS NMDAR DEPENDENT. [score:4]
When DBS was given in the presence of the NMDAR antagonist CPP, LTP of both the fEPSP and PS was blocked (Figures 1B,C), as was the down-regulation of miR-34a-5p and miR-132-3p. [score:4]
Our findings differ from those reported by Wibrand et al. (2010, 2012) who, in anesthetized animals, found no rapid changes in miR-34a-5p or miR-132-3p, but an up-regulation of miR-132-3p at 2 h (Wibrand et al., 2010, 2012). [score:4]
As such, changing expression of miR-132-3p can have broader consequences beyond Mapk1 regulation. [score:4]
Interactions between miR-132-3p and (A) four wild-type target MREs, and positive control and (B) miR-132-3p and three mutant target MREs, and positive control, as determined by dual luciferase assays. [score:4]
The same result was found for three of the four MRE inserts of interest (Hn1: p = 0.0002, n = 4; Klhl11: p = 0.007, n = 4; Mapk1: p < 0.0001, n = 4), indicating that miR-132-3p could regulate the expression of these three transcripts in vivo. [score:4]
Very little is known about either Hn1 or Klhl11, the other two genes that we identified as targets of miR-132-3p. [score:3]
Overall, these luciferase assays confirm Hn1, Klhl11, and Mapk1 as novel targets for regulation by miR-132-3p. [score:3]
We have shown in an in vitro assay that the expression of Mapk1 is likely to be regulated by miR-132-3p. [score:3]
This approach identified several plasticity-related genes as likely targets of miR-34a-5p and miR-132-3p (Table 2). [score:3]
Using the rat CA1 neuropil data as an estimation of the transcripts present in the dentate gyrus neuropil, this analysis reduced the predicted 1,379 targets to four: Ep300, Hn1, Klhl11, and Ptbp2, of which Ep300 and Ptbp2 had previously been shown to interact with miR-132-3p (Alvarez-Saavedra et al., 2011; Smith et al., 2011). [score:3]
Significant down-regulation of the luminescence ratio with the miR-132-3p mimic when compared to the negative control was observed for wild-type Hn1, Klhl11, and Mapk1. [score:3]
With mutant sequences, significant down-regulation of the luminescence ratio with the miR-132-3p mimic when compared to the negative control was observed for mutant Hn1, and Klhl11. [score:3]
PREDICTED miR-34a-5p AND miR-132-3p TARGETS. [score:3]
Plasmids containing MREs for glutamate receptor, ionotropic, AMPA 2 (Gria2), hematological and neurological expressed 1 (Hn1), kelch-like family member 11 (Klhl11), mitogen-activated protein kinase 1 (Mapk1), or a perfect complementary sequence to miR-132-3p were co -transfected into COS-7 cells with miRIDIAN rno-miR-132-3p mimic. [score:3]
miRNA-132 orchestrates chromatin remo deling and translational control of the circadian clock. [score:3]
Name of Insert Sequence miR-132-3p Perfect MatchCAGTGACTCTCGAGCAG CGACCATGGCTGTAGACTGTTAGACGCGGCCGCCAGTGACT Gria2 wildtype NM_017261.2 6745-72CAGTGACTCTCGAGCAG ATGAGGAGCAAGGCAAGGCTGTCAATTGACGCGGCCGCCAGTGACT Hn1 wildtype NM_001005876 1289-314CAGTGACTCTCGAGCAG GTACTTCTTAGTCCTGGACTGTTGCTGACGCGGCCGCCAGTGACT Klhl11 wildtype NM_001105838 2232-56CAGTGACTCTCGAGCAG GGCTGGAGATCCTTGGACTGTTACTGACGCGGCCGCCAGTGACT Mapk1 wildtype XM_006248658.1 4971-5000CAGTGACTCTCGAGCAG ACTTACTGTGCTATTGCATGACTGTTAAGGACGCGGCCGCCAGTGACT Gria2 mutant CAGTGACTCTCGAGCAGATGAGGAGCAAGGCAAATATATCAATTGACGCGGCCGCCAGTGACT Hn1 mutant CAGTGACTCTCGAGCAGGTACTTCTTAGTCCTGAAATATTGCTGACGCGGCCGCCAGTGACT Klhl11 mutant CAGTGACTCTCGAGCAGGGCTGGAGATCCTTGAAATATTACTGACGCGGCCGCCAGTGACT Mapk1 mutant CAGTGACTCTCGAGCAGACTTACTGTGCTATTGCATAAATATTAAGGACGCGGCCGCCAGTGACT rno-miR-132 mimic UAACAGUCUACAGCCAUGGUCG cel-miR-239b Negative Control UUGUACUACACAAAAGUACUG Target sequences are underlined. [score:3]
These analyses therefore predicted that Gria2, Hn1, Klhl11, and Mapk1 are novel targets of miR-132-3p. [score:3]
Together these data show a striking discrepancy in the LTP regulation of the primary and mature transcripts of miR-132-3p and miR-212-3p, suggesting that the LTP -induced reduction in mature miR-132-3p levels was also regulated by post-transcriptional mechanisms. [score:3]
These two novel targets of miR-132-3p offer interesting avenues for future research. [score:3]
FIGURE 3 Long-term potentiation differentially regulates mature miR-34a-5p and miR-132-3p. [score:2]
It is of note that we found no significant regulation at any time point of miR-212-3p, which is derived from the same primary transcript as miR-132-3p (20 min: p = 0.93; 5 h: p = 0.63; 24 h: p = 0.47; n = 4–5). [score:2]
FIGURE 4 Long-term potentiation differentially regulates the primary miRNA transcripts of miR-34a-5p and miR-132-3p. [score:2]
Using individual TaqMan qPCR assays, we confirmed reduced expression of miR-34a-5p and miR-132-3p (miR-34a-5p: p = 0.0001, n = 8; miR-132-3p: p = 0.001, n = 8; Figure 3), but not miR-34c-5p (p = 0.14, n = 9), miR-181c-5p (p = 0.46, n = 10) or miR-214-3p (p = 0.65, n = 9). [score:2]
To test whether miR-132-3p can bind to these putative target gene transcripts, we carried out dual luciferase assays using the ψCheck-2 plasmid containing synthetic insert sequences (∼60 nucleotides) including the MREs and adjacent sequences from each mRNA 3′UTR (Table 1). [score:2]
Likewise, molecules confirmed to interact with miR-132-3p include Mecp2, a plasticity-related transcriptional repressor (Klein et al., 2007), p250gap, a brain-enriched GTPase-activating protein for Rho family GTPases involved in NMDAR -dependent actin reorganization (Wayman et al., 2008), and the activity-regulated glutamate receptor subunits Gria1, Grin2a, and Grin2b (Kawashima et al., 2010). [score:2]
VALIDATION OF miR-132-3p TARGETS USING LUCIFERASE ASSAYS. [score:2]
Mutant Hn1 (p = 0.05, n = 4) and Klhl11 (p = 0.01, n = 4) MREs still significantly affected Renilla luciferase activity, suggesting that these seed sites are not critical and that 3′ compensatory binding is sufficient for regulation by miR-132-3p. [score:2]
FIGURE 5 MiR-132-3p binds to wild-type and mutant MRE of target gene transcripts. [score:2]
Neuronal activity rapidly induces transcription of the CREB-regulated microRNA-132, in vivo. [score:2]
Interestingly, previous studies have linked miR-132-3p and Mapk1, as levels of the pri-miR-132-3p/miR-212 cluster have been reported to be dependent on the Mapk pathway (Kawashima et al., 2010; Remenyi et al., 2010). [score:1]
As miR-132-3p has been reported to be located at synapses, these data suggest that synaptic levels of key glutamate receptor subunits are under the control of miR-132-3p. [score:1]
Taken together with our new data, this predicts that a potentially homeostatic feedback loop exists between miR-132-3p and Mapk1 levels, a mechanism that is not uncommon in miRNA function (Tsang et al., 2007). [score:1]
What drives this increase in the miR-132/212 primary transcript? [score:1]
This finding of an evoked activity-related increase in miRNA is in accord with the findings of Wibrand et al. (2010) in urethane-anesthetized animals, and raise the possibility that in awake animals the NMDAR -mediated reduction in the levels of mature miR-34a-5p and miR-132-3p out-competes a second, NMDAR-independent process, working to increase them. [score:1]
With Renilla luciferase expression under the control of the MRE following insertion, binding of the rno-miR-132-3p mimic to the MRE was measured as a decrease in Renilla luciferase activity as a result of decreased protein output. [score:1]
When DBS was delivered in the presence of CPP, the increase in the pri-miR-132 levels at 20 min was attenuated and was not significantly different from the LTP-stimulated, non-drug treated group (p = 0.08, n = 4; Figure 4B). [score:1]
This suggests that NMDAR activity was partially responsible for the LTP-related increase in miR-132-3p levels. [score:1]
It seems likely that this involves the LTP -induced activation of CREB (Abraham et al., 2002) as the promoter region of pri-miR-132/212 is intergenic and contains a cAMP response element (CRE; Nu delman et al., 2010). [score:1]
This mechanism may be employed to reset the levels of mature miR-132-3p and thereby contributing to an on-going capacity for long-term plasticity. [score:1]
In brief, annealed double stranded oligomers including the predicted rno-miR-132-3p miRNA binding elements (MREs) within the 3′ UTR of Gria2, Hn1, Klhl11, and Mapk1 transcripts, as well as mutant sequences where all guanines and cytosines were changed to adenines, and the perfect complimentary sequence to rno-miR-132-3p (Table 1), were cloned into the ψCheck-2 vector (Promega) and digested with XhoI and NotI-HF. [score:1]
COS-7 cells, seeded on 24-well plates (5 × 10 [4] cells/well; 4 h), were co -transfected with recombinant plasmid (400 ng/well), and either miRIDIAN miR-132-3p mimic or cel-miR-239b negative control sequences (Dharmacon, 240 pmol/well; Table 1) using Lipofectamine LTX with Plus Reagent (Invitrogen, 2.5 μl/well; 24 h). [score:1]
In contrast, the mutated Mapk1 MRE did not interact specifically with the miR-132-3p-3p mimic (p = 0.07, n = 4), suggesting that the seed site is necessary for miR-132-3p binding to Mapk1. [score:1]
[1 to 20 of 60 sentences]
3
[+] score: 146
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
Both ACTH and 17α-E2 up-regulated the expression of miRNA-212, miRNA-132, miRNA-154, miRNA-494, miRNA-872, miRNA-194, and miRNA-24-1, but reduced the expression of miRNA-322, miRNA-20b, miRNA-339, miRNA-27a, miRNA-551b, and miRNA-1224. [score:8]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96, and inhibited the expression of miRNA-138 and miRNA-19a. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96 and inhibited the expression of miRNA-138 and miRNA-19a (Fig. 4B ). [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
0078040.g006 Figure 6miRNA-132 and miRNA-214 binding sites in the 3′ UTR of the mouse SREBP-1c and LDLR genes mediate the downregulation of SREBP-1c and LDLR expression by miRNA-132 and miRNA-214, respectively. [score:6]
The level of expression of miR-212 and miR-132 was up-regulated (>1.5-fold) by both ACTH and 17α-E2 treatments. [score:6]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
miRNA-132 and miRNA-214 binding sites in the 3′ UTR of the mouse SREBP-1c and LDLR genes mediate the downregulation of SREBP-1c and LDLR expression by miRNA-132 and miRNA-214, respectively. [score:6]
miRNA-132 and miRNA-214 Suppress SREBP-1c and LDLR by Targeting Specific Site(s) within the 3′ UTR of SREBP-1c and LDLR, Respectively. [score:5]
Significant expression was also observed for miRNA-27a, miRNA-132 and miRNA-214, whereas very low expression was noted for all of the remaining (seven) miRNAs. [score:5]
We also obtained evidence that miR-132 and miRNA-214 inhibit the expression of SREBP-1c and LDLR, respectively. [score:5]
Likewise, expression of another predicted target gene of miR-132, HDAC3, was also unchanged by ACTH, 17α-E2 or DEX treatment (Fig. 5A). [score:5]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Here, we directly assessed the binding of miRNA-138, miRNA-132 and miRNA-182/miRNA-214 to the 3′UTR of StAR, SREBP-1c, and LDLR, respectively, and regulation of their expression levels, by carrying out luciferase reporter gene assays. [score:4]
ACTH treatment caused maximum up-regulation of two miRNAs, miRNA-212 and miRNA-132, with a fold-stimulation of 4.23 and 3.43, respectively. [score:4]
Real-time PCR (qRT-PCR) confirmed ACTH -mediated up-regulation of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96. [score:4]
Overexpression of pre-miRNA-132 and pre-miRNA-214 significantly decreased the luciferase activity of the 3′UTR of the SREBP-1c and LDLR reporter containing micRNA-132 and miRNA-214 binding sites, respectively (Fig. 6 ). [score:3]
Three genes, Mecp2, Ctbp1 and p250 GAP, have been recently identified as targets of miR-132 [36]. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
Overexpression of pre-miRNA-132 and pre-miRNA-214 significantly decreased the luciferase activity of the 3′UTR of the SREBP-1c and LDLR reporter containing micRNA-132 and miRNA-214 binding sites, respectively. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
CHO cells were co -transfected individually with StAR 3′-UTR (containing the putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), SREBP-1c 3′-UTR (containing the putative binding site for miRNA-132) ± pre-miRNA-132-3p, LDLR 3′-UTR (containing the putative binding site for miRNA-182), or LDLR 3′-UTR (containing the putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36h, followed by determination of luciferase activities. [score:1]
Seed sequences of the putative miRNA-138-5p, miRNA-132-3p and miRNA-182-5p/miRNA-214-3p binding sites in the 3′-UTR of mouse StAR, SREBP-1c and LDLR genes, respectively. [score:1]
