sort by

36 publications mentioning rno-mir-142

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-142. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 103
We found that EA could increase the expression of both miR-142 and miR-376c in the hypothalamus, and miR-142 down-regulation could inactivate the role of EA in HPA axis regulation during trauma. [score:7]
Partial hepatectomy induced the downregulation of hypothalamic miR-142 levels, and the effect of EA in adjusting the CRH level and attenuating the surgery -induced hyperactivity of the HPA axis mainly by up -regulating the expression of miR-142 and miR-376c occurred within the hypothalamus. [score:7]
We found that miR-142, miR-200c, miR-212, miR-325, miR-361, miR-376c, miR-429, and miR-494 overexpression could down-regulate the CRH mRNA level (p < 0.05; Figure 6A), and there was no difference between these miRNAs and the negative miRNA control (p > 0.05) in terms of cell viability (Supplementary Figure S2A). [score:6]
Also, miR-142 and miR-376c down expression could up-regulate CRH secretion simultaneously (p < 0.05; Figure 6D). [score:6]
Compared with overexpression of the scramble miRNA, miR-142, miR-200c and miR-376c could down-regulate CRH protein in primary cultured hypothalamus neurons (p < 0.05; Figure 7A). [score:5]
The decreased expression of the above miRNAs in primary hypothalamus neurons had no effect on cell viability (Supplementary Figure S2A), and the decreased expression of the miR-142, miR-361, miR-376c and miR-429 could increase CRH mRNA (p < 0.05; Figure 6C). [score:5]
The effect of the down-regulation of miR-142 or miR-376c on the change in serum CRH, ACTH and CORT levels (C). [score:4]
However, the underlying mechanism for hypothalamus miR-142 and miR-376c expression regulated by EA still needs to be further explored. [score:4]
Figure 7CRH is a target of miR-142 and miR-376c. [score:3]
The binding site (B) of miR-142, miR-200c and miR-376c on the 3′-untranslatedregions (3′ UTR) of CRH and their mutant plasmid. [score:3]
In the dual luciferase reporter system, miR-142 (0.55 ± 0.037) and miR-376c (0.6 ± 0.045) over -expression significantly reduced the fluorescein enzyme activity (p < 0.01), whereas miR-200c had no change (p > 0.05; Figures 7B,C). [score:3]
In Situ HybridizationHypothalamus PVN miR-142 and miR-376c expression was detected by in situ hybridization (ISH) analysis. [score:3]
The miR-142 and miR-376c expression in each brain slice was detected using an enhanced sensitive ISH detection kit (Boster Inc. [score:3]
The effect of the overexpression of miR-142 or miR-376c on the change in serum CRH, ACTH and CORT levels (B). [score:3]
Quantification of the expression levels of miR-142 and miR-376c among the control, hepatectomy, SEA and EA groups at 4 h and 1 day after hepatectomy (A). [score:3]
CRH Was a Target of miR-142 and miR-376c. [score:3]
In addition, there was no difference of miR-142 (p > 0.05) or miR-376c (p > 0.05) expression in the ventromedial hypothalamic nucleus (VMH), periventricular hypothalamic nucleus (Pe) and arcuate hypothalamic nucleus (Arc) among groups (Supplementary Figure S5). [score:3]
CRH protein expression (A) in primary hypothalamus neurons transfected with miR-142, miR-200c, miR-325, miR-361, miR-376c and miR-429 agomir or the negative control. [score:3]
Hypothalamic miR-142 and miR-376c could modulate the function of the HPA axis by targeting CRH. [score:3]
PVN miR-142 or miR-376c Overexpression Alleviated HPA Axis Hyperactivity Induced by Hepatectomy. [score:3]
Hypothalamus PVN miR-142 and miR-376c expression was detected by in situ hybridization (ISH) analysis. [score:3]
Besides, miR-142, miR-200c, miR-325, miR-361, miR-376c and miR-429 overexpression could decrease the level of CRHR1 mRNA simultaneously (p < 0.05; Figure 6B). [score:3]
The Regulatory Effect of EA on HPA Axis Hyperactivity in the Hepatectomy Rats Was Blocked by Intra-PVN Administration of miR-142 Antagomir. [score:2]
Furthermore, the level of hypothalamus miR-142 was decreased in the hepatectomy rats, which indicated that miR-142 was a potential miRNA in regulating the HPA axis during severe trauma. [score:2]
Decreased expression of miR-142 or miR-376c via antagomir in the PVN of rats was seen compared with the rats in the scramble group. [score:2]
Finally, a dual luciferase reporter gene assay verified that CRH was a target of miR-142 and miR-376c. [score:2]
The oligonucleotide probe to rno-miR-142 was 5′-AGTAG TGCTT TCTAC TTTAT G-3′, and the probe to rno-miR-376c was 5′-ACGTG AAATT TCCTC TATGT T-3′ (Boster Inc. [score:1]
Hypothalamic miR-142 and miR-376c Levels after Hepatectomy. [score:1]
Then, the rats were divided into the scramble, hepatectomy+scramble, hepatectomy+scramble+EA, hepatectomy+miR-142+EA and hepatectomy+miR-376c+EA groups. [score:1]
The luciferase activity (C) of the miR-142, miR-200c, miR-376c onto the 3′ UTR of CRH. [score:1]
Figure 9The effect of hypothalamus miR-142 and miR-376c on the hypothalamus pituitary adrenal (HPA) axis during hepatectomy. [score:1]
Detection of miR-142 and miR-376c in the PVN among groups at 1 day after hepatectomy (B). [score:1]
Then the rats were divided into the control+scramble, hepatectomy+scramble, control+miR-142, hepatectomy+miR-142, control+miR-376c and hepatectomy+miR-376c groups. [score:1]
Serum CRH (p < 0.05), ACTH (p < 0.05) and CORT (p < 0.01) expression levels were decreased in the hepatectomy+scramble+EA group compared with those in the hepatectomy+scramble group; compared with the hepatectomy+scramble+EA group, blood CRH (p < 0.05) and CORT (p < 0.01) levels were increased in the hepatectomy+miR-142+EA group (Figure 9C). [score:1]
