sort by

80 publications mentioning rno-mir-145

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-145. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 326
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-145b
In summary, we have demonstrated that the expression of miR-145 is substantially down-regulated in both ischemia/reperfused heart and H [2]O [2] -treated cardiomyocytes and that miR-145 over -expression confers cardiac protection against oxidative stress -induced cardiomyocyte apoptosis through directly inhibiting the Bnip3 expression and the ROS generation under oxidative stress conditions. [score:13]
In our study, p53 was found to be transiently up-regulated at 15 min and 30 min following the treatment of H [2]O [2], but was subsequently decreased at 1 hour and 2 hour (figure 1C), while miR-145 was continuously down-regulated from 30 min to 8 h after H [2]O [2] treatment, indicating that besides p53, alternative mechanisms may be involved in regulating the miR-145 expression in cardiomyocytes. [score:10]
Our results demonstrated that miR-145 is substantially down-regulated in cardiomyocytes with oxidative stress, and that over -expression of miR-145 significantly inhibited the H [2]O [2] -induced cellular apoptosis, ROS production, mitochondrial structure disruption as well as the activation of key signaling proteins in mitochondrial apoptotic pathway. [score:8]
Quantitative real time PCR revealed that the expression levels of miR-145 were increased after Ad-miR145 transduction (25–100 MOIs) (A), but suppressed by miR-145 inhibitor in a dose -dependent manner (50–100 nM) (B) in cultured NRVMs. [score:7]
Transfection of miR-145 inhibitor significantly suppressed the miR-145 expression (figure 2B). [score:7]
Indeed, ectopic expression of Bnip3 significantly induced apoptosis in cardiomyocytes and this was partially inhibited when miR-145 was over-expressed. [score:7]
0044907.g002 Figure 2 Quantitative real time PCR revealed that the expression levels of miR-145 were increased after Ad-miR145 transduction (25–100 MOIs) (A), but suppressed by miR-145 inhibitor in a dose -dependent manner (50–100 nM) (B) in cultured NRVMs. [score:7]
Noticeably, over -expression of miR-145 substantially inhibited the H [2]O [2] induced cardiomyocyte apoptosis, as determined by TUNEL staining and DNA ladder ELISA, whereas transfection of miR-145 inhibitor increased the rate of H [2]O [2] -induced cardiomyocyte apoptosis (figure 3A–C). [score:7]
Indeed, over -expression of miR-145 markedly down-regulated the activity of luciferease gene fused with the Bnip3 WT-3′-UTR (luc-Bnip3 3′UTR). [score:6]
Indeed, the expression of miR-145 has been shown to be down-regulated in a variety of cancer cells as we observed here in cardiomyocytes treated with H [2]O [2] (figure 1B). [score:6]
Real-time PCR revealed that miR-145 expression was down-regulated in NRVMs treated with H [2]O [2]. [score:6]
Consistent with apoptosis detection assays, over -expression of either Bnip3 CDS or Bnip3 CDS/3′UTR triggered cytochrome C release, whereas over -expression of miR-145 suppressed the Bnip3 CDS/3′UTR -induced cytochrome C translocation (figure 4B). [score:6]
Over -expressing miR-145 Attenuated H [2]O [2] -induced Apoptosis in CardiomyocytesTo determine whether miR-145 plays a role in the regulation of H [2]O [2] -induced apoptosis in cardiomyocytes, we performed the adenovirus -mediated over -expression of miR-145. [score:6]
Since previous studies suggest a role of p53 in regulating miR-145 expression [21], we further detected the p53 expression in H [2]O [2]-treatment cardiomyocytes through western blot and found that the protein levels of p53 increased in the first 30 min following H [2]O [2] treatment, but decreased afterwards (figure 1C). [score:6]
Strikingly, we demonstrated that miR-145 over -expression markedly attenuated the production of ROS in cardiomyoctes in response to oxidative stress, suggesting that miR-145 may exert the cardioprotective effects through regulating not only the expression of Bnip3, but also the activation of it. [score:6]
MiR-145 is a tumor suppressor miRNA that has been recently implicated in the regulation of apoptosis networks in tumor cells through its ability of targeting various anti-apoptotic molecules [7]– [9]. [score:6]
Moreover, the aberrant expression of miR-145 has been shown to be associated with vascular smooth muscle cells’ response to hydrogen peroxide (H [2]O [2]) -induced oxidative stress, indicating that miR-145 may participate in the regulation of the oxidative stress-triggered apoptosis and the regulation of the mitochondrial apoptotic pathway [10]. [score:5]
Expression of MiR-145 was Down-regulated in the Heart in Response to I/R Injury. [score:5]
The miR-145 inhibitor along with control inhibitor was transfected 24 hours after adenoviruses transduction. [score:5]
MiR-145 Regulated Bnip3 Expression through Targeting its 3’UTR. [score:5]
Expression of miR-145 in cardiomyocytes either transduced with Ad-miR145 and transfected with miR-145 inhibitor. [score:5]
MiR-145 regulated Bnip3 expression through targeting the specific binding cites in the 3′UTR of Bnip3. [score:5]
48 hr after transfection, cells were then transfected with 20 nM either miR-145 inhibitor or control inhibitor per 10 [6] cells. [score:5]
The result shows that miR-145 over -expression inhibited the activation of mitochondrial apoptotic pathway. [score:5]
In tumor cells, the p53 mutation and hypermethylation of miR-145 promoter seem to primarily account for the miR-145 down-regulation [21]. [score:5]
Over -expression of miR-145 significantly decreased the activity of luciferase gene fused with Bnip3 wild-type 3′-UTR, but had no effect on the activity of luciferase fused with Bnip3 3′-UTR mutant; (C), Detection of Bnip3 expression by western blot in the whole lysates of NVRMs transduced with different dosages of Ad-miR-145 (50 and 100 MOI). [score:5]
Furthermore, the anti-apoptotic effect of miR-145 was neutralized when Bnip3, one of the predicted miR-145 targets, was over-expressed. [score:5]
MiR-145 expression was down-regulated in ischemia/reperfused heart and H [2]O [2] -treated NRVMs. [score:5]
Since oxidative stress is a common pathological factor shared by many cardiovascular diseases, such as cardiac hypertrophy, cardiomyopathy, and acute myocardial infarction [31]– [32], identification of miR-145 as a novel cardioprotective molecule may potentially enable us to develop additional therapeutic strategies for prevention and treatment of cardiovascular disease. [score:5]
Previously, miR-145 has been shown to inhibit tumor growth mostly through targeting pro-proliferative molecules such as p70S6K and c-myc [25]– [26]. [score:5]
MiR-145 inhibitor (rno-miR-145 inhibitor, Cat. [score:5]
Here, we demonstrate that miR-145 protects against the activation of mitochondria apoptotic pathway in cardiomyocytes under oxidative stress through directly targeting mitochondrial membrane protein Bnip3. [score:4]
Before, it has been reported that human Bnip3 was a direct target of miR-145 [15]. [score:4]
Nevertheless, the mechanism of the down-regulation of miR-145 by oxidative stress is unclear. [score:4]
MiR-145 suppressed expression of Bnip3 through binding to its 3′UTR. [score:4]
To determine whether miR-145 plays a role in the regulation of H [2]O [2] -induced apoptosis in cardiomyocytes, we performed the adenovirus -mediated over -expression of miR-145. [score:4]
For both DNA ladder ELISA and TUNEL assay, cultured NRVMs were transduced with Ad-LacZ or Ad-miR-145 (MOI = 100) and transfected with either 0.5 µg Bnip3 CDS or Bnip3 CDS/3′UTR or rAd-psilence empty vector per 10 [6] cells; and then transfected with 10 nM miR-145 inhibitor or control inhibitor per 10 [6] cells. [score:4]
The down-regulation of miR-145 was also noted in vascular smooth muscle cells treated with H [2]O [2] [10]. [score:4]
Likewise, in cultured cardiomyocytes treated with 50 µM H [2]O [2] for 0.5 hour to 8 hours, the miR-145 mRNA levels were significantly down-regulated (figure 1B). [score:4]
The protein level of Bnip3 also saw a marked dose -dependent down-regulation when Ad-miR-145 was transduced at different MOIs (0, 50, and 100) (Figure 6C). [score:4]
Taking together, these results suggest that Bnip3 is a direct target of miR-145 in cardiomyocytes. [score:4]
In the present study, we identified Bnip3 as a direct target of miR-145 in rat cardiomyocytes. [score:4]
However, in cardiomyocytes, we found that miR-145 modulated the mitochondrial pathway by directly targeting key intermediates in the mitochondrial apoptosis machinery (figure 4, 6C). [score:4]
Since Bnip3 is directly involved in the mitochondrial apoptotic pathway, we asked whether miR-145 could regulate the mitochondrial apoptotic pathway. [score:3]
Namely, Bnip3-CDS contained 621 bp from +1 to +621 nt, and Bnip3-CDS-3′UTR contained 1378 bp from +1 to +1378 nt (+1 designates the translation starting site of rat Bnip3), including the two putative binding sites for miR-145 which located in +1267∼+1272 nt and +1308∼+1313 nt respectively. [score:3]
MiR-145 was considered to be a tumor suppressor microRNA and was shown to suppress tumor cell proliferation and induce cell apoptosis in a variety of tumor cell lines [7]– [9] [25]. [score:3]
To examine whether Bnip3 is a direct target of miR-145, we resorted to luciferase reporter assay. [score:3]
Forced expression of Bnip3 CDS enhanced mitochondrial disruption and abrogated the protective effect of miR-145. [score:3]
As shown in figure 1A, the expression level of miR-145 was significantly decreased, by approximately 50%, in reperfused myocardial tissues. [score:3]
The result showed that the protein level of Bnip3 was suppressed by miR-145 in a dose -dependent manner. [score:3]
Indeed, H [2]O [2] treatment markedly increased the levels of cleaved caspase 3, which were only slightly decreased by miR-145 over -expression. [score:3]
As shown in Figure 5C, H [2]O [2] and Bnip3 CDS, separately or combinatorially led to a strong staining of DCFH-DA, whereas miR-145 produced a relatively dim DCFH-DA staining in cardiomyocytes treated with H [2]O [2] and co -expressing Bnip3 CDS/3′UTR (figure 5B), suggesting that miR-145 attenuated the production of ROS and Bnip3 might be at its downstream. [score:3]
Two micrograms of total RNA were reverse transcribed in a total volume of 20 µl, and real-time PCR using SYBR green fluorescence was performed (BIO-RAD) to detect miR-145 expression as previously described [20]. [score:3]
Indeed, our findings support this viewpoint by showing that the protein levels of released cytochrome C and Apaf-1 were markedly decreased by miR-145 over -expression, whereas the protein levels of cleaved caspase3 were only moderately decreased. [score:3]
These results show that the protection of miR-145 against cardiomyocytes oxidative stress is, at least in part, functionally attributed to its suppression of Bnip3. [score:3]
Over -expressing miR-145 Attenuated H [2]O [2] -induced Apoptosis in Cardiomyocytes. [score:3]
In contrast, in miR-145-over -expressing cardiomyocytes, although small vesicles were presented in mitochondria, the outer membranes of mitochondria were largely intact, the cristae were evident, and the organization of mitochondria was neat and regular (figure 5A). [score:3]
The levels of Apaf-1, cytoplasmic cytochrome C, and mitochondrial Bnip3 were significantly increased in cells treated with H [2]O [2], but markedly decreased by over -expression of miR-145 in a dose -dependent manner (figure 4A). [score:3]
In contrast, over -expression of miR-145 barely affected the activity of luciferase gene fused with the Bnip3 3′-UTR mutant (luc-Bnip3 3′UTR-MU) (figure 6B). [score:3]
In fact, cardiomyocytes express a high level of endogenous miR-145 (Ct value ∼12, data not shown) and transduction of cardiomyocytes with Ad-miR145 further increased the level of miR-145 in a dose -dependent manner (figure 2A). [score:3]
MiR-145 Protected Against Mitochondrial Structure Disruption and Inhibited ROS Production. [score:2]
Taking together, these results suggest that miR-145 plays a protective role against the oxidative stress -induced cardiomyocyte apoptosis and this regulation of miR-145 is linked with Bnip3. [score:2]
Together, these data support an essential role of miR-145 in the regulation of the mitochondrial machinery through modulating the levels of molecules upstream of caspase activation [8]. [score:2]
MiR-145 inhibited H [2]O [2] -induced apoptosis in cultured NRVMs. [score:2]
MiR-145 modulated the expression levels of key apoptosis mediators. [score:2]
These results support that miR-145 regulated cardiomyocyte apoptosis through modulating the mitochondrial apoptotic pathway. [score:2]
Thus, it would be interesting to investigate whether a change of methylation status in miR-145 promoter or an aberrant processing of pre-miR145 may account for the miR-145 down-regulation in cardiomyocytes in response to oxidative stress. [score:2]
p53 has been identified to positively regulate miR-145 maturation [28]. [score:2]
Coincidently, in urothelial cancer cell line, miR-145 also induces a caspase3-independent cell death [8], in a similar way to the caspase-independent apoptosis mediated by Bnip3 [15]. [score:1]
Cardiomyocytes were transduced with Ad-miR145 or Ad-LacZ at 50 or 100 MOI and treated with 50 µM H [2]O [2] or vehicle as indicated. [score:1]
Adenoviruses harboring a 441–base pair DNA fragment encompassing the hsa-mir-145 gene (Ad-miR-145) were generated using the AdMax (Microbix) systems according to the manufacturers’ recommendations. [score:1]
AF243515), the fire luciferase cDNA fused with rat Bnip3 mRNA 3′UTR containing the two seed sequences for miR-145 (308 bp, +1012 to +1319 nt) and 3′UTR without the seed sequence (198 bp, +1012 to +1209 nt) were amplified separately from the genomic DNA of neonatal rat ventricle myocytes (NRVM) and cloned into the pGL3-promoter luciferase reporter vector (Promega, Madison, USA). [score:1]
0044907.g005 Figure 5For both electron transmission microscopy and ROS staining, NRVMs were transduced with Ad-miR-145 or Ad-LacZ (MOI = 100) and transfected with either 1 µg Bnip3 CDS or Bnip3 CDS/3′UTR or rAd-psilence empty vector per 10 [6] cells, and then treated with 50 µM H [2]O [2] for 2 h. (A), under electron transmission microscopy, it was shown that miR-145 attenuated H [2]O [2] -induced mitochondrial structural disruption (swelling, rupture and loss of cristae). [score:1]
For both electron transmission microscopy and ROS staining, NRVMs were transduced with Ad-miR-145 or Ad-LacZ (MOI = 100) and transfected with either 1 µg Bnip3 CDS or Bnip3 CDS/3′UTR or rAd-psilence empty vector per 10 [6] cells, and then treated with 50 µM H [2]O [2] for 2 h. (A), under electron transmission microscopy, it was shown that miR-145 attenuated H [2]O [2] -induced mitochondrial structural disruption (swelling, rupture and loss of cristae). [score:1]
To investigate whether miR-145 expression is altered during myocardial I/R injury, Stem-loop real-time PCR was used to detect the miR-145 mRNA levels in ischemia/reperfused myocardial tissues. [score:1]
The functional significance of miR-145 in the heart, however, has not been explored thus far. [score:1]
0044907.g006 Figure 6 (A), a representative illustration of the putative binding sites for miR-145 in rat Bnip3 3′-UTR. [score:1]
Sequence analysis of rat BNIP-3′UTR revealed two putative miR-145 binding sites located at 1267–1272 nt and 1308–1313 nt, which is highly conserved in both Homo sapiens and Rattus norvegicus (figure 6A). [score:1]
The result shows that miR-145 protected against H [2]O [2] -induced cardiomyocytes apoptosis, which was significantly enhanced by Bnip3. [score:1]
Preconfluent H9c2 cells, in 12-well plates, were transduced with Ad-LacZ and Ad-miR-145 at indicated MOIs for 24 h, then cells were transfected with 300 ng of firefly luciferase reporter plasmid (pGL3-Luc-Bnip3 -3′UTR or pGL3-Luc-Bnip3 -3′UTR MU) and 20 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) using Lipofectamine 2000 transfection reagent (Invitrogen). [score:1]
Considering that Apaf-1 functions as a linker between cytochrome C and caspase proteins [30], our results suggest there exist non-caspase signaling pathways linking cytochrome C and Apaf-1 to the DNA degradation and miR-145 -mediated protection against cardiac apoptosis may be through these alternative pathways. [score:1]
Accordingly, we constructed two reporter plasmids by cloning the rat Bnip3 3′UTR containing or without the two miR-145 putative binding sites (1267–1272 nt and 1308–1313 nt) (designated as WT and mutant, respectively) into the 3′UTR of pGL3 vector. [score:1]
Quantitative real-time PCR was performed to evaluate the miR-145 levels in cultured cardiomyocytes either transduced with Ad-miR145 or transfected with miR-145 inhibitor. [score:1]
Generation of miR-145 Adenovirus. [score:1]
The miR-145 adenovirus used in this study contained human miR-145 gene (has-miR-145), whose mature miRNA sequence is identical to that of rat miR-145 (rno-miR-145). [score:1]
In the present study, we demonstrated that miR-145 exerted a potent protective effect against the oxidative stress -induced apoptosis in cardiomyocytes (figure 3A–C). [score:1]
The panels show that miR-145 reduced H [2]O [2]-triggered ROS production, which was promoted by Bnip3. [score:1]
