sort by

107 publications mentioning rno-mir-146a (showing top 100)

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-146a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 444
We found that enhancive miR-146a could upregulate the expression of IL-1β and downregulate the expression of CFH, whereas reductive miR-146a could downregulate the expression of IL-1β and upregulate the expression of CFH, in hippocampi of chronic TLE rat mo dels. [score:21]
The results show that enhancive miR-146a can upregulate IL-1β levels in chronic TLE by downregulating CFH, and that upregulation of IL-1β plays an important feedback -regulating role in the expression of miR-146a and CFH. [score:13]
In summary, this study shows that enhancive miR-146a can upregulate the inflammatory factor IL-1β in chronic TLE by downregulating CFH, and that upregulation of IL-1β plays an important feedback -regulating role in the expression of miR-146a and CFH, forming a miR-146a–CFH–IL-1β loop circuit that initiates a cascade of inflammation and then leads to the perpetuate inflammation in TLE. [score:13]
These results showed that enhancive inflammatory factor IL-1β might play an important feedback -regulating role in upregulating expression of miR-146a and downregulating the expression of CFH in chronic TLE rats, in turn leading to the perpetuate inflammation in TLE. [score:12]
We found that enhancive miR-146a could upregulate the expression of IL-1β, whereas reductive miR-146a could downregulate the expression of IL-1β in the hippocampus, suggesting that miR-146a can regulate inflammation in chronic TLE. [score:12]
Additionally, enhancive IL-1β could feedback downregulate the expression of CFH, upregulate the expression of miR-146a and increase the abnormal wave forms in chronic TLE rat mo dels. [score:11]
Based on the above, we hypothesized that enhancive miR-146a can lead to an increase in IL-1β by downregulating CFH expression, and increased IL-1β can upregulate miR-146a expression further, forming the miR-146a–CFH–IL-1β loop circuit that initiates a cascade of inflammation and leads to the perpetuate inflammation in TLE. [score:11]
Meanwhile, the enhancive inflammatory factor IL-1β plays an important feedback role in upregulating the expression of miR-146a and downregulating the expression of CFH. [score:11]
Enhancive miR-146a could not upregulate expression of IL-1β after CFH gene knockdownAs shown in Fig.  8A, CFH expression was successfully knocked down by CFH-specific siRNA in U251 cells 24 h or 48 h after transfection. [score:10]
However, enhancive miR-146a could not upregulate the expression of IL-1β in U251 cells after CFH gene knockdown, which suggested that enhancive miR-146a might upregulate inflammatory factor levels through the CFH pathway. [score:10]
To explore whether enhancive miR-146a could upregulate the expression of IL-1β by downregulating CFH, U251 cells were transfected with miR-146a mimic after CFH gene knockdown. [score:10]
However, it was interesting that enhancive miR-146a did not upregulate the expression of IL-1β in U251 cells after CFH gene knockdown (P<0.01) (Fig.  8C), which suggested that enhancive miR-146a might upregulate inflammatory factor levels through the CFH pathway. [score:10]
miR-146a has been identified as a key regulator in the feedback system, and its expression was upregulated when induced by nuclear factor kappa B subunits through a myeloid differentiation factor 88 -dependent pathway, which in turn could downregulate the levels of interleukin-1 (IL-1) receptor -associated protein kinases-1 and -2 and tumor necrosis factor (TNF) receptor -associated factor 6, downstream of Toll-like and cytokine receptors, reducing the activity of this inflammatory pathway (Taganov et al., 2006; Hou et al., 2009). [score:10]
Our results show that enhancive miR-146a can upregulate the expression of IL-1β by downregulating CFH. [score:9]
The results revealed that an upregulation of miR-146a expression levels was accompanied by downregulation of CFH. [score:9]
These results showed that miR-146a agomir/antagomir can upregulate/downregulate miR-146a expression, respectively. [score:8]
Further studies showed that miR-146a can downregulate the expression of CFH (Lukiw et al., 2008; Hill et al., 2009; Pogue et al., 2009; Li et al., 2011; Lukiw, 2012; Lukiw et al., 2012a; He et al., 2016), and these effects were suppressed by incubation with an antisense oligonucleotide to miR-146a (Lukiw et al., 2008, 2012a). [score:8]
As shown in Fig.  S2, miR-146a expression was upregulated in the IL-1β group compared with the negative control group (P<0.01), indicating that increased inflammation could upregulate miR-146a levels in the hippocampi of chronic TLE rats. [score:8]
IL-1β expression was upregulated in the miR-146a agomir group compared with the miR-146a antagomir or control group, and downregulated in the miR-146a antagomir group compared with the miR-146a control group. [score:7]
CFH expression was downregulated in the miR-146a agomir group compared with the miR-146a antagomir or control group, and upregulated in the miR-146a antagomir group compared with the control group. [score:7]
After CFH gene knockdown in U251 cells, enhancive miR-146a did not upregulate the expression of IL-1β. [score:7]
Enhancive miR-146a could not upregulate expression of IL-1β after CFH gene knockdown. [score:7]
Previous cell experiments verified that increased IL-1β could upregulate miR-146a expression levels (Taganov et al., 2006; Nakasa et al., 2008; Iyer et al., 2012). [score:6]
One recent study found that CFH expression was significantly decreased at week 1 and 4 in TLE rats, and that downregulating miR-146a could increase CFH protein levels in the acute phase in TLE rats (He et al., 2016). [score:6]
In particular, Iyer et al. showed a significant upregulation of miR-146a in the astrocytoma cell line or cultured human astrocytes when exposed to IL-1β stimulation (Iyer et al., 2012); thus it is possible that expression of miR-146a in astrocytes could function in fine-tuning the inflammatory response triggered by IL-1β (Aronica et al., 2010). [score:6]
Furthermore, we determined the effect of miR-146a on CFH and found that enhancive miR-146a could downregulate the expression of CFH, similar to the findings in the AD field (Lukiw et al., 2008, 2012a; Hill et al., 2009; Pogue et al., 2009; Li et al., 2011; Lukiw, 2012). [score:6]
Omran et al. also speculated that the IL-1β–miR-146a loop circuit could be a new target for antiepileptic therapy, examining the dynamic expression of IL-1β and miR-146a in TLE rat mo dels (Omran et al., 2012). [score:5]
NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
A previous study showed that miR-146a can suppress CFH expression to contribute to the inflammatory pathology of AD (Lukiw et al., 2008). [score:5]
Bioinformatics analysis indicated that miR-146a had overlapping target recognition sites within the CFH mRNA 3′-untranslated region (3′-UTR; 5′-TTTAGTATTAA-3′) (Lukiw et al., 2012b; He et al., 2016). [score:5]
We found that miR-146a expression was upregulated in the agomir group compared with the antagomir or control group (P<0.01). [score:5]
As shown in Fig.  3A, IL-1β expression was upregulated in the miR-146a agomir group compared with the control group or miR-146a antagomir group (P<0.01), and was lower in the miR-146a antagomir group than in the control group (P<0.05). [score:5]
MicroRNA-146a feedback inhibits RIG-I -dependent Type I IFN production in macrophages by targeting TRAF6, IRAK1, and IRAK2. [score:4]
Previous studies showed that miR-146a was significantly upregulated in the hippocampi obtained from patients with TLE, as well as in experimental TLE rats (Aronica et al., 2010; Song et al., 2011; Hu et al., 2012; Omran et al., 2012; He et al., 2016). [score:4]
Hence, we speculated that miR-146a regulated inflammatory factor IL-1β expression by the CFH pathway in chronic TLE rats. [score:4]
Several studies found that miR-146a was associated with sustained inflammation by suppressing CFH in AD (Lukiw et al., 2008, 2012a; Hill et al., 2009; Pogue et al., 2009; Li et al., 2011; Lukiw, 2012), but it is not yet clear whether miR-146a can regulate inflammation via CFH in chronic TLE rats. [score:4]
These results were confirmed by WB (Fig.  4B,C), and indicated that miR-146a can regulate CFH expression levels in the hippocampi of chronic TLE rats. [score:4]
However, miR-146a expression was suppressed in the antagomir group compared with the control group (P<0.01) (Fig.  S1). [score:4]
miR-146a was significantly upregulated in the hippocampi obtained from patients with TLE, as well as in experimental TLE rats (Aronica et al., 2010; Song et al., 2011; Hu et al., 2012; Omran et al., 2012; He et al., 2016), suggesting the possible role of miR-146a in epileptogenesis. [score:4]
Fig. 8. Expression of IL-1β induced by miR-146a mimic in U251 cells after CFH gene knockdown. [score:4]
To determine the ability of inflammation to regulate the expression of miR-146a in the hippocampi of chronic TLE rats, the rats were injected with IL-1β at week  7 (chronic phase) post-SE. [score:4]
We found that enhancive miR-146a could increase the expression of IL-1β in U251 cells before CFH gene knockdown. [score:4]
Consequently, the miR-146a–CFH–IL-1β inflammatory loop circuit seems to provoke an amplification cascade of inflammation, and the upregulation of the upper or lower reaches of miR-146a/CFH/IL-1β levels is associated with further increases in inflammatory factors and hyperexcitability. [score:4]
IL-1β upregulated miR-146a in the hippocampi of chronic TLE rats. [score:4]
To determine the ability of miR-146a to regulate CFH expression in chronic TLE rat mo dels, the rats were injected with miR-146a agomir or miR-146a antagomir at week  7 (chronic phase) post-SE. [score:4]
Recently, one study group demonstrated that downregulating miR-146a can decrease seizure susceptibility in the acute phase in TLE rats (He et al., 2016). [score:4]
Differential expression of miRNA-146a-regulated inflammatory genes in human primary neural, astroglial and microglial cells. [score:4]
Characterization of an NF-kappaB-regulated, miRNA-146a -mediated down-regulation of complement factor H (CFH) in metal-sulfate-stressed human brain cells. [score:3]
Effects of miR-146a agomir/antagomir on IL-1β and CFH hippocampal expression in chronic TLE rat mo dels. [score:3]
Overall, this study provides evidence for how miR-146a modulates the inflammatory signaling occurring in TLE, and we detected, for the first time, that CFH expression was significantly decreased in the hippocampi of TLE patients. [score:3]
CFH expression was higher in the miR-146a antagomir group than in the control group (P<0.01). [score:3]
Therefore, modulation of the miR-146a–CFH–IL-1β loop circuit might be a novel therapeutic target for TLE. [score:3]
Expression of microRNA-146 in rheumatoid arthritis synovial tissue. [score:3]
Expression pattern of miR-146a, an inflammation -associated microRNA, in experimental and human temporal lobe epilepsy. [score:3]
Therefore, modulation of the miR-146a–CFH–IL-1β loop circuit could be a novel therapeutic target for TLE. [score:3]
Fig. 3. Effects of miR-146a agomir/antagomir on IL-1β hippocampal expression in chronic TLE rat mo dels. [score:3]
Fig. 4. Effects of miR-146a agomir/antagomir on CFH hippocampal expression in chronic TLE rat mo dels. [score:3]
Expression of CFH in the hippocampi of chronic TLE rats after injection with miR-146a agomir (n=10), miR-146a antagomir (n=10) or control (n=10). [score:3]
Furthermore, transfection with miR-146a mimic increased the expression of miR-146a in U251 cells (Fig.  8B). [score:3]
Several studies have verified that IL-1β represents a major pro-inflammatory cytokine that can promote the expression of miR-146a in cell experiments (Taganov et al., 2006; Nakasa et al., 2008; Iyer et al., 2012). [score:3]