In comparison with the hepatectomy group, the hypothalamus miR-142 level in the SEA group (p < 0.05) and the EA group (p < 0.01) was increased at 4 h after surgery. [score:1]
[1 to 20 of 35 sentences]
2
[+] score: 102
Other miRNAs from this paper: rno-mir-129-2, rno-mir-129-1, rno-mir-146a, rno-mir-206
These results showed that miR-142-5p can significantly inhibit the expression of VCAM-1 and that miR-142-5p inhibits the expression of VCAM-1 by binding to the AUGAAAUA sequence of the 3′UTR region of VCAM-1. The migration ability of BMMSCs is related to the level of osteogenesis, and impaired osteogenesis is an important part of the development of osteoporosis. [score:10]
In the current study, based on our previous transcriptome sequencing analysis, miR-142-5p was proven to bind 3′UTR in VCAM-1 gene and inhibit BMMSC migration by downregulating VCAM-1 expression. [score:8]
The results showed that miR-142-5p could inhibit the migration of BMMSCs by inhibiting the expression of VCAM-1. Estrogen deficiency is one of the major risk factors of osteoporosis. [score:7]
To confirm that miR-142-5p indeed binds to VCAM-1 3′UTR region and regulates VCAM-1 expression, the 3′UTR region of VCAM-1 was extracted and the 8 nucleotides of the binding domain were knocked down prior to being constructed into the luciferase expression vector. [score:7]
2.3. miR-142-5p Inhibited VCAM-1 Expression by Binding to the 3′UTR Region of VCAM-1. 2.4. miR-142-5p Inhibited Migration of BMMSCs. [score:7]
Due to the important role of VCAM-1 in migration of BMMSCs and the critical role of BMMSCs migration to site of bone formation prior to their osteogenic commitment for new bone formation during physiological bone remo delling and bone fracture healing, the findings in the current study indicated the important role of miR-142-5p in osteoporosis development involving targeting VCAM-1 and inhibiting BMMSC migration. [score:6]
After expression confirmation, miR-142-5p with a clear expression difference following OVX was selected for subsequent analyses to study how it regulates the behaviours and functions of BMMSCs. [score:6]
miR-142-5p has been proven in the current study to be the most significantly induced miRNA in BMMSCs and bind to 3′UTR of VCAM-1 to inhibit VCAM-1 expression in OVX -induced osteoporosis in rats. [score:5]
The results showed that miR-142-5p could inhibit the migration of BMMSCs by inhibiting the expression of VCAM-1. A bilateral OVX -induced osteoporosis mo del was established in the current study according to a previous study [11], and the BMD was measured on days 0, 45, and 90 after OVX (Table 1). [score:5]
Previously, miR-142-5p has been reported to be able to regulate several genes depending on cellular microenvironments, and its aberrant expression has been detected in various disorders. [score:4]
For example, it has been reported that miR-142-5p is an important noncoding RNA targeting several genes depending on cellular microenvironments. [score:3]
Significantly Increased Expression of miR-142-5p in BMMSCs Isolated from OVX-Induced Osteoporotic Rats. [score:3]
The expression levels of miR-142-5p and other miRNAs were normalized by U6. [score:3]
Furthermore, cells transfected with miR-142-5p mimic, but not the negative control mimic, were shown to have a much lower VCAM-1 protein expression as revealed via Western blotting analyses (Figure 3(d)). [score:3]
However, the target gene(s) and molecular mechanism of miR-142-5p action in osteoporosis are not clear yet. [score:3]
By analysing miRWalk database to identify mRNA that binds to miR-142-5p, miR-142-5p was found to be able to bind to the 3′UTR region of VCAM-1. Consistently, after analysing the transcriptome sequencing data of BMMSCs from our previous rat OVS osteoporotic mo del, the expression of VCAM-1 in BMMSCs was significantly decreased in the OVX osteoporotic rats (Figure 3(a)). [score:3]
Song and Kim reported that miR-142-5p levels correlated to A β42 expression [15]. [score:3]
In this present study, using an OVX osteoporosis mo del in rats, many miRNAs were found to have significant changes in expression, and, particularly, miR-142-5p was found to have the most significant induction in BMMSCs of rats with OVX -induced osteoporosis. [score:3]
The results revealed that when VCAM-1 sequence was intact, miR-142-5p significantly reduced the luciferase activity in the 3′UTR region of VCAM-1. However, when the sequence of binding to miR-142-5p in the 3′UTR region of VCAM-1 was knocked down, the luciferase activity was not affected by miR-142-5p. [score:2]
The effect of miR-142-5p on luciferase expression was detected by the dual-luciferase assay (Figure 3(c)). [score:2]
Sharma reviewed that miR-142-5p can regulate inflammation and immune responses [16]. [score:2]
The migration ability of BMMSCs transfected with miR-142-5p mimic was significantly decreased, while there were no significant differences in the group transfected with negative control mimic. [score:1]
Using transfection reagent Lipofectamine 2000 (Invitrogen, Carlsbad, CA), HEK293T cells were cotransfected with pGL3-VCAM-1-3′UTR-WT (with wild-type VCAM-1 sequence) or pGL3-VCAM-1-3′UTR-MUT (with 8 nucleotides of the VCAM-1 3′UTR region being mutated) (see below) and pRL and miR-142-5p mimic or negative control (NC) mimic (Genscript, Beijing, China). [score:1]
The binding sequence of miR-142-5p to VCAM-1 in the 3′UTR region is shown in Figure 3(b). [score:1]
As miR-142-5p was found to have the lowest p value, it was selected to be studied further. [score:1]
However, potential functions of miR-142-5p and VCAM-1 in osteoporosis have been hardly reported previously. [score:1]
miR-142-5p was also reported to play roles in colon cancer and squamous cell carcinoma [17, 18]. [score:1]