Individual fragments of the 3′ UTR region of the StAR gene containing site I or site II binding site for miRNA-138-5p, the 3′-UTR of SREBP-1c containing a binding site for miRNA-132-5p, the 3′-UTR of LDLR containing a binding site for miRNA-182-5p or the 3′-UTR of LDLR containing site I, site II, or site III binding site for miRNA-214-3p were inserted downstream of the luciferase open reading frame of pMIR-REPORT vector. [score:1]
CHO cells were co -transfected individually with the StAR 3′-UTR (containing putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), the SREBP-1c 3′-UTR (containing putative binding site for miRNA-132) ± pre-miRNA-132-3p (panel C), the LDLR 3′-UTR (containing putative binding site for miRNA-182) (panel D), or the LDLR 3′-UTR (containing putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36 h (panel E). [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Moreover, cultured mouse granulosa cells exhibited a robust induction of miRNA-132 and miRNA-212 when challenged with 8BrcAMP [36]. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
One study reported a robust induction of miRNA-21, miRNA-132 and miRNA-212 following in vivo stimulation of mouse ovaries with LH/hCG [36]. [score:1]
[1 to 20 of 34 sentences]
4
[+] score: 145
Other miRNAs from this paper: rno-mir-3120
Hence, the overexpression of miR-132 could potentially mediate its effects during neuronal development and by altering gene expression in multiple brain regions. [score:6]
Our data suggest that miR-132 downregulates proteins whose expression is required for the fast-onset but short-duration memory pathways. [score:6]
miR-132 has been shown to target p250GAP, which regulates Rac1-PAK -mediated dendrospinogenesis (Vo et al., 2005; Wayman et al., 2008; Impey et al., 2010), and methyl CpG -binding protein 2 (MeCP2), a protein involved in dendritic development and synaptogenesis and whose modulation can alter synaptic plasticity (Collins et al., 2004; Asaka et al., 2006; Moretti et al., 2006; Klein et al., 2007). [score:5]
Inhibition of miR-132 in primary hippocampal cultures decreased spine density and size (Impey et al., 2010) whereas overexpression in vivo increased spine density (Hansen et al., 2010). [score:5]
Expression of a sponge construct to inhibit the function of miR-132 blocked ocular dominance plasticity induced by monocular deprivation in control animals (Mellios et al., 2011; Tognini et al., 2011). [score:5]
One such miRNA is miR-132, the expression of which is regulated by neuronal activity due to the presence of CRE elements in its promoter region (Vo et al., 2005; Nu delman et al., 2010; Wibrand et al., 2010). [score:4]
To further validate the virus we confirmed knockdown of the miR-132 target p250GAP. [score:4]
We have now shown that the specific expression of miR-132 within the PRh impairs short-term recognition memory, a process known to be dependent on the activity of the PRh. [score:3]
Long-term memory (24-h delay) was not affected by miR-132 overexpression (miR-132 D2, 0.187 ± 0.054, n = 18; EGFP D2, 0.214 ± 0.043, n = 18; P = 0.704; Fig 2C). [score:3]
Fig 1Lentiviral -mediated overexpression of miR-132. [score:3]
Repression of these target proteins has been shown to account for many of the observed physiological effects of miR-132 (Vo et al., 2005; Klein et al., 2007; Wayman et al., 2008; Impey et al., 2010). [score:3]
The time-course of the acute phase of CCh-LTD coincides with the period at which a behavioural deficit was observed in the miR-132 -overexpressing rats and, furthermore, we have previously reported that activity of mAChRs is required for novel object recognition memory at this time delay (Warburton et al., 2003; Tinsley et al., 2011a, b). [score:3]
Hansen et al. (2010) demonstrated impaired recognition memory in transgenic mice overexpressing miR-132 throughout the brain. [score:3]
Visual activity was shown to increase the expression of miR-132 in primary visual cortex. [score:3]
Fig 3Overexpression of miR-132 in the perirhinal cortex. [score:3]
The pre-miRNA sequence is excised from the mRNA, allowing expression of both miR-132 and EGPF from a single transcript. [score:3]
We did not observe any effect of miR-132 overexpression on long-term memory tested at 24 h so one would not necessarily predict effects on the later phases of plasticity. [score:3]
The targets of miR-132 responsible for this deficit are yet to be elucidated. [score:3]
It is interesting to note that only short-term memory mechanisms were affected by the overexpression of miR-132. [score:3]
Subsequently, we investigated whether overexpression of miR-132 was interfering with mAChR -dependent plasticity mechanisms, as we have shown previously (Warburton et al., 2003; Tinsley et al., 2011a, b) that blockade of mAChRs by scopolamine produces similar impairments in recognition memory as the overexpression of miR-132 observed in the current study (i. e. impairment at short delay but not at long delay). [score:3]
The effects of miR-132 overexpression of the late phase of CCh LTD and on LTP were more modest. [score:3]
Two-sample t-tests were used to determine the significance of the difference in miR-132 expression between behavioural groups. [score:3]
The impairment in LTD would be predicted by the overexpression of miR-132 reducing the actin depolymerisation underlying LTD -associated spine shrinkage (Zhou et al., 2004). [score:3]
To address this question we produced a lentiviral vector to overexpress miR-132 and used this to selectively transduce neurons within the PRh. [score:3]
miR-132 targets p250GAP, a Rac1 GTPase-activating protein (Vo et al., 2005). [score:3]
Fig 4Overexpression of miR-132 reduced plasticity in the PRh. [score:3]
Our results confirm and refine this previous study by showing that overexpression of miR-132 that is restricted to the adult PRh leads to impairment in recognition memory, and also highlight changes in synaptic plasticity that may underlie this impairment. [score:3]
It is possible that the impairment we find in LTP is due to some homeostatic adjustment to the chronic overexpression of miR-132, but the exact mechanisms remain to be elucidated. [score:3]
We demonstrate that the impaired plasticity seen as a result of miR-132 overexpression underlies a functional deficit in short-term recognition memory. [score:3]
Primary cortical neurons were transduced with either the miR-132 virus, an EGFP-only virus or virus expressing a control miRNA, and protein lysates were collected 7 days post-transduction. [score:3]
It has recently been reported that a transgenic mouse overexpressing miR-132 throughout the forebrain showed impairments in recognition memory (Hansen et al., 2010). [score:3]
The reduced acute depression and impairment of novel object recognition reported in this paper suggests an impairment in mAChR signalling caused by the overexpression of miR-132. [score:3]
showed reduced levels of p250GAP in the miR-132-transduced neurons (F [2,20] = 6.136, P < 0.05, n = 6; Fig. 1D and E) compared to either the EGFP or miRNA control, confirming that the miR-132 expressed from the viral cassette was processed to a functioning mature miRNA. [score:2]
These data provide novel insight into the importance of miR-132 in regulating the neuronal function that underpins learning and memory. [score:2]
Tognini & Pizzorusso (2012) have proposed a mo del whereby precise control of miR-132 levels is required for regulation of synaptic plasticity. [score:2]
Our observations give empirical support to the hypothesis that miR-132 regulates experience -dependent synaptic function. [score:2]
Several miRNAs, including miR-132, have been shown to regulate the size and number of dendritic spines and alter synaptic activity (Edbauer et al., 2010; Impey et al., 2010; Lambert et al., 2010). [score:2]
We now demonstrate that miR-132 can also regulate longer-term synaptic plasticity. [score:2]
To quantify the expression of miR-132 in transduced PRh we extracted the RNA from this region of a second group of rats 2 weeks after behavioural testing and analysed using a miR-132-specific TaqMan assay. [score:2]
Whilst this manuscript was in preparation two groups have demonstrated that miR-132 regulates experience -dependent ocular dominance plasticity (Mellios et al., 2011; Tognini et al., 2011). [score:2]
There was a significant difference in fEPSP amplitude between EGFP- and miR-132-transduced PRh in both the acute and late phases of CCH-LTD. [score:1]
However, the fEPSP amplitude one hour following HFS did not significantly differ between EGFP- and miR-132-transduced slices (Fig 4F; P = 0.058). [score:1]
Although there is some variability between individual studies, miR-132 generally appears to have a positive effect on both the frequency and amplitude of mEPSCs (Edbauer et al., 2010; Impey et al., 2010; Lambert et al., 2010) and also modulates short-term synaptic plasticity (Lambert et al., 2010). [score:1]
DNA oligonucleotides, complementary to mature miR-132 (Eurofins MWG) were radio -labelled with γ [32]P (PerkinElmer, USA). [score:1]
By repressing p250GAP levels miR-132 increases (via Rac1–PAK signalling) the activity of the actin depolymerising protein n-cofilin (Impey et al., 2010). [score:1]
Interestingly, activation of many of the receptors and channels required for the slow-onset long-lasting mechanisms would result in an increase in intracellular calcium concentration, which could lead to the phosphorylation of CREB (which we have previously demonstrated to be required for long-term memory; Warburton et al., 2005) and the transcription of miR-132. [score:1]
Furthermore we have shown, in miR-132-transduced PRh slices, deficits in synaptic plasticity that are probably substrates for the behavioural impairment. [score:1]
There were no significant differences between the EGFP- and miR-132-transduced rats. [score:1]
Therefore a delayed, downstream, increase in miR-132 may actually be permissive to long-term memory. [score:1]
To investigate function in vivo we injected lentiviral miR-132 -expressing vectors bilaterally into the PRh and assessed recognition memory using the novel object recognition paradigm (Fig 2A). [score:1]
In slices of PRh that had been transduced in vivo with miR-132 this acute depression was significantly reduced. [score:1]
Transduction of PRh with miR-132 lentivirus did not affect basal synaptic activity as shown by input–output analysis (Fig. 4C). [score:1]
Comparisons of LTP and LTD between EGFP- and miR-132-transduced slices were made over the last data point (mean response over 2 min) for each experiment. [score:1]
The miR-132 gene was cloned from rat genomic DNA and inserted upstream of the EGFP coding sequence in the lentiviral cassette (Fig. 1A). [score:1]
The fEPSP amplitude 50 min after the washout of CCh was significantly smaller in the EGFP-transduced slices than in the miR-132-transduced slices (Fig 4F; P < 0.05). [score:1]
However, in slices from the miR-132-transduced hemisphere there was no long-term depression and the responses returned to baseline amplitude (50 min post-CCh, 94.9 ± 2.3% of baseline, n = 3 slices, P = 0.35; Fig. 4E and F). [score:1]
To achieve this, miR-132 was injected into the left PRh and EGFP injected into the right PRh of each animal. [score:1]
Slices from the miR-132-transduced hemisphere showed no significant LTP (60 min post-HFS, 105.0 ± 3.5% of baseline, n = 5 slices; P = 0.102; Fig. 4D and F). [score:1]
The mean value of three technical repeats was used to calculate the relative expression of miR-132 by the ΔΔ C [t] method for each biological replicate. [score:1]
[1 to 20 of 59 sentences]
5
[+] score: 124
Interestingly, we did not find any attenuation or downregulation of miR-132/-212 expression in IMA patients receiving β-blockers, as compared to non-β-blocker -treated patients (Figure 5D), indicating that not all blood pressure-reducing agents can downregulate miR-132/-212 expression, which further supports the notion that AngII mediates a global upregulation of miR-132/-212 in humans. [score:13]
Furthermore, by inhibition of the Gαq subunit in cardiac fibroblasts, we demonstrated significant decreases in miR-132 and -212 expressions, pointing to Gαq protein activation as the responsible pathway for AngII -induced miRNA regulation in vitro [19]. [score:6]
Importantly, our results show that functional inhibition of the AT [1]R reversed the miR-132 and -212 expression levels, demonstrating that AngII is responsible for the regulation, possibly via the Gαq -dependent pathway. [score:6]