The result shows that miR-145 protected against Bnip3 -induced cytochrome C release. [score:1]
However, little is known about whether miR-145 is associated with cardiomyocyte apoptosis under oxidative stress or how it interferes with the mitochondrial apoptotic pathway. [score:1]
For TUNEL staining, cells were cultured in chambers (Milipore, Billerica, USA) at a density of 10 [5] cells/chamber and transduced with Ad-miR-145 or Ad-LacZ. [score:1]
[1 to 20 of 90 sentences]
2
[+] score: 274
In addition, Len-sh- MKK4 also abrogated the synergistically enhanced TNF- α -induced upregulation of MMP-3, MMP-13, and Adamts-5 caused by miR-145 inhibitor (Supplementary Figure 10a); meanwhile, Len- MKK4 completely abolished the inhibitory effect of miR-145 mimics on TNF- α -induced upregulation of catabolic genes (Supplementary Figure 10b), which further confirmed that the inhibitory effect of miR-145 on TNF- α is mediated by MKK4. [score:13]
Meanwhile, injection of agomir-145 suppressed the expression of MMP-3 and MMP-13, as well as p-MKK4, p-c-Jun, and p-ATF2 in cartilage tissue after surgery (Figure 7f), indicating that MKK4-JNK/p38-c-Jun/ATF2 -mediated suppression of matrix-degrading enzymes expression is mainly responsible for the observed inhibitory effect of miR-145 on cartilage destruction caused by OA (Figure 7g). [score:11]
MiR-145 inhibits TNF- α -induced expression of matrix-degrading enzymesTo assess the involvement of miR-145 in the regulation of TNF- α -induced expression of matrix-degrading enzymes, we transfected chondrocytes with miR-145 mimics or inhibitor (Figure 3a and Supplementary Figures 5a and b). [score:10]
It is worth noting that the facilitation of miR-145 inhibitor on TNF- α -induced upregulation of MMP-3, MMP-13, and Adamts-5 was partially blocked by JNK- and p38-specific inhibitors (Figure 5d), which indeed effectively inhibited the phosphorylation of JNK or p38, as well as their downstream cascades, alone or in combination (Supplementary Figures 8a–c). [score:10]
Similarly, miR-145 overexpression plasmid inhibited, whereas miR-145 inhibition plasmid promoted, the expression of MKK4 (Figures 4e and f). [score:9]
37, 38 SP600125 (JNK inhibitor, 10  μM) (S1460; Selleck, Houston, TX, USA), SB203508 (P38 inhibitor, 10  μM) (S1076; Selleck), CC-5013 (TNF- α secretion inhibitor, 10  μM) (S1029; Selleck), miR-145 agomir (50  μM), miR-145 antagomir (200  μM), and empty lentivirus (Len-C) or lentivirus (1 × 10 [9] PFU, 20  μl) expressing sh- MKK4 (Len-sh- MKK4) or MKK4 (Len- MKK4) or the equivalent volume of vehicle (DMSO or PBS) were IA injected into the knee joints of recipient rats 1 week after the surgery (20  μl per joint per rat two times a week for 7 weeks) (n=6–10 per group). [score:9]
In cells expressing a luciferase construct containing the wild-type miR-145 promoter, TNF- α markedly reduced luciferase activity, whereas mutation of the NF- κB -binding site in the promoter inhibited TNF- α-triggered suppression of reporter activity (Figure 2h), indicating that p65 binding to the miR-145 promoter is crucial for the reduction of miR-145 by TNF- α. These results collectively suggest that reduction of miR-145 by TNF- α is mainly through the canonical NF- κB signaling pathway. [score:8]
Notably, overexpression of miR-145 inhibited, whereas inhibition of miR-145 promoted TNF- α -induced MMP-3, MMP-13, and Adamts-5, but not Adamts-4 (Figures 3e–g). [score:7]
showed that BAY11-7082 (NF- κB inhibitor) extremely rescued the inhibitory effects of TNF- α on miR-145 expression (Figure 2a). [score:7]
MiR-145 attenuates cartilage matrix degradation in experimental OA likely through its suppression of MKK4 -mediated TNF- α signalingConsidering that miR-145 has an inhibitory role in TNF- α -mediated signaling and induction of matrix-degrading enzymes in vitro, we further examined whether miR-145 affects catabolic genes expression and subsequent OA pathogenesis in vivo. [score:7]
To assess the involvement of miR-145 in the regulation of TNF- α -induced expression of matrix-degrading enzymes, we transfected chondrocytes with miR-145 mimics or inhibitor (Figure 3a and Supplementary Figures 5a and b). [score:6]
These data clearly show that miR-145 inhibits TNF- α -induced upregulation of MMP-3, MMP-13, and Adamts-5 in chondrocytes. [score:6]
The downregulation of miR-145 by TNF- α is dependent of the tradd–traf2–p65 axisTo elucidate the underlying mechanism of miR-145 reduction by TNF- α, NF- κB and MAPK inhibitors were used. [score:6]
Thus, miR-145 may be a more effective target for OA treatment because of its broad inhibition of matrix-degrading enzymes production caused by TNF- α. Unexpectedly, miR-145 exerted no effect on anabolic factors in chondrocytes treated with TNF- α. Consistently, our further studies confirm that the promoter regions of Mmp-3, Mmp-13 and Adamts-5 but not Sox-9, Col2a1, and Aggrecan, harbor the c-Jun or ATF2 -binding motif; therefore, MMP-3, MMP-13, and Adamts-5 but not Sox-9, Col2a1, and Aggrecan can be directly modulated by the miR-145/MKK4-JNK/p38-c-Jun/ATF2 axis. [score:6]
This study showed that miR-145 can be used as a potential novel target for therapy of OA because of its broadly inhibitory effects on TNF- α -mediated signaling and expression of MMPs and ADAMTS in vitro and in vivo, and more importantly, compared with the recombinant proteins, miR-145 agonist via methylated modifications exerts more stable and durable effect. [score:6]
However, in the present study, we found that miR-145 overexpression could simultaneously suppress several matrix-degrading enzymes at transcriptional and post-transcriptional levels. [score:5]
showed that miR-145 mimics significantly inhibited, whereas miR-145 inhibitors enhanced, the luciferase activity of cells transfected with wild-type MKK4 3′-UTR, but not cells transfected with the mutant MKK4 3′-UTR (Figure 4i). [score:5]
Collectively, these results suggest that MKK4 is a direct target of miR-145 and that the endogenous MKK4 is tightly regulated by miR-145 in chondrocytes during TNF- α stimulation and OA pathogenesis. [score:5]
Neither overexpression nor inhibition of miR-145 had any effect on chondrocyte viability (Figures 3b–d). [score:5]
Furthermore, miR-145 mimics additionally inhibited, whereas miR-145 inhibitor promoted, the nuclear import of p-c-Jun and p-ATF2 induced by TNF- α (Figure 5c). [score:5]
Indeed, knockdown of p65, traf2, or tradd blocked TNF- α -induced downregulation of miR-145 (Figure 2e). [score:5]
Considering that miR-145 has an inhibitory role in TNF- α -mediated signaling and induction of matrix-degrading enzymes in vitro, we further examined whether miR-145 affects catabolic genes expression and subsequent OA pathogenesis in vivo. [score:5]
[35] Thus, we propose miR-145 as an important regulator of cartilage homeostasis, especially the catabolic signals, and its abnormal downregulation by TNF- α facilitates the progression of OA. [score:5]
In conclusion, we elucidate a novel regulatory mechanism by discovering that miR-145 is a crucial negative regulator of TNF- α -mediated signaling activation and induction of cartilage matrix degradation mechanically through the MKK4-JNK/p38-c-Jun/ATF2 axis during OA pathogenesis, and demonstrate the potential utility of miR-145 and MKK4 as therapy targets for OA. [score:5]
In addition, neither overexpression nor inhibition of miR-145 affected the viability of chondrocytes. [score:5]
These data solidly confirm that MKK4 has an essential role in miR-145 -mediated suppression of TNF- α -induced catabolic factor expression. [score:5]
Binding of miR-145 to MKK4 3′-UTR severly impaired the translation of MKK4, resulting in suppression of TNF- α -mediated signaling and induction of downstream matrix-degrading enzymes. [score:5]
MiR-145 inhibits TNF- α -induced expression of matrix-degrading enzymes. [score:4]
Moreover, blocking the canonical NF- κB pathway or RNAi -mediated knockdown of tradd, traf2, or p65 partially rescued the reduction of miR-145 by TNF- α, suggesting that the inhibitory effect of TNF- α on miR-145 is mediated by p65. [score:4]
The downregulation of miR-145 by TNF- α is dependent of the tradd–traf2–p65 axis. [score:4]
Unexpectedly, miR-145 exerted no effect on TNF- α -induced downregulation of Sox-9, Col2a1, and Aggrecan in our experiments (Supplementary Figure 6a). [score:4]
To obtain more direct evidence, luciferase reporter constructs were generated and co -transfected with miR-145 mimics or inhibitors into the SW1353 cell line. [score:4]
MiR-145 negatively regulates TNF- α -mediated signalingTo elucidate the underlying mechanism through which miR-145 inhibits the production of TNF- α -induced matrix-degrading enzymes, we assessed the effect of miR-145 on the activation of NF- κB and MAPK pathways. [score:4]
In the present study, we report for the first time that MKK4 is a conserved target gene of miR-145. [score:3]
Data showed that the levels of p-Erk, p-p65, and I κB α were comparable; however, miR-145 mimics greatly repressed, by contrast, miR-145 inhibitor enhanced, the phosphorylation of MKK4, JNK, p38, c-Jun, and ATF2 under TNF- α stimulation (Figures 5a and b). [score:3]
The SW1353 cell line were co -transfected with miR-145 mimics or inhibitor (40 nM), luciferase constructs (described above) (200 ng), and pRL-TK (Promega) Renilla luciferase plasmid (50 ng). [score:3]
MiR-145 directly targets MKK4. [score:3]
The miR-145 inhibition plasmid was generated by the reverse complementary sequence of mature miR-145: 5′-AGGGATTCCTGGGAAAACTGGAC-3′, which was cloned into the BamHI/ HindIII site of the GV249 vector. [score:3]
MiR-145 is downregulated in TNF- α-stimulated chondrocytes and OA cartilage. [score:3]
To elucidate the underlying mechanism through which miR-145 inhibits the production of TNF- α -induced matrix-degrading enzymes, we assessed the effect of miR-145 on the activation of NF- κB and MAPK pathways. [score:3]
Notably, miR-145 mimics reduced, whereas miR-145 inhibitor elevated, MKK4 and p-MKK4 in a dose -dependent manner under TNF- α stimulation (Figures 4b–d). [score:3]
of qRT-PCR validation showed that the expression of miR-23b and miR-145 were indeed reduced by TNF- α in time- and dose -dependent manners (Figures 1f and g). [score:3]
In summary, these observations strongly suggest that miR-145 has a general inhibitory role in TNF- α -mediated JNK/c-Jun and p38/ATF2 activation and downstream gene induction. [score:3]
The miRWalk database was further applied to exclude the genes that had been validated as targets of miR-145 in previous reports. [score:3]
It is also worth mentioning that miR-145 may also serve as an efficient therapeutic target in inflammatory arthritis such as rheumatoid arthritis (RA) in consideration of the similar inflammatory conditions in patients with RA. [score:3]
To elucidate the underlying mechanism of miR-145 reduction by TNF- α, NF- κB and MAPK inhibitors were used. [score:3]
Thus, our results support the utility of miR-145 as an effective therapeutic target for cartilage matrix degradation in OA. [score:3]
Bioinformatic analysis using software revealed that MKK4, a member of the MKKs family, was a putative target of miR-145 (Figure 4a). [score:3]
On the other hand, miR-145 had also been identified to be involved in the regulation of chondrogenic differentiation in a previous study. [score:2]
MiR-145 attenuates cartilage matrix degradation in experimental OA likely through its suppression of MKK4 -mediated TNF- α signaling. [score:2]
Collectively, miR-145 critically controls OA development through strictly modulating the transcription of several key TNF- α -induced matrix-degrading enzymes. [score:2]
MiR-145 is downregulated in TNF- α-stimulated chondrocytes and OA cartilageWe first detected the levels of proinflammatory cytokines during surgery -induced OA and found that IL-1 β and TNF- α were strongly enriched compared with other cytokines (Figure 1a). [score:2]
To our knowledge, miR-145 represents the first identified TNF- α-reduced miRNA, which in turn serves as a negative regulator of TNF- α -mediated signaling activation and transcription. [score:2]
The miR-145 expression plasmid was created as follows: the precursor sequence for miR-145 was cloned into the XhoI/ KpnI site of the GV268 vector using the following primers: 5′-ACGGGCCCTCTAGACTCGAGCATATAGCACCCCACACTG-3′ (sense) and 5′-TTAAACTTAAGCTTGGTACCGAGGTCCCAAGACCGCTTAC-3′ (antisense). [score:2]
Altogether, these results demonstrate that miR-145 is negatively regulated by TNF- α in both chondrocytes and OA cartilage. [score:2]
Next, we investigated the possible targets of miR-145. [score:1]
MiR-145 negatively regulates TNF- α -mediated signaling. [score:1]
Bioinformatic analyses reveal that there is a consensus NF- κB -binding site in miR-145 promoter (Figure 2f). [score:1]
Moreover, a solid inverse correlation was observed between miR-145 and TNF- α in surgery -induced OA and human OA cartilage (Figure 1j). [score:1]
For a more durable effect of miR-145 in vivo, we generated agomir-145 and antagomir-145 via several specific chemical modifications (Figure 7a). [score:1]
Interestingly, CC-5013 significantly restored the reduction of miR-145 caused by destablization of the medial meniscus (DMM) surgery (Figure 1k). [score:1]
We further observed that the endogenous MKK4 significantly increased within a short period upon TNF- α stimulation (Figure 4g), consistent with the rapid reduction of internal miR-145 level by TNF- α, and this effect was remarkably diminished by external miR-145 mimics at different doses (Figure 4h). [score:1]
Indeed, modulation of miR-145 efficiently affected ECM degradation during OA, as evidenced by that miR-145 gain-of-function was able to restrain TNF- α -induced matrix-degrading enzymes and cartilage destruction caused by surgery -induced OA. [score:1]
Moreover, we uncovered the molecular mechanism underlying the protective effect of miR-145 on OA cartilage in vitro and further confirmed it in vivo. [score:1]
Chondrocytes stimulated with TNF- α for different time periods were used to further characterize the inhibitory effect of miR-145 on TNF- α -induced matrix-degrading enzymes, and the results agreed with the findings above (Figure 3h). [score:1]
[1 to 20 of 65 sentences]
3
[+] score: 212
Other miRNAs from this paper: hsa-mir-143, hsa-mir-145, rno-mir-143
Down-regulation of miR-145 and up-regulation of BNIP3 expression in gliomas. [score:9]
Second, down-regulation of miR-145 and up-regulation of BNIP3 increased the protein expression of Notch1, Hes1, and p21 in glioma cells. [score:9]
Together, our results indicate that miR-145 increases apoptosis of glioma cells by directly inhibiting BNIP3, resulting in the inhibition of Notch signaling, and suggest that miR-145 may serve as a novel therapeutic target in malignant gliomas. [score:8]
Figure 12 (A) Protein expression of Notch1, p21, Hes1 was determined by western blot analysis in U87 and U251 cells co -transfected with miR-145 inhibitor and BNIP3-siRNA, or with miR-145 inhibitor. [score:7]
First, up-regulation of miR-145 and knockdown of BNIP3 decreased the protein expression of Notch1, Hes1, and p21 in glioma cells. [score:7]
Here, we present a strong evidence that miR-145 inhibits the expression of BNIP3 by binding to its 3′-UTR in glioma cells, and we demonstrate an inverse correlation between miR-145 and BNIP3 expression in glioma tissues. [score:7]
Figure 11 (A, B) Protein expression of Notch1, p21 and Hes1 was determined by western blot analysis in U87 and U251 cells transfected with miR-145 mimics and mimics-NC, or miR-145 inhibitor and inhibitor-NC. [score:7]
To support these results, the protein expression of Notch1, p21, and Hes1 was also analyzed in U87 and U251 cells that were co -transfected with miR-145 inhibitor and BNIP3-siRNA, compared with miR-145 inhibitor. [score:6]
MiR-145 is a putative tumor suppressor miRNA that is down-regulated in various types of cancers [4, 9]. [score:6]
Lastly, co-transfection of down-regulated miR-145 and knockdown of BNIP3 decreased the protein levels of the Notch1-regulated proteins. [score:6]
Co-transfection of luciferase reporter with the miR-145 mimics into U87 and U251 cells decreased expression of BNIP3 (Figure 7B), indicating that BNIP3 is a direct target of miR-145 in glioma cells. [score:6]
For example, miR-145 has been found to inhibit migration and invasion of gliomas stem cells by targeting ABCG2 [29]. [score:5]
miR-145 inhibits Notch pathway by targeting BNIP3. [score:5]
miR-145 inhibits mRNA and protein expression of BNIP3. [score:5]
Figure 5 (A) Western blot was performed to detect the expression levels of Bax, Bcl-2 and Active Caspase-3. (A, B) Transfection effect of miR-145 mimics or inhibitor was confirmed by quantitative real-time PCR. [score:5]
Figure 5 (A) Western blot was performed to detect the expression levels of Bax, Bcl-2 and Active Caspase-3. We then searched for the target genes of miR-145 using microRNA. [score:5]
Stable cell lines were derived from U251 and U87 cells by transfection with miR-145 mimics, inhibitor, BNIP3 siRNA, BNIP3-pEX-2 expression vector, or corresponding control RNA using Lipofectamine 2000 for 48 h. Total RNA was extracted from brain tissues or glioma cells using TRIzol reagent (Invitrogen) and reverse transcribed to cDNA using a Thermoscript RT-PCR reagent kit. [score:5]