Among them, p values of miR-129-5p and miR-142-5p were both less than 0.01, being 0.0012 and 0.000058, respectively. [score:1]
[1 to 20 of 28 sentences]
3
[+] score: 85
To avoid the use of immuno-suppressant drugs, we tested whether inhibition of ectopic transgene expression through the inclusion of miR142-Tx4 in our vectors could prevent the development of transgene-directed immune responses to ARSB in MPS VI rats. [score:9]
More recently, inclusion of miR142-T sequences in the transgene expression cassette has been used to avoid off-target transgene expression in APC and prevent transgene-directed immune responses in the context of liver-directed gene transfer [35]. [score:9]
Inclusion of target sequences for the hematopoietic lineage-specific miRNA miR142-3p (miR142-T) in the 3′UTR of the transgene expression cassette has been reported to de-target transgene expression from hematopoietic cells in the spleen [35]. [score:9]
In conclusion we show that: i) systemic AAV2/8 administration to newborn rats is associated with vector dilution and low transduction levels; ii) the combination of AAV2/8 with the hepatocyte-specific promoter TBG prevents transgene expression in liver Kupffer and endothelial cells but not in newborn kidney and spleen; iii) the inclusion of target sequences for the miR142-3p in the expression cassette of the lysosomal enzyme ARSB does not prevent humoral immune responses to the transgene, and iv) the inclusion of WPRE-m in AAV2/8-TBG vectors is associated with decreased rat liver transduction levels. [score:7]
Eleven days after vector delivery, of eGFP expression showed transgene expression in liver but not spleen of rats receiving AAV2/8-TBG-eGFP-miR142-Tx4 (Fig. S2F) confirming that the inclusion of miR142-T prevents transgene expression in this ectopic site. [score:7]
This was avoided by the inclusion of target sites for miR142-3p in the transgene expression cassette. [score:5]
To test if this strategy can be exploited to inhibit ectopic transgene expression in the spleen of rats injected at P4 with AAV2/8-TBG vectors, we generated AAV2/8-TBG-eGFP vectors carrying four copies of the miR142-T (miR142-Tx4) immediately downstream of the eGFP coding sequence (see ). [score:5]
We hypothesized that this may contribute to the anti-hARSB immune responses we observed in MPS VI rats after liver transduction with AAV2/8-TBG-hARSB [14], [15] and that this could be prevented by the inclusion of the miR142-Tx4 element in the AAV2/8-TBG-hARSB expression cassette. [score:3]
However this is not surprising since the miR142-Tx4 sequence may negatively impact on the stability of transcripts deriving from the eGFP but not from the ARSB expression cassettes used in this study. [score:3]
Inclusion of target sequences for miR142-3p in the AAV vector genome does not reduce immune responses to ARSB in MPS VI rats injected with AAV2/8-TBG-hARSB. [score:3]
This is different from what we observed when the miR142-Tx4 sequence was included in the eGFP encoding vectors, resulting in reduced levels of liver transgene expression (Fig. S2). [score:3]
However, the low ARSB serum levels and the high anti-ARSB antibody titers we found despite the use of the miR142-3p target sequence argue against this. [score:3]
We have also observed that liver eGFP expression was lower in rats receiving vectors containing miR142-T compared to those injected with AAV2/8-TBG-eGFP (Fig. S2F and S2B respectively). [score:2]
Similar data were obtained in rats injected at P30 (Fig. 5C and E), suggesting that the inclusion of binding sites for miR142-3p in AAV2/8-TBG-hARSB vectors does not avert the development of anti-ARSB humoral immune responses. [score:2]
The obtained fragment (containing four copies of miR142-T) was subcloned in pBluescript II SK(+) previously digested with XbaI and XhoI. [score:1]
Monthly serum ARSB activity was very low in rats treated as newborns, independently of the presence of miR142-T sites (Fig. 5B). [score:1]
We speculate that the addition of the miR142-T sequence to the eGFP transcript may reduce its stability. [score:1]
The p-value between the TBG-hARSB and TBG-hARSB-miR142-Tx4 groups is 0.12. [score:1]
MPS VI rats were injected either at P4 or at P30 with 4×10e13 gc/kg of either AAV2/8-TBG-hARSB or AAV2/8-TBG-hARSB-miR142-Tx4. [score:1]
Sera from rats injected with AAV2/8-TBG-hARSB or AAV2/8-TBG-hARSB-miR142-Tx4 vectors were collected each month for analysis of ARSB activity and anti-ARSB antibodies. [score:1]
Animals receiving AAV2/8-TBG-hARSB or AAV2/8-TBG-hARSB-miR142-Tx4 vectors received in addition 4×10e12 gc/kg of AAV2/8-TBG-eGFP-WPRE-m to confirm liver transduction. [score:1]
MPS VI rats were injected either at P4 or at P30 with AAV2/8-TBG-hARSB or AAV2/8-TBG-hARSB-miR142-Tx4 vectors. [score:1]
To generate the pAAV2.1-TBG-eGFP-miR142-Tx4 plasmids, the eGFP coding sequence was excised from pAAV2/8-TBG-eGFP by restriction enzyme digestion with NotI and HindIII (Roche, Basel, Switzerland); the resulting eGFP fragment was then cloned in pAAV2.1-TBG-hARSBmiR142-Tx4 previously digested with NotI and ClaI to remove the hARSB coding sequence while keeping miR142-Tx4. [score:1]
The recombinant clones were digested with BglII to release the fragment containing the four miR142-T sites with BglII protruding ends. [score:1]
Wild-type rats were injected at P4 with 4×10e13 gc/kg of either AAV2/8-TBG-eGFP or AAV2/8-TBG-eGFP-miR142-Tx4. [score:1]
The miR142-Tx4 element was constructed by annealing the following two sets of oligonucleotides: 5′-CTAGATCT TCCATAAAGTAGGAAACACTACACGAT TCCATAAAGTAGGAAACACTACAAAGCTT -3′; 5′- TGTAGTGTTTCCTACTTTATGGAATCG TGTAGTGTTTCCTACTTTATGGAAGAT-3′ and 5′- TCCATAAAGTAGGAAACACTACATCAC TCCATAAAGTAGGAAACACTACAAGATC -3′; 5′- TCGAGATCT TGTAGTGTTTCCTACTTTATGGAGTGA TGTAGTGTTTCCTACTTTATGGAAAGCTT -3′. [score:1]