In conclusion, we found that miR-132 and -212 are increased in AngII -induced hypertension in vivo, in organs associated with blood pressure control, which partly mimics the “five miRNA” expression signature obtained by AT [1]R overexpression [19]. [score:5]
In line with the previous findings by Jeppesen et al. [19], this suggests that the upregulation of miR-132/-212 is a direct consequence of Gαq vasopressor stimulation pathways and not a result of secondary heart hypertrophy and fibrosis. [score:5]
ARB treated patients (n = 16) revealed a significant attenuation of miR-132 expression (0.55-fold), as well as a tendency for miR-212 downregulation (0.64-fold), as compared to non-ARB -treated patients (miR-132; 0.93 and miR-212; 1.01) (n = 16) (Figure 5B). [score:5]
Chronic AngII-Mediated Hypertension in Rats Increases miR-132/-212 Cluster Expression in Blood Pressure Regulating Organs: Heart, Aorta and Kidney. [score:4]
Interestingly, even though the ET-1 -induced hypertension had a much shorter duration than the sustained hypertension induced by AngII, both miR-132 and miR-212 were upregulated at a point in time when blood pressure was not (Figure 4). [score:4]
In contrast to our rat infusion mo del, only a modest blood pressure increase was observed in this mice strain, and miR-132/-212 was not significantly upregulated in mouse hearts (Figure 3). [score:4]
However, the levels of miR-132/-212 were not downregulated in patients treated with β-blockers. [score:4]
Even though miR-132 and miR-212 are expressed from the same precursor, we observed independent regulation in the different tissues in response to the same AngII infusion. [score:4]
Furthermore, miR-132 was found to be significantly upregulated in the plasma of AngII -induced hypertensive animals, whereas no regulation was observed for plasma miR-212 levels compared to the control rats (Figure 2B). [score:4]
Despite these limitations, we observed a significant downregulation of miR-132, as well as a robust attenuation of miR-212 in the ARB -treated patients. [score:4]
Interestingly, miR-132/-212 was upregulated in the aortas of mice stimulated with AngII from osmotic pumps for 14 days, but this study did not report blood pressure values [28]. [score:4]
In summary, these data indicate that upregulation of the miR-132/-212 cluster likely is part of a general response to Gαq-vasopressor stimulation of the ERK1/2 pathway and may be involved in a common AngII- and ET-1 -mediated signaling pathway leading to hypertension. [score:4]
In one study, miR-132 was reported to be constitutively expressed and released by pericyte progenitor cells, and transplantation of these cells into mice with myocardial infarction improves cardiac function through proangiogenic activities [25]. [score:3]
Since the miR-132 gene is clustered with the miR-212 gene and they are likely expressed together [21], we included miR-212 in further analyses. [score:3]
We found increased expression of miR-132 and -212 in the left ventricle, aorta and kidney, as well as in the plasma (Figure 2) after 10 days of sustained AngII -induced hypertension in rats, which is compatible with our pervious published in vitro study [19]. [score:3]
Interestingly, among the many dysregulated miRNAs, the second most significantly regulated miRNA was miR-132. [score:3]
For example, miR-132 and miR-212 are clustered closely in the genome and are transcribed together under the regulation of cAMP response element binding protein [8], which is a known AngII regulated gene [9, 10]. [score:3]
Treatment with Angiotensin II Receptor Blocker Attenuates the Expression of the miR-132/-212 Cluster in Human Hypertension. [score:3]
We previously demonstrated that AT [1]R signaling regulates miR-132 and -212 in HEK293N cells and in primary cultures of cardiac fibroblasts through the Gαq dependent pathway [19]. [score:2]
From a mechanistic point of view, these findings indicate that miR-132/-212, also in vivo, may be regulated through Gαq-ERK1/2 activation, which is one of the mutual steps in the AngII and ET-1 signaling pathways leading to hypertension [30– 32]. [score:2]
Since no anti-miR experiments have been conducted, it has not been possible to deduce the specific cause and effect relationship; however, the regulation of miR-132 and miR-212 is likely biological important, because although rats and humans share biological features in blood pressure control, they have multiple differences in the molecular subtypes of ion channels, receptors and signaling pathways in blood vessel cells. [score:2]
2.3. miR-132 and -212 Regulation in Response to AngII in Mice. [score:2]
2.4. miR-132 and -212 Regulations in Response to ET-1, Vasopressor-Induced Hypertension. [score:2]
These results thus showed that continuous AngII infusion for seven days in mice resulted in a modest increase in blood pressure without hypertrophic changes of the heart and no regulation of the miR-132/-212 cluster. [score:2]
Likewise, we observed a significant regulation of miR-132 (1.4-fold) and -212 (1.5-fold) in the kidneys of AngII-infused rats versus controls (Figure 2A). [score:2]
Further studies are necessary to assess the relative biological and pharmacological impact of individual miR-132 and miR-212 levels on systemic blood pressure, in the heart, arterial wall and kidney. [score:1]
Cleary, the in vivo mo del adds to our understanding, as we can narrow down the miRNA changes after AngII, to miR-132 and -212. [score:1]
We next asked whether treatment with β-blockers, often a first choice antihypertensive drug, would also decrease miR-132 and -212, following the notion that it could be reduction in blood pressure per se, which may alter the miRNA levels. [score:1]
miR-132/-212 has been described in both the central nervous and cardiovascular systems. [score:1]
Our results suggest that miR-132 and miR-212 are involved in AngII -induced Gαq-signaling pathway leading to hypertension. [score:1]
Several studies identify miR-132/-212 involvement in the central nervous system, i. e., in neuronal function and plasticity [8, 21, 26]. [score:1]
To further investigate whether this miR-132 and -212 regulation is specific to AngII or related to putative direct influences from blood pressure, we examined patients treated with β-blockers (Figure 5C). [score:1]
These results suggest that the miR-132/-212 cluster in humans may also be part of the response to Gαq-vasopressors, such as AngII. [score:1]
Additionally, we investigated the regulation of the miR-132/-212 cluster in endothelial cell lines and in primary cultures of vascular smooth muscle cells (VSMCs) and leukocytes and found no regulation in either of the cell types (data not shown). [score:1]
By contrast, no changes in miR-132/-212 levels were found in any of the three tissues in the acutely hypertensive rats (Figure 2A). [score:1]
In addition, miR-132/-212 has also been found to be involved in neovascularization, inflammation and adipocyte differentiation in the peripheral tissues [21, 23, 27]. [score:1]
Thus, AT [1]R activation in rats increases miR-132 and miR-212, while blocking the AT [1]R decreases miRNA levels in humans. [score:1]
In order to test whether the miR-132/-212 cluster response is specific for AT [1]R induction, we examined the effect of continuous infusion of a second vasopressor (ET-1) [22]. [score:1]
Altogether, these results strongly suggest that the miR-132/-212 cluster may be a general and novel mediator of AngII -induced hypertension. [score:1]
Besides the heart, the arterial wall and kidneys are involved in systemic blood pressure homeostasis, and we, therefore, examined whether the miR-132/-212 levels were affected also in these tissues. [score:1]
Moreover, the degree of miR-132/-212 increase shows a tendency to correlate with blood pressure suggesting that these miRNAs could play a novel role in AT1 receptor pharmacology, both in vitro and in vivo. [score:1]
[1 to 20 of 44 sentences]
6
[+] score: 112
Other miRNAs from this paper: rno-mir-137, rno-mir-212
Previously, suppressed level of miR132 which presumably targets the methyl-CpG binding protein 2 (MeCP2) mRNA, was proposed to un delie MeCP2 upregulation, which consequently represses Ppar-γ via recruitment of the co-repressor HP1α and HDAC at 5’ locus and upregulation of EZH2 methyltransferase which di- and tri-methylate H3K27 at 3’ regions of the gene [5]. [score:11]
Our results show miR-132 and miR-212 are increased 50% on day 1 and 2–2.5 fold on day 7 (Fig 1C), in contradiction to the notion that reduced expression of these miRNAs causes MeCP2 translational upregulation. [score:8]
These oligonucleotides effectively suppressed the expression of respective miRNA (Fig 1E) but had no significant effects on MeCP2 protein levels (Fig 1F), suggesting that miR-132 and miR-212 do not regulate MeCP2 expression. [score:8]
Wnt antagonism with FJ9 reduces MeCP2 protein and upregulates Ppar-γ in a manner independent of miR-132 and miR-212We have previously shown that Wnt3a treatment increases MeCP2 enrichment to the 3’ Ppar-γ promoter to repress Ppar-γ expression in aHSC, and Necdin or DLK1 induces MeCP2-mediaetd Ppar-γ repression via Wnt pathway [14, 18], placing the Wnt pathway as a converging point for this epigenetic regulation. [score:7]
As seen in HSC with canonical Wnt pathway inhibition, the pan-NADPH oxidase (NOX) inhibitor diphenyleneiodonium (DPI) reduces MeCP2 and non-phospho-β-catenin proteins and restores Ppar-γ expression and HSC quiescence but without changes in miR132 and miR212. [score:7]
NOX inhibition with DPI reduces MeCP2 and non-phosphorylated β-catenin, upregulates Ppar-γ, and inactivates HSC without changing miR-132 and miR-212. [score:6]
NOX inhibition with DPI reduces MeCP2 and non-phosphorylated β-catenin, upregulates Ppar-γ, and inactivates HSC without changing miR-132 and miR-212NOX-derived reactive oxygen species mediates HSC activation evoked by different fibrogenic mediators. [score:6]
The present study examined the roles of miR132 and miR212 which share sequence homology and targets [15] in MeCP2 expression and MeCP2 -mediated Ppar-γ regulation in Wnt- and NOX -mediated activation of HSCs. [score:6]
A previous report described that MeCP2 is the target of miR-132 and reduced miR-132 is responsible for upregulation of MeCP2 protein and consequent MeCP2 -mediated Ppar-γ repression in activation of HSC [5]. [score:6]
To assess the causal link between induced miR-132/miR212 and MeCP2 -mediated Ppar-γ upregulation, we transfected anti-miR-132 and anti-miR-212 oigos in FJ9 -treated HSC. [score:4]
miR-132 and miR212 are upregulated during culture activation of rat primary HSC. [score:4]
Wnt antagonism with FJ9 reduces MeCP2 protein and upregulates Ppar-γ in a manner independent of miR-132 and miR-212. [score:4]
To examine this inductive effect on miR-132/miR-212 at transcriptional level, we tested the HSC line BSC transfected with the plasmid which expresses luciferase downstream of four deletion fragments of the promoter and the region between the two miRNA sequences as depicted in Fig 2F. [score:3]
We then transfected anti-miR-132 or/and anti-miR212 oligonucleotides (oligos) into cultured aHSC to determine their effects on MeCP2 protein expression. [score:3]
This finding is of obvious importance as miR132 may serve as a most upstream molecule for Ppar-γ repression in activated HSCs (aHSC) and accordingly as a potential therapeutic target for liver fibrosis. [score:3]
miR-132 and miR-212 are highly conserved among vertebrates and share similar sequences, thus are predicted to have common targets [15]. [score:3]
miR-132 and miR-212 levels are not reciprocal with MeCP2 protein expression in activation of HSC. [score:3]
To further examine this intriguing mechanism and potential contribution of miR-212, we quantified by TaqMan qPCR, the levels of mature miR-132 and miR212 in parallel with assessment of MeCP2 mRNA and protein expression in rat primary HSC from day 0 to day 7 of culture on plastic. [score:3]
Using our TaqMan method with 4.5S RNA as the house keeping RNA, the levels of miR-132 and miR-212 are shown not to be reciprocal to MeCP2 protein expression in HSC in vitro and in vivo mo dels. [score:3]
0156111.g005 Fig 5 miR-132 and miR-212 are highly conserved among vertebrates and share similar sequences, thus are predicted to have common targets [15]. [score:3]
In contrary to previous report, our results failed to validate the roles of miR132 or miR212 in MeCP2 regulation in HSC. [score:2]
To test knockdown effects of miR-132 and miR-212, anti-oligonucleotides for these miRNAs (Invitrogen) were introduced into cultured rat HSC by electroporation using the Neon [TM] Transfection System (Invitrogen). [score:2]