Expression of IL-1β in the hippocampi of chronic TLE rats after injection with miR-146a agomir (n=10), miR-146a antagomir (n=10) or control (n=10). [score:3]
We found that the miR-146a mimic could increase the expression of IL-1β. [score:3]
Cells were harvested 24 h or 48 h after transfection with miR-146a mimic, and expression of miR-146a was detected by qRT-PCR. [score:3]
As shown in Fig.  4A, CFH expression was lower in the miR-146a agomir group than in the control group (P<0.05) or miR-146a antagomir group (P<0.01). [score:3]
miR-146a expression was markedly increased in the miR-146a mimic group compared with the control group. [score:2]
However, the mechanism of miR-146a regulating the epileptogenesis and progression of TLE is still unclear. [score:2]
In the present study, we investigated the expression and regulation of miR-146a, CFH and IL-1β, as well as the role of the miR-146a–CFH–IL-1β loop circuit, in perpetuate inflammation in a chronic TLE rat mo del. [score:2]
It is evident that most studies indicate that miR-146a is a key regulator of immune and inflammatory signaling and can be induced by pro-inflammatory cytokines (Taganov et al., 2006; Lukiw et al., 2008; Nakasa et al., 2008; Iyer et al., 2012). [score:2]
MicroRNA-146a (miR-146a) is a molecule that has been studied by many researchers, and might be involved in epileptogenesis by regulating the inflammatory response. [score:2]
Therefore, we wondered whether IL-1β could feedback regulate miR-146a and CFH in chronic TLE rats and then lead to the perpetuate inflammation. [score:2]
Brain-enriched miR-146a, as a post-transcriptional inflammation -associated miRNA, has been strongly implicated in the regulation of epileptogenesis (Aronica et al., 2010; Omran et al., 2012; He et al., 2016). [score:2]
miR-146a was detected using real-time quantitative PCR (qRT-PCR) analysis. [score:1]
After injection with miR-146a or IL-1β, rats were monitored by EEG for only 2 days as they were sacrificed 48 h later. [score:1]
Astrocytes are also a major source of IL-1β, miR-146a and CFH (Vezzani et al., 2008; Song et al., 2009; Aronica et al., 2010; Li et al., 2011). [score:1]
The EEG changes were obvious, but it was a drawback that there was no increase in convulsive motor seizures after miR-146a or IL-1β injection, possibly as a result of the small quantity of miR-146a or IL-1β and the short duration of monitoring. [score:1]
Taken together, the results showed that miR-146a had an important effect on inflammation in the hippocampi of chronic TLE rats. [score:1]
In the chronic TLE rat mo dels, rats were injected with miR-146a agomir, miR-146a antagomir or miR-146a control in the hippocampal region at week 7 (chronic phase) post-SE. [score:1]
Rats were injected with miR-146a agomir, miR-146a antagomir or control at week 7 (chronic phase) post-SE, and hippocampal tissues were collected 48 h later. [score:1]
Hence, we believe that the miR-146a–CFH–IL-1β loop circuit can lead to the perpetuate inflammation in TLE. [score:1]
For miR-146 and U6, 4.0 μg (tissue) or 2.0 μg (cell) of total RNA were reverse-transcribed into cDNA by polyA polymerase according to the manufacturer's instructions (All-in-one™ miRNA qRT-PCR Detection Kit, GeneCopoeia, USA). [score:1]
After we confirmed that the eligible rats entered the chronic phase by behavioral seizure observation and EEG, the rats were injected with a miR-146a agomir or miR-146a antagomir. [score:1]
Twenty-four hours post-transfection with CFH-specific siRNA, U251 cells were transfected with miR-146a mimic. [score:1]
Some recent studies have suggested the possible involvement of microRNA-146a (miR-146a) in the modulation of inflammatory signaling occurring in TLE. [score:1]
Moreover, the abnormal waves could be seen frequently and the average spectral power increased, similar to the effects caused by enhancive miR-146a in chronic TLE rats, which also indicated the enhancement of brain excitability. [score:1]
Details on the specific groups are as follows: ANN (n=6, U251 cells transfected with siRNA control and mimic control), ANM (n=6, U251 cells transfected with siRNA control and miR-146a mimic), ASN (n=6, U251 cells transfected with CFH-specific siRNA and mimic control) and ASM (n=6, U251 cells transfected with CFH-specific siRNA and miR-146a mimic). [score:1]
Therefore, we wanted to know whether miR-146a has an effect on behavioral seizures and EEG recordings in the chronic phase in TLE rats. [score:1]
Rats with seizures were randomly assigned to five groups at week 7: (1) the IL-1β control group (n=10, rats were injected with 1 μl 0.9% saline); (2) the IL-1β group (n=10, rats were injected with 1 μl 50 ng/μl IL-1β, three electrode-implanted rats); (3) the miR-146a group (n=10, rats were injected with 1 nmol miR-146a agomir, three electrode-implanted rats); (4) the miR-146a sponge group (n=10, rats were injected with 1 nmol miR-146a antagomir); and (5) the miR-146a control group (n=10, rats were injected with 1 nmol miR-146a control). [score:1]
We observed a marked increase in the average spectral power following injection of miR-146a agomir. [score:1]
Intranasal delivery of miR-146a mimics delayed seizure onset in the lithium-pilocarpine mouse mo del. [score:1]
Cells were transfected with miR-146a mimic 24 h after transfection with CFH-specific siRNA. [score:1]
Therefore, we investigated whether miR-146a can regulate inflammation by the CFH pathway, and whether IL-1β can feedback regulate miR-146a and CFH, forming an inflammation loop circuit that leads to the perpetuate inflammation in chronic TLE rats. [score:1]
Interestingly, IL-1β had a similar effect to miR-146a agomir on seizures in the chronic TLE rats. [score:1]
Meanwhile, enhancive miR-146a could increase the abnormal wave forms in the chronic TLE rat mo dels. [score:1]
However, whether enhancive miR-146a can promote inflammation in chronic TLE rats is still unclear. [score:1]
miR-146a increased the abnormal wave forms of chronic TLE rats. [score:1]
HSV-1 infection of human brain cells induces miRNA-146a and Alzheimer-type inflammatory signaling. [score:1]
To confirm the important role of miR-146a in seizures in chronic TLE rats, we injected rats with miR-146a agomir at week  7 (chronic phase) post-SE. [score:1]
To understand the effects of miR-146a on inflammation in chronic TLE rat mo dels, the rats were injected with miR-146a agomir or miR-146a antagomir at week  7 (chronic phase) post-SE. [score:1]
However, a recent study that delivered miR-146a mimic intranasally before pilocarpine injection to C57BL/6 mice found that it can improve seizure onset and hippocampal damage in the acute phase and even support an anti-inflammatory role for miR-146a (Tao et al., 2017). [score:1]
Interleukin-1β and microRNA-146a in an immature rat mo del and children with mesial temporal lobe epilepsy. [score:1]
Fig. 5. EEG recordings of chronic TLE rats after miR-146a agomir administration. [score:1]
MicroRNA-146a: a key regulator of astrocyte -mediated inflammatory response. [score:1]
The average spectral power increased after the miR-146a agomir injection (Fig.  5C). [score:1]
The open circles represent the average spectral power of all electrode-implanted miR-146a group rats (n=3) before injection with miR-146a agomir, and the gray circles indicate the average spectral power after injection. [score:1]
Thirty-six hours post-transfection with the miR-146a mimic, the cells were harvested for RNA isolation. [score:1]
Modulation of miR-146a/ complement factor H mediated inflammatory responses in a rat mo del of temporal lobe epilepsy. [score:1]
The miR-146a control is originated from Caenorhabditis elegans and has no homology with the rat genome, which is the contrast of miR-146a agomir or miR-146a antagomir. [score:1]
Furthermore, miR-146a and pro-inflammatory cytokine IL-1β are jointly increased in the chronic phase in TLE rats and TLE patients (Aronica et al., 2010; Omran et al., 2012), which suggests that miR-146a can promote inflammation in TLE. [score:1]
miR-146a was detected using qRT-PCR. [score:1]
We did not find an obvious increase in convulsive motor seizures following miR-146a agomir injection, but we did observe an obvious increase in the abnormal wave forms (Fig.  5A,B). [score:1]
miR-146a -mediated CFH deficits are conducive to excessive complement pathway activation associated with autoimmunity and a sustained inflammatory response. [score:1]
In the chronic phase of the epileptic mo del, 30-min samples of electrical activity were selected for further analysis at each of the following timepoints: 2 days before injection of IL-1β or miR-146a agomir, 1 day before injection of IL-1β or miR-146a agomir, 1 day after injection of IL-1β or miR-146a agomir, and 2 days after injection of IL-1β or miR-146a agomir. [score:1]
[1 to 20 of 112 sentences]
2
[+] score: 416
miR-146a upregulated VEGF expression and downregulated Smad4 expression in chondrocytes, while a miR-146a inhibitor acted in a converse manner. [score:13]
Knockdown of endogenous miR-146a with the inhibitor significantly suppressed the IL-1β upregulation of miR-146a expression (Figure 3A). [score:11]
Furthermore, we demonstrate that miR-146a upregulation in vivo is accompanied by downregulation of Smad4 and upregulation of VEGF in a surgically induced OA mo del of Sprague-Dawley rats. [score:10]
The induction of miR-146a expression in OA cartilage is thus correlated with the upregulation of VEGF and the downregulation of Smad4 in rat joints with surgically induced OA. [score:9]
Figure 3 miR-146a suppression impairs IL-1β downregulation of Smad4 and upregulation of vascular endothelial growth factor. [score:9]
IL-1β responsive miR-146a is overexpressed in an experimentally induced OA mo del, accompanied by upregulation of VEGF and downregulation of Smad4 in vivo. [score:9]
We demonstrate that VEGF expression is upregulated by induction of OA pathogenesis with joint instability, treatment of IL-1β, overexpression of miR-146a, or knockdown of Smad4. [score:9]
miR-146a is expressed in all layers of human articular cartilage, especially in the superficial zone, and its expression is upregulated in OA [7]. [score:8]
Interestingly, while the miR-146a inhibitor significantly affects the IL-1β regulation of Smad4 and VEGF, inhibition of miR-146a could not completely eliminate IL-1β-caused stimulation of VEGF and suppression of Smad4. [score:8]
Furthermore, induction of VEGF by IL-1β at least partially depends on upregulation of miR-146a; and its induction by miR-146a depends on Smad4 downregulation. [score:7]
Our results demonstrate for the first time that Smad4 is a direct target of miR-146a, and a critical mediator of miR-146a regulation of VEGF expression. [score:7]
Conversely, inhibiting miR-146a or overexpressing Smad4 reduces VEGF expression in chondrocytes. [score:7]
In this study we present evidence that miR-146a is upregulated in articular chondrocytes in response to IL-1β treatment in vitro and by destabilization of the knee joints in vivo, and that Smad4 is a direct target of miR-146a. [score:7]
We demonstrate that miR-146a inhibits chondrocyte response to TGF-β by suppressing transcriptional activity of a promoter harboring TGF-β responsive elements and by suppressing TGF-β induction of ERK activity. [score:7]
We find that the miR-146a inhibition of Smad4 results in upregulation of vascular endothelial growth factor (VEGF) and apoptosis of chondrocytes. [score:6]
miR-146a directly inhibits Smad4 expression through a seed site in the 3'-UTR of Smad4 mRNA. [score:6]
Mutation of the miR-146a binding site in the 3' UTR of Smad4 mRNA unequivocally identified Smad4 as a direct target of miR-146a for post-transcriptional regulation. [score:6]
To determine whether miR-146a inhibits Smad4 expression through this seed sequence, we constructed luciferase reporter plasmids harboring the wildtype 3' UTR and the mutant 3' UTR in which the putative miR-146a binding site is mutated (Figure 2G). [score:5]