confirmed that miR-145 expression was increased after miR-145 mimics transfection, and decreased after miR-145 inhibitor transfection (Figure 4A, 4B). [score:5]
In addition, consistent with previous studies [26], cells transfected with miR-145 mimics exhibited decreased expression of the anti-apoptotic protein Bcl-2, increased expression of the pro-apoptotic proteins Bax, and Active Caspase-3, and an elevated Bax/Bcl-2 ratio (Figure 5A). [score:5]
miR-145 inhibits expression of BNIP3 via binding to its 3′-UTR. [score:5]
BNIP3 mRNA expression was decreased by miR-145 mimics (Figure 6B), and increased in cells transfected with miR-145 inhibitor (Figure 6C). [score:5]
Over -expression of miR-145 in U87 and U251 cells decreased protein levels of Notch1 and its downstream targets, p21 and Hes1 (Figure 11A). [score:5]
MiR-145 promotes apoptosis of glioma cells by inhibiting BNIP3, resulting in the inhibition of Notch signaling. [score:4]
miR-145 can regulate Notch signaling pathway by targeting BNIP3. [score:4]
It was reported that the tumor suppressors miR-143 and miR-145 could modulate vascular smooth muscle cell differentiation by inactivating Notch-1 signaling [15], but the specific role of miR-145 in regulating the Notch signaling in malignant glioma is unknown. [score:4]
To test if BNIP3 is a direct target of miR-145, the 3′-UTR was cloned into a luciferase expression vector to evaluate its response to miR-145. [score:4]
miR-145 regulates Notch signaling by targeting BNIP3. [score:4]
Importantly, our results show that miR-145 induces apoptosis in glioma cells, suggesting that it functions as a tumor suppressor miRNA. [score:3]
Figure 4 (A, B) Transfection effect of miR-145 mimics or inhibitor was confirmed by quantitative real-time PCR. [score:3]
Immunofluorescence revealed that BNIP3 was localized in the nucleus of U87 and U251 cells, and its expression was decreased after miR-145 transfection (Figure 6E). [score:3]
confirmed that the nuclear levels of BNIP3 were decreased in cells transfected with miR-145 mimics and increased in cells transfected with miR-145 inhibitor. [score:3]
In this study, we demonstrate that the miR-145 expression is decreased in gliomas. [score:3]
In this study, we have identified BNIP3 as a target gene of miR-145. [score:3]
Our results demonstrate that BNIP3 is localized in the nucleus of glioma cells, and serves as a target of miR-145. [score:3]
Interestingly, the cytoplasmic levels of BNIP3 in cells transfected with miR-145 inhibitor were also increased (Figure 7A). [score:3]
To explore whether the effect of miR-145 on the Notch pathway was related to BNIP3, protein levels of Notch1, p21, and Hes1 were analyzed in cells transfected with BNIP3 siRNA or the BNIP3 expression vector. [score:3]
Correspondingly, Notch1, p21, and Hes1 protein levels increased in the presence of miR-145 inhibitor (Figure 11B). [score:3]
Taken together, these data indicate that miR-145 inhibits Notch signaling partly through BNIP3. [score:3]
Figure 7 (A) Western analysis of BNIP3, which is localized in the nucleus or the cytoplasm in U87 and U251 cells treated with miR-145 mimics and inhibitor for 48 h. (B) Wild-type 3′-UTR of BNIP3 gene was cloned into the firefly and Renilla reporter plasmid. [score:3]
BNIP3 expression inversely correlates with miR-145 in gliomas. [score:3]
These observations imply that BNIP3 acts as an oncogene and is involved in the regulation of miR-145 -mediated apoptosis in gliomas. [score:2]
MiR-145 expression is decreased in gliomas. [score:2]
Several miRNAs regulate the activation of glioma cells, including miR-145. [score:2]
Target screening assays have linked miR-145 and BNIP3 [31- 34]. [score:2]
Figure 2 (A) of miR-145 expression in glioma samples (n = 19) compared with normal samples (n = 10). [score:2]
To investigate the potential function of miR-145 in glioma cells apoptosis, U87 and U251 cells were transiently transfected with miR-145 mimics or inhibitor. [score:1]
However, the function of miR-145 in gliomas has not yet been elucidated. [score:1]
Indeed, miR-145 has been reported to play a pivotal role in Notch signaling [15]. [score:1]
In addition, miR-145 promotes the phenotype of Human Glioblastoma Cells selected for invasion [30]. [score:1]
We found that the 3′-UTR of BNIP3 contains putative binding sites for miR-145 (Figure 6A). [score:1]
Protein levels of BNIP3 also inversely correlated with miR-145 levels (Figure 6D). [score:1]
Figure 6 (A) Bioinformatics analysis shows the seed sequence of miR-145 binding to the 3′-UTR of BNIP3 mRNA. [score:1]
miR-145 induces apoptosis of glioma cells. [score:1]
miR-145 induces glioma cells apoptosis. [score:1]
To define the role of miR-145 in glioma, we analyzed miR-145 levels in human glioma samples, rat glioma tissues, and glioma cell lines by quantitative real-time PCR analysis. [score:1]
[1 to 20 of 55 sentences]
4
[+] score: 153
Both TNF-α and IL-1β protein levels were significantly up-regulated at both 12 h and 24 h post-MCAO/R, and they were successfully suppressed by Nurr1 overexpression induced by administration of anti-miR-145-5p (Figure 5D). [score:8]
These data demonstrate that lower expression of Nurr1 relieves transrepression of TNF-α in microglia and inhibits cell growth in primary neurons after OGD/R 2 h. We demonstrated that increasing expression of miR-145-5p peaked at 12 h in our rat MCAO/R mo del (Figure 2A). [score:7]
I/R -induced miR-145-5p overexpression suppresses Nurr1 protein expression and attenuates Nurr1 transrepression of the TNF-α promoter in microglia (OGD/R 2 h), which then causes TNF-α-related neuronal injury. [score:7]
In the present study, miR-145-5p mimic clearly decreased Nurr1 expression in HEK293T (P < 0.001), as did miR-132 and miR-34c-5p, which was consistent with the previous study that miR-34c-5p directly regulated Nurr1 in HCT116 cells (Beard et al., 2016) and miR-132 targeted Nurr1 in differentiation of dopamine neurons (Yang et al., 2012). [score:7]
These experiments suggest that enhanced levels of miR-145-5p inhibit neuronal viability by regulating expression of Nurr1 and TNF-α in microglia after OGD/R. [score:6]
This regulatory effect is inhibited by Nurr1 protein decline that induced by miR-145-5p overexpression. [score:6]
These data reveal that lower expression of Nurr1 induced by miR-145-5p upregulation increases infarct volume at an early stage of cerebral ischemia of rats by activating TNF-α and IL-1β proinflammatory signals. [score:6]
In particular, expression of TNF-α, which was reported to be transrepressed by Nurr1, displayed a pattern of expression opposite that of Nurr1 under treatment with the miR-145-5p mimic or anti-miR-145-5p (Figure 3D). [score:5]
Administration of anti-miR-145-5p significantly increased Nurr1 mRNA expression (Figure 5B) and reduced TNF-α mRNA expression at 12 h post-MCAO/R (Figure 5C) but not at 24 h post-MCAO/R. [score:5]
Double immunofluorescence staining shows more expression of Nurr1 in active microglia with administration of anti-miR-145-5p, and little expression of Nurr1 with administration of miR-145-5p mimic in the peri-infarct areas bordering with intact tissues post 12 h of MCAO/R. [score:5]
Administration of miR-145-5p mimic in primary microglia post OGD/R significantly reduced TNF-α expression and IL-1β by enhancing Nurr1 expression, which subsequently improved neuronal cell viability (Figures 3E, 4E). [score:5]
Modulation of miR-145-5p expression affects cell viability under in vitro ischemic conditions, and this occurs via regulation of Nurr1 (Figures 3D,E). [score:4]
showed that the miR-145-5p mimic clearly decreased the luminescence reporter signal to a greater extent (P < 0.001; Figure 2D), as did miR-132 and miR-34c-5p, which were previously shown to directly target Nurr1. [score:4]
miR-145-5p has been shown to be up-regulated in the pathological process of vascular neointimal lesion formation (Saugstad, 2010; Li et al., 2012), cardiomyocyte survival (Chen et al., 2015), and H [2]O [2] -induced neuronal injury (Gan et al., 2012). [score:4]
However, no significant changes of miR-145-5p expression were observed at different time points of OGD/R in primary neurons (Figure 3A). [score:3]
Circulatory microRNA-145 expression is increased in cerebral ischemia. [score:3]
Figure 6Nurr1 expression in active microglia with administration of miR-145-5p in peri-infarct areas post 12 h of MCAO/R. [score:3]
Here, we observed that miR-145-5p expression sharply increased in the cortex of rats 12 h post MCAO/R (Figure 2B) and in isolated primary microglia post OGD/R 2 h (Figure 3A). [score:3]
Accordingly, Nurr1 protein expression increased 4.53- and 3.42-fold upon treatment with anti-miR-145-5p at 12 h and 24 h post-MCAO/R, respectively (Figure 5D). [score:3]
Accordingly, Nurr1 expression increased significantly upon anti-miR-145-5p treatment vs. [score:3]
However, these changes of infarct volume were not observed significantly at 24 h. (B) By RT-qPCR analysis, Nurr1 mRNA expression significantly increased in anti-miR-145-5p injection samples (p < 0.001) whereas decreased after administration of mimic miR-145-5p (p < 0.05). [score:3]
Eleven miRNAs, including miR-145-5p, miR-34c-5p, miR-365-3p, miR-214-3p, miR-151, miR-27a, miR-153-5p, miR-365-3p, miR-33-5p, miR-217-5p and miR-129-5p, were differentially and significantly expressed (P < 0.05; Figure 2B). [score:3]
miR-145-5p expression increased from the onset of OGD/R, peaked at 2 h, and then progressively decreased until 12 h in microglia (Figure 3A). [score:3]
Abnormal Inactivation of Nurr1-Mediated Transrepression on TNF-α by miR-145-5p Overexpression Accelerates Inflammatory Injury in Acute MCAO/R of Rats. [score:3]
Additional in vivo studies have shown that administration of anti-miR-145-5p could increase Nurr1 expression and reduce subsequent infarct volume in acute cerebral ischemia (MCAO/R 12 h). [score:3]
It is noteworthy that 24 h after MCAO/R in rats, miR-145-5p inhibition could not reduce infarct volume despite the significant increase in Nurr1 (Figure 5A). [score:3]
miR-145-5p Regulates Endogenous Nurr1 Levels in Microglia. [score:2]
In the present study, we therefore sought to determine: (1) how Nurr1 level and Nurr1-related microRNAs change in the brain of MCAO/R rats, an in vivo mo del; (2) in in vitro studies, what are the post-transcriptional regulatory network of Nurr1 and the specific mechanisms of Nurr1 on microglia activation; (3) in an in vivo study, whether miR-145-5p/Nurr1/TNF-α signal exerts neuron injury function upon cerebral ischemia-reperfusion in rats. [score:2]
In summary, our study identified and confirmed a novel regulation of Nurr1 by miR-145-5p in both in vitro and in vivo cerebral ischemic conditions. [score:2]
After OGD/R 2 h induction of miR-145-5p overexpression in microglia, the Nurr1 protein was clearly reduced when compared with cells in the normoxia group (Figure 3D). [score:2]
Here, we describe a novel miR-145-5p regulatory mechanism of Nurr1 that can act downstream of TNF-α activation. [score:2]
By immunofluorescence assay, massive Nurr1 expression was observed in active microglia after anti-miR-145-5p treatment (Figure 6). [score:2]
Mutations of the miR-145-5p and Nurr1 recognition sites in the 3′UTR abolished their interaction (Figure 2E). [score:2]
MicroRNA-145 protects cardiomyocytes against hydrogen peroxide (H [2]O [2]) -induced apoptosis through targeting the mitochondria apoptotic pathway. [score:2]
As expected, anti-miR-145-5p administration via ICV injection reduced infarct volume by 24.05% at 12 h post MCAO/R in rats (Figure 5A). [score:1]
These results suggest that miR-145-5p modulates Nurr1 through its 3′UTR. [score:1]
Blocking the abnormal activation of miR-145-5p-Nurr1-TNF-α axis signaling can relieve neurons death upon MCAO/R of rats in acute time. [score:1]
Reporter constructs containing either the wild-type or mutated 3′UTR were used to demonstrate miR-145-5p specificity in the Nurr1 3′UTR. [score:1]
Conversely, a noticeable increase in neuronal cell death was observed in those co-cultured with miR-145-5p mimic -transfected microglia (Figure 3E). [score:1]
Figure 5The axis signaling of miR-145-5p-Nurr1-TNF-α in acute MCAO/R mo del of rats by in vivo expriments. [score:1]
Oppositely, administration of miR-145-5p mimic increases neurons death notably in microglia after OGD/R 2 h than those co-cultured with microglia control (p < 0.01). [score:1]
Administration of anti-miR-145-5p reduced infarct volume by 24.05% at 12 h, whereas administration of the miR-145-5p mimic increased infarct volume by 11.05% (Figure 5A). [score:1]
However, in the mNSS and foot fault tests were not significantly different between the null and miR-145-5p mimic administration animals (p > 0.05). [score:1]
Before suffered MCAO/R, the groups were: null group, scramble group, anti-miR-145-5p group, miR-145-5p mimic group, Nurr1-siRNA group, Nurr1 activation plasmid group (Nurr1; intra-cerebroventricular injection). [score:1]
miR-145-5p Interruption Facilitates Neurological Outcome of Rats Post MCAO/R. [score:1]
Administration of anti-miR-145-5p induced a sharp increase of Nurr1 mRNA levels in comparison with the null group at each time point of OGD/R in microglia (Figure 3B) but not in primary neurons (Figure 3C). [score:1]
miR-145-5p mimic treatment in active microglia in peri-infarct areas post 12 h of MCAO/R using immunofluorescence (Figure 6). [score:1]
Further mutation of the miR-145-5p and Nurr1 recognition sites in the 3′UTR abolished their interaction in HEK293T cells as detected by luciferase reporter assay (Figure 2E). [score:1]
Therefore, it is still worth exploring function and mechanism(s) of miR-145-5p/Nurr1/TNF-α Signaling in human stoke in the near future. [score:1]
Whatever, more researches must be performed to elucidate the specific effects of miR-145-5p on cerebral I/R injury in human blood or cerebrospinal fluid. [score:1]
It may be an effective therapeutic strategy of reducing neuronal injury following MCAO/R in rats by blocking abnormal activation of miR-145-5p/Nurr1/TNF-α axis signaling in the acute phase. [score:1]
This indicates that the supression of miR-145-5p, which decreased neuron cell death by increasing TNF-α -mediated inflammation, might be insufficient to provide protective effects under these conditions. [score:1]
We next administered the miR-145-5p mimic and anti-miR-145-5p in vivo via ICV injection into ischemic rats immediately after MCAO. [score:1]
miR-145-5p mimic and anti-miR-145-5p were administered to the animals before they underwent any surgery via intracerebroventricular infusion. [score:1]
These data demonstrate that it was essential to elucidate the specific relation between miR-145-5p and Nurr1 in rat mo del of cerebral I/R injury. [score:1]
After MCAO/R, the groups were: sham-operated (sham) group, MCAO/R group, null + MCAO/R group, scramble + MCAO/R group, anti-miR-145-5p + MCAO/R group, miR-145-5p mimic + MCAO/R group, Nurr1-siRNA + MCAO/R group, Nurr1 + MCAO/R group. [score:1]
[1 to 20 of 56 sentences]
5
[+] score: 150
We found that the mRNA and protein expression levels of OPG decreased, while those of RANKL increased, suggesting that miR-145 overexpression may lead to decreased OPG expression and increased RANKL expression, thereby playing a key role in the development and regeneration of bone cells in SINFH. [score:10]
Furthermore, Götte et al. reported that experimental miR-145 overexpression inhibits the actin bundling protein fascin and the junctional cell adhesion molecule JAM-A by targeting the osteoprotegerin (OPG)/receptor activator of nuclear factor-κ B (RANK)/receptor activator of nuclear factor-κ B ligand (RANKL) pathway, which is associated with bone metabolism [20, 21]. [score:7]
The results indicated that miR-145 overexpression elicited a decrease in the expression level of OPG protein and that the differences in OPG protein expression between the lentivirus -mediated miR-145 group and lentiviral control and normal groups were significant (both P < 0.01). [score:7]
Additionally, Yuan et al. determined that thousands of miRNAs, such as miR-21, miR-17, and miR-92a, are up-regulated, whereas others, such as miR-205 and miR-145, are downregulated in the setting of femoral head repair using high-throughput gene chip technology [22]. [score:7]
As shown in Fig 8, transfected cells were collected for total RNA extraction for gene detection after 24, 48, and 72 h. The results indicated that the mRNA expression level of OPG gradually decreased, while the mRNA expression levels of RANK and RANKL significantly increased in the setting of miR-145 overexpression. [score:7]
org/), the online miRNA target gene prediction tool, was utilized to predict the target genes of miR-145 and showed that OPG (TNFRSF11B) is one of the target genes of miR-145 and that the binding regions of the 3 'UTR of the OPG gene and miR-145 are highly conserved in mammals (Fig 4A). [score:7]
After transfection of 293T cells with an miR-145 overexpression vector, miR-145 expression in 293T cells increased significantly, while OPG mRNA and protein expression decreased significantly (all P < 0.05). [score:7]
MiR-145 and OPG expression in 293T cells after transfection with the miR-145 overexpression vector. [score:5]
The expression of miR-145 in the lentivirus -mediated miR-145 group was significantly up-regulated compared with that in the control and normal groups (both P < 0.01). [score:5]