In summary, our results do not support the roles of miR-132 and miR-212 in regulating MeCP2 protein in HSC activation in culture or in vivo. [score:2]
To assess transcriptional regulation for the miR-212 and miR-132 cluster, promoter deletion-luciferase constructs (-1205/-74, -725/-75, -468/+293, +29/+293) were generated by cloning different lengths of the promoter and regions between the two miRNA sequences into the pGL3-basic vector (Promega) as described [17]. [score:2]
Anti-oligonucleotides effectively abrogate miR-132 and miR-212 but do not reduce MeCP2 protein in aHSC. [score:1]
FJ9 treatment increases both miR-132 and miR-212 (Fig 2E). [score:1]
However, the levels of neither miR-132 nor miR-212 are changed by DPI (Fig 3D), suggesting the observed effect on MeCP2 is independent of these miRNAs. [score:1]
[1 to 20 of 27 sentences]
7
[+] score: 62
DARPP-32, which is phosphorylated by PKA, accumulates in the nucleus of striatal neurons and inhibits PP1, leading to increased histone H3 phosphorylation [44] The observed upregulation of miR-212 and miR-132 in the dorsal striatum following extinction training in rats with a history of cocaine SA may be associated with posttranslational modifications (PTMs) of histones that are induced by daily cocaine administration and the subsequent changes in dopamine and glutamate transmission (see Fig.   6). [score:8]
Our results demonstrate the upregulation of mature miR-132 and miR-212 expression in the rats following cocaine SA, but not after 14 days of intake in either the YC or YS groups. [score:6]
To assess whether cocaine induced long-lasting changes in the expression level of striatal miRNAs that are important for synaptic plasticity, we analyzed the expression pattern of miR-124, miR-132, miR-134, and miR-212 after 14 days of the SA of the drug and after the 10-day extinction training (Table 2). [score:5]
Possible explanations for the miR-212 and miR-132 upregulation during the self-administration phase and its persistence during extinction training may include multiple cocaine -induced mechanisms, such as changes in dopamine and glutamate neurotransmission, alterations in specific signaling pathways, and/or epigenetic regulation. [score:5]
The in vivo studies demonstrated that miR-132 expression is regulated by neuronal activity and that the miRNA influencing structural and synaptic plasticity may regulate experience -dependent plasticity [17]. [score:5]
Furthermore, the post hoc test indicated that the levels of miR-212 and miR-132 were only significantly upregulated in the rats with a cocaine SA history (1.5-fold, p < 0.01 and 1.7-fold p < 0.001, respectively) (Fig.   3b). [score:4]
Consistent with the above cited findings, it is very likely that the long-term upregulation of miR-212 and miR-132 is governed by epigenetic mechanisms. [score:4]
Additionally, there were significant differences in the expression patterns of miR-212 (p < 0.01) and miR-132 (p < 0.001) between the cocaine SA-2 and YC-2 groups (Fig.   3b). [score:3]
This mechanism may be involved in the expression of either miR-212/132 cluster or miR-132 alone. [score:3]
For the first time, our data showed that cocaine SA and extinction training is able to significantly increase the expression levels of the mature miR-212 and miR-132 transcripts in rats. [score:3]
Consistent with the above findings, in this study, we analyzed the expression of miR-124, miR-132, miR-134, and miR-212, as well as the levels of the Ago2, Pum2, and REST mRNAs and proteins following cocaine self-administration (SA) and its withdrawal with using extinction training (neither cocaine delivery nor the presentation of the conditioned stimulus) in rats. [score:3]
Fig. 3The expression pattern of miR-212 and miR-132 in the rat striatum after cocaine self-administration (a) and 10-day extinction training (b). [score:3]
The later finding extends the recent observations of Hollander et al. who demonstrated that 6-h (but not 1 h) access to cocaine SA for 7 days increased miR-132 and miR-212 expression in the rat striatum [19]. [score:3]
Recent preclinical observations reported that either acute cocaine treatment [18] or extended access to cocaine self-administration [19, 20] significantly increases miR-132 expression in rodent striatal neurons. [score:3]
miRNAs with FC ≥1.3 and p < 0.05 were considered to be differentially expressed (indicated in bold) compared to the YS group SA self-administered group, YC yoked cocaine group, YS yoked saline (control) group We observed that the 14th day of cocaine SA had a significant effect on the level of miR-212 (F [(2, 15)] = 7.41, p < 0.01) and miR-132 (F [(2, 15)] = 5.50, p < 0.05). [score:1]
miRNAs with FC ≥1.3 and p < 0.05 were considered to be differentially expressed (indicated in bold) compared to the YS group SA self-administered group, YC yoked cocaine group, YS yoked saline (control) group We observed that the 14th day of cocaine SA had a significant effect on the level of miR-212 (F [(2, 15)] = 7.41, p < 0.01) and miR-132 (F [(2, 15)] = 5.50, p < 0.05). [score:1]
Recently, it was demonstrated that four miRNAs (miR-124, miR-132, miR-134, and miR-212) are especially important for neuronal function, plasticity, and/or substance use disorder. [score:1]
Surprisingly, the significant increase in the miR-132 and miR-212 levels was long-lasting and remained in the rats that had been withdrawn from cocaine SA. [score:1]
[1 to 20 of 18 sentences]
8
[+] score: 56
0018613.g004 Figure 4Three general trends of miRNA expression trajectories were observed for Wistar islets at 2.8G vs 16.7G: i) increased expression as exhibited by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreased expression as in the case of rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708 and, iii) no change as seen in rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:7]
Three general trends of miRNA expression trajectories were observed for Wistar islets at 2.8G vs 16.7G: i) increased expression as exhibited by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreased expression as in the case of rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708 and, iii) no change as seen in rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:7]
Rat miR-375, miR-132 and miR-708 are indicated for reference, representing no significant change (dark tones), upregulated (yellow tones) and downregulated (blue tones) miRNAs in GK. [score:7]
The deregulated expression of mir-132 and mir-212 in different experimental mo dels strongly links these miRNAs to common pathways underlying the disease pathologies of diabetic GK rats and obese mouse mo dels. [score:6]
Using assays [24] we validated the expression of ten most upregulated miRNAs from the significant list, and also prioritizing miRNAs which appeared in previous studies on pancreatic islets or insulin-secreting beta cell lines such as miR-124, miR-376a, miR-132 and miR-212. [score:5]
Four of the glucose-regulated miRNAs found in this study, mir-124, mir-212, mir-132, and mir-409-3p, were previously reported to be upregulated in the mouse insulin secreting cell line, MIN6, after 16 h stimulation in 25 mM glucose [31], which is noteworthy despite that tumour-derived cell lines have been shown to generally exhibit significantly different miRNA signature compared to primary cells [6]. [score:4]
Interestingly, miR-212 and miR-132 have also been shown to be upregulated in isolated pancreatic islets in the obese phenotypes of both the diabetes-resistant (B6) and diabetes-susceptible (BTBR) mouse mo dels [32]. [score:4]
We specifically found expression of rno-miR-130a, rno-miR-132, rno-miR-212 and rno-miR-335 to be regulated by hyperglycaemia. [score:4]
This is clearly seen for rno-miR-212, rno-miR-132, and rno-miR-130a, whose expression levels in the GK and Wistar islets eventually coincide at 16.7G (Fig. 4). [score:3]
In general, aside from more significant changes in expression levels of miRNAs at 24 h incubation compared to 1 h incubation, three trends in terms of expression changes are also observed in the Wistar islet upon stimulation at 16.7G as compared to 2.8G: i) increasing miRNA levels, as displayed by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreasing miRNA levels as exhibited by rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708, and iii) no significant change as displayed by rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:3]
We saw changes in miRNA expression manifested within a short temporal window of only one hour, such as for rno-miR-130a, rno-miR-132, rno-miR-212 and rno-miR-335. [score:3]
In contrast, rno-miR-212 and rno-miR-132 showed the opposite trend leading to decreased miRNA levels upon stimulation at 16.7 G. Thus, for miRNAs that increases with increasing glucose concentrations in the normal Wistar islets, the GK islet miRNAs levels go down (rno-miR-132 and rno-miR-212) or do not change (rno-miR-409-3p), whereas for miRNAs whose levels decrease with increasing glucose concentration in Wistar islets, the GK islet miRNAs is also reduced (e. g. rno-miR-124, rno-miR-142-3p, rno-miR-375) (Fig. 4). [score:1]
Among the miRNAs tested only rno-miR-130a, rno-miR-132, rno-miR-212 and rno-miR-335 responded to glucose stimulation at either 8.3 mM or 16.7 mM in the healthy Wistar islets (Fig. 3; p<0.05). [score:1]
This trend was particularly distinct for both miR-212 and miR-132, which belong to the same gene cluster being only 200 nt apart and containing identical seed sequences. [score:1]
[1 to 20 of 14 sentences]
9
[+] score: 51
Of note, recently, miRNA132 (miR132) was identified as a novel CREB target gene and was suggested to regulate neuronal morphogenesis through translational inhibition of a GTPase-activating protein, p250GAP [21]. [score:8]
EA Increased the Expression of pCREB Protein, BDNF Protein, and miR132 and Decreased the Expression of p250GAP Protein in the Hippocampus of 2VO Rats and These Effects Were Partially Inhibited by H89. [score:7]
We also observed another newly recognized CREB -driven target, miR132, which was indicated in mediating dendritic plasticity through suppressing translation of p250GAP, a member of the Rac/Rho family of GAPs [21, 42]. [score:7]
As illustrated in Figure 5, the expressions of the pCREB protein, BDNF protein, and miR132 were decreased 7 days after the 2VO operation, accompanied by an increased expression of p250GAP protein (pCREB, BDNF, miR132, and p250GAP: P < 0.01, resp. [score:5]
Treatment of EA impeded the reduction of pCREB protein, BDNF protein, and miR132 expression in 2VO rats, as well as suppressing the increase of p250GAP protein (pCREB, BDNF, miR132, and p250GAP: P < 0.05, resp. [score:5]
Taken together, our data indicated that EA could ameliorate learning and memory deficits and alleviate hippocampal synaptic plasticity impairment of cerebral hypoperfusion rats, with a probable regulation of PKA/CREB signaling pathway, including the expression of pCREB protein, BDNF protein, miR132, and p250GAP protein. [score:4]
Firstly, spatial learning and memory, LTP and dendritic spine density, and neuronal viability as well as expression of pCREB, BDNF, miR132, and p250GAP proteins were examined to test effects of EA in cerebral hypoperfusion. [score:3]
The relative change of miR132 expression was determined using 2 [−ΔΔCT] method [24]. [score:3]
BDNF could regulate miR132 transcription via the ERK1/2 signaling, together with kinase MSK1 and the phosphorylation of CREB [43]. [score:2]
PKA/CREB signaling pathway was potentially involved in the neuroprotective effects, including the regulation of proteins such as pCREB, BDNF, p250GAP, and miR132. [score:2]
Herein, we found that EA altered the morphology of dendritic spines, accompanied by an increase of miRNA-132 and a reduction of p250GAP protein in 2VO rats. [score:1]
Simultaneously, the effects of EA on the molecular level of pCREB protein, BDNF protein, miR132, and p250GAP protein were also blocked by H89 in EA -treated 2VO rats. [score:1]
These results revealed the important role of miR132 in the improvement of learning and memory by EA. [score:1]
As reported, the transcription of miR132 was induced in response to neurotrophins [43] or synaptic activity [44]. [score:1]
Analyses with one-way ANOVA revealed a significant main effect of EA (pCREB: F(2,17) = 11.766, P < 0.01; BDNF: F(2,19) = 13.820, P = 0.000; miR132: F(2,33) = 9.106, P < 0.01; and p250GAP: F(2,17) = 10.539, P < 0.01; and n = 5 per group). [score:1]
[1 to 20 of 15 sentences]
10
[+] score: 50