Interestingly, the extent of miR-146a inhibition of Smad4 protein levels is more than the extent of miR-146a inhibition of Smad4 mRNA levels. [score:5]
Conversely, transfection of a miR-146a inhibitor stimulated Smad4 protein levels and inhibited VEGF protein levels in chondrocytes (Figure 2D). [score:5]
IL-1β treatment increases expression of miR-146a and VEGF and decreases Smad4 expression in chondrocytes. [score:5]
While the reporter activity of the wildtype 3' UTR is significantly inhibited by miR-146a, this inhibition is greatly reduced in the mutant 3' UTR (Figure 2H). [score:5]
miR-146a may contribute to OA pathogenesis by increasing VEGF levels and by impairing the TGF-β signaling pathway through targeted inhibition of Smad4 in cartilage. [score:5]
Co-regulation of miR-146a with Smad4 and VEGF in OA cartilage in vivoTo determine whether expression of miR-146a, Smad4 and VEGF is co-regulated in OA cartilage in vivo, we surgically induced OA through joint instability in Sprague-Dawley rats (Figure 7B, C). [score:5]
This indicates that miR-146a targets Smad4 through both mRNA degradation and translational repression. [score:5]
As shown in Figure 5A, overexpression of miR-146a led to a decrease in both basal and TGF-β1-stimulated activity of the p3TP-luciferase reporter, suggesting that miR-146a significantly inhibits TGF-β signaling transduction. [score:5]
While IL-1β treatment inhibited Smad4 mRNA levels, transfection of the miR-146a inhibitor markedly increased Smad4 mRNA despite the presence of IL-1β (Figure 3B). [score:5]
Overexpression of miR-146a inhibited Smad4 protein levels and stimulated VEGF protein levels (Figure 2A). [score:5]
To elucidate the role of miR-146a in mediating IL-1β signaling, we used a specific miR-146a hairpin inhibitor to block its expression. [score:5]
The expression of miR-146a was significantly upregulated in OA cartilage compared with normal cartilage (Figure 7A). [score:5]
To determine whether miR-146a regulates the expression of Smad4 and VEGF, we transfected miR-146a into primary chondrocytes. [score:4]
miR-146a is one of the first identified miRNAs upregulated in human OA cartilage. [score:4]
Similar to miR-146a, other miRNAs have been implicated in regulating TGF-β pathways by targeting Smads in chondrocytes. [score:4]
Smad4, a common mediator of the TGF-β pathway, is identified as a direct target of miR-146a by harboring a miR-146a binding sequence in the 3'-UTR region of its mRNA. [score:4]
IL-1β regulates Smad4 and VEGF expression through miR-146a. [score:4]
Furthermore, miR-146a is critical for IL-1β downregulation of Smad4 in chondrocytes. [score:4]
Furthermore, miR-146a upregulation of VEGF is mediated by Smad4. [score:4]
Smad4 is thus a direct target of miR-146a. [score:4]
Together, these findings suggest that dysregulation of miR-146a may contribute to OA pathogenesis by inhibiting Smad4, a key component in the anabolic TGF-β pathway, by stimulating VEGF in the angiogenesis, chondrocyte hypertrophy, and extracellular matrix degradation pathways, and by inducing chondrocyte death. [score:4]
Figure 1 IL-1β stimulates miR-146a and vascular endothelial growth factor along with downregulation of Smad4. [score:4]
Smad4 thus mediates upregulation of VEGF by miR-146a. [score:4]
To determine whether Smad4 mediates the upregulation of VEGF by miR-146a, RNA interference with Smad4 siRNA was performed in rat chondrocytes. [score:4]
miR-146a thus regulates the expression of Smad4 and VEGF in an opposite manner. [score:4]
Mutation of the binding sequence significantly relieved the inhibition of the Smad4 reporter activity by miR-146a. [score:4]
Knockdown of Smad4 increased VEGF protein levels (Figure 4B), while overexpression of Smad4 significantly reduced miR-146a stimulation of VEGF protein levels (Figure 4E). [score:4]
Upregulation of VEGF by miR-146a is mediated by Smad4. [score:4]
Knockdown of Smad4 by miR-146a may therefore inhibit ERK phosphorylation. [score:4]
In addition to miR-146a, other miRNAs may also play important roles in OA pathogenesis: miR-140, a cartilage-specific miRNA, regulates gene expression of ADAMTS-5 in chondrocytes [25]; and miR-140 [-/- ]mice display an OA-like phenotype [26]. [score:4]
To determine whether expression of miR-146a, Smad4 and VEGF is co-regulated in OA cartilage in vivo, we surgically induced OA through joint instability in Sprague-Dawley rats (Figure 7B, C). [score:4]
Figure 2 Smad4 is a direct target of miR-146a. [score:4]
Fourth, we have for the first time identified a direct molecular target of miR-146a in chondrocytes. [score:4]
We focused our study on miR-146a after it came up in our screening for IL-1β upregulated miRNAs in chondrocytes. [score:4]
Our data suggest that miR-146a regulates chondrocytes and OA pathogenesis by inhibiting Smad4, a pivotal mediator of the TGF-β signaling pathway. [score:4]
First, we demonstrate for the first time that miR-146a is upregulated by experimentally induced OA pathogenesis in a well-established OA animal mo del of Sprague-Dawley rats in vivo. [score:4]
miR-146a is thus involved in IL-1β regulation of Smad4 and VEGF expression. [score:4]
Stanczyk and colleagues reported that the expression of miR-146 is increased in rheumatoid arthritis synovial fibroblasts [30]. [score:3]
Since IL-1β stimulates apoptosis in chondrocytes [23] and the loss of cellularity is a hallmark of OA cartilage [24], we examined whether the expression of miR-146a affects chondrocyte apoptosis. [score:3]
While IL-1β treatment greatly increased the VEGF mRNA levels, the miR-146a inhibitor significantly reduced this increase (Figure 3C). [score:3]
We demonstrate that miR-146a may be involved in a novel signaling cascade critical for a series of IL-1β -induced pathologic features of OA including reduced cellular response to TGF-β, elevated VEGF expression, and increased chondrocyte apoptosis. [score:3]
Nakasa and colleagues reported increased miR-146a/b expression in synovial tissue from rheumatoid arthritis patients [31]. [score:3]
The induction of VEGF expression by miR-146a may affect angiogenesis and inflammation during OA pathogenesis. [score:3]
Using miRNA target prediction software [1], we identified a potential miR-146a binding sequence in the 3' UTR of Smad4 (Figure 2G). [score:3]
Ectopic expression of miR-146a led to a remarkable reduction of the luciferase activity of reporter with the wildtype 3' UTR but not that of the mutant reporter. [score:3]
We show that the expression levels of Smad4, a key transcription factor mediating the TGF-β family member signaling pathway, are inversely related to miR-146a levels both in vitro and in vivo. [score:3]
Primary chondrocytes from Sprague-Dawley rats were treated with IL-1β before the expression levels of miR-146a, Smad4 and vascular endothelial growth factor (VEGF) were quantified by real-time PCR and/or western blotting. [score:3]
IL-1β treatment of chondrocytes increased the expression levels of miR-146a and VEGF and decreased the levels of Smad4 in a time -dependent manner. [score:3]
miR-146a is one of the first identified miRNAs expressed differentially in osteoarthritis (OA) cartilage. [score:3]
Figure 7 miR-146a and Smad4 are expressed reciprocally in surgically induced osteoarthritis in rats. [score:3]
The expression of miR-146a/b was elevated after treatment with lipopolysaccharide and proinflammatory mediators [22]. [score:3]
The miR-146a expression plasmid was created as previously described [17]. [score:3]
Overexpression of miR-146a reduced the levels of phospho-ERK 1/2 at all time points (Figure 5B), whereas the total ERK levels remained relatively constant (Figure 5B). [score:3]
The aim of this study is to identify a molecular target of miR-146a, thereby elucidating its function in chondrocytes during OA pathogenesis. [score:3]
Overexpression of miR-146a in chondrocytes caused a significant increase of the percentage of TUNEL -positive cells (Figure 6), indicating that miR-146a takes part in mediating IL-1β -induced apoptosis in chondrocytes. [score:3]
Expression levels of miR-146a, Smad4, and vascular endothelial growth factor (VEGF) were monitored by quantitative real-time PCR and western blotting. [score:3]
Knockdown of miR-146a caused similar effects on the IL-1β regulation of Smad4 and VEGF protein levels as on their mRNA levels (Figure 3D). [score:3]
Chondrocytes were transfected with miR-146a inhibitors and treated with or without IL-1β for 24 hours. [score:3]
Expression of miR-146a led to a reduction of cellular responsiveness to TGF-β and an increase of apoptosis rate in chondrocytes. [score:3]
The induction of miR-146a expression in articular cartilage is thus caused by OA. [score:3]
Chondrocytes were treated with IL-1β for 24 hours in the presence or absence of the miR-146a inhibitor. [score:3]
Treatment of IL-1β rapidly induced miR-146a within 6 hours in primary rat chondrocytes, and its expression gradually increased over a 24-hour time course (Figure 1A), which is consistent with the microarray results. [score:3]
Our results provide deeper insights into the roles of miRNA in OA pathogenesis and raise the possibility that miR-146a may be a therapeutic target for the treatment of OA. [score:3]
This suggests that, in addition to miR-146a, other factors are involved in mediating IL-1β regulation of VEGF and Smad4. [score:2]
miR-146a operates as a negative regulator in innate immunity by affecting IL-1R -associated kinase-1 and TNF-receptor -associated factor 6. In human OA tissue samples, miR-146a may be involved in both proinflammatory cytokine response and modulation [7, 32]. [score:2]
Co-regulation of miR-146a with Smad4 and VEGF in OA cartilage in vivo. [score:2]
We provide several lines of evidence here to demonstrate that miR-146a may be an important regulator in OA. [score:2]
Lastly, our data indicate that at least some of the effects of miR-146a on OA pathogenesis may be exerted by VEGF. [score:1]
Because Smad4 is a common mediator of the TGF-β signaling pathway, we next addressed the question of whether miR-146a affects the cellular responses to TGF-β. [score:1]
Third, we demonstrate that miR-146a is induced by joint instability resulting from medial collateral ligament transection and medial meniscal tear of the knee joints in vivo. [score:1]
Briefly, the precursor sequence for miR-146a was amplified through PCR using genomic DNA as the template, and the PCR products were cloned into the pSuper vector (Oligoengine, Seattle, WA, USA). [score:1]
However, the exact etiological mechanism of miR-146a in OA pathogenesis is not clear. [score:1]
The observed effects of miR-146a are identical in chondrocytes at the freshly isolated and passage 1 stage. [score:1]
In parallel with the increase of miR-146a level, IL-1β treatment stimulated VEGF mRNA (Figure 1C) and protein levels (Figure 1D) in a time -dependent manner. [score:1]
However, it was not clear whether this is a coincidence or miR-146a plays a role in OA pathogenesis. [score:1]
miR-146a increases apoptosis in chondrocytes. [score:1]
It remains to be tested whether miR-146a is responsive to alteration of mechanical load in addition to proinflammatory cytokine. [score:1]
Chondrocytes were transfected with miR-146a mimics, and, after serum starvation, cells were treated with TGF-β1 (10 ng/ml) for the indicated periods. [score:1]
Figure 5 miR-146a attenuates the transforming growth factor-β signaling pathway. [score:1]
OA pathogenesis was surgically induced with joint instability in rats, evaluated by histopathological analysis with safranin O staining, and the expression levels of miR-146a, Smad4, and VEGF were quantified using real-time PCR and/or immunohistochemistry. [score:1]
The inductive factors for miR-146a may be more complex in vivo. [score:1]
The effect of miR-146a on cellular response to transforming growth factor (TGF)-β1 was quantified by a luciferase reporter harboring TGF-β1 responsive elements and by extracellular signal-regulated kinase assay. [score:1]