The mRNA expression levels of miR-145, OPG, RANK and RANKL in THP-1 cells were assessed by RT-PCR, and the protein expression levels of OPG, RANK and RANKL were assessed by western blotting. [score:5]
The results showed that miR-145 expression was significantly up-regulated in the lentivirus -mediated miR-145 group compared with the control and normal groups (both P < 0.01). [score:5]
Changes in microRNA (miR)-145 and osteoprotegerin (OPG) expression in 293T cells after transfection with the miR-145 overexpression vector. [score:5]
Furthermore, OPG was confirmed as an miR-145 target gene using TargetScan. [score:5]
MiR-145 was transfected into THP-1 cells, and the gene expression levels of RANKL, RANK and OPG were subsequently determined via real-time PCR in the experimental group, which overexpressed miR-145. [score:5]
In conclusion, the present study has provided evidence that miR-145 regulates osteoblast proliferation and regeneration in SINFH by targeting the OPG/PANK/PANKL signaling pathway. [score:4]
After 293T cells were transfected with the miR-145 overexpression vector, the expression level of miR-145 in 293T cells was significantly increased compared with that in control cells and normal cells (both P < 0.01). [score:4]
After miR-145 overexpression, the levels of OPG mRNA and protein expression decreased significantly compared with their corresponding levels in the control and normal groups (both P < 0.05) (Fig 2). [score:4]
Lentiviruses containing miR-145 and control sequences were injected into rats with SIFHN via the tail vein, and serum miR-145 expression levels were detected by real-time PCR at 1 week after injection. [score:3]
The most well-studied miRNA associated with SINFH is microRNA (miR)-145, a short RNA molecule in humans encoded by the MIR145 gene that has been found to be downregulated in hormone-NO patients, based on the results of miRNA chip assays performed by Wei et al. and Seeliger et al. [17– 19]. [score:3]
Previous studies have shown that miR-145 is downregulated in hormone-NO patients using miRNA chip assays; thus, we focused on miR-145 in the present study and performed a series of experiments to determine its role in SINFH and the mechanisms underlying its effects [17– 19]. [score:3]
The 3'-untranslated region (UTR) of OPG was joined to a luciferase reporter vector, which was co -transfected into THP-1 cells with an miR-145 precursor (pre-miR-145). [score:3]
After 293T cells were transfected with the miR-145 overexpression vector for 48 h, GFP fluorescence intensity was observed using a fluorescence microscope to determine transfection efficiency. [score:3]
The level of miR-145 expression in the lentivirus -mediated negative control (NC) group was not significantly different from that of the normal group (P > 0.05) (Fig 3A). [score:3]
Serum OPG concentrations were detected by ELISA, which showed that miR-145 overexpression elicited significant decreases in serum OPG levels (P < 0.05) (Fig 3B). [score:3]
The 2 [-ΔΔCt] method was used for analysis of miR-145, OPG, PANK and PANKL expression. [score:3]
OPG is a target gene of miR-145. [score:3]
ELISA and western blotting were conducted to measure serum OPG levels in SINFH rats and showed that OPG protein levels were decreased in the setting of miR-145 overexpression, suggesting that miR-145 expression may be negatively correlated with OPG levels in SINFH. [score:3]
MiR-145 plays a role in the occurrence of SINFH by targeting the OPG/RANK/RANKL signaling pathway. [score:2]
According to the instructions of the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA), the cells were disrupted to detect biological luminescence and to observe the targeting of OPG by miR-145. [score:2]
Note: A, serum miR-145 level after transfection; B, serum OPG concentration after transfection; C, serum OPG protein expression level after transfection; **, compared with the blank group and negative control (NC) group, P < 0.01; experiments were repeated 3 times, and means were obtained. [score:2]
In the present study, we successfully constructed a rat mo del of SINFH via tail vein injections of a lentiviral vector, pLV-shRNA-miR-145, and observed that miR-145 expression increased markedly in SINFH rats compared with control rats. [score:2]
MiR-145 and OPG expression in rat serum. [score:2]
0159805.g003 Fig 3Note: A, serum miR-145 level after transfection; B, serum OPG concentration after transfection; C, serum OPG protein expression level after transfection; **, compared with the blank group and negative control (NC) group, P < 0.01; experiments were repeated 3 times, and means were obtained. [score:2]
Then, the remaining 16 rats in the experimental group were divided into a lentiviral treatment group (treated with tail vein injections of pLV-shRNA-miR-145) and a lentiviral control group (treated with tail vein injections of pLV-shRNA-miR-control) after pathological confirmation of SINFH, with each group comprising 8 rats. [score:1]
Although the exact relationship among miR-145, OPG and SINFH is unknown, RANKL and RANK are believed to be involved in the mechanisms underlying the effects of miR-145 on OPG levels and function in SINFH. [score:1]
After being transfected with miR-145, 293T cells and THP-1 cells were collected at 24 h, 48 h and 72 h. Total protein was extracted after cell disruption, and protein concentrations were estimated with the bicinchoninic acid (BCA) method. [score:1]
However, the relationship among miR-145, SINFH and the OPG/RANK/RANKL pathway remains uncertain. [score:1]
According to the rat Rno-miR-145 (MIMAT0000851) gene sequence in the miBase database (5’-GUCCAGUUUUCCCAGGAAUCCCU-3’), a pair of oligonucleotide chains containing the miR-145 sequence and the reverse complementary miR-145 sequence, which can form an shRNA precursor sequence containing a stem-loop structure after annealing, were designed. [score:1]
Therefore, present study aimed to determine the potential role of miR-145 in SINFH and the relationship between miR-145 and the OPG/RANK/RANKL signaling pathway in SINFH to highlight the mechanisms underlying the effects of miR-145 in SINFH progression. [score:1]
A rat mo del of SINFH was constructed via injection of the lentiviral vector pLV-shRNA-miR-145. [score:1]
Additionally, we evaluated OPG, RANKL and RANK mRNA and protein expression in THP-1 cells treated with miR-145 transfection using real-time PCR and western blotting. [score:1]
As shown in Fig 9, OPG protein content decreased in a time -dependent manner after miR-145 transfection. [score:1]
[1 to 20 of 42 sentences]
6
[+] score: 131
Other miRNAs from this paper: rno-mir-19b-1, rno-mir-19b-2, rno-mir-143, rno-mir-146a
Our results showed that inhibition of miR-145 repressed COL-I and α-SMA expression, while miR-145 mimics upregulated COL-I and α-SMA expression in HSCs. [score:10]
Suggested by Targetscan and PicTar, the online softwares for predicting target gene of microRNA, KLF4 might have a target seed sequence of miR-145. [score:7]
Furthermore, endogenous miR-145 was down-regulated by transfecting miR-145 specific inhibitor for 48 hours in activated primary HSCs. [score:6]
Then we used the luciferase reporter assay to determine whether miR-145 directly target KLF4 in LX-2 cells and found that miR-145 reduced 50–60% luciferase activities of KLF4 3′-UTR expression plasmid, indicating a direct binding of miR-145 (Fig. 6e). [score:6]
We made a couple of findings: (1) miR-145 were significantly increased in the process of cultured HSCs spontaneously and TGF-β induced activation; (2) miR-145 promoted HSC activation; (3) KLF4 was down-regulated in activated HSCs and in cirrhotic liver tissues; and (4), suppression of KLF4 could be an important molecular basis for miR-145 mediated HSC activation. [score:6]
Consistent with these reports, our data has shown an inhibitory effect of miR-145 on KLF4 expression. [score:5]
In our study, we found that miR-145 was up-regulated (Fig. 1) both by micro-array and qRT-PCR. [score:4]
We also found that KLF4 was the direct target of miR-145 in HSCs. [score:4]
This negative regulation of KLF4 expression could be one of the mechanisms of miR-145 mediated HSC activation. [score:4]
Together, our data showed that miR-145 were significantly up-regulated both in the process of culture activation of primary HSCs and in TGF-β induced HSC activation, suggesting an important role of miR-145 in liver fibrosis. [score:4]
KLF4 is the direct target of miR-145 in HSCs. [score:4]
Collectively, our observation indicated that, via targeting KLF4, miR-145 could be an essential regulator in HSCs activation and in liver cirrhosis. [score:4]
As shown in Fig. 1b and c, in line with the increased α-smooth muscle actin (α-SMA) and COL-I levels (Fig. 1b), miR-145 (Fig. 1c) was up-regulated by TGF-β1 stimulation. [score:4]
miR-145 was up-regulated in spontaneously and TGF-β activated HSCs. [score:4]
MiR-145 is one of the upregulated miRNA among the reported 53 miRNAs. [score:4]
We also detected miR-145 levels in rat fibrotic livers, and found that miR-145 expression was increased (Fig. 2b). [score:3]
KLF4 was suppressed by miR-145 in HSCs. [score:3]
KLF4 has been reported as one of the main targets of miR-145 in vascular smooth muscle cells 17. [score:3]
Although miR-145 has been reported to target KLF4 in vascular smooth muscle cells and other mesenchymal cells 22 23, its effect on KLF4 have not been examined in HSCs. [score:3]
The miRNA level of miR-145 or mRNA levels of α-SMA or COL-I were examined by qRT-PCR after transfecion of specific mimics or inhibitors for 48 hours in activated rat primary HSCs. [score:3]
The relative value of miR-145 to U6 (or target mRNA to β-actin mRNA) was set as 1 in the control or day 0 HSCs. [score:3]
In this study, we showed that both mRNA and protein levels of KLF4 were increased after transfection of miR-145 inhibitor (Fig. 6a and b); whereas transfection of miR-145 mimics reduced both mRNA and protein levels of KLF4 in rat HSCs (Fig. 6c and d). [score:3]
We showed that miR-145 is highly expressed in HSCs rather than in hepatocytes (Fig. 2c). [score:3]
Elevated expression of miR-145 in spontaneously and TGF-β induced activation of HSCs. [score:3]
The miR-145 mimics and inhibitor were designed and purchased from GeneCopoeia (USA) and transfected into activated HSCs at passages 3–5 at final concentration of 50 μM by Lipofectamine [TM] 2000. [score:3]
MiR-145 level is up-regulated in murine and human liver fibrosis. [score:3]
To assess the function of miR-145 in activation of HSCs, we detected the expression of miR-145 in quiescent (day 0), semi-activated (day 4) and completely-activated (day 12 and passaged) HSCs by qRT-PCR. [score:3]
To determine whether TGF-β modulates miR-145 expression, the activated rat primary HSCs (within 3–5 passages) were further activated by treating with 10 ng/ml of TGF-β1. [score:3]
It was interesting that the expression level miR145 was significantly decreased after passages as compared to day 12, although it still kept at high level (Fig. 1a). [score:2]
To examine whether miR-145 could be able to regulate activation of HSCs, rat primary HSCs were transfected with miR-145 specific mimics or a scrambled miRNA for 48 hours, respectively. [score:2]
More importantly, miR-145 levels were also significantly increased in CCl [4] induced cirrhotic liver tissues of rats and natural cirrhotic liver specimen of human patients (Fig. 2). [score:1]
We firstly detected the miRNA-145 levels in liver tissues from hepatic fibrosis patients (Metavir score = 4). [score:1]
3′-UTR containing putative miR-145 binding sites of the KLF4 gene was obtained by PCR from LX-2 and was constructed into the pmirGLO Vector (Promega, USA). [score:1]
To determine if miR-145 were also elevated in fibrotic liver, total RNA was isolated from human cirrhotic and non-fibrotic liver tissues and rat fibrosis mo dels. [score:1]
To reveal the expression level of miR-145 in hepatocytes and HSCs in the liver, we isolated and purified primary hepatocytes and HSCs from normal rats, and measured miR-145 level. [score:1]
We showed that miR-145 was elevated both in culture activated HSCs or TGF-β stimulated activation (Fig. 1). [score:1]
The miRNA level of miR-145 or mRNA levels of α-SMA or COL-I were examined by qRT-PCR. [score:1]
Although, recently Zhou et al. reported that miR-145 was decreased in activated HSCs 31. [score:1]
Promotion of HSC activation by miR-145. [score:1]
LX-2 cells were transfected with 50 nM miR-145 mimics or negative control (NC) along with empty pmirGLO vector or KLF4-UTR-pmirGLO by Lipofectamine [TM] 2000 for 24 hours. [score:1]
We confirmed that miR-145 was indeed increased during the process of HSCs activation. [score:1]
miR-145 promoted HSC activation. [score:1]
[1 to 20 of 42 sentences]
7
[+] score: 121
An enhanced level of ROS content upregulates the p53 and p65 subunit of the transcription factor nuclear factor-κB (NF-κB) complex expressions and transcriptional activities (7, 8), which have a positive impact on miR-145 overexpression (8, 9). [score:8]
The PGE components had a suppressive impact on high p53 and p65 expression levels in the liver and skeletal muscle tissues of diabetic rats and, accordingly, implicated miR-145 upregulation by p53/p65 stimulation. [score:8]
PGE administration downregulated miR-145 levels in Alloxan-diabetic Wistar rats by suppression of ROS -mediated p53 and p65 overexpression. [score:8]
Our experiments demonstrated an accelerated level of p53 gene expression in the liver and skeletal muscle tissues of diabetic rats, in response to massive ROS production followed by high miR-145 expression in target tissues, as well as plasma. [score:7]
A p53 response element is located in the promoter region of miR-145, which upregulates its expression (8) and may be involved in miR-145 activation during oxidative stress situations (21). [score:6]
Due to the negative effects of the pomegranate on ROS production, inflammation, p53 and p65 levels (15- 17), we hypothesized that treatment with the pomegranate fruit aqueous extract (PGE) could ameliorate miR-145 levels in alloxan -induced diabetic rats (as an animal mo del for T1DM) via downregulation of p53/p65 expressions. [score:6]
In comparison to the control group, miR-145 expression upregulated in the plasma (3.7-fold, Fig. [score:6]
Pomegranate fruit aqueous extract downregulates miR-145 expression in diabetic rats. [score:6]
In the alloxan-diabetic rats, in response to ROS accumulation, the NF-kB complex upregulated miR- 145 by binding its p65 subunit to the miR-145 promoter (9). [score:4]
Researchers report upregulation of miR-145 in obesity and increased lipolysis in adipocytes (3). [score:4]
Also, a recent study has reported miR-145 upregulation in type 1 diabetes mellitus (T1DM) patients and an animal mo del (5). [score:4]
IRS-1 is a vital mediator in the insulin metabolic signaling pathway downregulated by miR-145. [score:4]
Consequently, the decreased irs-1 mRNA level, as a direct target of miR-145, improved in the intended tissues followed by enhanced glucose uptake and storage. [score:4]
ROS is identified as a positive regulator of inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α); therefore, it stimulates p65 induction of miR-145 expression in an alternative way (9, 10). [score:4]
This study examines the effects of pomegranate fruit aqueous extract (PGE) on the levels of ROS, p53, p65, miR-145, and its target insulin receptor substrate 1 (irs-1) mRNA in Alloxan-diabetic male Wistar rats. [score:3]
According to these evidences, we have hypothesized that ROS accumulation in alloxan-diabetic rats accelerates hyperglycemia and hyperlipidemia through the enhancement of miR-145 expression levels. [score:3]
In contrast, diabetic rats treated with PGE for 21 days reversed miR-145 elevation with increased irs-1 mRNA expression. [score:3]
The miR-145 expression level is associated with reactive oxygen species (ROS) accumulation. [score:3]
There is a synergy between miR-145 overexpression, high levels of lipolysis, TNF-α secretion, and NF-kB activation. [score:3]
miR-145 inhibitory effects on the insulin signaling pathway have been shown to lead to hydrolysis of TG and FFA release (3). [score:3]
We observed marked decreases in p53, p65, miR-145 expression levels followed by an elevated level of irs-1, which contributed to improvement in insulin sensitivity. [score:3]
In this study, the DC group has depicted a decreased level of irs-1 transcription in response to miR-145 overexpression. [score:3]
Based on the main contribution of the liver and skeletal muscle tissues in blood glucose homeostasis (14), downregulation of miR-145 could be considered a therapeutic method in obesity, metabolic syndrome, and T1DM subjects. [score:3]
Fig. 4 Quantitative real-time polymerase chain reaction analysis of the miR-145 expression levels. [score:3]
In line with these reports, our results have revealed that PGE treatment contributed to the improvement in hyperlipidemia as a result of a reduction in ROS -mediated p65 induction of miR-145 expression in alloxan-diabetic rats. [score:3]
The same results were obtained from healthy treated groups, as oral administration of PGE lowered the basal level of miR-145 expression in all groups and, conversely, elevated irs-1 levels in the healthy animals. [score:3]