In the current study, qPCR analysis performed on whole dentate gyrus lysates confirmed upregulation of Arc mRNA at 30 minutes and 2 hours post-HFS and upregulation of miR-132 at 2 hours (Figure 8A and 8B). [score:7]
We show that, in contrast with the Arc -targeting miRNAs, miR-132 expression progressively increases during the first three weeks of in vitro development (Figure 6B). [score:6]
As a positive control we also examined miR-132, which is known to be developmentally upregulated in hippocampal neurons [49], [50]. [score:5]
The expression of Arc -targeting miRNAs was not significantly different from that of the previously described dendritic miRNAs, miR-132 and miR-134. [score:5]
LTP in the dentate gyrus is also associated with upregulation of mature miR-132 at two hours post-HFS [23]. [score:4]
Using the same RNA preparations from whole lysates, we confirmed significant upregulation of miR-132 at the 30 minutes (1.4 fold) and 3 hours (2-fold) time points (Figure 7B). [score:4]
This stands in contrast to miR-132 which is transcribed in a synaptic activity -dependent manner and rapidly functions to repress protein expression of synaptic proteins such as p250GAP [60]. [score:3]
miR-132 expression increases with neuronal differentiation. [score:3]
Brain-derived neurotrophic factor (BDNF) can induce the expression of plasticity-related genes such as Arc and miR-132 in embryonic hippocampal neurons [39], [49]– [51]. [score:3]
In contrast, the Arc -associated miRNAs and a known dendritic miRNA, miR-132, showed similar SN/homogenate expression ratios. [score:3]
We therefore investigated the effect of BDNF treatment of hippocampal neurons on expression of Arc -targeting miRNAs, using Arc mRNA and miR-132 as positive controls. [score:3]
Notably, both treatment paradigms induced the BDNF-regulated miRNA, miR-132, in addition to Arc mRNA. [score:2]
B) Quantitative relative real-time PCR of miR-19a, miR-34a, miR-326, miR-193a and miR-132. [score:1]
miR-132 was significantly elevated at 2 h post-HFS. [score:1]
[1 to 20 of 14 sentences]
11
[+] score: 47
In the first study, smRNAs deep sequencing analysis in vascular smooth muscle cells show that the miR-132/miR-212 cluster is induced by the hormone angiotensin II and by targeting PTEN, increases the expression of the gene MCP1 (Monocyte chemotactic protein 1), a key regulator of cardiovascular disorders (Jin et al., 2012). [score:6]
miR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. [score:5]
In particular, miR-132 has been shown to increase dendritic spine complexity in both immature cortical and hippocampal neurons in part by translational inhibition of p250GAP. [score:5]
Intriguingly, miR-132 was previously shown to repress the expression of MeCP2 through direct interaction with the transcript 3′UTR (Klein et al., 2007). [score:4]
Consistent with this hypothesis, in vitro studies showed that knockdown of MeCP2 increased miR-212 (and miR-132) expression in cultured cells (Im et al., 2010). [score:4]
Since miR-212 and miR-132 share the same seed region it is wi dely believed that they target the same mRNAs. [score:3]
A series of studies in the last few years have demonstrated the importance of miR-132 cluster in neuronal morphogenesis and in regulating synaptic plasticity. [score:2]
Gonadotropin-releasing hormone induces miR-132 and miR-212 to regulate cellular morphology and migration in immortalized LbetaT2 pituitary gonadotrope cells. [score:2]
miR-212 and miR-132 are required for epithelial stromal interactions necessary for mouse mammary gland development. [score:2]
microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus. [score:2]
Two recent reports implicate the importance of the miR-132/212 family in cardiovascular development and disorders. [score:2]
Future studies in this respect could further help in improving our understanding of how miR-212 and miR-132 regulate different neuronal and non-neuronal functions or if these two miRNAs are functionally redundant? [score:2]
Shown are mouse/human miR-212 and miR-132 genes, with locations of CRE elements through which CREB can stimulate miR-212 and miR-132 transcription. [score:1]
The first study showed that in rats with extended access to cocaine (6 h per day) there is a ∼1.75-fold increase in both striatal miR-212 and miR-132 levels (Hollander et al., 2010). [score:1]
Moreover, as miR-132 and miR-212 share the same seed region, this suggests that miR-212 may similarly repress MeCP2. [score:1]
Transgenic miR132 alters neuronal spine density and impairs novel object recognition memory. [score:1]
Convergent repression of Foxp2 3′UTR by miR-9 and miR-132 in embryonic mouse neocortex: implications for radial migration of neurons. [score:1]
As p250GAP is a Rho-Rac family GTPase activating protein, this finding highlights a role for Rho, and also transducers downstream of Rac-GTPases such as PAK, in the effects of miR-132 on activity -dependent neuronal remo deling (Wayman et al., 2008; Hansen et al., 2010; Magill et al., 2010). [score:1]
The miR-132/miR-212 family of miRNAs was first identified in a genome wide search for genes responsive to the transcription factor cAMP response element binding protein (CREB) using an approach termed Serial Analysis of chromatin occupancy (SACO) (Impey et al., 2004). [score:1]
Analysis of the promoter for this miRNA gene cluster reveals the presence of multiple cAMP response element (CRE) sites and experimental evidence verifies that these miRNAs are indeed CREB inducible (Vo et al., 2005); (see Figure 1) Recent studies from Remenyi et al. have shown that this gene cluster in fact produces four mature miRNAs, namely miR-132, miR-132*, miR-212, and miR-212*, where miR-132* and miR-212* are encoded by the same primary transcript, but on the opposite strand, as the miR-132 and miR-212 miRNAs, respectively (Remenyi et al., 2010). [score:1]
[1 to 20 of 20 sentences]
12
[+] score: 42
On the other hand, while most of the miRNAs studied remained low at adulthood, mir-132 expression increased after puberty to reach intermediate levels between neonatal (maximum) and pubertal (minimum) expression. [score:5]
However, whereas Lin28b mRNA was only marginally increased by FSH, the relative expression levels of let-7a, let-7b and mir-132 were more robustly increased by FSH and hCG, or their combination, which suggests a strong gonadotropic regulation that may take place at the tubular and/or interstitial compartment of the testis. [score:4]
Expression analyses of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs were conducted in testicular samples from rats at different stages of postnatal development. [score:4]
Of note, we attempted also to detect the testicular distribution of mir-132 in rat testis by ISH, but this was unsuccessful probably due to lower endogenous expression levels of this miRNA. [score:3]
The combined administration of both gonadotropins caused cumulative effects on mir-132 miRNA expression (Fig. 6). [score:3]
Effects of HPX and gonadotropin replacement on testicular expression Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs. [score:3]
Expression analyses included Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132 and mir-145 miRNAs. [score:3]
For instance, during neonatal period, Lin28a/Lin28b mRNA expression was minimum and (especially for Lin28b) increased thereafter, whereas let-7 and also mir-132, mir-9 and mir-145 miRNAs abundance was maximal on PND1, decreasing progressively along postnatal maturation. [score:3]
For this reason, we studied testicular expression of Lin28a and Lin28b mRNAs and let-7a, let-7b, mir-145 and mir-132 miRNAs in mo dels of GH deficiency, hypothyroidism and in adrenalectomized rats. [score:3]
In Experiment 1, the expression profiles of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-9, mir-145 and mir-132 miRNAs were determined in the testis of rats at different age-points during postnatal maturation: neonatal (PND-1), infantile (PND-15), juvenile (PND-30), early pubertal (PND-38), pubertal (PND-45) and adult (>PND-75) ages, in keeping with previous references 38; size = 7–8 per group. [score:3]
In addition, previous literature and bioinformatic analyses of our group had documented the putative regulatory role in this hub of mir-145 and mir-132, which is highly conserved across most vertebrates. [score:2]
In contrast, CD males displayed a consistent decline in let-7b, mir-132 and mir-145 miRNA abundance at PND-15, but these changes in miRNA levels were transient and were not detected at PND-45, the expected time of puberty (Fig. 4). [score:1]
Levels of mir-132 and mir-145 tended to decrease only at PND-15 in LL males (Fig. 5). [score:1]
In contrast, let-7a, let-7b and mir-145 miRNA levels (Fig. 3) were significantly higher than in controls, while mir-132 (Fig. 3) and mir-9 (Suppl. [score:1]
In contrast, mir-132 levels diminished after HPX and significantly increased (even over control values) after treatment with hCG or FSH. [score:1]
Let-7a, let-7b, mir-132, and mir-145 (Fig. 1), as well as mir-9 (Suppl. [score:1]
However, while let-7a, mir-132 and mir-9 decreased sharply after PND1, let-7b increased between the neonatal and infantile age, to decline thereafter until puberty, whereas mir-145 levels remained elevated during infantile period and dropped during the juvenile transition. [score:1]
[1 to 20 of 17 sentences]
13
[+] score: 39
Specifically, miR-195 potentially regulates vesicle -associated membrane protein 1 (VAMP1), miR-30a targets actinin, alpha 1 (ACTN1), miR-21 targets paired-like homeodomain 2 (PITX2) in D6; miR-132 potentially regulates solute carrier family 2, member 1 (SLC2A1), nuclear receptor subfamily 4, group A, member 2 (NR4A2) and Cdc42 guanine nucleotide exchange factor 9 (ARHGEF9), miR-203 targets calcium binding protein 7 (CABP7), miR-17-5p targets early growth response 2 (EGR2) in S6; miR-330 potentially regulates CD247, nerve growth factor receptor (NGFR) and FAT tumor suppressor homolog 3 (FAT3), miR-338 targets ADAM metallopeptidase domain 17 (ADAM17), miR-218 targets src kinase associated phosphoprotein 1 (SKAP1), miR-185 targets calcium channel, voltage -dependent, N type, alpha 1B subunit (CACNA1B) in S9. [score:20]
In the general neurogenesis subnetwork, the nuclear orphan receptor NR4A2, the target of miR-132, are induced after excitotoxic and oxidative stress, up-regulate neuroprotective genes, and increase neuronal survival. [score:6]
In mammals, it has been recently revealed that miR-132 was able to modulate dendritic morphology via suppression of specific targets [51], and miR-132 increased dendritic protrusion width and increased miniature excitatory postsynaptic current amplitude [52]. [score:5]
SLC2A1, another target of miR-132, is expressed in the plasma membrane and cytoplasm of myelinating SCs around the nodes of Ranvier and in the Schmidt-Lanterman incisures, and is involved in the transport of glucose into the metabolically active region of peripheral axons [50]. [score:5]
Consequently, SCs may alter miRNA expression, including miR-330, miR-218 (in S9) and miR-132 (in S6), to modulate two-way communication between neurons and SCs to maintain structural integrity and functional recovery after axotomy to the peripheral nerves. [score:3]
[1 to 20 of 5 sentences]
14
[+] score: 37
Other miRNAs from this paper: rno-mir-212
In the present study we disclosed that the gene designated prt6, encoding non-coding RNAs with the sequences of EST 1392108_at (Affymetrix), miR-212, and miR-132, is development- and PCP-regulated gene in the rat thalamus, and that the schizophrenomimetic NMDA receptor antagonist elicits a significant increase in the expression levels of prt6 at PD32 and 50, but not PD8, 13, 20 and 25. prt6 RNAs are strongly expressed in the brain and testis, and are also upregulated by PCP in the neocortex and hippocampus of young adult rats at PD50. [score:10]
In agreement with this, our recent DNA microarray experiments showed that PCP administered with the same regimen as in the present study suppresses the neocortical expression of the predicted targets of these two miRNAs, PAIP2A and H2AFZ (unpublished data), suggested by sequence analyses (miRanda and TargetScan) of miR-132 and miR212. [score:9]
Because these micro -RNAs have been shown to play important roles in the development, maturation, and function of neurons [41], [42], the minimal and marked developmental changes in the basal expression of prt6 (Figure 4 ) and miR-132 [42], respectively, could be accounted for by the possible alterations in the processing of various non-coding RNAs related to prt6 during embryonic and pre-weaning periods. [score:5]