Of particular interest, miR-146a was chosen for further investigation because previous studies have revealed that miR-146a mediates inflammation response [22], and its expression is higher in OA cartilage than in normal cartilage [7]. [score:1]
The effect of miR-146a on apoptosis was quantified by the. [score:1]
C5.18 cells were co -transfected with miR-146a and p3TP-luciferase reporter plasmid (p3TP-lux, possessing TGF-β response elements) followed by treatment with TGF-β1 (10 ng/ml). [score:1]
miR-146a attenuates TGF-β signaling pathway. [score:1]
Figure 6 miR-146a leads to apoptosis in chondrocytes. [score:1]
C5.18 cells were co -transfected with miR-146a mimics (GenePharma, Shanghai, China) and p3TP-lux using DharmaFECT Duo transfection reagent (Dharmacon Inc. [score:1]
We demonstrate that miR-146a results in an increase of the apoptosis rate in articular chondrocytes. [score:1]
miR-146a is one of the first identified miRNAs associated with OA cartilage [7]. [score:1]
Second, we demonstrate that miR-146a is induced by IL-1β treatment of chondrocytes in a time -dependent manner in vitro. [score:1]
HEK293T cells were transfected with either pGL3 luciferase vector containing a fragment of Smad4 3' UTR harbouring binding sites for miR-146a, or the corresponding mutant constructs. [score:1]
Our observation and the previous literature suggest that the responsiveness to IL-1β and/or other inflammatory cytokines is a hallmark of miR-146a. [score:1]
[1 to 20 of 111 sentences]
3
[+] score: 335
Other miRNAs from this paper: rno-mir-125b-1, rno-mir-125b-2, rno-mir-134, rno-mir-155
The predicted targets of miR-146a CFH are down-regulated in the temporal lobe mo del ratsWe next performed bioinformatics analysis to identify the possible targets of miR-146a, including TargetScan 6.2, PicTar, DIANA-microT version 4.0 and miRanda-mirSVR (Supplementary Figure S1A). [score:10]
To confirm that the inhibitory effect of miR-146a on cfh 3′-UTR reporter expression was mediated specifically via predicted miR-146a target sites located in the cfh 3′-UTR, mutations were introduced in the seed sequences of both target sites in the reporter construct (Figure 5C). [score:10]
miR-146a inhibits CFH expression via predicted 3′-UTR target sitesA putative miR-146a target site in the cfh 3′-UTR were identified (Figure 5A). [score:9]
miR-146a inhibits CFH expression in human neuronal and glial cellsTo begin to dissect the role that miR-146a plays in the basal regulation of CFH protein expression, we examined whether miR-146a directly reduces endogenous CFH levels. [score:9]
miRNA-146a (miR-146a) has been demonstrated to respond to IL-1β and LPS stimulation, and down-regulates its target genes– TRAF6 and IL-1 receptor associated kinase 1 (IRAK-1), leading to inhibition of inflammatory response in monocytes, macrophages and astrocytes [20– 22]. [score:8]
First, miR-146a expression was up-regulated in a rat mo del of TLE, which resulted in significant decrease in CFH expression (Figures 1 and 2). [score:8]
To further validate the important role of miR-146a in TLE through down -regulating CFH expression, we suppressed CFH expression in rat hippocampus by stereotactic injection of LV shRNA (Figure 3B). [score:8]
Mutation of target site partially eliminated the inhibitory effect of miR-146a mimics on reporter expression (Figure 5C). [score:8]
Down -regulating miR-146a expression increases CFH protein level and reduces acute seizures in the temporal lobe mo del ratsTo determine if miR-146a has regulating effect for CFH expression and seizures, we treated rats by intracerebroventricularly injecting antagomir-146a into them. [score:7]
Furthermore, miR-146a mimics decreased CFH expression and neuronal and glial cells (Figure 4), and luciferase reporter assays demonstrated that miR-146a down-regulated Cfh mRNA expression via 3′-UTR pairing (Figure 5). [score:7]
Overexpression of miR-146a also suppresses CFH protein expression in human neural cells [10]. [score:7]
Therefore, miR-146a mediates its inhibitory effect on cfh 3′-UTR reporter expression by interacting with at least one of two predicted target sites in the cfh 3′-UTR. [score:7]
Figure 5 miR-146a inhibits CFH expression via predicted 3′-UTR target sites(A) Sequences of human cfh mRNA 3′-UTR and miR-146a. [score:7]
miR-146a inhibits CFH expression via predicted 3′-UTR target sites. [score:7]
In summary, our results demonstrate an up-regulation of miR-146a with prominent expression during epileptogenesis in a rat mo del of TLE. [score:6]
At 1 week post-SE, prominent up-regulation of miR-146a expression was detected within the hippocampal DG region (Figure 1A). [score:6]
To further confirm the regulating effect of miR-146a on CFH expression, we transfected miR-146a inhibitor into SH-SY5Y, THP-1 and U373 cells. [score:6]
The predicted targets of miR-146a CFH are down-regulated in the temporal lobe mo del rats. [score:6]
Figure 1 miR-146a was up-regulated in TLE mo del rats(A) In situ hybridization analysis of miR-146a expression in hippocampal tissue of control rats and after induction of SE. [score:6]
Taken together, these results suggested that exogenous miR-146a is likely to inhibit CFH expression via mRNA destabilization. [score:5]
Our current data showed that miR-146a could bind to the putative sequence on the 3′-UTR of cfh mRNA and inhibits both mRNA and protein expression for CFH. [score:5]
AD Alzheimer's disease CDS coding sequence CFH complement factor H CFI cofactor for factor I CSF cerebrospinal fluid DG dentate gyrus DMEM Dulbecco's modified Eagle's medium EEG electroencephalography GAPDH glyceraldehyde-3-phosphate dehydrogenase HRP horseradish peroxidase IL interleukin IRAK-1 IL-1 receptor associated kinase 1 KEGG kyoto encyclopedia of genes and genomes LPS lipopolysaccharide LV lentivirus miR-146a miRNA-146a MG microglia M-Per mammalian protein extraction reagent MS multiple sclerosis NC negative control PD Parkinson's disease PED periodic epileptiform discharge RCA regulator of complement activation RIN RNA integrity number RIPA radioimmunoprecipitation assay SE status epilepticus TLE temporal lobe epilepsy T-Per tissue protein extraction reagent TRAF TNF receptor associated factor WT wildtype INTRODUCTION. [score:5]
The sequence of miR-146a inhibitor was 5′-AA CCC AUG GAA UUC AGU UCU CA-3′ and miR–inhibitor–NC was 5′-UCU ACU CUU UCU AGG AGG UUG UGA-3′. [score:5]
miR-146a inhibited CFH expression in human neuronal and glial cell lines. [score:5]
Consistently, the overexpression of miR-146a in THP-1 cells obviously abrogated the expression of CFH protein (Figures 4E and 4F). [score:5]
miR-146a expression in TLE mo del rat hippocampus was antagonized using an antagomir that specifically and efficiently targets miR-146a. [score:5]
We next studied the inhibitory effect of miR-146a on CFH expression in human monocytic and astrocyte cells. [score:5]
To begin to dissect the role that miR-146a plays in the basal regulation of CFH protein expression, we examined whether miR-146a directly reduces endogenous CFH levels. [score:5]
miR-146a inhibits CFH expression in human neuronal and glial cells. [score:5]
An up-regulation of miR-146a has also been shown in human AD brain, suggesting that the misregulation of specific miRNAs could contribute to the inflammatory pathology observed in AD brain [10]. [score:5]
We next performed bioinformatics analysis to identify the possible targets of miR-146a, including TargetScan 6.2, PicTar, DIANA-microT version 4.0 and miRanda-mirSVR (Supplementary Figure S1A). [score:5]
Figure 4 miR-146a inhibited CFH expression in human neuronal and glial cell linesQuantitative RT-PCR (A) and immunoblot analysis (B and C) of the effect of transient transfection of miR-146a mimics on CFH mRNA and protein levels in SH-SY5Y cells; * P<0.05. [score:5]
The results presented in the present report provide evidence that up-regulation of miR-146a is the pathogenesis of CFH deficiency that drives inflammatory neurodegeneration. [score:4]
To determine if miR-146a has regulating effect for CFH expression and seizures, we treated rats by intracerebroventricularly injecting antagomir-146a into them. [score:4]
These in vivo and in vitro data suggest that miR-146a is a negative feedback regulator of neuroinflammation and epileptogenesis via targeting CFH. [score:4]
Our observations demonstrate that miR-146a recognizes an miRNA binding site in the CFH mRNA 3′-UTR that is conductive to down-regulation of CFH in vitro and in vivo. [score:4]
The CFH mRNA and protein levels were significantly enhanced following transfection with miR-146a inhibitor as compared with transfection with the NC miRNA inhibitor in SH-SY5Y, THP-1 and U373 cells (Supplementary Figure S1). [score:4]
Understanding the role of miR-146a epilepsy -associated pathologies may be relevant for the development of new therapeutic strategies whereby glial function is targeted. [score:4]
Cotransfection of the reporter construct along with miR-146a mimics resulted in significantly reduced Renilla activity relative to cotransfection with NC mimic or transfection of reporter construct alone (53% of NC mimics) suggesting an inhibitory regulatory interaction between miR-146a and the cfh 3′-UTR (Figure 5C). [score:4]
These data confirmed the negative regulation of miR-146a on CFH expression in glial cells. [score:4]
Down -regulating miR-146a expression increases CFH protein level and reduces acute seizures in the temporal lobe mo del rats. [score:4]
It is remarkable that several significantly up-regulated brain miRNAs– miR-125b, miR-146a and miR-155–may contribute to so many of the observed deficits in AD including increased glial cell proliferation, altered synaptogenesis, deficits in neurotrophism, altered cytokine signalling and non-homoeostatic activation of innate immunity and inflammatory signalling [60– 62]. [score:4]
miR-146a was up-regulated in TLE mo del rats. [score:4]
Finally, down -regulating miR-146a by intracerebroventricular injection of antagomir-146a enhanced the hippocampal expression of CFH and decreased seizure susceptibility in TLE mo del (Figure 6). [score:4]
Two predicted miR-146a target sites in the CFH 3′-UTR reporter construct were mutated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies). [score:4]
Injection of miR-146a antagomir markedly stimulated the down-regulation of hippocampal miR-146a levels in TLE mo del rats from 3 days to 7 days (Figure 6A). [score:4]
Therefore, endogenous CFH levels are inhibited significantly by miR-146a delivery in human SH-SY5Y cells (Figure 4A). [score:3]
To determine the temporal–spatial expression and cellular distribution of miR-146a, we performed in situ hybridization in tissue samples of control rats and rats that were killed at 1 week after SE. [score:3]
Furthermore, transfection of miR-146a mimic significantly decreased cfh mRNA and protein expression in cultured astrocytes and microglia cells. [score:3]
Taken together, these data indicated that miR-146a expression was enhanced significantly in the temporal lobe mo del rats. [score:3]
Effects of miR-146a on hippocampal expression of CFH and seizure susceptibility in vivo. [score:3]
RT-PCR result indicated that enhancing miR-146a expression had obvious effects on the mRNA level of Cfh in U373 cells (Figure 4G). [score:3]
A putative miR-146a target site in the cfh 3′-UTR were identified (Figure 5A). [score:3]
Figure 6Effects of miR-146a on hippocampal expression of CFH and seizure susceptibility in vivo(A) Rats were injected intracerebroventricularly with antagomir-146a or NC on TLE mo del. [score:3]
miR-146a expression was normalized to that of the U6B small nRNA gene (rnu6b). [score:3]
Increased levels of miR-146a were detected in the temporal lobe mo del ratsTo determine the temporal–spatial expression and cellular distribution of miR-146a, we performed in situ hybridization in tissue samples of control rats and rats that were killed at 1 week after SE. [score:3]