Therefore, we analyzed the expression levels of p53, p65, and miR-145, along with the mRNA content of irs-1 in diabetic rats treated with different doses of PGE compared to diabetic and healthy controls In this experimental study, chemicals and reagents were obtained from the following sources: Alloxan monohydrate (Sigma, St. [score:2]
miR-145 is a member of the miR-143-145 cluster and acts as a negative regulator of insulin receptor substrate 1 (IRS-1) level by pairing with the 3’-UTR region of irs-1 mRNA (2). [score:2]
As a result, miR-145 stimulates hyperglycemia and hyperlipidemia due to insulin signaling pathway disruption (4). [score:1]
We used real-time polymerase chain reaction (PCR) to investigate the modulation of p53, p65, miR-145, and irs-1 expression levels. [score:1]
[1 to 20 of 30 sentences]
8
[+] score: 117
Consistent with our findings, a global screen of miR expression changes under different muscle wasting conditions found that miR-145 was downregulated after denervation or starvation [15]. [score:6]
As noted above, one of the miRs downregulated after SCI was miR-145, which has been reported to be present in skeletal muscle homogenates and to undergo reduced expression after denervation or starvation [15]. [score:6]
By qPCR, miR-145 and miR-206 were downregulated after SCI (Fig 2); their expression was reduced after SCI by Nanostrings although the differences were not significant (p < 0.11 and 0.08, respectively) (Fig 2 and Table 1). [score:6]
Its ability to target Activin receptor IB [46] and Smad3 [47, 48] suggest that reduced levels of miR-145 would promote muscle atrophy gene expression programs. [score:5]
miRs were selected for qPCR analysis because they met one of the following criteria: (1) they were myomirs (miRs 1, 133b, and 206) or involved in muscle regeneration (miR-486); (2) they targeted genes implicated in muscle atrophy (miR-23a/b, miR-27); (3) they were expressed in muscle at high levels and were altered after SCI but have unclear roles in muscle atrophy (miR-145); (5) they were not altered after SCI (miRs 17 and 126) and thus provide controls for internal consistency when comparing qPCR and Nanostrings data. [score:5]
miR mRNA miR-23a AcvR-IC AcvR-IIB BMRP1B BMPR2 Smad3 Smad4 [63] Smad5 miR-145 AcvR-IB [47, 48] AcvR-IIA Cited2 Inhibin Smad2 Smad3 [47, 48] Smad4 Smad5 TGFBR2 AcvR-IIB miR-206 BMPR-1B Smad2 Smad4 TGFBR3 Cited2 Confirmed targets are identifed by boldface. [score:5]
In cardiomyocytes, miR-145 has been shown to prevent damage induced by reactive oxygen species through protection against mitochondrial apoptosis [43], to protect against Ca [2+] overload induced by reactive oxygen species by targeting CaMKIIδ [44] and to block cardiomyocyte hypertrophy by targeting GATA6 [45]. [score:5]
miR mRNA miR-23a AcvR-IC AcvR-IIB BMRP1B BMPR2 Smad3 Smad4 [63] Smad5 miR-145 AcvR-IB [47, 48] AcvR-IIA Cited2 Inhibin Smad2 Smad3 [47, 48] Smad4 Smad5 TGFBR2 AcvR-IIB miR-206 BMPR-1B Smad2 Smad4 TGFBR3 Cited2 The possibility that Cited2 is indeed a target for miR-145 was considered. [score:4]
To modify the miR-145 target site in the Cited2-3’UTR, the plasmid was subjected to site directed mutagenesis using the Q5 Site directed mutagenesis kit (New England Biolabs) and the appropriate mutagenic primers (5’AATATGCTAACAGAGAAGATTAAACATGTGGGCCAAAC and 5’TGAAAACTTAAGTCTGTACTC). [score:4]
miR-145 was identified as a being downregulated in skeletal muscle at 56 days after SCI. [score:4]
Ingenuity Canonical Pathways -log(p-value) Ratio Axonal Guidance Signaling 4.90E+01 2.26E-01 Molecular Mechanisms of Cancer 3.60E+01 2.11E-01 Protein Kinase A Signaling 3.10E+01 1.90E-01 Integrin Signaling 2.98E+01 2.62E-01 Actin Cytoskeleton Signaling 2.91E+01 2.49E-01 Regulation of the Epithelial-Mesenchymal Transition Pathway 2.89E+01 2.72E-01 Epithelial Adherens Junction Signaling 2.86E+01 3.08E-01 TGF-ß Signaling 2.45E+01 3.79E-01 HGF Signaling 2.37E+01 3.33E-01 B Cell Receptor Signaling 2.29E+01 2.44E-01 Role of Macrophages, Fibroblasts and Endothelial Cells in Rheumatoid Arthritis 2.27E+01 1.85E-01 ERK/MAPK Signaling 2.27E+01 2.35E-01 Glucocorticoid Receptor Signaling 2.23E+01 1.95E-01 Cardiac Hypertrophy Signaling 2.20E+01 2.11E-01 Clathrin -mediated Endocytosis Signaling 2.20E+01 2.32E-01 Role of NFAT in Cardiac Hypertrophy 2.16E+01 2. 35E-01 Xenobiotic Metabolism Signaling 2.16E+01 1.89E-01 IGF-1 Signaling 2.15E+01 3.30E-01 Role of Osteoblasts, Osteoclasts and Chondrocytes in Rheumatoid Arthritis 2.15E+01 2.10E-01 Ephrin Receptor Signaling 2.12E+01 2.36E-01 Germ Cell-Sertoli Cell Junction Signaling 2.08E+01 2.44E-01 [1] Significantly enriched biological themes were determined for the 735 known or predicted mRNA targets for miR-23a, miR-145, miR-206 and miR-467F using Ingenuity Pathways Analysis. [score:4]
The sequence alignment and reporter gene studies support the conclusion that miR-145 binds the predicted seed sequence within the Cited2 3’ UTR and represses translation of Cited2 protein. [score:3]
miR-145 targets Cited2. [score:3]
Reporter gene studies were performed to test whether miR-145 altered the expression of a luciferase reporter into which a portion the 3’ UTR of the Cited2 mRNA containing the miR-145 seed sequence or a mutated version of it was inserted 3’ to the coding sequence for the firefly luciferase gene. [score:3]
Cross sections of rat gastrocnemius muscle revealed bright staining for miR-145 within muscle fibers in proportion to the concentration of the hybridization probe (Fig 3A and 3B) while no staining was observed with a scrambled miR control (Fig 3D) or without any probe (Fig 3E) confirming that miR-145 is expressed in skeletal muscle fibers. [score:3]
The miR-145 target site was changed from AACUGGAA to A CAGAGAA. [score:3]
To determine miR-145 was correlated with in expression of Cited2, rat gastrocnemius muscle was subjected to subcellular fractionation. [score:3]
A. Alignment of miR-145 with the putative target site in the 3’UTR of Cited2 and with a mutated version. [score:3]
0166189.g004 Fig 4 A. Alignment of miR-145 with the putative target site in the 3’UTR of Cited2 and with a mutated version. [score:3]
Six mRNA targets involved in TGF-β signaling were identified for miR-23a, 9 for miR-145, and 5 for miR-206 (Table 3). [score:3]
This second approach was intended to evaluate changes in the expression of specific miRs such as the myomirs, mirRs implicated either directly (miR-206) or indirectly (miR-23a/b) in muscle atrophy, and one miR not previously linked to muscle atrophy (miR-145). [score:3]
Cited2 mRNA is a miR-145 target. [score:3]
Confirmed or predicted mRNA targets involved in TGF-β signaling were identified for miR-23a, miR-145, and miR-206. [score:3]
Possible explanations for these discrepant findings are that miR-145 levels in muscle fibers are too low to influence Cited2 translation or that Cited2 protein levels are controlled by protein turnover. [score:3]
The possibility that Cited2 is indeed a target for miR-145 was considered. [score:2]
As compared to the Sham group, a significant reduction in miR expression was observed in the SCI group for miR-23a, miR-23b, miR-27b and, miR-145 (Fig 2A). [score:2]
miR-145 significantly reduced normalized firefly luciferase activity whereas mutation of the predicted miR-145 seed sequence in the 3’ UTR of the Cited2 mRNA abrogated this effect (Fig 4A and 4B). [score:2]
An alignment of the 3’ UTR of Cited2 from 23 species was performed and revealed that the miR-145 seed sequence found in the mouse Cited2 mRNA is highly conserved across 20 species, including rats (S1 Fig) but was absent from guinea pig (Cpo) and cat (Fca), and mutated in frog (Xtr). [score:1]
A: 20 nM miR-145 probe, B: 40 nM miR-145 probe; C: U6 snRNA probe (1 nM); D: scrambled control probe (40 nM); E: no probe. [score:1]
Cells were co -transfected with 0.2 μg of pmirGLO vector containing the 3’ UTR of Cited2 and a miR-145 mimic (670 nM; Qiagen) or a universal siRNA negative control (Allstars, Qiagen) using the Attractene reagent as per manufacturer’s protocol (Qiagen). [score:1]
S1 Fig Upper panel shows a sequence alignment of the region of mouse (Mmu) Cited2 mRNA containing the predicted miR-145 seed sequence; the seed sequence is highlighted in light blue. [score:1]
miR-145 has been found to have roles in the pathogenesis of many different types of cancer and to be an important modulator of smooth muscle [41], in part through modulation of KLF4 [42]. [score:1]
Therefore, distribution within muscle of miR-145 was addressed using LNA-FISH. [score:1]
Fluorescent in situ hybridization (FISH) analysis of miR-145. [score:1]
The sections were then rinsed in 0.85% NaCl for 5 min, followed by 2x SSC buffer for 5 min, dehydrated through graded ethanols and left to dry at room temperature for 1 h. The sections were pre-hybridized at 37°C for 4 h in SSC prehybridization solution (bioPlus, 700830) then hybridized overnight at 37°C with a digoxigenin-labeled miRCURY LNA probe for miR-145 or scrambled control (Exiqon) at 20-40nM in hybridization solution (Exiqon). [score:1]
The physiologic importance of this activity of miR-145 in skeletal muscle is, however, unclear as nuclear and cytoplasmic Cited2 protein levels were not altered in muscle from SCI rats despite the reduction of miR-145 observed after SCI. [score:1]
org) revealed a miR-145 seed sequence in the 3’-UTR of the mouse Cited2 mRNA. [score:1]
0166189.g003 Fig 3 LNA-FISH was performed on cross sections of (rat gastrocnemius muscle using DIG-labeled LNA-FISH probes for miR-145, scrambled control, and U6 snRNA. [score:1]
A conserved, predicted miR-145 seed sequence was identified in the 3’-UTR of mouse Cited2 mRNA. [score:1]
LNA-FISH was performed on cross sections of (rat gastrocnemius muscle using DIG-labeled LNA-FISH probes for miR-145, scrambled control, and U6 snRNA. [score:1]
Upper panel shows a sequence alignment of the region of mouse (Mmu) Cited2 mRNA containing the predicted miR-145 seed sequence; the seed sequence is highlighted in light blue. [score:1]
miR-145 is localized to muscle fibers. [score:1]
Distribution of miR-145 in muscle tissue. [score:1]
It is not known whether miR-145 is present in skeletal muscle fibers as opposed to other cellular constituents of skeletal muscle, and consequently or whether such reductions might impact skeletal muscle fiber homeostasis. [score:1]
Lower panel: an alignment of murine cited2 mRNA and murine miR-145 is shown. [score:1]
[1 to 20 of 45 sentences]
9
[+] score: 90
The same expression pattern was detected for mir-145, with the exception that it was strongly expressed also in smooth muscle cells in the interstitial blood vessels, in accordance with previous works 56 57; mir-145 is known to indirectly suppress Lin28a/Lin28b expression by repressing its transcriptional activator, c-Myc 11 12. [score:10]
However, while this phenomenon might explain loss of expression of some transcripts (e. g., Lin28b), the arrest of spermatogenesis at early stages can hardly justify the observed increases in miRNAs, such as let-7b and mir-145, which are abundantly expressed in spermatocytes and early spermatids, therefore suggesting additional regulatory phenomena reciprocally linking Lin28 and let-7 expression in the testis. [score:8]
Germ cells expressing both let-7b and mir-145 corresponded to pachytene spermatocytes (P in B, C), while a fainter expression was found in round spermatids (RS) from stage I to stage VII, and expression was absent in elongating spermatids (ES) from stage VIII onwards. [score:7]
The same applies to the dynamic changes reported in the seminiferous tubules, with absent expression of let-7b and mir-145 in cell types of the seminiferous epithelium with high expression of Lin28a (spermatogonia) or Lin28b (round/elongating spermatids) in the mouse. [score:5]
The same expression pattern was observed for mir-145, with the exception that it was strongly expressed also in smooth muscle cells in the interstitial blood vessels (Fig. 2-I, upper panel, D). [score:5]
Pattern of cellular expression of let-7b and mir-145 expression in adult rat testis. [score:5]
Expression analyses of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs were conducted in testicular samples from rats at different stages of postnatal development. [score:4]
For instance, during neonatal period, Lin28a/Lin28b mRNA expression was minimum and (especially for Lin28b) increased thereafter, whereas let-7 and also mir-132, mir-9 and mir-145 miRNAs abundance was maximal on PND1, decreasing progressively along postnatal maturation. [score:3]
With regard to miRNA expression, HPX did not result in detectable alterations in relative let-7a, let-7b or mir-145 miRNA levels. [score:3]
For this reason, we studied testicular expression of Lin28a and Lin28b mRNAs and let-7a, let-7b, mir-145 and mir-132 miRNAs in mo dels of GH deficiency, hypothyroidism and in adrenalectomized rats. [score:3]
Thus, neonatally estrogenized rats, in which puberty was altered, showed decreased testicular Lin28a and Lin28b mRNA levels, while let-7a, let-7b and mir-145 miRNAs expression levels were enhanced. [score:3]
Admittedly, however, we do not exclude the possibility that some of the reported changes of these mRNA and miRNA species might stem from testicular cell types other than germ cells; this might well be the case for Lin28b, whose protein has been detected in mouse Leydig cells 53, as well as mir-145, which is highly expressed in smooth muscle cells of interstitial blood vessels of rat testis (present results). [score:3]
In the lower panel, schematic representation, comparing the expression of Lin28a (green box) and Lin28b (red box) protein in mouse germ cells 53, and of let-7b and mir-145 in rat germ cells (current study) is shown. [score:3]
Such distribution fits well with the pattern of cellular expression of two selected miRNAs, known to repress Lin28a/Lin28b, namely, let-7b and mir-145, as detected by ISH adult rat testis. [score:3]
Effects of HPX and gonadotropin replacement on testicular expression Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs. [score:3]
In Experiment 1, the expression profiles of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-9, mir-145 and mir-132 miRNAs were determined in the testis of rats at different age-points during postnatal maturation: neonatal (PND-1), infantile (PND-15), juvenile (PND-30), early pubertal (PND-38), pubertal (PND-45) and adult (>PND-75) ages, in keeping with previous references 38; size = 7–8 per group. [score:3]
Expression of let-7b and mir-145 in adult rat testis. [score:3]
A strong expression for mir-145 was detected in the smooth muscle cells in the interstitial blood vessels (BV in D). [score:3]
Expression analyses included Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132 and mir-145 miRNAs. [score:3]
In contrast, ISH assays successfully detected the expression of two selected miRNAs of the system, namely, let-7b and the related miRNA, mir-145, in testicular sections from adult rats. [score:2]
In addition, previous literature and bioinformatic analyses of our group had documented the putative regulatory role in this hub of mir-145 and mir-132, which is highly conserved across most vertebrates. [score:2]
In contrast, let-7a, let-7b and mir-145 miRNA levels (Fig. 3) were significantly higher than in controls, while mir-132 (Fig. 3) and mir-9 (Suppl. [score:1]
Double digoxigenin (DIG)-labeled miRCURY LNA™ Let-7b, mir-145 and RNU6 detection probes (Exiqon, Denmark) were employed in this study. [score:1]
Levels of mir-132 and mir-145 tended to decrease only at PND-15 in LL males (Fig. 5). [score:1]
However, while let-7a, mir-132 and mir-9 decreased sharply after PND1, let-7b increased between the neonatal and infantile age, to decline thereafter until puberty, whereas mir-145 levels remained elevated during infantile period and dropped during the juvenile transition. [score:1]
In contrast, CD males displayed a consistent decline in let-7b, mir-132 and mir-145 miRNA abundance at PND-15, but these changes in miRNA levels were transient and were not detected at PND-45, the expected time of puberty (Fig. 4). [score:1]
Let-7a, let-7b, mir-132, and mir-145 (Fig. 1), as well as mir-9 (Suppl. [score:1]
[1 to 20 of 27 sentences]
10
[+] score: 80
MiR-143 and miR-145 were direct transcriptional targets of serum response factor (SRF), myocardin and Nkx2.5 and were down-regulated in injured or atherosclerotic vessels containing proliferating, less differentiated smooth muscle cells. [score:7]
Interestingly, as shown in Fig.   3, at 4 weeks post-MI, with the exception of miR-143-3p, changes in miR-30a-5p, miR-30c-5p, miR-145-5p, and miR-140-3p expression tended to increase compared to the control group, whereas the expression of these four miRNAs decreased and the expression of miR-143-3p increased in the SkM +MI group, suggesting that these miRNAs may be associated with SkM therapy in myocardial injury. [score:6]
With the exception of miR-143-3p, we observed that changes in the expression of miR-30a-5p, miR-30c-5p, miR-145-5p, and miR-140-3p at 4 weeks post-MI tended to increase compared to the control group, whereas expression of these four miRNAs decreased and the expression of miR-143-3p increased in the SkM treatment group, suggesting that these miRNAs could be associated with the SkM therapy of myocardial injury. [score:6]
We focused on a novel set of apoptosis -associated miRNAs and their target genes, among which 4 miRNAs (miR-30a-5p, miR-30c-5p, miR-145-5p, miR-140-3p), except one (miR-143-3p), were downregulated in the SkM treated group as compared to the untreated group. [score:5]