The upregulated 3.0-kb (Fragment Y) product could act in the brain, at least in part, as a long primary transcript (pri-miRNA) for miR-132 and/or miR212, because the sequences of these micro -RNAs are tandemly located within the transcript. [score:4]
In terms of the NMDA receptor function-related and development -dependent schizophrenomimetic-responsive nature of prt6, it should be noted that miR-132 and miR-212, the sequences of which are found in prt6 RNA (Figure 2 ), have been reported to be dysregulated in the prefrontal cortex of postmortem brains from schizophrenic patients [43]– [45]. [score:3]
Capital letters indicate the nucleotide sequences of mature miR-132. [score:1]
The 5′ end of Fragment X (and thereby Fragment A) is located exactly at the flanking region of 3′ end of preRNA of miR-132 (Figure 2B ). [score:1]
Based on the below observations, these structural features lead to the suggestion that miR-132 and -212 could be derived from these prt6 RNA products. [score:1]
In silico overall structural analysis of prt6 suggests that Fragment Y corresponds to a presumable long primary transcript as pri -RNA of miR-132 and -212 and of their 3′ flanking fragment. [score:1]
The transcriptional initiation site of this transcript is almost the same as that of a non-coding miR132 -associated transcript, DQ223059, previously reported in the rat [30], and the canonical TATA box (TATAAA) is located at 25 bp upstream of the start site (Figure 2A ). [score:1]
Instead, we speculated presence of a tandem array of microRNAs (miRNAs), miR-212 and miR-132, located upstream of the 5′ end of Fragment X (Figure 2A ). [score:1]
[1 to 20 of 11 sentences]
15
[+] score: 35
The most upregulated miRNAs were miR-146a-5p, miR-132-5p, miR-21-5p at 1.63, 1.61, and 1.56-fold of the control, respectively, while the most downregulated miRNAs were miR-29b-3p, miR-352, miR-30e-5p at 0.60, 0.70, and 0.72-fold of the control, respectively. [score:7]
Furthermore, the overexpression or knock-down of miR-132 in the brain modulates learning and memory in several experimental paradigms [62- 65]. [score:4]
The most upregulated microRNAs were miR-132-3p, miR-212-3p and miR-21-5p, which were increased by 1.75, 1.83 and 1.89-fold respectively. [score:4]
We found common expression of 9 miRNAs (miR-132, miR-137, miR-139, miR-29a, miR-324, miR-352, miR-282, miR-146a, and miR-23a) when our data were compared to a data set describing miRNA expression 60 d after pilocarpine -induced status epilepticus [24]. [score:4]
Another miRNA, miR-132, is enriched in neurons and consistently upregulated following epileptogenic stimuli [57]. [score:4]
It is also necessary for neuronal spine formation, and the overexpression of miR-132 results in increased spine density [61, 62]. [score:3]
The largest increases in expression occurred in miR-212-3p, miR-132-3p and miR-21-5p at 1.54, 1.52 and 1.41 fold of the control levels respectively (Table 1). [score:3]
The highest positive correlation of expression was observed for miR-132-5p and miR-212-5p (0.98) miR-132-3p and miR-212-3p (0.97), miR-708-5p and miR-374-5p (0.94), and miR-374-5p and miR-31a-5p (0.94). [score:3]
miR-132 strongly influences neuronal morphology, increasing dendritic outgrowth and arborization [60]. [score:1]
In particular, following an intra-amygldala injection of kainic acid, the depletion of miR-132 reduces seizure -induced neurodegeneration [48]. [score:1]
In addition to its role in neuronal plasticity, miR-132 can participate also in neurodegeneration. [score:1]
[1 to 20 of 11 sentences]
16
[+] score: 33
However, our data indicate there is a large upregulation of pri-miRNA132/RM2 within the molecular layer (dendrites) following synaptic activity, indicating that pri-miR132 may leave the nucleus unprocessed. [score:4]
For pri-miR132, we also examined expression at the 2 h time point. [score:3]
We also examined the expression pattern for Egr3, Egr4, H1a, pri-miR132, Sox11, and Ptgs2 (n = 3). [score:3]
Therefore, we examined the rat genome upstream from the RM2 genomic locus and we determined that a CREB dependent non-protein coding transcript that codes for the miRNAs, miRNA-212 and miRNA-132 (Vo et al., 2005) was directly adjacent to the RM2 locus. [score:2]
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
However, for this time point, none of these targets exhibited an increase in the ML on the stimulated side compared to the unstimulated side (p > 0.05; n = 4 for 2 h, n = 5 for control), except for pri-miR132 and Egr4 (p < 0.05; n = 4 for 2 h, n = 5 for control). [score:2]
This possibility makes it plausible that miRNA132 is transported to the dendrites as a pri-miR132. [score:1]
The ∼660 bp transcript was shorter than the ∼1.6 kb transcript because it was lacking a region intervening between miR132 and RM2, most likely due to the presence of an intron that was spliced out. [score:1]
The DNA templates to produce fluorescent in situ hybridization (FISH) RNA probes for Egr3, Egr4, Sox11, Ptgs2, pri-miR132 were PCR amplified from rat cDNA and these PCR products were cloned into the pCR4-TOPO vector using a TA cloning kit (Invitrogen, #450030). [score:1]
These data indicate that miRNA132, might be transported to the dendrites following synaptic activity as a longer unprocessed transcript which is then likely processed to a mature miRNA when it reaches its destination. [score:1]
We also identified pri-miR132 RNA as being localized to granule cell dendrites; however, our FISH experiments were not able to confirm this finding, and this may be due technical limitations of the FISH technique not being capable of detecting low levels of this transcript. [score:1]
Images for Pri-miR132 were captured at the same exposure for both the 2 and 4 h time points. [score:1]
RM2 Is a Non-coding Transcript Containing pri-miRNA132. [score:1]
If the mRNAs for pri-miR132, Sox11, and Ptgs2 do indeed localize to dendrites within the ML, they likely do so at much lower levels than Arc mRNA, considering that our ability to detect them within the ML using FISH is limited. [score:1]
We determined that indeed RM2 was contiguous with an RNA transcript that contained miRNA132 (Figure 4). [score:1]
Collectively, these findings are intriguing because miRNA132 is believed to localize to dendrites (Edbauer et al., 2010; Bicker et al., 2014), but it is currently unknown how it gets there (Tai and Schuman, 2006). [score:1]
These transcripts contained the miR132 coding sequences to be contiguous with RNA sequences represented by the Affymetrix RM2 probe, RAT230_2:1392108_AT. [score:1]
Dq223059 transcript contains both miR212 and miR132 between putative exon 1 and exon 2. We discovered a ∼1.6 kb and a ∼660 bp transcript that was present within ML samples that were collected 4 h post-pp-HFS. [score:1]
We will refer to RM2 as pri-miR132. [score:1]
Images were taken at the 4 h (and pri-miR132 2 h) timepoint at an optimal exposure for each gene. [score:1]
FIGURE 4 Two thousand eight hundred base pair region of rat chromosome 10 between nucleotides 62013904 and 62016691 containing the pri-miR132/RM2 gene loci. [score:1]
A 2 h time point is included for pri-miR132. [score:1]
FIGURE 5FISH for Arc, Egr3, Egr4, H1a, pri-miR132, Sox11, and Ptgs2. [score:1]
[1 to 20 of 23 sentences]
17
[+] score: 24
Other miRNAs from this paper: rno-mir-124-3, rno-mir-124-1, rno-mir-124-2
As mentioned earlier, a recent study showed that a miRNA important for inhibiting OD plasticity in the visual cortex (mir132) and the miRNA which produced a transgenerational “giant” phenotype (mir124) was upregulated in the mPFC of P14 mice following maternal-separation (130). [score:6]
As mentioned earlier, alterations in the expression of mir132 have been shown to regulate critical period timing for OD plasticity. [score:4]
Further, mir132 is upregulated by (131). [score:4]
Furthermore, has been shown to upregulate mir132 in cultured immature cortical neurons, as well as in cultured astroglial cells (131). [score:4]
Specifically, Uchida et al. (130) showed that MS180 from P2 to P14 increased the expression of mir132 in the PFC of P14 mice relative to SR P14 mice. [score:3]
In a recent study, increasing mir132 expression in mice before monocular deprivation blocked OD plasticity during the critical period (120), suggesting that mir132 acts as a brake on plasticity. [score:3]
[1 to 20 of 6 sentences]
18
[+] score: 21
Expression of the miR-132 target, p250GAP, is inversely correlated with miR-132 levels and spinogenesis. [score:5]
Inhibition of miR-132 decreases both mEPSC frequency and the number of GluR1 -positive spines, while knockdown of p250GAP has the opposite effect. [score:4]
Expression of miR-132 enhances neurite outgrowth, dendritic morphogenesis, and spine formation (34– 37), and is induced by BDNF via CREB. [score:3]
Additionally, miR-132/p250GAP circuit regulates Rac1 activity and spine formation by modulating synapse-specific Kalirin7–Rac1 signaling. [score:2]
Furthermore, knockdown of p250GAP increases spine formation while introduction of a p250GAP mutant unresponsive to miR-132 attenuates this activity. [score:2]
It has been shown that CREB- and activity-regulated miR-132 is necessary and sufficient for hippocampal spine formation. [score:2]
These results suggest that neuronal activity regulates spine formation, in part, by increasing miR-132 transcription, which in turn activates a Rac1–Pak actin remo deling pathway. [score:2]
These include: let-7a, miR-124, miR-125a-5p, and miR-132. [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 20
In the present study, miR-145-5p mimic clearly decreased Nurr1 expression in HEK293T (P < 0.001), as did miR-132 and miR-34c-5p, which was consistent with the previous study that miR-34c-5p directly regulated Nurr1 in HCT116 cells (Beard et al., 2016) and miR-132 targeted Nurr1 in differentiation of dopamine neurons (Yang et al., 2012). [score:7]
miR-132 regulates the differentiation of dopamine neurons by directly targeting Nurr1 expression. [score:7]
showed that the miR-145-5p mimic clearly decreased the luminescence reporter signal to a greater extent (P < 0.001; Figure 2D), as did miR-132 and miR-34c-5p, which were previously shown to directly target Nurr1. [score:4]
MicroRNA-132 promotes estradiol synthesis in ovarian granulosa cells via translational repression of Nurr1. [score:2]
[1 to 20 of 4 sentences]
20
[+] score: 19
Using Target Scan software, miR-30b, miR-96, miR-183, and miR-132 were found to target SCN3A. [score:5]
In conformity to previous report (Leinders et al., 2016), intrathecal injection of miR-132-3p mimetic dose -dependently produced pain behavior in naïve rats, miR-132-3p was reported to up-regulated in neuropathic pain, which was in contrast to miR-30b. [score:4]
MiR-132 was upregulated in SNI rats (Leinders et al., 2016), while miR-182, miR-183, miR-96 decreased in SNL rats (Aldrich et al., 2009). [score:4]
Increased miR-132-3p expression is associated with chronic neuropathic pain. [score:3]
Using Target Scan software, miR-30b, miR-96, mir-183, and miR-132 were predicted to highly relate to SCN3A. [score:3]
[1 to 20 of 5 sentences]
21
[+] score: 18
Althogether these studies strongly suggest that an up-regulation of most, if not all, members of the let-7 and miR-7 families and of the miR-132/212 cluster marks hypothalamus development while miR-9, miR-124a, miR-145 and miR-219 displayed nucleus-specific regulations of expression. [score:8]
Let-7b, miR-124a and miR-9 displayed no expression differences in MPN between P15 and P30 while let-7a, miR-7, miR-132, miR-145 and miR-219 displayed up-regulations. [score:6]
Our data also established the up-regulation of all members of the let-7 and miR-7 gene families, as well as that of the four miRNAs encoded by the miR-132/212 cluster, i. e. miR-132-3p, miR-132-5p, miR-212-3p and miR-212-5p, when comparing stages P14 and P28. [score:4]
[1 to 20 of 3 sentences]
22
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
MiR-132, 5-fold down-regulation in DHT -treated group compared to control in this study, has previously been shown to be related to luteinizing hormones [12], raising the possibility that elevated LH in PCOS could involve the expression and action of miR-132. [score:5]
Thus, it is possible that the down-regulation of miRNAs (rno-miR-770, rno-miR-466c, rno-miR-31, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184) observed in this study could be associated with promoted thecal hyperandrogenesis [37, 38]. [score:4]
MiRNAs found to be primarily down-regulated in DHT -treated rats includes rno-miR-770, rno-miR-466c, rno-miR-21, rno-miR-31, rno-miR-182, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184. [score:4]