Given that CFH in the brain plays an important role in neuroinflammation of AD [10], and miR-146a is a key regulator of the inflammatory response [21, 22], we hypothesized that miR-146a may be involved in the pathogenesis of TLE via regulation of CFH in the brain. [score:3]
At 3 and 7 days following SE onset, rats were decapitated under deep anaesthesia and hippocampal tissue was quickly removed for detection of miR-146a and CFH expression. [score:3]
miR-146a expression was also studied using qPCR. [score:3]
Sequence comparison between the predicted miR-146a target sites in the human CFH 3′-UTR and orthologous sequences from multiple mammalian species revealed no sequence differences (Figure 5A). [score:3]
In the present study, we investigated the expression and regulation of miR-146a on CFH in neuronal and glia cells, as well as the role of miR-146a and CFH in epileptogenesis in a rat mo del. [score:2]
These mutant reporter constructs were then cotransfected along with miR-146a mimic into SH-SY5Y cells and reporter expression compared with wild-type reporter (Figure 5C). [score:2]
In the present study, we investigated the expression and regulation of miR-146a on CFH in neuronal and glia cells, as well as the role of miR-146a and CFH in epileptogenesis in a rat mo del of TLE. [score:2]
miR-146a expression in rat DG region was significantly increased in1 week (latent phase) and 4 weeks (chronic phase) post-SE, compared with non-SE values (Figure 1B). [score:2]
The result showed that the expression levels of Cfh mRNA were significantly decreased in THP-1 cells transfected with miR-146a compared with controls (Figure 4D). [score:2]
Notably, cfh mRNA expression cells were significantly reduced following transfection with miR-146a mimics as compared with transfection with the NC miRNA mimics. [score:2]
However, down -regulating miR-146a with antagomir-146a decreased seizure susceptibility in TLE mo del. [score:2]
However, how miR-146a is regulated in the experimental epilepsy rats and whether it contributes to epileptogenesis remain to be identified. [score:2]
miR-146a has been shown to critically modulate innate immunity through regulation of toll-like receptor (TLR) signalling and cytokine responses [22– 25]. [score:2]
SH-SY5Y cells were transfected with either NC or miR-146a mimics. [score:1]
Cells were seeded at ∼70% confluence in six-well plates and, 24 h later, transfected with 100 nM hsa- miR-146a or human negative control (NC) (RiboBio) using TurboFect according to manufacturer's instructions (Thermo Fisher Scientific). [score:1]
The genomic locus of miR-146a is situated at 5q34, comprising a CpG island-enriched promoter. [score:1]
In addition, it was reported that miR-146a was markedly increased in experimental TLE rats as well as in human epilepsy samples [26, 27], suggesting the possible role of miR-146a in epileptogenesis. [score:1]
To validate the functionality of the putative miR-146a– cfh 3′-UTR interaction, a reporter construct was prepared containing the full-length cfh 3′-UTR. [score:1]
Three days or seven days later, the rats were killed and hippocampal tissues were analysed for miR-146a levels by qRT-PCR. [score:1]
The sequence of miR-146a mimics was 5′-UGAGAACUGAAUUCCAUGGGUU-3′ and miR–NC was 5′-UUC UCC GAA CGU GUC ACG UTT-3′. [score:1]
Accumulating evidence shows that miR-146a is involved in the innate immune response. [score:1]
Increased levels of miR-146a were detected in the temporal lobe mo del rats. [score:1]
An miR-146a antagomir or an antagomir-NC (RiboBio) was dissolved in an artificial CSF at a concentration of 20 nmol/ml (1 nmol/50 μl for each rat) and infused at a very slow rate by microsyringe into the lateral ventricle of the TLE rats (n=17) as previously described [34]. [score:1]
Then, was performed to determine whether the formation of CFH protein was altered after miR-146a transfection. [score:1]
These results indicate that miR-146a may play a role in epileptogenesis through decreasing CFH in a rat mo del of TLE. [score:1]
[1 to 20 of 81 sentences]
4
[+] score: 331
Previous report has mentioned that Jimonji-domain containing 3 (JMJD3) is a direct target of miR-146a in human MSCs 39, to test whether this molecular interaction exists in rat ADSCs, we first screened for the potential target of miR-146a in bioinformatic platforms such as miRanda and TargetScan, the species difference has been taken into consideration that the predicted targets were limited to “Rattus norvegicus”, the results showed us that JMJD3 was not included in the list of potential target of miR-146a. [score:12]
However, with the consideration that miRNAs might have multiple targets in gene regulation 25, to verify whether the repressive function of miR-146a on ADSC osteogenic differentiation was mediated by its repression on SMAD4, we transduced miR-146a inhibitor into SMAD4-knockdown ADSCs, and our results showed that osteogenic markers were no longer elevated by knocking down miR-146a in ADSCs that had also had SMAD4 knocked down 37. [score:9]
To further test whether miR-146a had regulatory effects on JMJD3 expression in rat ADSCs, we performed qPCR and Western blot analysis, the results showed that neither the mRNA nor the protein expression levels of JMJD3 was affected by the up- or down-regulation of miR-146a (Supplementary Fig. S6). [score:9]
The lentiviral vector overexpressing miR-146a was termed Lenti-miR-146a, target sequence containing the stem-loop region was synthesized as shown in Table 1. The lentiviral vector to knockdown miR-146a was named Lenti-miR-146a inhibitor, synthesized sequence to complementarily binding to mature miR-146a was shown in Table 1. The empty vector was used as negative control and termed Lenti-miR-NC. [score:8]
As shown in Fig. 4A, SMAD4 protein expression was gradually decreased in ADSCs overexpressing miR-146a, while the treatment of Lenti-miR-146a inhibitor markedly increased SMAD4 expression when compared to the control. [score:8]
In contrast, the expression of these genes could still be up-regulated by the miR-146a inhibitor in si-NC transfected ADSCs. [score:8]
Our study demonstrated that knocking down miR-146a significantly promoted SMAD4 expression, this might greatly enhance the transcriptional activity of the SMAD protein complex and subsequently lead to an amplified cascade of expression of downstream osteogenic specific genes, making ADSCs more “sensitive” to commit osteogenesis under the induction of surrounding BMP2, which partly explained the improved reparative effects of miR-146a-knockdown ADSCs. [score:7]
As shown in Fig. 3C and D, the overexpression of miR-146a significantly repressed the expression of Osterix (33.09 ± 5.76%) and Runx2 (25.69 ± 4.62%) (p < 0.05), while the knockdown of miR-146a increased the expression of Osterix (65.16 ± 5.53%) and Runx2 (61.35 ± 5.98%) (p < 0.05) when compared to the control group [Osterix (49.97 ± 7.27%), Runx2 (40.35 ± 5.27%)]. [score:7]
As shown in Fig. 4D, luciferase analyses showed that the co-transfection of miR-146a overexpression plasmid (miR-146a) and the wild type 3′-UTR binding site plasmid (wt-SMAD4-3′-UTR) significantly suppressed luciferase expression in comparison to negative control plasmid (miR-NC). [score:7]
Our data showed that the mRNA levels of SMAD4 were not affected by up- or down-regulation of miR-146a, but the protein levels were negatively regulated by miR-146a, which suggested that SMAD4 expression might be repressed by miR-146a at a post-transcriptional level 31 33. [score:7]
In addition, both ALP and ARS staining indicated that ALP activity and extracellular matrix calcium deposition were attenuated in SMAD4-knockdown ADSCs and could no longer be elevated by miR-146a inhibitor, but both were promoted by miR-146a inhibitor in si-NC transfected ADSCs (Fig. 5C). [score:6]
These data suggested a potential molecular mechanism responsible for the down-regulation of miR-146a in BMP2 -treated ADSCs, that BMP2 interacted with STAT3 signaling pathway and subsequently decreased miR-146a expression. [score:6]
Expression levels of important osteogenic markers were significantly elevated by the knockdown of intracellular miR-146a, together with extracellular matrix calcification enhanced; in contrast, the overexpression of miR-146a led to the opposite effects. [score:6]
Our data indicated miR-146a might negatively regulate SMAD4 expression by specifically binding to SMAD4 3′-UTR and interfering with protein translation 50. [score:6]
To further explore how BMP2 lead to the down-regulation of miR-146a in ADSCs, western blot was performed and showed that the signal transducer and activator of transcription 3 (STAT3) was inactivated after BMP2 treatment in a time dependent manner, and qPCR results showed the expression level of miR-146a decreased gradually following BMP2 treatment (Supplementary Fig. S1B and C). [score:6]
Furthermore, western blot analyses revealed similar patterns that the protein expression of Osterix, Runx2 and OPN were attenuated in SMAD4-knockdown ADSCs and could not be promoted by the transduction of miR-146a inhibitor (Fig. 5B). [score:6]
Collectively, our data indicated that BMP2 led to a cohort of differentially expressed miRNAs in ADSCs and miR-146a down-regulation was mediated by the inactivation of STAT3. [score:6]
Previous study has indicated that BMP2 induces apoptosis of myeloma cells through the modulation of signal transducer and activator of transcription 3 (STAT3), which is a key factor in mediating immune suppression in tumor microenvironment and responsible for the transcription of several important miRNAs, and the phosphorylated-STAT3 could directly bind to the promoter region of miR-146a and transcriptionally activate its expression 42 43. [score:6]
The knockdown of miR-146a promoted the osteogenic differentiation of ADSCs by elevating pivotal osteogenic marker genes expression, while the overexpression of miR-146a repressed them. [score:6]
In summary, our data demonstrated that 57 miRNAs differentially expressed during BMP2 -induced osteogenesis in ADSCs, among which miR-146a was the most significantly down-regulated miRNA. [score:6]
[#]Represents significant differences between the Lenti-miR-146a and Lenti-miR-NC groups; *represents significant differences between the Lenti-miR-146a inhibitor and Lenti-miR-NC groups; [&]represents significant differences between the Lenti-miR-146a, Lenti-miR-146a inhibitor, Lenti-miR-NC and the control groups. [score:5]
[#]Significant differences between the Lenti-miR-146a and Lenti-miR-NC groups; *significant differences between the Lenti-miR-146a inhibitor and Lenti-miR-NC groups; [&]represents significant differences between the Lenti-miR-146a, Lenti-miR-146a inhibitor, Lenti-miR-NC and control groups. [score:5]
Next, western blot analyses agreed with qPCR results that OPN, Runx2 and Osterix were greatly suppressed in ADSCs transduced with miR-146a at both 7 and 14 days, whereas their expression were significantly increased following the knockdown of miR-146a in ADSCs when compared to the control (Fig. 3A). [score:5]
Then, a STAT3 inhibitor further repressed miR-146a expression in ADSCs by the inactivation of STAT3. [score:5]
Taken together, our data suggested that the 385-392 position of SMAD4 3′-UTR is a direct binding site of miR-146a, and miR-146a negatively regulates SMAD4 expression through interacting with 3′-UTR of SMAD4 mRNA. [score:5]
The expression levels of SMAD4, Runx2 and Osterix in Lenti-miR-146a, Lenti-miR-146a inhibitor, Lenti-miR-NC and control groups. [score:5]
As shown in Fig. 5A, the mRNA expression levels of osteogenic related genes, such as BSP, OPN, Osterix and Runx2 in si-SMAD4 transfected ADSCs were repressed compared to si-NC transfected ADSCs, and these genes could no longer be promoted by Lenti-miR-146a inhibitor. [score:4]
To test the relationship between miR-146a and SMAD4, we used a loss-of-function approach in which ADSCs were co -transfected the miR-146a inhibitor, which promotes ADSC osteogenesis, in SMAD4-knockdown ADSCs. [score:4]