The resulting double-stranded fragments (each one containing two copies of miR142-T) were ligated thanks to the presence of phosphorylated 5′ ends. [score:1]
F) Wild-type rats were injected at postnatal day (P)4 with 4×10e13 gc/kg of either AAV2/8-TBG-eGFP or AAV2/8-TBG-eGFP-miR142-Tx4 vectors. [score:1]
0033286.g005 Figure 5MPS VI rats were injected either at P4 or at P30 with AAV2/8-TBG-hARSB or AAV2/8-TBG-hARSB-miR142-Tx4 vectors. [score:1]
[1 to 20 of 29 sentences]
4
[+] score: 66
Reductions in miR-142 are associated with elevations in ubiquitin proteasome activity [47], which is a cellular strategy for degrading proteins denatured by stress and repairing DNA damage [48], Collectively, these observations suggest that stress -induced down-regulation of miR-142-5p and -203 and up-regulation of Hsp72 may be crucial components of exosome -based stress -induced immunomodulation and cytoprotection, which is consistent with previous findings demonstrating the immunomodulating and cellular consequences of stress [39], [49]. [score:7]
com query, 374 genes are predicted targets of rno-miR-142-5p and 386 genes are predicted targets of rno-miR-203. [score:5]
Pathway analyses of the 760 predicted mRNA targets of miR-142-5p and -203 revealed functionally enriched pathways that overlap with demonstrated targets of the stress response. [score:5]
Since down-regulation of miR-142-5p is known to enable cytokine -mediated survival [27], prazosin administration should decrease associated inflammatory cytokine activity. [score:4]
Recent findings indicate that down-regulation of miR-142 promotes early normal macrophage differentiation [30]. [score:4]
Consistent with previous research, blockade of the α [1]-ADR with prazosin prior to inescapable tail shock stress reduces stress -induced elevations of Hsp72 in plasma [35], [50], and attenuates the stress -induced down-regulation of miR-142-5p. [score:4]
Further, we identify sympathetic nervous system (SNS) activation of the α [1]-adrenergic receptor (ADR) as an important signaling process to exosomal elevations of Hsp72 and down-regulation of miR-142-5p. [score:4]
For example, exposing cells to a non-lethal stressor, such as heat, to elevate Hsp72 and down-regulate miR-142-5p and -203 in exosomes could enhance the immunogenicity of exosome -based vaccines, specifically cancer vaccines [8], [53]. [score:4]
The data presented here also demonstrate that exposure to an acute stressor down-regulates miR-142-5p and -203 in circulating plasma exosomes, likely affecting macrophage and dendritic cell -mediated immunity. [score:4]
Down-regulation of miR-142-5p is also known to enable cytokine -mediated survival signaling in response to hemodynamic stress through the IL-6 receptor, gp130 [27], further supporting its immunological contribution during the stress response. [score:4]
Intraperitoneal administration of the α [1]-ADR antagonist prazosin (2.0 mg/kg) 30 min prior to Stress attenuated the stress -induced down-regulation of miR-142-5p, but not miR-203. [score:4]
This study also reveals that exosomal modification in Hsp72 and miR-142-5p from stressed rats rely on sympathetic nervous system release of norepinephrine (NE) and its subsequent activation of one of its target receptors, the α [1]-ADR. [score:3]
Additional KEGG analysis of predicted gene targets for miR-142-5p revealed involvement with ubiquitin mediated proteolysis. [score:3]
Pathway enrichment analyses of rno-miR-142-5p and rno-miR-203. [score:1]
Based on these findings, we hypothesize that exposure to an intense, acute stressor modifies plasma exosome cargo, specifically Hsp72 and miR-142-5p, by activating the SNS and inducing the release of NE from sympathetic nerve terminals. [score:1]
Prazosin attenuates stress -modified changes in exosomal Hsp72 and miR-142-5p. [score:1]
Stress reduces exosomal miR-142-5p and miR-203. [score:1]
Functionally enriched pathways impacted by miR-142-5p and miR-203. [score:1]
Future studies should elucidate the tissue origin of these stress modified exosomes and examine if α [1]-ADR blockade in stressed animals affects their cytosolic Hsp72 and miR-142-5p, thus indicating whether α [1]-ADR activation is critical for their transcription and synthesis or their exosomal loading. [score:1]
MiRNA from stressed, control, stress + prazosin, and control + prazosin rats were analyzed for changes in miR-142-5p, miR-150, miR-155, and miR-203. [score:1]
Plasma exosomes isolated from the α [1]-ADR study were analyzed for miRNA related to stress and inflammation (miR-142-5p, -150, -155, and -203) and variations were observed. [score:1]
To explore the impact of acute stress on plasma exosome miRNA, we analyzed miR-142-5p, -150, -155, and -203 based on evidence of their differential presence in heat stressed rats [26], involvement in TLR -mediated immunity [28], and association with macrophage differentiation [30]. [score:1]
KEGG and Wiki analyses revealed that rno-miR-142-5p and rno-miR-203 are related to several functional categories, including metabolic pathways (25 genes), mRNA processing (12 genes), cancer pathways (10 genes), ubiquitin mediated proteolysis (9 genes), mitogen-activated protein kinase (MAPK) signaling (8 genes), transforming growth factor-β (TGF-β) signaling pathway (6 genes), and TGF-β receptor signaling pathway (6 genes). [score:1]
Additionally, reductions in miR-142-5p were reversed with prazosin administration (Figure 3). [score:1]
[1 to 20 of 24 sentences]
5
[+] score: 54
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
These miRNAs were chosen as representative of the different patterns that were observed: up-regulation (miR-9a-5p) or down-regulation (miR-598-5p) during latency, down-regulation in the late latency - first spontaneous seizure period (miR-381-3p) and down regulation in the chronic stage (miR-142-5p). [score:11]