Among the fourteen miRNAs mapped to the ingenuity databases, twelve (rno-let-7d, rno-miR-132, rno-miR-182, rno-miR-183, rno-miR-184, rno-miR-21, rno-miR-221, rno-miR-24, rno-miR-25, rno-miR-26b, rno-miR-31 and rno-miR-96) had 171 experimentally validated targets. [score:3]
[1 to 20 of 4 sentences]
23
[+] score: 14
Neither was differentially expressed in the isolated granule cell layer, containing granule cell somata (miR-23a-3p: FC = 1.00 ± 0.15; p = 0.50; miR-151-3p: FC = 0.98 ± 0.13; p = 0.43; n = 7; Fig 5), although miR-132-3p was up-regulated (FC = 1.41; p = 0.03; data not shown) in keeping with previous research [13]. [score:6]
While there was no correlation between LTP magnitude and miRNA fold change (data not shown), five miRNAs were upregulated: miR-132-3p (FC = 1.32 ± 0.08; p = 0.029); miR-7b-5p (FC = 1.38 ± 0.09; p = 0.025); miR-151-3p (FC = 1.16 ± 0.004; p < 0.001); miR-872-5p (FC = 1.48 ± 0.05; p = 0.011); and miR-23a-3p (FC = 1.73 ± 0.05; p = 0.005). [score:4]
The only more detailed analysis comes from one report that miR-132-3p upregulation is restricted to granule cell somata 2 h after LTP induction in vivo [13]. [score:4]
[1 to 20 of 3 sentences]
24
[+] score: 14
For example, miR-134 regulates LimK1 at the spine by stimulation of BDNF [19], miR-138 regulates palmitoylation in neurons by inhibiting the translation of LYPLA [16], [18], miR-132 targets p250GAP to enhance spine growth [20] and the FMRP associated miRNA, miR-125b blocks the translation of NR2B resulting in neuronal structural changes [21]. [score:11]
Among the differentially expressed miRNAs was miR-132, a known activity -dependent miRNA [20]. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 14
Our data provides a detailed map of miRNA brain expression in rats and shows that there are some differences in the expression in the cerebellum of a subset of the detectable transcripts, which are either highly enriched (miR-206 and miR-497) or nearly depleted (miR-132, miR-212, miR-221 and miR-222). [score:5]
Forebrain enrichment was also seen for the two members of the miR-132 family (miR-132 and miR-212), which were also most highly expressed in the hippocampus and amygdaloid regions. [score:3]
Notably, we found reciprocal expression profiles for a subset of the miRNAs predominantly found (> ten times) in either the cerebellum (miR-206 and miR-497) or the forebrain regions (miR-132, miR-212, miR-221 and miR-222). [score:3]
The selected miRNAs were rno-let-7a (part # 4373169), rno-miR-132 (part # 4373143), rno-miR-206 (part # 4373092) and rno-miR-320 (part # 4395388). [score:1]
The within-region variability of miR-132 (sd = 0.38 and 0.37), miR-320 (sd = 0.38 and 0.44), miR-497 (sd = 0.47 and 0.27) and let-7a (sd = 0.40 and 0.55) did not differ from the regional average of the hippocampus (sd = 0.39) and the hypothalamus (sd = 0.43) respectively (P-values from 0.13 to 0.95). [score:1]
miR-132 has also been related to neuronal morphogenesis [13], [14], and both miR-132 and miR-219 have been shown to modulate the circadian clock [15]. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 13
Overexpression of miR-132 and inhibition of miR-184 protects beta cells against palmitate- or cytokine -induced apoptosis [7]. [score:5]
Overexpression of miRNA-132 or miRNA-212 increased glucose-stimulated insulin secretion [17]. [score:3]
The inductions of miR-132 and miR-212 by GLP-1 were correlated with cyclic adenosine monophosphate (cAMP) production and were blocked by a protein kinase A inhibitor[17]. [score:3]
Recent studies reported that the signaling pathways triggered by GLP-1 in rodent and human pancreatic β-cells were complex, with miRNA-132 and miR-212 as two of the many miRNAs involved in GLP-1 activity. [score:1]
There were seven miRNAs reduced by over 50% (miR-380-5p, miR-139-5p, miR-743b-5p, miR-212-3p, miR-132-5p, miR-3592, and miR-201-5p) after liraglutide treatment. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 13
In our corresponding mo del, the miR-132 was up-regulated, whereas the miR-30d was down-regulated in plasma. [score:7]
Previously, Jin et al. determined the miRNA expression profiles in liver from an HFD -induced steatosis mo del rat and found that miR-132 and miR-30d were up-regulated in liver [27]. [score:6]
[1 to 20 of 2 sentences]
28
[+] score: 13
In agreement with previous results (Wibrand et al., 2012), miR-132 was significantly upregulated at 120 min post-HFS in dentate gyrus lysates (Figure 2C). [score:4]
Experience -dependent expression of miR-132 regulates ocular dominance plasticity. [score:4]
Consistent with our previous work (Wibrand et al., 2010), expression of miR-212 and miR-132 was increased in dentate gyrus lysates at 120 min post-HFS. [score:3]
miR-132, an experience -dependent microRNA, is essential for visual cortex plasticity. [score:1]
Wibrand and colleagues observed NMDAR -dependent decreases in mature miR-212 and miR-132 in the absence of NMDAR -dependent effects on precursor miRNA levels, suggesting that NMDAR signaling promotes decay of the mature miRNAs. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 13
There are also a number of miRNAs such as miR-132, miR-212, miR-130a and miR-152 shown to be upregulated in the pancreatic islets of the wi dely-studied T2D mo del Goto-Kakizaki rats (Esguerra et al., 2011) with active roles in beta cell stimulus-secretion coupling (Malm et al., 2016; Ofori et al., 2017). [score:4]
Among the other miRNAs included in this study, we observed significantly higher expression levels of miR-132 and miR-212 at higher confluences in INS-1 832/13 cells (Figs. 3A– 3B) but only an increasing trend in the human EndoC-βH1 cells (Figs. 3C– 3D). [score:3]
miR-132 and miR-212 expression in INS-1 832/13 cells (A–B) or in EndoC-βH1 cells (C–D) at different confluences. [score:3]
Although we showed that miR-375, which is one of the most enriched beta cell miRNA was not significantly influenced by confluence level in cultured rat and human beta cell lines, we clearly demonstrated that miR-132 and miR-212 are more dependent on cellular densities, as was shown for some miRNAs in other cells types (Hwang, Wentzel & Men dell, 2009; Van Rooij, 2011). [score:1]
We also investigated the influence of confluence on the expression levels of miR-200a, miR-130a, miR-152, miR-132 and miR-212. [score:1]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 11
Among the miRNAs differentially expressed in Liu's study, rno-miR-132-3p, rno-miR-146b-5p, rno-miR-223-3p, rno-miR-21-5p, and rno-miR-214-3p were upregulated, which was just the same as our findings. [score:6]
Among these differentially expressed miRNAs, rno-miR-130b-3p, rno-miR-132-3p, rno-miR-181a-1-3p, rno-miR-222-3p, rno-miR-351-5p, and rno-miR-21-3p had the largest positive fold changes, while rno-miR-335, rno-miR-192-3p, rno-miR-194-5p, rno-miR-192-5p, rno-miR-499-5p, and rno-miR-210-3p had the largest negative fold changes (Table 1). [score:3]
Relative expression levels of the selected miRNAs and mRNAs were depicted in Figure 3. Consistent with the microarray data, real-time PCR confirmed that, compared with controls, rno-miR-132-3p, rno-miR-181a-1-3p, rno-miR-222-3p, and rno-miR-351-5p were significantly increased, while rno-miR-192-3p, rno-miR-194-5p, rno-miR-29c-3p, rno-miR-185-5p, and rno-miR-30c-5p were significantly decreased in stone-forming rat kidneys. [score:2]
[1 to 20 of 3 sentences]
31
[+] score: 11
Hansen K. F. Sakamoto K. Aten S. Snider K. H. Loeser J. Hesse A. M. Page C. E. Pelz C. Arthur J. S. Impey S. Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptomeLearn Mem. [score:3]
Liu F. Li Y. Jiang R. Nie C. Zeng Z. Zhao N. Huang C. Shao Q. Ding C. Qing C. miR-132 inhibits lipopolysaccharide -induced inflammation in alveolar macrophages by the cholinergic anti-inflammatory pathwayExp. [score:3]
Hansen K. F. Karelina K. Sakamoto K. Wayman G. A. Impey S. Obrietan K. miRNA-132: A dynamic regulator of cognitive capacityBrain Struct. [score:2]
Xie B. Zhou H. Zhang R. Song M. Yu L. Wang L. Liu Z. Zhang Q. Cui D. Wang X. Serum miR-206 and miR-132 as potential circulating biomarkers for mild cognitive impairmentJ. [score:1]
A study from 2013 proposed members of the miR-132 and miR-134 families as biomarkers for the detection of mild cognitive impairment (MCI) [41]. [score:1]
Scott H. L. Tamagnini F. Narduzzo K. E. Howarth J. L. Lee Y. B. Wong L. F. Brown M. W. Warburton E. C. Bashir Z. I. Uney J. B. MicroRNA-132 regulates recognition memory and synaptic plasticity in the perirhinal cortexEur. [score:1]
[1 to 20 of 6 sentences]
32
[+] score: 11
Targeting miR-132 in vivo depleted miR-132 levels in the mouse hippocampus and reduced the seizure -induced neuronal death [11]. [score:3]
One of their previous studies suggested that targeting miR-132 reduces seizure -induced neuronal death and protects the hippocampus [11]. [score:3]
The Henshall group also reported that the expression level of another miRNA, miR-132, was increased following status epilepticus. [score:3]
Using the pilocarpine mouse mo del of epilepsy, Nu delman et al. reported that neuronal activity rapidly induces transcription of the CREB-regulated miR-132 in vivo[6]. [score:2]
[1 to 20 of 4 sentences]
33
[+] score: 9
Other miRNAs from this paper: rno-mir-21, rno-mir-145, rno-mir-214, rno-mir-222, rno-mir-223
For example, miR-223 is highly expressed in neutrophils that are present in the spinal cord during the early phase of spinal cord injury [30]; miR-132 regulates dendritic spine morphology and synaptic physiology, contributes to the maturation of dendrites in newborn neurons in the adult hippocampus, and impacts the plasticity of visual cortex circuits [31], [32]; miR-21 is highly expressed in the spinal cord and DRGs following traumatic injury, thus promoting neurite outgrowth by down -regulating expression of Sprouty2 protein [18], [25]. [score:9]
[1 to 20 of 1 sentences]
34
[+] score: 9
rno-miR-184, rno-miR-347, rno-miR-181a-2-3p, rno-miR-204-5p, rno-miR-132-3p and rno-miR-328b-3p are significantly up-regulated while other 10 miRNAs are significantly down-regulated Fig. 16 Hierarchical clusterings analysis of miRNA expressionprofile for intrauterine infection group and control at P3. [score:9]
[1 to 20 of 1 sentences]
35
[+] score: 9
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Finally, other subsets of miRNAs were either up-regulated (miR-23a-3p, miR132-3p, miR-146a-5p, miR-154-3p, miR-181d-5p, miR-212-3p, miR-212-5p, miR-344b-5p, miR-380-3p, miR-410-3p, miR-433-3p and miR-3584; Fig. 2, Supplementary Fig. S4), or down-regulated (miR-29c-5p, miR-30a-5p, miR-30c-2-3p, miR-30e-3p, miR-138-5p, miR-140-3p, miR-551b-3p and miR-652-3p; Fig. 2, Supplementary Fig. S5) during all phases of the disease. [score:9]
[1 to 20 of 1 sentences]
36
[+] score: 8
It has been reported that the expression of miR-146a, miR-155, and miR-132 is upregulated in monocytes after exposure with TNF-α [38], but our study showed only the expression miR-146a was increased in T cells after chronic exposure to TNF-α. [score:8]
[1 to 20 of 1 sentences]
37
[+] score: 8
Most specific for maturation of SHR vessels at the miRNA level was the up-regulation of miR-132-3p. [score:4]
MiR-132 is one of the microRNAs that is up-regulated by angiotensin II. [score:3]
Maturation shows many similarities in WKY and SHR, with some exceptions such as miR-132-3p. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 8
Prominent among this group were miRNAs that are enriched in neurons and associated with developmental regulation (let-7i, let-7f, let-7b, miR-98), cell cycle regulation (miR-137, mIR-128) and neural activity (miR-132, miR-212). [score:4]
MiR-212 and miR-132 are tandem miRNAs with similar target specificity due to their identical seed sequences. [score:3]
In the brain, miR-212 and miR-132 play vital roles in the formation and plasticity of neuronal connections, and long-term synapse activation (reviewed [42, 43]). [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 8
Nine miRNAs (miR-21, miR-24, miR-214, miR-132, miR-195, miR-210, miR-144, miR-150 and miR-34a) were found in exosomes obtained from rats subjected to RIPC, but only miR-24 was significantly upregulated ([#] P < 0.05, n = 4). [score:4]
b, c Flow cytometric analysis of the uptake of exosomes by H9c2 cells at various time points We further determined the expression of nine miRNAs (miR-24, miR-21, miR-214, miR-132, miR-195, miR-210, miR-144, miR-150 and miR-34a) in both RIPC-EXO and EXO (Fig.   3a). [score:3]