Taken together, these results indicate that the knockdown of SMAD4 attenuates the effects of miR-146a inhibitor on the osteogenesis of ADSCs. [score:4]
Above all, these morphological analyses exhibited that the treatment of miR-146a repressed bone regeneration, whereas the treatment of miR-146a inhibitor significantly enhanced this process, suggesting that miR-146a negatively regulated ADSC -mediated bone formation in vivo. [score:4]
In our study, miR-146a was the most significantly down-regulated miRNAs in ADSCs during BMP2 -induced osteogenesis. [score:4]
As shown in Fig. 5D and E, semi-quantitative analysis of both ALP and ARS revealed that the knockdown of SMAD4 not only repressed ALP activity and ECM calcification, but also attenuated the effects of miR-146a inhibitor. [score:4]
The expression of bone marker proteins is negatively regulated by miR-146a. [score:4]
The knockdown of SMAD4 attenuates the effects of the Lenti-miR-146a inhibitor. [score:4]
qPCR, western blot, ALP and ARS staining analyses were conducted to determine the effects of the miR-146a inhibitor in ADSCs with SMAD4 knocked down. [score:4]
On days 7 and 14 after gene transduction, ALP staining and quantitative analyses showed that ALP activity in miR-146a overexpressed ADSCs was dramatically attenuated, while greatly enhanced in miR-146a knockdown ADSCs in comparison to the control (Fig. 2B and C). [score:4]
These data suggested that miR-146a negatively regulates the SMAD4 expression at the post-transcriptional, not the transcriptional level. [score:4]
SMAD4 knockdown attenuates the effects of the Lenti-miR-146a inhibitor. [score:4]
Next, a luciferase activity assay was conducted to show that miR-146a repressed luciferase expression in wt-SMAD4-3′UTR plasmid transfected cells, in addition, mutagenesis of the predicted binding site abolished the inhibitory effects of miR-146a. [score:4]
SMAD4 has been shown to be a key molecule in the mediation of BMP2 -induced osteoblast differentiation 32 49, previous study has revealed that miR-146a is involved in the regulation of chondrocyte apoptosis by targeting SMAD4 in primary rat chondrocytes. [score:4]
As for the mRNA level of SMAD4, our qPCR results showed that neither overexpressing nor knockdown of miR-146a had significant impacts on SMAD4 mRNA level (Fig. 4B). [score:4]
Meanwhile, bioformatic prediction showed that SMAD4 might be one of miR-146a’s potential targets, to investigate whether miR-146a regulates SMAD4 expression, ADSCs were individually assigned to three lentiviral treatments and then subjected to qPCR and western blot analyses. [score:4]
These data suggested that the inactivation of STAT3 might contribute to the down-regulation of miR-146a. [score:4]
To test the role of STAT3 in regulating miR-146a, ADSCs were treated with a specific STAT3 inhibitor (WP1066) and qPCR results showed that intracellular miR-146a level was decreased after the inactivation of STAT3 when compared to the control (Supplementary Fig. S1D). [score:3]
N) and bone mineral density (BMD) in the regenerated bone tissues; whereas the overexpression of miR-146a attenuated bone regeneration. [score:3]
[#]Represents significant differences between the Lenti-miR-146a and Lenti-miR-NC groups; *represents significant differences between the Lenti-miR-146a inhibitor and Lenti-miR-NC groups. [score:3]
Twenty-four SD rats (female, 6–8 weeks old) were divided randomly into four groups: (A) PSeD scaffold loaded with miR-146a transduced ADSCs; (B) PSeD scaffold loaded with miR-146a inhibitor transduced ADSCs; (C) PSeD scaffold loaded with miR-NC transduced ADSCs; (D) PSeD scaffold alone as the negative control. [score:3]
A significantly repression on pivotal osteogenic genes such as OPN, Runx2, BSP, Osterix were observed following miR-146a transduction; whereas in ADSCs transduced with miR-146a inhibitor, they were markedly increased on day 7 and continuously elevated on day 14 (Fig. 2A). [score:3]
As shown in Fig. 8B, the ratios of SMAD4-, Runx2- and Osterix -positive cell in the miR-146a treated group (13.89 ± 2.83%, 8.94 ± 1.64%, 9.46 ± 2.62%) were lower than miR-NC group (20.65 ± 2.62%, 14.74 ± 1.58%, 16.99 ± 2.11%) (p < 0.05), but these ratios in miR-146a inhibitor treated group were much higher in comparison to miR-NC treated group (p < 0.05). [score:3]
Predicted targets of rno-miR-146a were identified using miRanda (www. [score:3]
Expression profile of miRNAs in primary ADSCs and ADSCs treated with BMP2 for 48 hours as determined by microarray analysis (n = 3), miR-146a is highlighted by the red box. [score:3]
To explore whether this molecular interaction contributed to ADSC -mediated bone regeneration, immunohistochemical staining was performed and showed that SMAD4 expression was also negatively affected by miR-146a in newly formed bone. [score:3]
[#]Represents significant differences between the Lenti-miR-146a and Lenti-miR-NC groups; *represents significant differences between the Lenti-miR-146a inhibitor and Lenti-miR-NC groups; [#]P < 0.05, [##]P < 0.01, [###]P < 0.001; *P < 0.05, **P < 0.01, ***P < 0.001. [score:3]
The amount of regenerated bone in the control group was markedly smaller than the other three groups, there was less regenerated bone in miR-146a treated group, while much more regenerated bone tissue in miR-146a inhibitor treated group in comparison to miR-NC group. [score:3]
Our study provides preliminary results highlighting the prospective application of miR-146a in treating bone related diseases. [score:3]
To verify this predicted binding site, a dual luciferase reporter system was constructed and co -transfected with the miR-146a overexpression plasmid. [score:3]
Our results showed that the treatment of miR-146a inhibitor markedly improved the repair of calvarial defect, with significantly elevated bone volume fraction (BV/TV), trabecular number (Tb. [score:3]
Considering the diversification of miRNA regulation in different species 47 48, we tested whether miR-146a had regulatory effects on JMJD3 in rat ADSCs. [score:3]
Collectively, our in vitro and in vivo results suggested that the osteogenic differentiation of ADSCs was negatively regulated by miR-146a, and the knockdown of miR-146a greatly enhanced ADSCs -mediated bone regeneration. [score:3]
Among these differentially expressed miRNAs, we selected miR-146a because it was the most significantly changed miRNA during BMP2 -induced osteogenesis (Fig. 1). [score:3]
To verify our hypothesis, we examined the expression of SMAD4 in miR-146a transduced cells. [score:3]
Constructed reporter vectors were co -transfected with pRL-TK vector (Promega) and miR-146a overexpression plasmid or its control plasmid using X-tremeGENE transfection reagent (F. Hoffmann-La Roche Ltd, Basel, Switzerland) into 293 T cells. [score:3]
Previous report has made the link between miR-146a and the osteogenesis through negatively regulating JMJD3 in human MSCs 39. [score:2]
N and BMD were detected in miR-146a inhibitor treated group (49.8 ± 5.49%, 0.4094 ± 0.0687, 0.01581 ± 0.00299 g/cc) as compared to the miR-NC group (36.35 ± 6.28%, 0.3029 ± 0.0524, 0.01116 ± 0.0033 g/cc) (p < 0.05); whereas these parameters in miR-146a treated group (23.73 ± 5.47%, 0.1379 ± 0.0409, 0.00743 ± 0.0017 g/cc) were markedly lower (p < 0.05). [score:2]
SMAD4 is negatively regulated by miR-146a. [score:2]
Our results suggested that miR-146a negatively regulated the osteogenesis of ADSCs in vitro. [score:2]
These data suggested that miR-146a regulates bone formation by ADSCs in vivo through affecting SMAD4 and its downstream genes including Runx2 and Osterix. [score:2]
To address whether miR-146a regulate the osteoblast differentiation of ADSCs, three lentiviral systems were individually transduced. [score:2]
Collectively, these results indicated that miR-146a negatively regulates the osteogenesis of ADSCs. [score:2]
Our results showed that neither the mRNA nor the protein expression levels of JMJD3 was affected by miR-146a, suggesting that miR-146a might regulate the osteogenesis of rat ADSCs in a JMJD3-independent way, and the underlying mechanism requires further investigation. [score:2]
Then, the effects of miR-146a on ADSC osteogenic differentiation was further investigated by overexpression and knockdown experiments. [score:2]
MiR-146a regulates bone formation in vivoTo test the effectiveness of miR-146a -modified ADSCs in inducing in vivo bone formation, four groups cell-scaffold composites were constructed to repair rat calvarial critical-sized defect by seeding lentiviral -modified ADSCs onto porous poly(sebacoyl diglyceride) (PSeD) scaffolds. [score:2]
Thus, these results suggested that miR-146a regulated ADSC osteogenic differentiation through affecting SMAD4 in vitro. [score:2]
As shown in Fig. 7B, fluorochrome -labelled areas (tetracycline, calcein, alizarin red) in miR-146a treated group (18.85 ± 6.39 mm [2], 34.22 ± 12.23 mm [2], 31.1 ± 11.02 mm [2]) were respectively smaller than those observed in miR-NC group (62.58 ± 5.73 mm [2], 76.83 ± 9.52 mm [2], 65.18 ± 6.04 mm [2]), while they were markedly larger in miR-146a inhibitor treated group (92.38 ± 16.69 mm [2], 115.32 ± 11.87 mm [2], 90.93 ± 9.95 mm [2]) as compared with miR-NC group. [score:2]
MiR-146a post-transcriptionally regulated SMAD4, a key co-activator in the transduction of BMP2 signaling into the nucleus, through interacting with the 3′-UTR within SMAD4′s mRNA. [score:1]
How to cite this article: Xie, Q. et al. Effects of miR-146a on the osteogenesis of adipose-derived mesenchymal stem cells and bone regeneration. [score:1]
The incorporation of PSeD scaffold and miR-146a modified ADSCs holds great potential in developing new strategy for bone defects. [score:1]
In our study, both the phosphorylated-STAT3 and miR-146a levels were gradually decreased in BMP2 -treated ADSCs, indicating that the inactivation of STAT3 by BMP2 might contribute to the repression on miR-146a. [score:1]
The emission of green fluorescent protein (GFP) was observed by fluorescence microscopy (Supplementary Fig. S1E) 72 hours after the transduction, the efficiencies of lentiviral transduction of Lenti-miR-146a, Lenti-miR-146a inhibitor and Lenti-miR-NC, which were calculated from the proportion of GFP -positive ADSCs to total cells, were all greater than 80%. [score:1]
MiR-146a regulates bone formation in vivo. [score:1]
MiR-146a negatively regulates ADSC osteogenesis. [score:1]
To test the effectiveness of miR-146a -modified ADSCs in inducing in vivo bone formation, four groups cell-scaffold composites were constructed to repair rat calvarial critical-sized defect by seeding lentiviral -modified ADSCs onto porous poly(sebacoyl diglyceride) (PSeD) scaffolds. [score:1]
However, miR-146a appeared to have no effect on luciferase level when co -transfected with the mutant 3′-UTR binding site (mut-SMAD4-3′-UTR). [score:1]
To determine the molecular basis of miR-146a’s repression on SMAD4, we again used in silico approaches to identify putative binding site of miR-146a. [score:1]
[1 to 20 of 84 sentences]
5
[+] score: 293
Other miRNAs from this paper: rno-mir-346, rno-mir-192, rno-mir-146b
As shown in Figure 3, the protein and mRNA expressions of TLR4 and NF-κB decreased in the miR-146a mimic and the Tak-242 groups, while mRNA and protein expressions of TLR4 and NF-κB increased in the miR-146a inhibitor and the TLR4 groups, and the mRNA and protein expressions of TLR4 and NF-κB in the TLR4 group were significantly higher than those in the miR-146a inhibitor group (all P < 0.05). [score:11]
These data suggested that miR-146a suppressed the inflammatory response and down-regulated the expression of proliferation-related molecules in rat RA-FLSs by inhibiting the TLR4/NF-κB signaling pathway. [score:10]