We identified a single miRNA, miR-142-3p that was altered both in plasma and in the brain, but the pattern of expression was different in that it was down-regulated in the former and up-regulated in the latter. [score:9]
The patterns of dysregulation, however, were totally different: miR-142-3p was up-regulated in the GCL during latency and down-regulated in plasma in the chronic period. [score:8]
First, a subgroup of miRNAs (miR-15b-5p, miR-17-5p, miR-18a-5p, miR-19a-3p, miR19b-3p, miR-20a-5p, miR-20b-5p, miR-21-5p, miR-23b-5p, miR-24-3p, miR-27a-3p, miR-92a-3p, miR-93-5p, miR-142-3p, miR-344b-2-3p, miR-431, miR-466b-5p and miR-674-3p) displayed increased expression levels during latency (4 and 8 days after SE), decreased their expression levels at the time of the first spontaneous seizure and returned to control levels in the chronic phase (Fig. 2, Supplementary Fig. S1). [score:5]
Finally, miR-30c-2-3p, miR-101b-3p, miR-142-3p, miR-142-5p, miR-181a-1-3p, miR-374-5p, miR-466c-3p, miR-1188-3p, miR-3065-3p and miR-3582 were significantly down-regulated in the chronic stage (Supplementary Fig. S7D). [score:4]
Cluster 3 was composed by two up-regulated microRNAs, miR-142-3p and miR-146a-5p. [score:4]
All these miRNAs displayed a peak in expression levels 8 days after SE, except for miR-21-5p, miR-27a-3p, miR-142-3p and miR-674-3p that peaked earlier (4 days after SE). [score:3]
The other 24 performed the analysis in plasma samples obtained from the trunk blood, reporting an increase in miR-142-5p levels during the acute phase, miR-21-5p in the early stage and of miR-146a-5p in the chronic stage, that reflect parallel changes in miRNAs expression observed in the brain. [score:3]
In fact, the expression patterns of miR-20b-5p, miR-142-3p, miR-181d-5p, miR-212-5p, miR-344b-5p and miR-674-3p were identical to those observed using the microarray, and those of miR-21-5p and miR-146a-5p were very similar, although not identical (Fig. 4). [score:3]
The only miRNA dysregulated both in the GCL and in plasma was miR-142-3p. [score:2]
MiR-9a-3p and miR-142-3p were chosen for validation in the same cohort of samples, displaying the same patterns observed in the microarray, even if they did not reach statistical significance. [score:1]
Cluster 3 (that includes miR-142-3p and miR-146a-5p) and cluster 4 (including miR-181c-5p and miR-181c-5p) are connected to the “cytokine-cytokine receptor interaction” signaling pathway, which suggests a neuroinflammatory role for those miRNAs. [score:1]
[1 to 20 of 12 sentences]
6
[+] score: 44
In the 1 h incubation (Fig. 3), with the exception of rno-miR-142-3p and rno-miR-335, the relative expression levels of the miRNAs at 2.8G were similar to those of freshly isolated islets (Fig. 3; p<0.05 vs 2.8G in Wistar), i. e. GK miRNAs significantly -upregulated in the microarrays consistently exhibited higher levels of expression than the Wistar miRNAs, whereas rno-miR-708 which was found to be downregulated in GK was minimally expressed. [score:13]
0018613.g004 Figure 4Three general trends of miRNA expression trajectories were observed for Wistar islets at 2.8G vs 16.7G: i) increased expression as exhibited by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreased expression as in the case of rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708 and, iii) no change as seen in rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:7]
Three general trends of miRNA expression trajectories were observed for Wistar islets at 2.8G vs 16.7G: i) increased expression as exhibited by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreased expression as in the case of rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708 and, iii) no change as seen in rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:7]
In GK, more pronounced variation of miRNA expression trajectories (magnitude and direction of expression) were observed upon glucose stimulation at 8.3G, especially for rno-miR-124, rno-miR-142-5p and rno-miR-409-3p (Fig. 3; p<0.01 vs 2.8G in GK). [score:6]
Data analysis and presentation are as described for Figure 3. In comparison, the expression trajectories of some miRNAs in the GK islets also follow similar trends as in the Wistar islets, such as rno-miR-124, rno-miR-142-3p and rno-miR-375. [score:3]
In general, aside from more significant changes in expression levels of miRNAs at 24 h incubation compared to 1 h incubation, three trends in terms of expression changes are also observed in the Wistar islet upon stimulation at 16.7G as compared to 2.8G: i) increasing miRNA levels, as displayed by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreasing miRNA levels as exhibited by rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708, and iii) no significant change as displayed by rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:3]
Data analysis and presentation are as described for Figure 3. In comparison, the expression trajectories of some miRNAs in the GK islets also follow similar trends as in the Wistar islets, such as rno-miR-124, rno-miR-142-3p and rno-miR-375. [score:3]
However, despite these attempts in the GK islet to attain normal levels of miRNAs, failures were seen in most GK miRNAs wherein the levels at 16.7G either overshoot those of Wistar's as in rno-miR-142-3p, rno-miR-142-5p, rno-miR-375 and rno-miR-124, or completely miss the normal levels as in the case of rno-miR-335 and rno-miR-376a (Fig. 4). [score:1]