GO-Analysis based on miRNA targeted genes showed significant function of target genes by rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p. [score:5]
Pathway analysis based on miRNA targeted genes showed significant pathways targeted by rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p. [score:5]
We focused on changes in some apoptosis -associated miRNA and in gene expression in response to SkM MI therapy, corroborated some of the results obtained from microarrays with real-time qPCR analysis, and selected some significant miRNAs, including miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p, which were involved with anti-apoptotic target genes such as Angptl4, Dpep1, Egr1, Eif5a, Tsc22d3, Irs2 and Cebpb. [score:5]
We observed a significant trend in the expression of some apoptosis-related miRNA and mRNA, including the expression of miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p (Fig.   3). [score:5]
We also demonstrated that miR-140, miR-143 and miR-145 might also collectively cooperate in MI treatment with SkMs by regulating targeted genes such as Egr1. [score:4]
MicroRNA-GO-Network, screening out the main function of the target genes regulated by rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p. [score:4]
miR-143 and miR-145 act as integral components of the regulatory network whereby SRF controls cytoskeletal remo deling and phenotypic switching of smooth muscle cells (SMCs) during vascular disease [31]. [score:4]
In this experiment, we focused on a subset of apoptosis-related miRNAs, including miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p, and mRNAs involved in anti-apoptotic target genes such as Angptl4, Dpep1, Egr1, Eif5a, Tsc22d3, Irs2 and Cebpb. [score:3]
We focused on five apoptosis-related miRNAs (miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p), demonstrated their changes after SkMs treatment and filtered out 7 anti-apoptotic target genes, namely, Angpt14, Eif5a, Egr1, Irs2, Cebpb, Tsc22d3, and Dpep1, in the heart tissues (Fig.   6). [score:3]
MIRANDA, MICROCOSM, and MIRDB programs were employed to predict potential targets of five key miRNAs, miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p. [score:3]
Venn’s diagram for target genes of rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p predicted by MIRANDA, MICROCOSM, MIRDB. [score:3]
In our study, the expression of miR-145-5p increased after MI and declined after SkM treatment. [score:3]
Our data also suggest that some apoptosis -associated miRNAs, such as miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, miR-140-3p and their target genes, may play an important role in myocardial injury after MI. [score:3]
The five key miRNAs in the network were identified as miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p. [score:1]
The results from real-time qPCR analysis showed high concordance with our microarray results for all investigated transcripts, as shown in Fig.   4. Fig.  4 Analyses of the expression of rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p by RT-PCR. [score:1]
The five key miRNAs in the network were identified as miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p, as shown in Additional file 12: Figure S4. [score:1]
Accumulating evidence strongly suggests that the miR-145 family has a relationship with apoptosis [26– 28]. [score:1]
The expression of miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p in the infarcted border zone region was measured by real-time analysis 4 weeks after MI. [score:1]
This result was consistent with a human study in MI patients showing that the concentration of circulating miR-145 correlates with that of cTnI and CK-MB; increased circulating miR-145, cTnI and CK-MB are associated with worse outcomes in human MI blood samples [29]. [score:1]
[1 to 20 of 23 sentences]
11
[+] score: 65
On the other hand, miR-145 controls VSMC phenotype by increasing target gene myocardin expression via inhibition of an intermediary [20], [28]. [score:7]
To determine if CKD affects the expression of circulating miR-125b, miR-145 and miR-155, we analyzed the expression in stored sera from 90 stage 3–4 CKD patients who had participated in a previous study and consented for future use of their blood samples. [score:5]
For example, in non-CKD patients with cardiovascular disease, miR-145 and miR-155 were found to be lower in patients with coronary artery disease than in those without [7]. [score:5]
To determine the effect of CKD on miRNA expression, we isolated VSMC from the aorta of CKD (Cy/+) rats and their normal littermates and determined the expression of miR-125b, miR-145, and miR-155 by real time PCR. [score:5]
Our in vitro work confirms that in the VSMC from CKD animals there was downregulation of both miR-145 and myocardin, indicating a more proliferative VSMC [2], [16]. [score:4]
was performed to determine the expression of miR-125b, miR-145, miR-155 and miR-210 and normalized by U6 (A). [score:3]
0064558.g001 Figure 1 Sera were collected from stage 3–4 CKD patients (n = 10), hemodialysis patients (n = 10) and healthy volunteers (n = 8) and total RNA isolated and real time PCR performed to determine the expression of circulating levels of miR-125b (A), miR-145 (B) and miR-155 (C) normalized by U6. [score:3]
Myocardin is normally stimulated by miR-145 [28] and thus, the low expression of myocardin in our study confirmed the functional importance of the decreased level of miR-145. [score:3]
Sera were collected from stage 3–4 CKD patients (n = 10), hemodialysis patients (n = 10) and healthy volunteers (n = 8) and total RNA isolated and real time PCR performed to determine the expression of circulating levels of miR-125b (A), miR-145 (B) and miR-155 (C) normalized by U6. [score:3]
Elia et al have shown that the expression of miR-145 is decreased in mice subjected to aortic constriction and in the ApoE mouse mo del of atherosclerosis. [score:3]
This is in contrast to the work of Fichtlscherer et al who found that miR-145 and 155 were decreased in non-CKD patients with coronary artery disease with or without diabetes [7]. [score:3]
Therefore, in the present study we evaluated three “vascular” miRNAs that are known to be expressed in the artery and involved in vascular smooth muscle cell (VSMC) differentiation (miR-145 and 155) [2], [15], [16], inflammatory vascular disease (miR-155) [17]– [19], abnormalities in the angiotensin pathway (miR-155) [20]– [22] and arterial calcification (miR-125b) [23], [24] in patients with CKD. [score:3]
Cultured VSMC from CKD rats had significantly lower expression of miR-125b, miR-145 and miR-155 compared to that from normal rats (Figure 3A). [score:2]
Target-specific PCR primers (miR-125b, miR-145, miR-155 and miR-210) were obtained from Applied Biosystems. [score:2]
Since miR-145 normally increases myocardin, low levels observed in our study in VSMC in animals with CKD in vitro and in vivo, and in the circulation of patients with CKD may imply that the normal ‘safeguard’ regulation of myocardin by miR-145 may be impaired. [score:2]
The results demonstrated that there is significantly reduction in expression in miR-125b, miR-145, and in thoracic aorta from CKD compared to that from normal rats (Figure 2A). [score:2]
By real time PCR, the expression of miR-125b, miR-145 and miR-155 were lower in thoracic aorta from CKD compared to that from normal rats (all p<0.01; Figure 2A). [score:2]
Calcium and vitamin D levels were no longer significant for miR-125b, miR-145 or miR-155. [score:1]
However, there was no correlation between AT1R and RUNX2, or between miR-145 and myocardin. [score:1]
Circulating levels of miR-125b, miR-145 and miR-155 are decreased in CKD. [score:1]
For the human studies, review of circulating miRNAs, the miR-145 and miR-155 indicated the results were not normally distributed, and therefore all of the miRNAs were converted to natural logarithmic values. [score:1]
Furthermore, they demonstrated that VSMC from miR-145 null mice are de-differentiated [38]. [score:1]
In addition, after adjustment, diabetes continued to be associated with miR-145 (β = 1.69, p = 0.02, 95% CI 0.34, 3.04) but not miR-155. [score:1]
The circulating levels of miR-125b, miR-145 and miR-155 are decreased with progressive eGFR; the ability to detect such miRNA may offer hope of a novel cardiovascular biomarker. [score:1]
There were negative correlations of miR-155 with the presence of calcification miR-155 (r = –0.537, p = 0.04; Figure 2B) and miR-125b and calcification (r = –0.478, p = 0.07), but no relationship with miR-145. [score:1]
[1 to 20 of 25 sentences]
12
[+] score: 42
miR-145 has also been proposed as a tumor suppressor that can target the 3′-untranslated region of the insulin receptor substrate-1 gene and dramatically inhibit the growth of colon cancer cells [43]. [score:9]
Our data showed that acupuncture at taichong acupoint regulated miR-339, miR-223, and miR-145 expression, while acupuncture at nonacupoint failed to affect these miRNAs' expression. [score:6]
miR-145 has been proposed to inhibit human embryonic stem cell self-renewal, represses expression of pluripotency genes, and induces lineage-restricted differentiation [41]. [score:5]
Moreover, compared to acupuncture at nonacupoint, acupuncture at taichong point significantly upregulated the expression of miRNA-339, miR-223, and miR-145 in medullas of SHRs (Figure 3). [score:5]
To validate the microarray profiling data, qRT-PCR was used to confirm the upregulated miRNAs including miRNA-339, miR-223, miR-145, and miR-451. [score:4]
The data showed that miR-339, miR-223, and miR-145 were significantly upregulated in medullas of SHRs treated with acupuncture at taichong point in contrast to the mo del group untreated with acupuncture (Figure 2). [score:4]
miRNA-339, miR-223, and miR-145 are highly conserved and have multiple targets predicted for them in both humans and rats [39– 41]. [score:3]
Importantly, our RT-PCR assay has confirmed that miRNA-339, miR-223, and miR-145 were upregulated in SHRs treated with acupuncture at taichong acupoint in comparison with the nonacupoint group. [score:3]
While being compared to the normal control group (healthy SD rats), miR-339, miR-223, and miR-145 were significantly downregulated in mo del group. [score:3]
[1 to 20 of 9 sentences]
13
[+] score: 37
Two differences that occurred in the current study were downregulation of miR-126 and miR-145 in MCT PAH rats, which had previously been reported as upregulated in human iPAH specimens and BMPR2 deficient mice [12]. [score:7]
This increase was accompanied by significant increases in miR-17, 21 and 223 expression levels in plasma relative to vehicle controls (Fig 1D), whereas miR-145 was downregulated in plasma (Fig 1D). [score:6]
Inhibition of miR-145 [12], enhancement of miR-328 expression [14], and enhancement of the miR424/503-FGF axis also attenuated experimental pulmonary hypertension [19, 20]. [score:5]
A group of miRNAs were downregulated in the lung and PA of MCT PAH rats, including miR-126, miR-145, miR-150, miR-424, and miR-503 (Fig 1A and 1B). [score:4]
Only plexigenic lesions demonstrated an increase in miR-145 expression levels. [score:3]
Among these the miR-17–92 cluster, miR-21, miR-145, miR-204 and miR-210 are dysregulated in PASMCs, miR-124 is primarily dysregulated in fibroblasts in the adventitia, and miR-17, miR-21, miR-424, and miR-503 appear to play important roles in PAECs. [score:3]
In that study, miR-145 expression levels in laser microdissected concentric lesions of lung specimens from PAH patients compared to levels in unremo deled human control PA specimens were not different. [score:2]
The finding of reduced expression in miR-145, which has often been considered a smooth muscle cell (SMC) specific miRNA [34, 35], in MCT PAH, was surprising since this mo del has been associated with a vigorous pulmonary artery SMC proliferative response. [score:2]
MiR-17, miR-21, and miR-145 dysregulation have been linked to TGFβ, BMPR2 and RhoA/RhoB kinase signaling [24– 26]. [score:2]
Levels of miR-145 were also reduced in the RV (Fig 1C). [score:1]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
N = 4. p values are as follows: MiR-126 p = 0.499, miR-145 p = 0.422, miR-150 p = 0.803. [score:1]
[1 to 20 of 12 sentences]
14
[+] score: 36
In summary, the data analysis supports the view that the down-regulation of four miRs (miR-133b, miR-143, miR-335-5p, miR-1) appears to orchestrate the development of chronic neuropathic pain in Sural-SNI while the up-regulation of seven miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1) appear to orchestrate the recovery from post-nerve injury induced pain in Tibial-SNI. [score:8]
By using the rationale from our dual SNI variants we interpret that the decrease in expression of four miRs (miR-133b-3p, miR-145, miR-143, and miR-1) contributes to pain while the increase in expression of two miRs (miR-193b-3p and miR-191-5p) limits the level of pain that develops following a sciatic nerve crush. [score:5]
On the other hand, the translation of these ion channels would be predicted to decrease in the Tibial-SNI primary sensory neurons due to the increase in expression of all seven identified miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1). [score:5]
Hence, it appears that decreasing miR-145 in primary sensory neurons contributes to the development of chronic pain by enhancing the expression of ion channels known to contribute to neuronal hyperexcitability and possibly by promoting non-specific sprouting following a peripheral nerve injury. [score:4]
In both the microarrays (Figure 3A) and qPCR (Figures 3B,C) seven miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1) had a significantly higher level of expression in Tibial-SNI than in Sural-SNI. [score:3]
Taken together, an increase in miR-145 correlates with recovery from post-nerve injury induced pain, while a lack of an increase (Sural-SNI) or decrease (sciatic nerve transection, sciatic nerve crush) of miR-145 correlates with development of chronic pain following a peripheral nerve injury. [score:2]
L3-DRG, which contains the somata of the uninjured saphenous nerve fibers, also showed differential regulation between the two SNI variants, but only three of these miRs (miR-133b, miR-145, miR-143) were significantly different. [score:2]
Following sciatic nerve crush, miR-145 is decreased in the nerve stump (Viader et al., 2011) at a time period in which animals display mechanical and cold allodynia (Tamaddonfard et al., 2014). [score:1]
The opposite will be the case in Tibial-SNI in which there is an increase in miR-145. [score:1]
Enhancement of miR-145 reduces neurite outgrowth in cultured DRG sensory neurons (Zhang et al., 2011). [score:1]
Of the seven miRs identified, miR-145 is consistently altered in two other sciatic nerve injury mo dels. [score:1]
In our dual injury mo del, the Tibial-SNI animals, but not the Sural-SNI animals, recovered from post-injury pain and showed an increase in miR-145. [score:1]
Following complete sciatic nerve transection, miR-145 is decreased in DRG (Zhang et al., 2011; Zhou et al., 2011) and nerve stump (Yu et al., 2012). [score:1]
Ct values were <30.60 for miR-133b, <27.78 for miR-145, <27.66 for miR-193b, <30.19 for miR-143, <33.69 for miR-335, <23.42 for miR-191, <37.89 for miR-130a, <36.00 for miR-325, <32.04 for miR-1. Reference miRs were: MammU6-4395470 (Ct values < 19.30), snoRNA135-4380912 (Ct values < 33.98), and U87-4386735 (Ct values < 28.32). [score:1]
[1 to 20 of 14 sentences]
15
[+] score: 29
Moreover, the microRNAs miR-103, miR-107, miR-133a, miR-145, mir146a and miR-98, which presented altered expression at 7 days after SCI in both Liu's study [6] and ours, demonstrated significant alterations in the expression of their targets, according to De Biase et al. [7]. [score:7]
For miR-146a and miR-145, no significant variations in expression were found, although there was a trend toward downregulation. [score:6]
Similarly, we analyzed proapoptotic miR-29c, which regulates p53 -mediated apoptosis [29], as well as miR-145 and miR-107, which belong to the group of 25 microRNAs whose targets were significantly enriched in the mRNA expression patterns following spinal cord injury reported by De Biase et al. (2005). [score:6]
Additionally, the overexpression of the mitochondrial superoxide dismutase 2 gene (sod2) 7 days after injury [73], [74] is consistent with the downregulation of its modulator miR-145 [75]. [score:6]
The expression level of miR-145 also showed a repression trend, although this was not significant (Figure 5). [score:3]
We validated the changes in the levels of the microRNAs miR-21, miR-223, miR-146a, miR-219-5p, miR-29c, miR-468, miR-145 and miR-107 using Q-PCR. [score:1]
[1 to 20 of 6 sentences]
16
[+] score: 28
Previous ex vivo studies using portal veins from Dicer knockout mice 22 and in vitro studies using A10 cells, a transformed rat aortic smooth muscle cell line, indicated the potential for miR-145 -dependent regulation of CaMKIIδ protein expression 23. [score:5]
We expect that miR-30, miR-145 and other miRs act collectively to regulate the VSM phenotype switch which involves changes in expression of hundreds of proteins. [score:4]
As expected, expression of miR-145, a well-known marker and regulator of the smooth muscle contractile phenotype 23 decreased dramatically following vascular injury and de-differentiation of VSM. [score:4]