RA-FLS cells were divided into 6 experimental groups: (1) control (no transfection); (2) miR-146a mimic (transfected with miR-146a mimic); (3) miR-146a inhibitor (transfected with miR-146a inhibitor); (4) Tak-242 (treated with TLR4/NF-κB signaling pathway inhibitor); and (5) miR-146a mimic + LPS (transfected with miR-146a mimic and treated with TLR4/NF-κB signaling pathway activator) and (6) TLR4 (treated with TLR4 overexpressing vector). [score:9]
The mRNA expressions of COX-2 and MMP-3 were detected by and was used to measure the expressions of Seprase and MMP-3. COX-2 and MMP-3 mRNA levels decreased in the miR-146a mimic and the Tak-242 groups, but increased in the TLR4 and miR-146a inhibitor groups and COX-2 and MMP-3 expressions in the TLR4 group were higher than in the miR-146a inhibitor group (all P < 0.05) and were similar to control in the mimic + LPS groups (P > 0.05; Figure 5). [score:9]
results demonstrated that PGE2, MMP-3 and Seprase protein expressions were decreased in the miR-146a mimic and the Tak-242 groups, increased in the miR-146a inhibitor and the TLR4 groups (all P < 0.05), the protein expressions of PGE2, MMP-3 and Seprase were higher in the TLR4 group than that of the miR-146a inhibitor group, and similar to control in the mimic + LPS groups (P > 0.05; Table 4). [score:9]
Similarly, our results demonstrated that miR-146a overexpression inhibits RA-FLS cell proliferation and pro-inflammatory cytokine production by inhibiting the TLR4/NF-κB signaling pathway. [score:7]
Our study demonstrates that miR-146a suppresses FLS proliferation by downregulating the activation of the TLR4/NF-κB signaling pathway. [score:6]
In order to figure out the role of miR-146a on the expression of NO and iNOS, the release of NO was determined by Greiss reaction and the mRNA expression of iNOS was detected via. [score:5]
Moreover, miR-146a expression correlated with smoking and serious and active RA disease (both P < 0.05). [score:5]
In summary, our study shows that miR-146a reduces FLS cell proliferation and pro-inflammatory cytokine production by inhibiting TLR4/NF-κB signaling, thereby suppressing RA. [score:5]
The iNOS mRNA levels decreased in the miR-146a mimic and the Tak-242 groups (P < 0.05), increased in the miR-146a inhibitor and TLR4 groups, and iNOS levels in the TLR4 group was higher than in the miR-146a inhibitor group (both P < 0.05), but were similar to control in the mimic + LPS group (P > 0.05; Figure 4B). [score:5]
The reverse transcription quantitative polymerase chain reaction (RT-qPCR) results of miR-146a expression are shown in Figure 1. The expression of miR-146a was 1.07 ± 0.27 in RA-FLS tissues, and 1.93 ± 0.47 in non-RA FLS tissues. [score:5]
NO levels descended in the miR-146a mimic and the Tak-242 groups (P < 0.05), ascended in the miR-146a inhibitor and the TLR4 groups, and NO levels in the TLR4 group was higher than in the miR-146a inhibitor group (P < 0.05), but were similar to control in the mimic + LPS group (P > 0.05; Figure 4A). [score:5]
The protein and mRNA expressions of TLR4 and NF-κB were detected by and western blotting to figure out the effect of miR-146a on expressions of TLR4 and NF-κB in RA-FLSs. [score:5]
The miR-146a mimic (5′-UGAGAACUGAAU UCCAUGGGUU-3′), inhibitor (5′-AACCCAUGGAAUUC AGUUCUCA-3′) and TLR4 overexpressing vector were purchased from Shanghai Zimmer Pharmaceutical Company (Shanghai, China). [score:5]
The rat FLSs were transfected with lentiviral vectors expressing empty vector plasmid (negative control, NC), miR-146a mimic, and miR-146a inhibitor as previously described [36]. [score:5]
As shown in Figure 8, the apoptotic rate (percent Annexin V [+] PI [+] apoptotic cells) increased in the miR-146a mimic sand the Tak-242 groups, but decreased in the miR-146a inhibitor and thr TLR4 groups, and apoptotic rate in the TLR4 group was lower than in the miR-146a inhibitor group (P < 0.05) and was similar to control in the mimic + LPS group (P > 0.05). [score:5]
As the time of culture increased, the proliferation increased in all groups (all P < 0.05), and the inhibitory rate decreased in the miR-146a inhibitor and the TLR4 groups (both P < 0.05), while increased in the miR-146a mimic and the Tak-242 groups (both P < 0.05). [score:5]
The mRNA levels of IL-1β, IL-6, IL-8 and IL-17 reduced in the miR-146a mimic and the Tak-242 groups (all P < 0.05), increased in the miR-146a inhibitor and the TLR4 groups, the mRNA levels of IL-1β, IL-6, IL-8 and IL-17 were significantly higher in the TLR4 group than in the miR-146a inhibitor group (all P < 0.05), and no obvious differences were found between the control and the mimic + LPS groups (all P > 0.05; Table 2). [score:5]
MiR-146a overexpression inhibits inflammatory response of FLSs in RA mo del rats. [score:4]
Here, we focused on association between miR-146a and the TLR/NK-κB signaling pathway specifically; future studies should examine the mechanisms by which miR-146a is regulated and identify its target molecules. [score:4]
These results demonstrated that miR-146a negatively regulated TLR4 expression by binding to its 3’UTR in RA-FLS. [score:4]
Pauley et al. showed that miR-146a expression controlled the release of some pro-inflammatory cytokines and therefore regulated the extent of stimulation [22]. [score:4]
Results of immunohistochemistry showed that compared with the control and the NC groups, the expressions of proliferating cell nuclear antigen (PCNA) and intercellular adhesion molecular-1 (ICAM-1) in RA-FLSs were significantly declined in the miR-146a mimic group, but elevated in the miR-146a inhibitor groups (both P < 0.05). [score:4]
Therefore, lower miR-146a expression promotes the release of proinflammatory cytokines, thus exacerbating RA pathology. [score:3]
miR-146a expression in fibroblast-like synoviocytes of RA patients. [score:3]
mir-146 expression in RA patients. [score:3]
Figure 7(A) CCK-8 assay shows proliferation of RA-FLS cells from control, miR-146a mimic, miR-146a inhibitor, Tak-242 and mimic + LPS treatment groups at 24, 48 and 72 h. (B) Cell inhibitory rate in control, miR-146a mimic, miR-146a inhibitor, Tak-242 and mimic + LPS treatment groups at 24, 48 and 72 h. Note: [*]denotes P < 0.05 as compared with the control group; [#]denotes P < 0.05 as compared with the 24 h time point; [&]denotes P < 0.05 as compared with the 48 h time point; CCK-8: cell counting kit-8; OD: optical density. [score:3]
Figure 4(A) Nitric oxide levels in RA-FLS cells from control, miR-146a mimic, miR-146a inhibitor, Tak-242 and mimic + LPS treatment groups as analyzed by the Griess method. [score:3]
The miR-146a inhibitor and TLR4 treated RA-FLSs showed increased cell density with closely arranged cells (Figure 6). [score:3]
Therefore, miR-146a and TLR4/NF-κB signaling are potential therapeutic targets for RA. [score:3]
We also found that lower miR-146a expression was associated with increased FLS proliferation and increased levels of the fibroblast growth factors, COX-2, PGE2, MMP-3 and Seprase. [score:3]
and western blotting analysis of COX-2, PGE2, MMP-3 and Seprase mRNA and protein levels in RA-FLS cells from control, miR-146a mimic, miR-146a inhibitor, Tak-242 and mimic + LPS treatment groups. [score:3]
Figure 2miR-146a binds to 3’UTR of TLR4 gene(A) Schematic representation of Target Scan analysis demonstrating the miR-146a binding site in 3’UTR of TLR4. [score:3]
Figure 1RT-qPCR analysis of miR-146a expression in the fibroblast-like synoviocytes from RA (n = 12) and non-RA (n = 10) patients is shown in Figure 1. Note: RA-FLS: rheumatoid arthritis fibroblast-like synoviocytes obtained from patients in First Teaching Hospital of Tianjin University of Traditional Chinese Medicine that were treated with arthroscopic synovectomies; non-RA FLS: non-rheumatoid arthritis fibroblast-like synoviocytes obtained from patients that were treated with arthroscopy for amputation due to meniscus injury to knee joint, pure meniscus injury to knee joint, anterior cruciate ligament injury, loose body, and synovial plica syndrome; [*]denotes P < 0.05 in comparison to the non-RA group; miR-146a: microRNA-146a; RA: rheumatoid arthritis. [score:3]
Effect of miR-146a on expression of COX-2, PGE2, MMP-3 and Seprase in RA-FLSs. [score:3]
Effect of miR-146a on nitric oxide (NO) production and inducible nitric oxide synthase (iNOS) expression in RA-FLSs. [score:3]
The correlation between miR-146a expression level and clinicopathological features in the RA patients. [score:3]
Figure 8(A) FACS plots showing AnnexinV-FITC versus propidium iodide staining in RA-FLSs from control, miR-146a mimic, miR-146a inhibitor, Tak-242 and mimic + LPS treatment groups. [score:3]
However, cell proliferation increased in the miR-146a inhibitor and the TLR4 groups (both P < 0.05) and decreased in the miR-146a mimic and the Tak-242 groups (both P < 0.05) than in the control group at 48 and 72 h (P > 0.05). [score:3]
Figure 3(A) analysis of TLR4 and NF-κB mRNA levels in RA-FLS cells from control, miR-146a mimic, miR-146a inhibitor, Tak-242 and mimic + LPS treatment groups. [score:3]
Figure 5RT-qPCR and western blotting analysis of COX-2, PGE2, MMP-3 and Seprase mRNA and protein levels in RA-FLS cells from control, miR-146a mimic, miR-146a inhibitor, Tak-242 and mimic + LPS treatment groups. [score:3]
The levels of IL-1β, IL-6, IL-8 and IL-17 in the miR-146a inhibitor group were lower than in the TLR4 group (all P < 0.05). [score:3]
In the rat RA mo del, the arthritis score was lower in the miR-146a mimic group than in the control and NC groups suggesting that miR-146a overexpression decreased inflammation. [score:3]
miR-146a inhibits cell proliferation in several cancers [6]. [score:3]
miR-146a overexpression reduces FLS cell proliferation. [score:3]
Effect of miR-146a on TLR4 and NF-κB expression in RA-FLSs. [score:3]
analysis of miR-146a expression in the fibroblast-like synoviocytes from RA (n = 12) and non-RA (n = 10) patients is shown in Figure 1. Note: RA-FLS: rheumatoid arthritis fibroblast-like synoviocytes obtained from patients in First Teaching Hospital of Tianjin University of Traditional Chinese Medicine that were treated with arthroscopic synovectomies; non-RA FLS: non-rheumatoid arthritis fibroblast-like synoviocytes obtained from patients that were treated with arthroscopy for amputation due to meniscus injury to knee joint, pure meniscus injury to knee joint, anterior cruciate ligament injury, loose body, and synovial plica syndrome; [*]denotes P < 0.05 in comparison to the non-RA group; miR-146a: microRNA-146a; RA: rheumatoid arthritis. [score:3]
Results of and western blotting showed that the TLR4 mRNA and protein expressions were significantly lower in the miR-146a group than that of the NC group (both P < 0.05). [score:3]
As shown in Table 1, we observed lower miR-146a expression in the RA-FLS tissues (1.07 ± 0.27) than in non-RA FLS tissues (1.93 ± 0.47; P < 0.05). [score:3]
We analyzed the target genes of miR-146a at the microRNA. [score:3]
The miR-146a mimic and inhibitor were then mixed with 1X lipofectamine 3000 reagent for 5 min and incubated at room temperature for 20 min. [score:3]
Expression of miR-146a in RA-FLS tissues and its relationship with clinicopathological features of RA. [score:3]
The expression of miR-146a was lower in RA-FLS tissues than that of non-RA FLS tissues (P < 0.01). [score:3]
Another 20 RA mo del rats were randomly classified into the control, NC, miR-146a mimic and miR-146a inhibitor groups (5 rats in each group). [score:3]
miR-146a levels were not associated with gender, age and course of disease (all P > 0.05). [score:3]
Effect of miR-146a on expressions of TLR4 and NF-κB in RA-FLSs. [score:3]
Effect of miR-146a on COX-2, PGE2, MMP-3 and Seprase expression in RA-FLSs. [score:3]
The miR-146a mimic and inhibitor were diluted in 50 µl serum-free medium, whereas 1 µl lipofectamine 3000 reagent was diluted in 50 µl serum-free medium. [score:3]
A previous study reported that miR-146a could control TLR and cytokine signaling through targeting the TNF receptor–associated factor 6 and IL-1 receptor -associated kinase [17]. [score:3]