In contrast, rno-miR-212 and rno-miR-132 showed the opposite trend leading to decreased miRNA levels upon stimulation at 16.7 G. Thus, for miRNAs that increases with increasing glucose concentrations in the normal Wistar islets, the GK islet miRNAs levels go down (rno-miR-132 and rno-miR-212) or do not change (rno-miR-409-3p), whereas for miRNAs whose levels decrease with increasing glucose concentration in Wistar islets, the GK islet miRNAs is also reduced (e. g. rno-miR-124, rno-miR-142-3p, rno-miR-375) (Fig. 4). [score:1]
[1 to 20 of 9 sentences]
7
[+] score: 35
While miR-142-5p and miR-219-5p were upregulated on the 3rd day after ventral combined with dorsal root avulsion, miR-17 and miR-199a-5p were upregulated on the 14th day after ventral combined with dorsal root avulsion and were predicted to target VGLUT1. [score:9]
miR-142-5p and miRNA-219-5p, which were upregulated on the 3rd day; and miR-17 and miR-199a-5p, which were upregulated on the 14th day. [score:7]
Furthermore, 40 of the miRNAs, including miR-34b-3p, miR-25-3p, miR-126-5p, miR-142-5p, and miR-324-5p, were only transiently upregulated (Figure  2A); the other 23 miRNAs, including miR-34a-3p and miR-324-5p, were transiently downregulated on the 3rd day but returned to normal levels by the 14th day (Figure  2B). [score:7]
Ventral combined with dorsal root avulsion resulted in a sustained upregulation of 10 miRNAs, including miR-19b-3p, miR-20b-5p, miR-21-5p, miR-27a-3p, miR-29b-3p, miR-106b-3p, miR-142-3p, miR-322-5p, miR-352, and let-7a-5p (Figure  2E). [score:4]
In the present study, by using the miRWalk database, we determined that the following altered miRNAs target the VGLUT1 gene: miR-142-5p, miR-219-5p, miR-17 and miR-199a-5p. [score:3]
Using deletion and site-directed mutagenesis approaches, it was shown that the post-transcriptional regulation of the D1 receptor is specifically mediated by miR-142-3p [58]. [score:3]
Dopaminergic receptors can also be regulated by miR-142-3p. [score:2]
[1 to 20 of 7 sentences]
8
[+] score: 28
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Of the three ZT06 groups that illustrated differential expression of miRNAs due to CD, emphasis was placed on the two-week chronic ZT06 group due to the differential expression of miRs 146a and 146b, and miR-127 (Figures 5A-5B and 6A). [score:11]
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Differentially expressed miRNAs based on Illumina sequencing in all the circadian-disrupted samples and their links to breast cancer development and circadian rhythms. [score:10]
Between the ZT06 groups that showed differences in miRNAs, there were no significant correlations or patterns in specific miRNA expression, with only two miRNAs being differentially expressed in more than one group, miR-150-5p and miR-142-5p (Table 2). [score:5]
Although only two miRNAs were identified in more than one of the ZT06 groups, miR-142-5p and miR150-5p (Table 2), there are significant correlations and patterns related to breast cancer development in each ZT06 group. [score:2]
[1 to 20 of 4 sentences]
9
[+] score: 27
The results showed that 14 miRNAs (miR-30a-5p, miR-30e-5p, miR-425-5p, miR-142-3p, miR-191a-3p, miR-215, miR-29b-3p, miR-30b-5p, miR-26a-5p, miR-345-5p, miR-361-5p, miR-185-5p, miR-103-3p) were down-regulated but no miRNA was up-regulated among above three altered miRNAs from microarray in OVX serum by normalizing to miR-25-3p (Fig. 3b). [score:7]
The clinical characteristics of the subjects were shown in Table 1. Among the detected miRNAs, miR-30b-5p showed significant down-regulation in both osteopenic and osteoporotic patients, while miR-103-3p and miR-142-3p were markedly down-regulated only in osteoporotic patients (Fig. 4a). [score:5]
Three serum miRNA (miR-103-3p, miR-142-3p and miR-328-3p) were markedly down-regulated only in osteoporotic patients and miR-30b-5p decreased in both osteopenic and osteoporotic patients. [score:4]
As shown in Fig. 4c, miR-30b-5p, miR-103-3p and miR-142-3p were significantly down-regulated after bedrest, while miR-328-3p had no significant change. [score:4]
After adjusting for age, weight and height, miR-30b-5p, miR-103-3p, miR-142-3p and miR-328-3p were significantly positively correlated with H-BMD (total hip BMD) (r = 0.541, p = 0.001; r = 0.355, p = 0.039; r = 0.650, p < 0.001; r = 0.355, p = 0.039 respectively). [score:1]
Moreover, miR-142-3p also acted as an essential modulator in macrophage differentiation 40. [score:1]
It was attractive to identify the important role of miR-142-3p in osteoclast differentiation. [score:1]
As shown in Fig. 4b, the AUC of miR-30b-5p was 0.793 (95% CI = 0.625–0.909, p = 0.0001), and 0.800 for miR-103-3p (95% CI = 0.607–0.926, p = 0.0004), 0.789 for miR-142-3p (95% CI = 0.599–0.918, p = 0.0023), and 0.874 for miR-328-3p (95% CI = 0.698–0.967, p < 0.0001). [score:1]
To access the potential diagnostic value of miR-30b-5p for bone loss (osteopenia and osteoporosis), and the value of miR-103-3p, miR-142-3p, miR-328-3p for osteoporosis, ROC analysis was conducted and the associated area under the curve (AUC) was used to confirm the diagnostic value of each miRNA. [score:1]
Meanwhile, miR-30b-5p and miR-142-3p were significantly associated with FN-BMD (femur neck BMD) (r = 0.439, p = 0.009; r = 0.489, p = 0.003 respectively) as well. [score:1]
And the ROC analysis (Fig. 4d) showed considerable diagnostic value: 0.926 for miR-30b-5p (95% CI = 0.67–1.00, p < 0.0001), 0.796 for miR-103-3p (95% CI = 0.52–0.96, p = 0.0133), 0.950 for miR-142-3p (95% CI = 0.68–1.00, p < 0.0001). [score:1]
[1 to 20 of 11 sentences]
10
[+] score: 24
Male-biased miRNA expression was associated with pathways related to cancer (miR-130b, miR-214, miR-181b, miR-199a, miR-150, miR-135a, miR-142-3p, miR-142-5p, miR-185), hematological disease (miR-22*, miR-142-3p, miR-142-5p, miR-150, miR-181b), and renal inflammation/nephritis (miR-130b, miR-223, miR-150, miR-142-5p, miR-296*, miR-185-3p) (Additional file 2). [score:5]