miR-145 over -expression has also been shown to have a strong effect on VSM phenotype and neointima formation 23. [score:3]
Collectively, miR-30 family members are expressed at a level comparable to miR-145. [score:3]
Collectively, in differentiated carotid arteries (Fig. 1) and aorta (Fig. 2) miR-30 family members are expressed at levels comparable to miR-145 which is considered a high abundance microRNA associated with and regulating the differentiated VSM phenotype 23. [score:3]
The expressions of miR-30 family members and miR-145 were compared between injured and uninjured carotid arteries and U6 expression was measured and used for normalization. [score:2]
As positive controls, miR-145, SM-MHC, and SM-22α were all expressed at lower levels, and KLF4 at higher levels, in cultured VSM compared to fully differentiated aortic VSM. [score:2]
Upon vascular injury or culture of the VSM cells, total miR-30 levels decrease by approximately 75%, similar in magnitude to the decrease in miR-145 and coincident with the switch to a VSM cell synthetic phenotype. [score:1]
These magnitude changes are comparable to those previously observed in A10 cells using miR-145 23 and the partial effects in both studies could be due redundant effects of the miR-30 and miR-145 species. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 28
We also identified differential expression of a number of miRNAs which target histone modification enzymes; miR-145 suppresses histone deacetylase 2 (HDAC2) [51], miR-129 is predicted to target HDAC2 mRNA and miR-29 targets HDAC4 mRNA [52]. [score:11]
In general agreement with the array data, we observed a trend towards downregulation of miR-125-a-5p (p = 0.079, fold change −1.79) and miR-145 (p = 0.089, fold change −1.82) in methamphetamine self-administration rats (Figure  3a, n = 6 in each group). [score:4]
Of these, two (miR-9, adj p = 0.0228 and miR-145, adj p = 0.0298) that were identified as significantly enriched, were also significantly differentially-expressed in the miRNA microarray results. [score:3]
We identified 78 miRNA and 150 mRNA transcripts that were differentially expressed (fdr adjusted p < 0.05, absolute log2 fold change >0.5); these included genes not previously associated with addiction (miR-125a-5p, miR-145 and Foxa1), loci encoding receptors related to drug addiction behaviors and genes with previously recognized roles in addiction such as miR-124, miR-181a, DAT and Ret. [score:3]
MiRNA candidates were selected based on novelty and mRNA targeting (miR-125a-5p, miR-145). [score:3]
miR-9 has been linked to nicotine and ethanol exposure [44]; however, dysregulation of miR-145 has not previously been reported after administration of any drug of addiction. [score:2]
Validation experiments using qRTPCR showed a trend for miRNA-125a-5p and miR-145 in a consistent direction to the array data, however, this did not reach statistical significance. [score:2]
[1 to 20 of 7 sentences]
18
[+] score: 24
The underlying mechanism might be related to the modulation of 18 upregulated and 14 downregulated miRNAs, in particular, miR-20a, miR-145, miR-30, and miR-98. [score:7]
qRT-PCR showed that miR-145 and miR-20a expression was downregulated in the mo del group compared with their expression in the PQR group, which was consistent with the microarray results. [score:7]
Thus, involution was obtained by miChip analysis for four selected miRNAs that showed either high (miR-145) or low (miR-30) signal intensities, or high (miR-20a) or low (miRNA-98) differential expression values among the three groups. [score:3]
In our studies, the most frequently observed and the most promising miRNAs as potential treatment targets are miR-145 [11] and miR-208 [25]. [score:3]
Others have been linked to the regulation of vascular smooth muscle cells; these include miR-145, let-7d, miR-24, miR-26a, and miR-146 [13]. [score:2]
Interestingly, some studies [27– 29] have shown that miR-143 and miR-145 play an important role in switching the phenotypes of smooth muscle cells during vascular remo deling. [score:1]
Some miRNAs, including miR-1, miR-145, miR-122, miR-221, and miR-222, have been linked to vascular endothelial dysfunction [12]. [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 23
Among the three microRNAs (Shi et al., 2012; Xu et al., 2012, 2015) (miR-497-5p, miR-145-5p, miR-128-3p) previously reported to target p70s6k1 mRNA and inhibit its translation, only miR-128-3p was downregulated by TXL during I/R. [score:10]
MiR-145 directly targets p70S6K1 in cancer cells to inhibit tumor growth and angiogenesis. [score:5]
Because TXL was reported to decrease expression of microRNAs and increase levels of their corresponding proteins under certain conditions (Wang J. Y. et al., 2014; Zhang et al., 2014, 2017), we used quantitative PCR to examine levels of several microRNAs (Shi et al., 2012; Xu et al., 2012, 2015) (miR-497-5p, miR-145-5p, and miR-128-3p) known to target the mRNA of p70s6k1 in HCMs (Figure 6B). [score:5]
MicroRNAs (miR-497-5p, miR-145-5p, and miR-128-3p) were reverse transcribed using miScript II RT Kit (Qiagen, Valencia, CA, USA) and then quantified by quantitative real-time RT-PCR using the miScript SYBR green PCR kit (Qiagen). [score:1]
The miR-497-5p, miR-145-5p, and miR-128-3p levels were determined with the 2 [(−ΔΔCT)] relative quantification method, using U6 as an internal control. [score:1]
There were no significant differences in levels of the other two microRNAs, miR-497-5p and miR-145-5p, in these two groups. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 23
Interestingly, miR-223-3p, miR-760-5p and miR-145-5p, were also significantly up-regulated after correction for multiple testing (Fig.   2). [score:4]
Moreover, the present results demonstrated that miR-223, miR-760 and miR-145 may be up-regulated in NP and released in exosome-like vesicles (ELV) when the NP tissue is exposed to the dorsal nerve roots. [score:4]
** p < 0.0001 Fig.  2Fold expression of a miR-223, b miR-760 and c miR-145 in nucleus pulposus (NP) tissue frozen directly (native) or 180 min after NP application onto the dorsal nerve roots (exposed) after harvesting. [score:4]
Fig.  3Fold expression of a miR-223, b miR-760 and c miR-145 in cell-free medium frozen after nucleus pulposus (NP) incubation for 5 min or 3 h. Overall linear mixed mo del, beta = 0.65, **p < 0.001, 95% CI (0.28, 1.01), nanoparticle tracking analysis, western blot analysis and qPCR were used to demonstrate exosome-like vesicles (ELV) in the media conditioned for 3 h by NP. [score:3]
Previous data suggest that miR-145 may regulate immune cells [12], and that inflammatory responses in the intervertebral disc may be reduced by miR-146a [13]. [score:2]
Representative western blot showing alix, tsg101 and CD-9. d Examples of miR-223, miR-760 and miR-145 qPCR amplification plot in the exosome fraction. [score:1]
An increased release of small non-coding RNAs, including miR-223, miR-760 and miR-145, from NP in exosome-like vesicles was demonstrated. [score:1]
The serum analyses in patients demonstrated a significant decrease in IL-6 (Fig.   5b) and miR-223-3p (Fig.   5c) from inclusion to 12 months (paired Student’s t test, p = 0.005), which was not the case for miR-760-5p and miR-145-5p (data not shown). [score:1]
miR-223-3p, miR760-5p and miR-145-5p were also found in the media fraction (Fig.   3). [score:1]
Additional qPCR analysis of the ELV samples showed that miR-223-3p, miR760-5p and miR-145-5p were present in the exosome fraction (Fig.   4d). [score:1]
Wang CY Yang SH Tzeng SF MicroRNA-145 as one negative regulator of astrogliosisGlia. [score:1]
[1 to 20 of 11 sentences]
21
[+] score: 23
Among the identified miRNAs, miR-124-3p, -125b-5p, -135b-5p, and -199a-5p showed a gradual decrease in expression in either HRECs or RPE cells along with an increase in HG-treatment time, whereas miR-145-5p and -146a-5p exhibited opposite expression changes (downregulation in HRECs and upregulation in RPE cells) in response to HG exposure for increasing durations. [score:11]
Moreover, miR-145 and -146a were downregulated gradually in HG -treated HRECs, but were upregulated in RPE cells exposed to hyperglycemia and in DM rats. [score:7]
The expression of miR-124-3p, -125b-5p, -135b-5p, and -199a-5p decreased gradually along with an increase in HG-exposure time, whereas the expression of miR-145-5p and -146a-5p was elevated from day 1 to 7 (Figure 2(b)), with the levels of these two miRNAs on day 7 > 2.5-fold higher than those in the NG-exposed group. [score:5]
[1 to 20 of 3 sentences]
22
[+] score: 22
The expression was normalized to the housekeeping miR-145 and to the expression in the Control group (see and sections of the manuscript). [score:5]
The relative expression of each of these miRNAs was then normalized to miR-145, which was found to display a robust and stable expression within all experimental groups (CT ∼26, see Table S1). [score:5]
Effect of altered cardiac workload on heart weight and the expression of miR-145 and miR-21. [score:3]
All CT values were normalised to miR-145 by the equation: The relative expression (RQ) of each miRNA in the target groups (AS, HTX, Fetal) was calculated by the equation: The Control group consisted of the pooled data from Sham and Native hearts (see ). [score:3]
All CT values were normalised to miR-145 by the equation: The relative expression (RQ) of each miRNA in the target groups (AS, HTX, Fetal) was calculated by the equation: The Control group consisted of the pooled data from Sham and Native hearts (see ). [score:3]
All data were normalized to miR-145 and compared with expression levels observed in the Control hearts (Table S3). [score:2]
Figure S1 illustrates the ΔCT values (CT [sample]-CT [miR-145]). [score:1]
[1 to 20 of 7 sentences]
23
[+] score: 21
Comparing the miRNAs expression of LPS -treated rats with LPS + RvD1, a significant downregulation of the levels of miR-195-5p, miR-200a-3p (related to SIRT1 expression and activity), miR-145-5p (related to both SIRT1 and p53 regulation), and miR-34a-5p (candidate for p53 regulation) in ocular tissues of LPS + RvD1 1000 ng/kg treated rats compared to the LPS -treated group (P < 0.01 versus LPS group; Figure 6) was noted. [score:9]
These miRNAs are notoriously and inversely related to SIRT1 expression in tissues as, for example, 195-5p and miR-200a-3p relate to SIRT1 expression and activity, miR-145-5p relates to SIRT1 and p53 levels, and miR-34a-5p relates to p53 regulation [9– 11]. [score:6]
Interestingly, the protective action of intravitreal RvD1 was associated with an increased level of endogenous SIRT1 within the eye and a downregulated expression of miR-195-5p, miR-200a-3p, miR-34a-5p, and miR-145-5p. [score:6]
[1 to 20 of 3 sentences]
24
[+] score: 19
Finally, through GO and pathway analysis of putative targets of individual miRNA, it was identified that certain miRNAs, including let-7f, regulated target genes associated with drug metabolism; certain miRNAs, including miR-150, regulated target genes associated with the response to glucose stimulation; numerous miRNAs, including miR-145, regulated genes associated with cell proliferation and apoptosis; and numerous other miRNAs, including miR-194, regulated genes associated with the inflammatory response. [score:11]
Among the miRNAs, miR-214, miR-199a-5p, miR-150, miR-199a-3p, miR-351, miR-145, miR-764, miR-497 and miR-92b were upregulated, whilst miR-7a, miR-325-5p, miR-485, miR-708, miR-344-3p, let-7f, miR-26b, miR-129, miR-29c and let-7a were downregulated. [score:7]
These miRNAs include miR-214, miR-199a-5p, miR-150, miR-351, miR-145, miR-92b, miR-7a, miR-485, miR-708, let-7f, miR-26b, miR-129, miR-29c and let-7a. [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 19
Decreased expression of miRNA-145 has been suggested to increase protein synthesis of targets directly involved in signaling events that promote organism growth and development. [score:7]
d Toxicological functions predicted for transcript abundance in the experimentIn Fig.   7c, it reveals how decreased expression of microRNA-145 can lead to increased expression of pathways involving cell growth and proliferation. [score:5]
d Toxicological functions predicted for transcript abundance in the experiment In Fig.   7c, it reveals how decreased expression of microRNA-145 can lead to increased expression of pathways involving cell growth and proliferation. [score:5]
The top molecule (consistency score ≥ 10.453) suggested to play a role in differential regulation of pathways was microRNA-145 (Fig.   7c). [score:2]
[1 to 20 of 4 sentences]
26
[+] score: 17
To confirm the differential expression of miR-30a, miR-143, miR-191*, and miR-223 in SAH and sham animals as well as the lack of differential expression of miR-145, additional qPCR assays were performed. [score:4]
We also examined the regulation of miR-145 because of its relationship with miR-143 and because many studies have shown that the two often co-transcribe and are important in the phenotype of vascular smooth muscle cells [10, 21]. [score:2]
In a conditional Dicer knockout mouse, which do not have functional miRNAs, it was found that miRNAs are essential for vascular smooth muscle cell differentiation and function, a phenotype that can partially be rescued by miR-145, again pointing to its crucial role in vascular smooth muscle cells [32, 35]. [score:2]
This study suggests that an increase in miR-143 and in part miR-145 in the hours after SAH could play an important role in the early development of this pathology. [score:2]
However, we could not demonstrate any regulation of miR-145 in this study (Figure  2E). [score:2]
Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, et al. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. [score:2]
Rangrez AY, Massy ZA, Metzinger-Le Meuth V, Metzinger L. miR-143 and miR-145: molecular keys to switch the phenotype of vascular smooth muscle cells. [score:1]
Fold change over sham for miR-30a (A), miR-143 (B), miR-191* (C), miR-223 (D), and miR-145 (E) at 0 h, 1 h, 6 h, and 24 h post-SAH. [score:1]
miR-145, miR-221, and miR-222 were selected based on their relationship with miR-143 and miR-223, respectively. [score:1]
[1 to 20 of 9 sentences]
27
[+] score: 17
Other miRNAs from this paper: rno-mir-7a-1, rno-mir-7a-2, rno-mir-7b, rno-mir-27a, rno-mir-146a
For example, miR-7 inhibits the invasion and metastasis of cancer cells by regulating Egfr expression [24– 26]; miR-145 inhibits cell proliferation of lung adenocarcinoma by targeting Egfr [27], miR-146a suppresses tumor growth and progression by targeting Egfr in prostate cancer [28]; miR-27a regulates non-small lung cancer by targeting Egfr [29]. [score:17]
[1 to 20 of 1 sentences]
28
[+] score: 17
Althogether these studies strongly suggest that an up-regulation of most, if not all, members of the let-7 and miR-7 families and of the miR-132/212 cluster marks hypothalamus development while miR-9, miR-124a, miR-145 and miR-219 displayed nucleus-specific regulations of expression. [score:8]
Let-7b, miR-124a and miR-9 displayed no expression differences in MPN between P15 and P30 while let-7a, miR-7, miR-132, miR-145 and miR-219 displayed up-regulations. [score:6]
Our data established that miR-124, miR-145 and miR-219 are steadily expressed in ARC/ME from stages P4 to P28 (see Supplemental Table S4). [score:3]
[1 to 20 of 3 sentences]
29
[+] score: 17
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
From our top ten differentially expressed miRNAs at the early OP to mid OP stage transition, two miRNAs (miR-199a-5p and miR-145) show strong target bias towards C11Orf9. [score:5]
In addition, miR-145 also followed a similar expression pattern increasing during the first transition from OP1 to OP2, stable during OP2 to OP3 and then subsequently increasing from OP3 to OL. [score:3]
For instance, miR-145 and miR-199a-5p within our data showed similar expression patterns throughout differentiation and both contain conserved 8mer predicted seed pairings to multiple sites within the 3′-UTR of C11orf9. [score:3]
Similarly, the expression pattern of miR-145 at these stages conformed to the same trend as miR-199a-5p. [score:3]
Therefore, these data suggest that miR-199a-5p and miR-145 may be simultaneously regulating the human homolog of MRF. [score:2]
The key miRNAs discussed in this manuscript were validated by conducting real-time qRT-PCR for samples from the appropriate stages, including the following: miR-199a and miR-145 at the OP1, OP2, OP3, and OL stages; miR-214 at the OP1 and OP2 stages; miR-184 and miR-1183 at the GP and OP1 stages (Table 1 ). [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 16
Recently, miR-145 has been described to target Sox9 in chondrocytes [28, 29]. [score:3]
By assessing the miR-145 expression in the presence of IL-1β, there was no significant increased miR-145 level observed, and no time- or concentration -dependent manner in our experimental system (Figure S1 in Additional file 1). [score:3]
However, in the current study, we did not observe a negative correlation between the expression of miR-145 and Sox9 in the presence of IL-1β. [score:3]
miR-145 has been reported to target Sox9 in chondrocytes [28, 29]. [score:3]
Figure S1: Relative miR-145 expression levels at present of IL-1β in primary rat chondrocytes. [score:3]