Since the subject of our study was IRI, we selected nine miRNAs that have been reported to be involved either in oxidative stress (such as miR-150 and miR-21) 14, 15 or in cardiomyocyte apoptosis (such as miR-195, miR-132, miR-140, miR-144, miR-24, miR-214 and miR-34a) 16– 21 in our investigation and, using quantitative PCR (qPCR), explored whether RIPC could modify the expression level of these nine miRNAs in plasma exosomes. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 8
Other miRNAs from this paper: mmu-mir-132
miR132 is expressed in neurons, and is involved in processes of neurogenesis, regulating for example dendritic growth and arborisation in newborn neurons of adult hippocampus [58]. [score:4]
AChE expression can be regulated by different microRNAs, with one of the most prominent being miR132 [57]. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 7
Interestingly, several potential interactions between 8 up-regulated miRNAs and 6 down-regulated aquaporins (AQPs) genes were observed for examples: miR-199a-5p, -214 and -503 can anneal to Aqp1 and Aqp12a with octamer seeds; and Aqp4 has multiple 9nt long binding sites for miR-132. [score:7]
[1 to 20 of 1 sentences]
42
[+] score: 7
Other miRNAs from this paper: hsa-mir-181c, hsa-mir-132, rno-mir-181c, hsa-mir-1246
Negative regulation of microRNA-132 in expression of synaptic proteins in neuronal differentiation of embryonic neural stem cells. [score:4]
Growth factors stimulate expression of neuronal and glial miR-132. [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 7
Other miRNAs from this paper: rno-mir-130a, rno-mir-130b, rno-mir-152, rno-mir-184, rno-mir-212
However we only found common DNA sequence motif in the promoter region of two other upregulated miRNAs in the GK rat islets, miR-132 and miR-212 34. [score:4]
In that study our group showed putative transcription factor binding sites for Calmodulin Binding Transcription Activator 1 (Camta1) and NK2 homeobox protein, Nkx2-2. Elsewhere, we and others also demonstrated cAMP -dependent regulation of the miR-132/212 cluster through a PKA -dependent mechanism 35 involving cAMP-response element (CRE) -binding proteins and CRTC1 36. [score:2]
In db/ db and high-fat diet fed mice, miR-132 and miR-184 in the pancreatic islets were suggested to be induced by hyperglycaemic and hyperlipidaemic conditions typically encountered in prediabetic and diabetic states 37. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 7
Other miRNAs from this paper: rno-mir-21, rno-mir-130b, rno-mir-451
In total, three microRNAs (miR-21, miR-130b and miR-132) were significantly up-regulated (≥2-fold, P < 0.01), whereas 10 down-regulated (≤0.5-fold, P < 0.01) in hearts from HCM patients (Fig. 1A). [score:7]
[1 to 20 of 1 sentences]
45
[+] score: 6
Yao C Hypoxia -induced upregulation of miR-132 promotes Schwann cell migration after sciatic nerve injury by targeting PRKAG3Mol. [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
In previous studies, miR-34a and miR-132 were found to be increase after SE, and silencing miR-34a or miR-132 by microinjection of antagomirs led to the inhibition of caspase-3 expression, which was accompanied by reduction in apoptotic neurons, indicating a positive regulation of these two miRNA on neuronal apoptosis [12], [13]. [score:6]
[1 to 20 of 1 sentences]
47
[+] score: 6
Moreover, miR-212 and miR-132 [45] were able to regulate autophagy in cardiomyocytes via their commonly targeting gene of Foxo3 expression. [score:6]
[1 to 20 of 1 sentences]
48
[+] score: 6
Interestingly, a recent study has also reported that miR-132 levels are lowered in breast cancer cells, and identified miR-132 as a tumor suppressor that acts by inhibiting proliferation, migration, invasion, and metastasis [13]. [score:5]
Further investigation has illustrated that miR-132 expression is induced by light within the suprachiasmatic nucleus (SCN) and that it has the capacity to restore homeostasis and reset the activity caused to the circadian clock by nocturnal light [12]. [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 6
More recently, it was demonstrated that decreased levels of miR-132/212 lead to transmembrane protein 106B (TMEM106B) up-regulation and, consequently, a perturbation of PGRN pathways and increased risk to develop FTLD-TDP (Chen-Plotkin et al., 2012). [score:4]
TMEM106B, the risk gene for frontotemporal dementia, is regulated by the microRNA-132/212 cluster and affects progranulin pathways. [score:2]
[1 to 20 of 2 sentences]
50
[+] score: 6
Remenyi J, van den Bosch MW, Palygin O, Mistry RB, McKenzie C, Macdonald A, Hutvagner G, Arthur JS, Frenguelli BG, Pankratov Y: miR-132/212 knockout mice reveal roles for these miRNAs in regulating cortical synaptic transmission and plasticity. [score:3]
For example, studies in mutant mice have shown that, miR-183/96/182 clusters and miR132/212 were essential for the synaptic development in retina [16- 18], and miR-124 was critical for the maturation of cone cells [19] in retina. [score:2]
In retinal ganglion cells, a recent study specifically demonstrated that miR-132 was involved in BDNF -mediated retinal ganglion axonal branching and maturation [21]. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 5
MiRNA-132 was upregulated in the activated astrocyte in our experiment; it was also upregulated in animal mo del of mesial temporal lobe epilepsy characterized by significant astrocyte activation [23]. [score:4]
MiRNA-132 was recently designated as a “NeurimmiR,” a class of miRs suggested to act as a crosstalk between the neuronal and immune system [36]. [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 5
The targeting of acetylcholinesterase by miR-132-3p may be indeed relevant for the association of the enzyme activity with amyloid load in late onset AD (Alkalay et al., 2013; Lau et al., 2013). [score:3]
MicroRNA-132 potentiates cholinergic anti-inflammatory signaling by targeting acetylcholinesterase. [score:2]
[1 to 20 of 2 sentences]
53
[+] score: 5
Among the overexpressed miRNAs, miR-148a, miR-335, miR-132 and miR-204 were identified, all of which have been reported to be overexpressed in β cells in comparison with α cells [44], suggesting that adenoviral transduction aids in cellular reprogramming toward a β cell lineage. [score:5]
[1 to 20 of 1 sentences]
54
[+] score: 5
Other miRNAs from this paper: rno-mir-212
Furthermore, they showed that cocaine stimulation of MeCP2 decreased the expression of miR-212 and miR-132 resulting in an increase of BDNF expression with an increase in cocaine intake. [score:5]
[1 to 20 of 1 sentences]
55
[+] score: 5
Other miRNAs from this paper: mmu-mir-132, mmu-mir-212, rno-mir-212
It was reported that miR-132, one member of the miR-132/212 cluster, is induced by H [2]O [2] to target NR4A2 to aggravate apoptosis [33], but whether NR4A2 is the target of miR-212-3p in cardiomyocytes was unknown. [score:5]
[1 to 20 of 1 sentences]
56
[+] score: 5
Other miRNAs from this paper: rno-mir-20a, rno-mir-126a, rno-mir-155
Moreover, STDP was reported to attenuate atherosclerotic lesions in ApoE(-/-) mouse mo del via reducing the aortic expression of miR-21a, miR-132, miR-126a, miR-155 and increasing expression of miR-20a [16]. [score:5]
[1 to 20 of 1 sentences]
57
[+] score: 4
Other miRNAs from this paper: mmu-mir-132
Leptin induces hippocampal synaptogenesis via CREB-regulated microRNA-132 suppression of p250GAP. [score:4]
[1 to 20 of 1 sentences]
58
[+] score: 4
Tognini P Putignano E Coatti A Pizzorusso T Experience -dependent expression of miR-132 regulates ocular dominance plasticityNat. [score:4]
[1 to 20 of 1 sentences]
59
[+] score: 4
The downregulated miRNAs were miR-132-5p and miR-490-5p (Figure 7). [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 3
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Mouse miR-124a as well as miR-128, miR-101 and miR-132 have been reported to be expressed specifically in brain [15]. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
OTA increases miR-132 and miR-200c expression in porcine renal proximal tubular cells [33]. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
Shaltiel G. Hanan M. Wolf Y. Barbash S. Kovalev E. Shoham S. Soreq H. Hippocampal microRNA-132 mediates stress-inducible cognitive deficits through its acetylcholinesterase targetBrain Struct. [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 3
Expression patterns of miR-124, miR-134, miR-132, and miR-21 in an immature rat mo del and children with mesial temporal lobe epilepsy. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
Murine macrophages incubated with paclitaxel had significantly increased expression of miR-155, miR-147, miR-146a and miR-132 30. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
Wang et al[33] demonstrated impaired acquisition of trace fear memory in mice following reduced miR-132 expression in the hippocampus. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
miR-155 and miR-132 expression levels were also demonstrated to be increased in the total liver as well as in isolated hepatocytes and the Kupffer cells of alcohol-fed mice (9). [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Other miRNAs from this paper: rno-mir-146a, rno-mir-155
For example, the expression levels of miR-146a, miR-155, and miR-132 decreased by 93 ± 3% with increasing donor age [40]. [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
Indeed, since the first report of a change in miRNA expression (miR-132) after a seizure [40], the involvement of miRNAs in epilepsy pathogenesis has become a focus for epigenetic research. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
Lin identified the involvement of cAMP/PKA and ERK dependent CREB signaling pathways in the luteolin -mediated miR-132 expression and neuritogenesis of PC12 cells [47]. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 2
Yi L. T. Li J. Liu B. B. Luo L. Liu Q. Geng D. BDNF-ERK-CREB signalling mediates the role of miR-132 in the regulation of the effects of oleanolic acid in male mice J. Psychiatry Neurosci. [score:2]
[1 to 20 of 1 sentences]
71
[+] score: 2
Neuronal activity rapidly induces transcription of the CREB-regulated microRNA-132, in vivo. [score:2]
[1 to 20 of 1 sentences]
72
[+] score: 2
For example, neurite outgrowth is regulated by miR-132 [50]. [score:2]
[1 to 20 of 1 sentences]
73
[+] score: 2
Other miRNAs from this paper: rno-mir-125b-1, rno-mir-125b-2
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
[1 to 20 of 1 sentences]
74
[+] score: 2
Other miRNAs from this paper: rno-mir-125b-1, rno-mir-125b-2
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
[1 to 20 of 1 sentences]
75
[+] score: 2
Other miRNAs from this paper: mmu-mir-132, mmu-mir-212, rno-mir-212
Gonadotropin-releasing hormone induces miR-132 and miR-212 to regulate cellular morphology and migration in immortalized LbetaT2 pituitary gonadotrope cells. [score:2]
[1 to 20 of 1 sentences]
76
[+] score: 1
Other miRNAs from this paper: rno-mir-146a, rno-mir-155
Kong H, Yin F, He F, Omran A, Li L, Wu T, Wang Y, Peng J. The effect of miR-132, miR-146a, and miR-155 on MRP8/TLR4 -induced astrocyte-related inflammation. [score:1]
[1 to 20 of 1 sentences]
77
[+] score: 1
For instance, the S100A8 precedes Aβ plaque formation [17], IGFBP-2 drives AD neurodegeneration [18], miR-146a-5p facilitates neuroinflammation in AD pathogenesis [19], and miR-132-3p contributes to tau hyper-phosphorylation [20]. [score:1]
[1 to 20 of 1 sentences]
78
[+] score: 1
Most of binding sites for miRNAs described in Nurr1 mRNA (Table 1) are located in the further 3'end of the longest 3’UTR of mice or human Nurr1 mRNAs with the exception of miR-132 [25] that binds in the codifying sequence, and miR-217 [24] that binds around the nucleotide 567 of the longest 3’UTR of human Nurr1 mRNA. [score:1]
[1 to 20 of 1 sentences]
79
[+] score: 1
The eight circulating miRNAs, miR-29a, miR-34a, miR-375, miR-103, miR-107, miR-132, miR-142-3p and miR-144, and the two tissue-specific miRNAs, miR-199a-3p and miR-223, were identified to be significantly altered in T2D across a meta-analysis of controlled profiling studies [51]. [score:1]
[1 to 20 of 1 sentences]
80
[+] score: 1
MiR-128, miR-132, miR-134, and miR-138 have also been shown to be involved in NSC maturation and dendritic spine morphogenesis [17]. [score:1]
[1 to 20 of 1 sentences]
81
[+] score: 1
Other miRNAs from this paper: rno-let-7b, rno-mir-21, rno-mir-98, rno-mir-138-2, rno-mir-138-1
Four of the five studies, including ours, identified an increase in miR132 [32]. [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
In 2015, Lannes et al. reported that the miR-132/212 pathway is associated with the stimulation of FSH secretion by GnRH [48]. [score:1]
[1 to 20 of 1 sentences]