The expression of three miRNAs associated with fibrosis (miR-142-5p, miR-150, miR-223) was correlated with histopathology fibrosis severity scores. [score:3]
Individual animal kidney fibrosis severity scores correlated positively and significantly (p < 0.05) with individual miR-142-5p (R = 0.526), miR-150 (R = 0.567), and miR-223 (R = 0.724) expression from those animals at 78 and 104 weeks of age. [score:3]
Several miRNAs also exhibited substantial male-biased expression, including miR-142-5p (7.8-fold), miR-130b (5.9-fold), and miR-206 (4.6-fold). [score:3]
Three of these six molecules exhibited a pattern of increasing expression with age (miR-223, miR-150, miR-142-5p). [score:3]
Male-biased expression at older ages was observed for miR-142-5p (Figure  5F) with significant difference at 104 weeks of age. [score:3]
Statistically significant sex differences were confirmed for miR-183, miR-204, and miR-142-3p (Figure  7B-D). [score:1]
These six miRNAs are miR-130b, miR-296*, miR-223, miR-142-5p, miR-185, and miR-150. [score:1]
These miRNAs showed high representation in renal inflammation and nephritis pathways, and included miR-214, miR-130b, miR-150, miR-223, miR-142-5p, miR-185, and miR-296*. [score:1]
Furthermore, miR-142-5p and miR-223, both male-biased DEMs (Figures  5 and 7), have been previously implicated in fibrosis pathways [53], highlighting agreement regarding the functional roles of these miRNAs. [score:1]
[1 to 20 of 10 sentences]
11
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
miR-142-3p, a hematopoietic-specific miRNA [56], exhibits distinct expression patterns during T-cell development and maturation [55]. [score:4]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 5 sentences]
12
[+] score: 18
Su et al. showed miR-142-5p regulates human and mouse macrophage profibrogenic gene expression in chronic inflammation and mo dels of liver and lung fibrosis 47. [score:4]
Interestingly miR-142-5p expression in macrophages also influences fibrosis in the lung 47, a phenotype that is induced by radiation. [score:3]
Finally miR-142-5p had tumor-suppressive effect in lung cancer cells 48 49. [score:3]
In summary, similar to miR-144, miR-142-5p regulates cell growth and inflammation. [score:2]
We verified the up regulation of these 4 miRNAs, which are miR-142-5p, 144-3p, 144-5p and 19a-3p by radiation (Fig. 2a). [score:2]
MiR-142-5p was reported to control T-cell responses in vitro and in murine mo dels of graft versus host disease 22. [score:2]
We verified an increase of miR-142-5p, 144-3p, 144-5p and 19-3p in blood after 15 Gy in our rat mo del. [score:1]
Increases of miR-142-5p were found in lungs of patients with idiopathic pulmonary fibrosis 47. [score:1]
[1 to 20 of 8 sentences]
13
[+] score: 13
Other miRNAs from this paper: rno-mir-340-1, rno-let-7b, rno-mir-144, rno-mir-153, rno-mir-340-2
There were 10 miRNAs that were consistently up−/down-regulated at least 1.5-fold at all five time points after TBI (Table 1), among which miR-142-3p, -144, -340-5p, -674-5p, -153, -186, -190, -132* and -138-1* were up-regulated, whereas let-7b was down-regulated. [score:10]
GO analysis of selected miRNAs (miR-142-3p, -144, -340-5p, -674-5p, -153, -186, -190, -132*, -138-1* and let-7b) revealed that many of their target genes are involved in biological processes and cellular functions that might be related to TBI pathophysiology. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 10
Treatment with triptolide enhanced expression of five miRNAs (rno-miR-146b-5p, rno-miR-20b-5p, rno-miR-142-3p, rno-miR-223-3p, and rno-miR-21-5p), while that of five other miRNAs (rno-miR-668, rno-miR-203-3p, rno-miR-382-5p, rno-miR-344b-3p, and rno-miR-30b-3p) was significantly downregulated (Tables 3 and 4, and Figure 8). [score:6]
It was reported that triptolide may regulate heat shock protein 70 by inducing the expression of miR-142-3p [11]. [score:4]
[1 to 20 of 2 sentences]
15
[+] score: 9
The miRNA profile analysis showed that 38 miRNAs were differentially expressed between the HBC and CHB subjects; 33 were up-regulated, including miR-27a, miR-27b, miR-142-3p, miR-151-5p and miR-424, and 5 were down-regulated in HBC patients compared with the levels in CHB patients (fold-change>2.0 and P<0.01) (Table 2). [score:8]
For these experiments, 5 candidate miRNAs (miR-27a, miR-27b, miR-142-3p, miR-151-5p, and miR-424) were chosen because they were among in the 38 deregulated miRNAs in HBC compared with CHB. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 8
T cell infiltration could also explain the observed upregulation of miR-142 expression, as this is a highly expressed and cell type-specific microRNA in these immune cells [54]. [score:8]
[1 to 20 of 1 sentences]
17
[+] score: 7
Among the miRNAs, miR-34a, miR-32, miR-376a, miR-384-3p, miR-29b and miR-142-3p were the highly overexpressed, with fold induction of 11.8, 24.2, 12.7, 14.4, 11.6 and 19.1, respectively. [score:3]
We noted that miRNAs miR-34a, miR-18a, miR-19a, miR-32, miR-96, miR-142-3p miR-29b and miR-7b were significantly upregulated in the AOM rat fecal colonocytes compared to those obtained from the saline controls and the degree of induction was greater in the tumor bearing AOM rats compared to the tumor non-bearing AOM rats (Fig. 3B). [score:2]
Furthermore, fecal colonocytes from the tumor bearing AOM rats showed a significantly higher induction of miR-34a, miR-18a, miR-19a and miR-142-3p (3.0, 2.3, 2.2 and 2.1 fold induction respectively) (p<0.05), Thus, it is evident that the miRNA dysregulation in the histologically normal colonic mucosa of the AOM rats was mirrored in the fecal colonocytes and the miRNA modulation was augmented by the presence of neoplasia in the colon thus supporting potential role as a minimally intrusive modality for field carcinogenesis detection. [score:2]