The IL-1β treatment did not have any time- or concentration -dependent effects on miR-145 (Figure S1A and S1B in Additional file 1). [score:1]
[1 to 20 of 6 sentences]
31
[+] score: 14
Also the miR-145 and miR-130a that did not show the effect on the reporter fused to the short variant also did not modify luciferase activity of the reporter fused to the long variant, indicating that under these conditions, these miRNAs do not regulate Nurr1 expression. [score:4]
C. Effect of miR-145, miR-302d or miR-130a overexpression on Nurr1 3’UTR short. [score:3]
C. RT-PCR showing the expression of the long 3’UTR variant of Nurr1 mRNA in the developing mesencephalon D. Effect of different combination of miR-145, miR-302d and miR-130a on luciferase reporter fused to the long 3’UTR variant of Nurr1 mRNA. [score:3]
The intersection of these criteria resulted in 11 miRNAs (Fig 2A, grey numbers), from which we selected three with higher scores and non-redundant family: miR-145, miR-130a and miR-302d (Fig 2B). [score:1]
The precursor sequences of the miR-145, miR-302d, miR-130a, miR-204, miR-93, miR-17, miR-455, miR-212 and miR-30a were cloned on pEGP-CE vector, acquired from Cell Biolabs Inc (7758 Arjons Drive San Diego, CA 92126 USA). [score:1]
The seed sites of miRNAs selected for the short 3’UTR are: miR-145 in nucleotide 25, miR-302d in nucleotide 465, and miR-130a in nucleotide 606. [score:1]
Of the 11 candidate miRNAs, we choose, according to scores, miR-145, miR-302d and miR-103a for further experimentation. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 13
The current findings show that prenatal stress downregulates brain miR-145, as opposed to its upregulation in human blood cells in MS [29]. [score:7]
While miR-145 has a regulatory role in embryonic neuronal differentiation in rats [87], it is also differentially expressed in MS-afflicted human patients, thus providing a potential epigenetic marker of this condition [29]. [score:4]
Non-stress groups), as observed by microarray analyses, the following candidates were selected for verification by qRT-PCR analysis: miR-151, miR-145, miR-425 (all down) and miR-103, miR-323, miR-98 (up) (Figure 3C). [score:1]
The following miRNAs were analyzed (5′ to 3′): mirR-181 and miR-186 (dams); miR-103, miR-151, miR-323, miR-145, miR-425, miR-98 (newborns). [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 13
Of the 30 miRNAs they found upregulated in traumatic spinal cord injury, miR-223, miR-214, miR-20b-5p, miR-17, miR-146a, miR-199a-3p, miR-221-3p, miR-146b, and miR-145 were also upregulated in our study, and among the 16 downregulated miRNAs in traumatic spinal cord injury, miR-34a and miR-338 were also downregulated after ventral combined with dorsal root avulsion in our study. [score:13]
[1 to 20 of 1 sentences]
34
[+] score: 12
miR-100 targets AGO2, miR-199a-3p and miR-145 target ZEB2, miR-143 targets BCL2, and miR-199a-5p targets CDKN1B, which are 4 of 7 genes targeted by the rat miRNA signature in the present study. [score:11]
al, showed changes in miR-100, 199a-3p, 199a-5p, miR-143 and miR-145. [score:1]
[1 to 20 of 2 sentences]
35
[+] score: 12
MiR-145 indirectly down-regulates VEGF in cancer cells to inhibit tumor growth and angiogenesis by targeting p70S6K1, an upstream molecule of VEGF [21]. [score:8]
Recent studies also indicate that a panel of miRNAs (i. e., miR-10, miR-15b, miR-16, miR-20a, miR-20b, miR-27a, miR-126, miR-145, miR-195, miR-205, and miR-210) is involved in the regulation of VEGF expression in ECs and tumor cells [16]– [26]. [score:4]
[1 to 20 of 2 sentences]
36
[+] score: 11
Other miRNAs from this paper: rno-mir-21, rno-mir-132, rno-mir-214, rno-mir-222, rno-mir-223
For example, miR-21 promotes neurite outgrowth by directly down -regulating Sprouty2 expression; while miRNA-145 inhibites neurite outgrowth by inhibiting Robo2 expression. [score:11]
[1 to 20 of 1 sentences]
37
[+] score: 10
Other miRNAs from this paper: rno-mir-143
Rangrez et al. [25] showed that high Pi treatment causes down-regulation of miR-143 and miR-145 and concomitant up-regulation of their targets and synthetic/activated VSMC markers, such as Klf4 and Klf5. [score:9]
Additionally, miR-145 was identified as part of the specific miRNA profile of destabilized human plaques [26], a biomechanical failure of the plaque that may involve microcalcification [27]. [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 10
The majority of these progression -associated miRNAs, including miR-10a, miR10b, miR-124, miR-125b, miR-126, miR-145, were increasingly downregulated with increasing lesion severity, while 2 miRNAs, miR-21 and miR-200a, were upregulated with advancing tumor progression. [score:7]
The 8 miRNAs we found from our profiling (specifically, miR-10a, miR-10b, miR-21, miR-124, miR-125b, miR-126, miR-145, and miR-200a) each showed progressive changes in expression with advancing lesion grade. [score:3]
[1 to 20 of 2 sentences]
39
[+] score: 10
Our lab showed that knocking-down miR-145, a highly stroke -induced miRNA increases the expression of its down-stream target superoxide dismutase-2 with concomitant neuroprotection in rats subjected to transient MCAO [3]. [score:6]
A subsequent study showed that miR-145 also targets the anti-inflammatory cytokine IFN-β that is known to decrease infarction by attenuating the neutrophil and macrophage infiltration into the ischemic brain [24]. [score:3]
Hence, miR-145 induction seems to curtail the ability of the brain to mitigate oxidative stress and inflammation thus contributing to the post-ischemic brain death. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 10
Notably, we found miR-222, miR-291-3p, miR-183, miR-363-3p, miR-92, miR-19a and miR-145 as down-regulated miRNAs between E11 and E13 and whose expression was negatively correlated with the expression of their predicted targets. [score:10]
[1 to 20 of 1 sentences]
41
[+] score: 10
Both mir-1 and mir-145, whose expression is downregulated in prostate cancer, have been implicated as pro-differentiation factors by silencing the stem cell self-renewal and pluripotency program or inhibiting epithelial-mesenchymal transition (EMT), respectively [61], [62]. [score:8]
For example, many target genes of miRNAs let-7, mir-1, and mir-145 were hypermethylated in cells cultured under AR-inducing conditions for 3 days compared to 1 day (Table S6), suggesting a promoting role of these microRNAs in secretory differentiation of prostatic epithelial cells. [score:2]
[1 to 20 of 2 sentences]
42
[+] score: 8
Nevertheless the altered expression of miR-145 and miR-210 was not unique for the acute phase as we found them to be increased in recovery phase (Figure 3). [score:3]
Gan C. S. Wang C. W. Tan K. S. Circulatory microRNA-145 expression is increased in cerebral ischemiaGenet. [score:3]
We observed that circulating miR-145 and miR-210 were indeed significantly increased in stroke patients with strong AUC values of 0.90 and 1.0 respectively. [score:1]
Incidentally, miR-145 and miR-210 had been previously reported to be potential biomarkers for stroke diagnosis [18, 19]. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 7
For liver cancer, one recent study reported that miR-21, miR-31, miR-122, miR-221, miR-222 were significantly up-regulated in HCC tissues, whereas miR-145, miR-146a, miR-200c, and miR-223 were found to be down-regulated [15]. [score:7]
[1 to 20 of 1 sentences]
44
[+] score: 6
In a few cases, the Northern blot showed a higher expression in comparison with the microarray, including miRNA-195 in heart and miRNA-145 in kidney and spleen. [score:3]
Among the 12 selected miRNAs, two were lung-specific (miR-195 and miR-200c), one was kidney-specific (miR-10a), and three were co-expressed in the lung and heart (miR-126, miR-143 and miR-145) as determined by HSD, OSI and two-fold criteria. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 6
Recently, miRNA-144, 145, and 214 are identified to be down-regulated in primary neurons responding to sciatic nerve transection, and miR-145 inhibited neurite growth of dorsal root ganglia (DRG) neuron through Slit-Robo-srGAP signaling pathway [13]. [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
Inhibition of miR-145 and upregulation of miR-21 have neuroprotective effects [46], [48]. [score:6]
[1 to 20 of 1 sentences]
47
[+] score: 6
Moreover, application of miR145, which down-regulated its target protein KLF5, reduced IH as well 45. [score:6]
[1 to 20 of 1 sentences]
48
[+] score: 5
To select an effective micro RNA target for our glioma-specific oncolytic virus, we studied miR124, miR143 and miR145 expression profiles in a panel of different human tissues and found that the miRNA 124 level is significantly higher in human brain tissue (Figure 3A). [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 5
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-145, rno-mir-33, hsa-mir-33b
As shown in Fig. 2c, miR-33-3p expression was increased (x1.4-fold, p < 0.05), whereas the expression of miR-145-3p and 7-1-5p was reduced (x0.65-0.68-fold, p < 0.0001). [score:5]
[1 to 20 of 1 sentences]
50
[+] score: 5
In serum exosomes, a total of 962 targets of rno-miR-145-3p, rno-miR-181a-5p, rno-miR-21-5p, rno-miR-200a-5p, rno-miR- 375-3p, and rno-miR-1b were predicted by Target Scan, miRDB, and DIANA Tools. [score:5]
[1 to 20 of 1 sentences]
51
[+] score: 4
ERK1/2 regulation of miRNAs has been previously addressed as it modulated the expression of miR-133a in cardiac myocytes [25], and miR-145 in vascular smooth muscle cells [26]. [score:4]
[1 to 20 of 1 sentences]
52
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
MiR-145 and miR-365 were specifically expressed in DRG (Fig. 3a). [score:3]
Dorsal root ganglion let-7c, miR-17, miR-145, miR-150, miR-199a, miR-223, miR-365, miR-451. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 4
Furthermore, among these miRNAs, many were found to be involved in angiogenesis, including several with a regulatory function in cell proliferation, the expression of growth factors and extracellular proteolysis, such as miR-497, miR-98, miR-181a, miR-145, miR-29b and miR-27a 24– 29. [score:4]
[1 to 20 of 1 sentences]
54
[+] score: 4
Other miRNAs from this paper: hsa-mir-145
McLendon J. M. Joshi S. R. Sparks J. Matar M. Fewell J. G. Abe K. Oka M. McMurtry I. F. Gerthoffer W. T. Lipid nanoparticle delivery of a microRNA-145 inhibitor improves experimental pulmonary hypertensionJ. [score:3]
McLendon et al. reported that lipid nanoparticle delivery of an antisense oligonucleotide against microRNA-145 improved Sugen-hypoxia -induced PAH in rats [28]. [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 4
However miR-151*, miR-10a-5p, miR-205, miR-17-5p, miR-145 and miR-664 were up-regulated in the AcarH group (fold change>2, P<0.05, Table 2, Figure 4). [score:4]
[1 to 20 of 1 sentences]
56
[+] score: 4
In addition, compared to F0-N rats, stress in F0-S dams induced one miRNA (rno-miR-466b-1-3p) and suppressed the expression of three miRNAs (rno-miR-145-3p, rno-miR-24-1-5p and rno-miR-375) (all Ps <0.10). [score:4]
[1 to 20 of 1 sentences]
57
[+] score: 4
Expression of miR-145-5p was significantly increased in 2 months-rats compared to 7 days-rats (Fig.   1A). [score:2]
Interestingly, SOD2 is regulated by 5 of 13 miRNAs selected by IPA, i. e. mir-21-3p, miR-21-5p, miR-23a-3p, miR-145-5p and miR-222-3p (Fig.   1A). [score:2]
[1 to 20 of 2 sentences]
58
[+] score: 4
revealed that four miRNAs (miR-29b-3p, miR-145-5p, miR-24-2-5p, miR-665) were significantly regulated (P<0.05), three miRNAs (miR-21-3p, miR-466b-2-3p, miR-466d) tended to be significantly regulated (P<0.15), and one miRNA (miR-34a-5p) was not confirmed to be significantly regulated by qRT-PCR (Table 2 ). [score:4]
[1 to 20 of 1 sentences]
59
[+] score: 4
For example, miR-145 and miR-15a are down-regulated in GH and pituitary adenomas, respectively [23, 24]. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 3
B: microRNAs let-7i, let-7a, let-7c, miR-34a, miR-124, miR-145, and miR-143 were up regulated; miR-21 was down regulated 12 weeks post-irradiation vs. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Other miRNAs from this paper: hsa-mir-21, hsa-mir-145, rno-mir-21
miR-145 levels are reduced in the JCR:LA-cp obese-prone rat compared to the lean-prone metabolically normal animal, and when miR-145 levels are upregulated in the obese-prone animal, the result is complete restoration of coronary collateral growth (59). [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
Other miRNAs from this paper: rno-mir-29c-1, rno-mir-29c-2
They were able to show that miR145 expression was altered in type 1 diabetic patients with incipient diabetic nephropathy [27]. [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 3
7 miRNAs that met the criteria ofLog2 fold change>1 and P value<0.05 were represented in blue dots and shown in Table 3. Among them, miR-664, miR-141, miR-145, miR-148b_MM2, miR-200a showed higher expression in the caput while miR-327 and let-7c in the cauda. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
Intriguingly, a large number of cocaine-responsive miRNAs identified so far (miR-8 family, miR-145, miR-451) can putatively target genes implicated in addiction, including TrkB receptor, which transduces the actions of BDNF in brain and play a crucial role in activity -dependent synaptic plasticity. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
In an attempt to discover whether the guinea pig Abcb1 isoform 1’s 3′UTR contains MREs, the reverse complement of several human ABCB1-specific miRs validated to reduce ABCB1 mRNA expression and ABCB1 activity (miR223 [24], miR508-5p [25], bta-miR145 [26], miR381 and miR-495 [27]) were searched via BLAST alignment for extrapolation to guinea pig; however, none were found. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
The luciferase values were further normalized to the average luciferase value obtained after transfecting a panel of microRNAs not predicted to target the rat Arc 3′UTR (rno-miR-370, rno-miR-150, rno-miR-342, rno-miR-30b, rno-miR-105, rno-miR-145 and rno-miR-9). [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
Compared to the other 2 groups, 21 miRNAs are upregulated in 6-hour group as shown in the upper portion of Fig. 2, miR-9, miR-204, miR-335, miR-23a, miR-708, miR-146a, miR-325-5p, miR-106b, miR-143, miR-140, miR-376b-3p, miR-7a, miR-541, miR-185, miR-499, miR-127*, miR-320, miR-140*, miR-145*, miR-423*, miR-378. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 2
At 2 ppm, three miRNAs (miR-142-3p, miR-145 and miR-203) were significantly decreased. [score:1]
The most decreased miRNAs at 6 ppm FA were miR-145 and miR-142-3p (Rager et al. 2013). [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 2
Similar analysis of “late” group, including c-Maf, Ets1, N-Myc, Nfat5, and Nfib, yielded 10 miRNAs: miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351, with multiple connections. [score:1]
Ten miRNAs, miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 2
We previously described the miRNA profiles of muscle tissues and reported that the plasma concentration of miR-145 was increased in ischemic colitis [18]. [score:1]
Therefore, the absence of miR-145 and other muscle-specific miRNAs, that is, miR-133a and miR-133b, might clarify kidney injury. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 1
MiR-143 and miR-145 control odontoblast differentiation and dentin formation through KLF4 and OSX transcriptional factor signaling pathways [10]. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
Other miRNAs from this paper: rno-mir-143, rno-mir-490
So they suggested miR-145 and PAI-1 as clinically relevant biomarkers of the bladder cancer [34]. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
For miR-145-5p, −27a-3p, −29a-3p, −344b-3p, −369-5p, and −409a-5p that lay within miR gene clusters potentially transcribed as single RNA units, we noted that associated miRNAs displayed similar FCEs and padj-values. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
In fact, a single oncogene (miRNA-145) has been demonstrated to re-program primary cells to display a CSCs phenotype [24]. [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
These include rno-miR-195, rno-miR-125a-5p, rno-let-7a, rno-miR-16, rno-miR-30b-5p, rno-let-7c, rno-let-7b, rno-miR-125b-5p, rno-miR-221, rno-miR-222, rno-miR-26a, rno-miR-322, rno-miR-23a, rno-miR-191, rno-miR-30 family, rno-miR-21, rno-miR-126, rno-miR-23b, rno-miR-145 and rno-miR-494. [score:1]
[1 to 20 of 1 sentences]
77
[+] score: 1
It enhances bladder cancer cell migration and invasion in part though hsa-miR-145/ZEB1/2/FSCN1 pathway [42]. [score:1]
[1 to 20 of 1 sentences]
78
[+] score: 1
Seven out of 25 microRNAs (miR-367, miR-216b, miR-383, miR-692, miR-135b, miR-145*, miR-877, miR-434-5p and miR-337-5p), were already modulated after 2 weeks of DOX at 3 mg/kg/week (Table 1). [score:1]
[1 to 20 of 1 sentences]
79
[+] score: 1
Hypoxia modulates the undifferentiated phenotype of human renal inner medullary CD133 [+] progenitors through Oct4/miR-145 balance. [score:1]
[1 to 20 of 1 sentences]
80
[+] score: 1
A number of miRNAs, including miR-1 [15], miR-15b [16], miR-21 [17] and miR-145 [18], have been implicated in myocardial I/R injury due to their effects on key genes associated with apoptosis. [score:1]
[1 to 20 of 1 sentences]