[1 to 20 of 3 sentences]
18
[+] score: 7
miR-448, let-7b, miR-540, miR-296, miR-880, miR-200a, miR-500, miR-10b, miR-336, miR-30d, miR-208, let-7e, miR-142-5p, miR-874, miR-375, miR-879, miR-501, and miR-188 were upregulated, while miR-301b, miR-134, and miR-652 were downregulated in TMH group (Table 5). [score:7]
[1 to 20 of 1 sentences]
19
[+] score: 5
Particular miRNAs associated with aGvHD include miRNAs that enhance T-cell activation, such as miR-155 (4, 10), miR-142 (11), miR-29a, miR-29b, and the miR-17-92 cluster (12), and miRNAs that repress T-cell activation, such as mir-146a (13), which is also upregulated in T regulatory cells (Tregs) (14). [score:5]
[1 to 20 of 1 sentences]
20
[+] score: 5
For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively. [score:3]
As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively. [score:2]
[1 to 20 of 2 sentences]
21
[+] score: 5
A decrease in miR-142-3p may be related to the expression of genes that increase cell proliferation. [score:3]
At 2 ppm, three miRNAs (miR-142-3p, miR-145 and miR-203) were significantly decreased. [score:1]
The most decreased miRNAs at 6 ppm FA were miR-145 and miR-142-3p (Rager et al. 2013). [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 5
In contrast, the same degraded an oligonucleotide mimicking the sequence of miR-142-3p directly spiked in the exosome preparations. [score:2]
C) Exosomes isolated from MIN6B1 culture media were spiked with an oligonucleotide corresponding to the sequence of miR-142-3p (oligo-m142-3p) and incubated with (+ RNase) or without (Ctl) RNAse A and T1. [score:1]
For example, miR-451 and miR-142-3p were much more abundant in exosomes than in MIN6B1 cell extracts, whereas the levels of miR-32 and miR-194 were clearly higher inside the cells. [score:1]
After isolation, exosomes were collected in 150 μl PBS and 20 ρmol of an oligonucleotide duplex containing the mature miR-142-3p sequence (Eurogentec) were spiked in each sample. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 4
In fact, these autophagy linked genes’ mRNA includes, the target sequence for miRNAs related to diverse families 5, 6. The gene networks regulating autophagy pathway were determined using a system biology and unrevealed miR-130, miR-98, miR-124, miR-204, and miR-142 as presumed posttranscriptional modulators of this pathway at different levels [6]. [score:4]
[1 to 20 of 1 sentences]
24
[+] score: 4
Meanwhile, Ning et al. found that down-regulation of miR-142-5p attenuated ischemia/reperfusion injury in hippocampal neurons by promoting Nrf2/HO-1 signaling approach [41]. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 3
Additionally, Zhang et al. [22] have demonstrated miR-29b and miR-142-5p that was changed significantly in human serum during aging process, and we have confirmed that these two miRNAs also showed same expression pattern in young and aged rat serum (Supplementary Figure 2). [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
Those miRNAs differentially expressed on the microarrays with greatest fold changes, miRNA-101a, miRNA-142-3p, miRNA-433 and miRNA-96, were further analyzed. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 2
Namely, pregnant rats fed SO and FO diets during the first 12 days of pregnancy showed significant lower expression of miR-449c-5p, miR-134–5p, miR-188, miR-32, miR130a, miR-144–3p, miR-431, miR-142–5p, miR-33, miR-340–5p, miR-301a, miR-30a, miR-106b, and miR-136–5p, as compared with OO, LO, and PO diets. [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 2
MiR-98, miR-124, miR-130, miR-142, and miR-204, might regulate autophagy [25, 26]. [score:2]
[1 to 20 of 1 sentences]
29
[+] score: 2
In cardiac hypertrophy, miR-142 is a potent repressor of cytokine signaling in the myocardium (Rönn et al., 2014). [score:1]
Repression of miR-142 by p300 and MAPK is required for survival signalling via gp130 during adaptive hypertrophy. [score:1]
[1 to 20 of 2 sentences]
30
[+] score: 1
The seed sequences of miRNAs in this study are as follows: let7c, 16-UGAGGUAGUAGGUUGUAUGGUU-37; miR-24-2, 25-GUGCCUACUGAGCUGAAA CAGU-46; miR-142-5p, 16-CAUAAAGUAGAAAGCACUACU-36. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
The terminal 5' exon of orthologous transcript NP_001101587.1 in rat is missing, locating miR-148b upstream of NP_001101587.1; (c) Rat miR-142 is located in the first exon of the alternatively spliced transcript Q9JIR0-2. The orthologous alternative transcripts in human and mouse lacks the 5' exon, placing human and mouse miR-142 upstream of the BZRAP1 transcript. [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
Previously, they also have been named for instance miR-142-s (5'arm) and miR-142-as (3'arm). [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
Circulating levels of miR-129 and miR-142 were reduced in congestive heart failure [59, 60]. [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
Fold-changes ranged between a decrease of 0.49-fold (miR-504) and an increase of 1.55-fold (miR-142) relative to the contralateral control dentate gyrus (Figure 2B). [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
miR-142-5p, 5’ end of the precursor of miR-142, is increased in chronic heart failure patients [23]. [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
The eight circulating miRNAs, miR-29a, miR-34a, miR-375, miR-103, miR-107, miR-132, miR-142-3p and miR-144, and the two tissue-specific miRNAs, miR-199a-3p and miR-223, were identified to be significantly altered in T2D across a meta-analysis of controlled profiling studies [51]. [score:1]
[1 to 20 of 1 sentences]