Figure 9(A) Arthritis score of RA mo del rats transplanted with control, negative control, miR-146a mimic and miR-146a inhibitor transfected rat RA-FLSs. [score:3]
Effect of miR-146a on nitric oxide (NO) levels and inducible nitric oxide synthase (iNOS) expression in RA-FLSs. [score:3]
The expressions of TLR4 in the miR-146a mimic and the NC groups were detected by and. [score:3]
Taganov et al. reported that the induction of miR-146a is regulated by nuclear factor-kappa B (NF-κB) [14]. [score:2]
MiR-146a targets interleukin-1 receptor -associated kinase (IRAK1) and modulates the function of toll-like receptors and related cytokines [21]. [score:2]
Moreover, the signaling pathway that could regulate miR-146a in the FLSs was not clear, which has not been reported. [score:2]
The dual luciferase gene assay was used to confirm the target relationship between TLR4 and miR-146a. [score:2]
Moreover, it has been demonstrated that miR-146a expression was higher in RA-FLSs when compared with those from patients with osteoarthritis (OA)-FLSs [17]. [score:2]
Results of show in Table 3. Compared to the control group, the levels of IL-1β, IL-6, IL-8 and IL-17 were significantly reduced in the miR-146a mimic and the Tak-242 groups (all P < 0.05), while they were elevated in the miR-146a inhibitor and the TLR4 groups (all P < 0.05). [score:2]
Effects of miR-146a on RA-FLS morphology. [score:1]
Nakasa et al. reported that miR-146a was induced by LPS and proinflammatory mediators [20]. [score:1]
miR-146a is induced in response to TLR4 signaling in monocytes that play a key role in innate immune response [13]. [score:1]
In order to investigate effects of miR-146a on RA-FLSs morphology, the expression of miR-146a was detected by, and the morphology of miR-146a was observed by an inverted microscope. [score:1]
Effect of miR-146a on RA-FLS cell proliferation. [score:1]
Effect of miR-146a on RA-FLSs apoptosis. [score:1]
Then, FLSs were transfected with miR-146a mimic and miR-146a NC in combination with TLR4-3’UTR plasmid vector and mutant TLR4-3’UTR vector. [score:1]
Results of showed that the control and miR-146a mimic + LPS treated RA-FLS cells showed dense cell growth and similar cell morphology. [score:1]
In the miR-146a mimic and Tak-242 treatments, the RA-FLSs were smaller with high refractive index, decreased cell density and apoptotic. [score:1]
Effect of miR-146a on inflammatory response in rat RA mo del. [score:1]
Effects of miR-146a on RA-FLSs morphology (× 200). [score:1]
was adopted to determine the expression level of miR-146a and mRNA levels of TLR4 and NF-κB, and western blotting was performed to measure protein levels of TLR4 and NF-κB. [score:1]
Data was analyzed to figure out the relationship between miR-146a and clinicopathological features of RA. [score:1]
Effect of miR-146a on expressions of COX-2, PGE2, MMP-3 and Seprase in RA-FLSs could be investigated. [score:1]
However, there was no difference in the apoptotic cells between the miR-146a mimic and the Tak-242 groups (P > 0.05). [score:1]
In the FLS cells transfected with mutated 3’ UTR of TLR4 gene, the luciferase activities between the miR-146a mimic and the NC groups were comparable (P > 0.05; Figure 2). [score:1]
Effect of miR-146a on RA-FLS cell apoptosis. [score:1]
miR-146a represses cartilage and synovial inflammation [8, 9]. [score:1]
COX-2: cyclooxygenase-2; MMP3: matrix metalloproteinase-3. In order to investigate effects of miR-146a on RA-FLSs morphology, the expression of miR-146a was detected by, and the morphology of miR-146a was observed by an inverted microscope. [score:1]
miR-146a binds to 3’UTR of TLR4 gene. [score:1]
In order to figure out the effect of miR-146a on the symptoms of RA rats, the RA rat mo del was established. [score:1]
Moreover, lower TLR4 and NF-κB mRNA and protein levels were observed in the miR-146a mimic group than in the control and NC groups (P < 0.05) (Figure 9). [score:1]
As shown, miR-146a binds to wild type TLR4-3’UTR and diminishes relative firefly luciferase activity. [score:1]
[1 to 20 of 92 sentences]
6
[+] score: 223
The results showed that zhenbao pill could up-regulate the level of miR-146a-5p in ASCI rats and down-regulate the level of GPR17, which suggested that zhenbao pill might exert its anti-apoptotic effect by regulating miR-146a-5p and GPR17 expression. [score:10]
MiR-146a-5p reversed the role of zhenbao pill on GPR17 expressionTo explore the regulatory relationship between miR-146a-5p and zhenbao pill on GPR17 expression, SH-SY5Y cells were divided into five groups: control group, hypoxia group, hypoxia + zhenbao pill group, hypoxia + zhenbao pill + NC group, and hypoxia + zhenbao pill + miR-146a-5p inhibitor group. [score:8]
It could be seen that miR-146a-5p expression was decreased (Figure 3A) and GPR17 expression was increased (Figure 3B,C) after ASCI, but zhenbao pill could reverse these, and the effects of zhenbao pill on the expression of miR-146a-5p and GPR17 were increased as time goes on (Figure 3A,B). [score:7]
As shown in Figure 6A, zhenbao pill reduced the expression of GPR17, while knockdown of miR-146a-5p reversed the down-regulation of GPR17. [score:7]
In SH-SY5Y cells, zhenbao pill up-regulated the level of miR-146a-5p and down-regulated the level of GPR17. [score:7]
Additionally, the study showed that zhenbao pill could up-regulate miR-146a-5p and down-regulate GPR17 in SH-SY5Y cells. [score:7]
MiR-146a-5p directly regulates GPR17 expressionBased on bioinformatics analysis (TargetScan and microrna. [score:6]
Zhenbao pill regulated miR-146a-5p and GPR17 expression and neuronal apoptosisAs mentioned above, GPR17 might be a potential therapeutic target for SCI and miR-146a-5p might be associated with ASCI, so we investigated the role of zhenbao pill on the expression of miR-146a-5p and GPR17. [score:6]
In summary, zhenbao pill could inhibit neurones’ apoptosis by regulating the expression of miR-146a-5p/GPR17, and then promoting the recovery of spinal cord function. [score:6]
And knockdown miR-146a-5p could reverse the inhibitory effect of zhenbao pill on GPR17 expression, the anti-apoptotic effect of zhenbao pill and the recovery of zhenbao pill on hind limb motor function in ASCI rats. [score:6]
To explore the regulatory relationship between miR-146a-5p and zhenbao pill on GPR17 expression, SH-SY5Y cells were divided into five groups: control group, hypoxia group, hypoxia + zhenbao pill group, hypoxia + zhenbao pill + NC group, and hypoxia + zhenbao pill + miR-146a-5p inhibitor group. [score:6]
Rats in ASCI + zhenbao pill + miR-146a-5p inhibitor group received miR-146a-5p inhibitor vector packaged with lentiviral vector by intraperitoneal injection. [score:5]
In our study, we found abnormal expressions of five miRNAs in ASCI rats, and only miR-146a-5p expression was increased after being treated with zhenbao pill. [score:5]
Moreover, miR-146a-5p inhibitor could reverse the promoting effect of zhenbao pill on miR-146a-5p and the inhibitory effect of zhenbao pill on GPR17 (Figure 7B). [score:5]
MiR-146a-5p directly regulates GPR17 expression. [score:4]
Zhenbao pill up-regulated miR-146a-5pIn this part, we selected five miRNAs to test according to the literature [16, 23– 28], aiming to confirm which miRNA could be affected by zhenbao pill grouping method described above. [score:4]
The study further demonstrated that GPR17 was a target of miR-146a-5p, and could be negatively regulated by miR-146a-5p. [score:4]
Zhenbao pill regulated miR-146a-5p and GPR17 expression and neuronal apoptosis. [score:4]
Zhenbao pill regulated the expression of miR-146a-5p and GPR17 in SH-SY5Y cells exposed to hypoxia. [score:4]
The results indicated that zhenbao pill could reduce cell apoptosis via down -regulating GPR17, while this could be reversed by miR-146a-5p inhibitor. [score:4]
Zhenbao pill up-regulated miR-146a-5p. [score:4]
In combination, it suggested that zhenbao pill might exert its anti-apoptotic effect by regulating miR-146a-5p and GPR17 expression. [score:4]
The rats were divided into four groups: sham group, ASCI group, ASCI + zhenbao pill + NC group, and ASCI + zhenbao pill + miR-146a-5p inhibitor group. [score:3]
Others (n=28) were randomly assigned into four groups: sham group (n=7), ASCI group (n=7), ASCI + zhenbao pill + negative control (NC) group (n=7), and ASCI + zhenbao pill + miR-146a-5p inhibitor group (n=7). [score:3]
Moreover, it was reported that miR-146a-5p expression was markedly decreased in spinal cord [17] and could alleviate neuropathic pain in spinal cord [16]. [score:3]
The expression of miR-146a-5p in hypoxia group was reduced as measured by quantitative real-time PCR (qRT-PCR), and zhenbao pill pretreatment reversed the expression of miR-146a-5p (Figure 5A). [score:3]
NC was the control group of miR-146a-5p inhibitor). [score:3]
MiR-146a-5p mimic or miR-146a-5p inhibitor were transfected into the cells using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. [score:3]
Figure 3Effect of zhenbao pill on miR-146a-5p and GPR17 expression and neuronal apoptosis(A) The levels of miR-146a-5p in spinal tissue of rats at different time points. [score:3]
Together, we speculated that miR-146a-5p might be regulated to the occurrence and development of ASCI. [score:3]
As mentioned above, GPR17 might be a potential therapeutic target for SCI and miR-146a-5p might be associated with ASCI, so we investigated the role of zhenbao pill on the expression of miR-146a-5p and GPR17. [score:3]
Effect of zhenbao pill on miR-146a-5p and GPR17 expression and neuronal apoptosis. [score:3]
SH-SY5Y cells were co -transfected with GPR17-3′-UTR-WT reporter vector or GPR17-3′-UTR-MUT reporter vector and miR-146a-5p mimic or miR-146a-5p inhibitor or NC by using Lipofectamine 2000 (Invitrogen). [score:3]
In the ASCI + zhenbao pill group, miR-146a-5p expression was increased, the levels of other miRNA had no significant change. [score:3]
Figure 6The effect of miR-146a-5p on the expression of GPR17 induced by hypoxia. [score:3]
Figure 5The effect of zhenbao pill on the expression of miR-146a-5p and GPR17 in SH-SY5Y cells exposed to hypoxia. [score:3]
The effect of miR-146a-5p on GPR17 expression. [score:3]
We found decreased miR-146a-5p expression in ASCI rats, thus we speculated that miR-146a-5p might be related to ASCI. [score:3]
Twenty-eight adult female SD rats were divided into four groups: sham group, ASCI group, ASCI + zhenbao pill + NC group, and ASCI + zhenbao pill + miR-146a-5p inhibitor group. [score:3]
The binding sites of miR-146a-5p and GPR17 were analyzed online using TargetScan [22] and microRNA. [score:3]
The results showed that miR-208, miR-124, miR-146a-5p, miR-103, and miR-21 were all expressed abnormally in spinal tissue of ASCI rats (Figure 2). [score:3]
The effect of miR-146a-5p on the expression of GPR17 induced by hypoxia. [score:3]
However, only miR-146a-5p expression was increased after being treated with zhenbao pill (Figure 2). [score:3]
As shown in Figure 7A, zhenbao pill could promote the recovery of hind limb motor function, while miR-146a-5p inhibitor could attenuate the recovery function of zhenbao pill. [score:3]
Moreover, miR-146a-5p mimics reduced the mRNA and protein expression of GPR17 in SH-SY5Y cells (Figure 4B). [score:3]
The effect of zhenbao pill on the expression of miR-146a-5p and GPR17 in SH-SY5Y cells exposed to hypoxia. [score:3]
Figure 4The effect of miR-146a-5p on GPR17 expression(A) The results predicted by online bioinformatics methods showed that GPR17 3′-UTR contained an miR-146a-5p binding site. [score:3]
Compared with miR-146a-5p mimics, miR-146a-5p inhibitor had an opposite trend (Figure 4C). [score:2]
Zhenbao pill regulated the expression of miR-146a-5p and GPR17 in SH-SY5Y cells exposed to hypoxiaBecause of its similar characteristics to nerve cells, SH-SY5Y human neuroblastoma cells are commonly used as a substitute for nerve cells [29]. [score:2]
These results indicated that zhenbao pill might exert its effects on ASCI by regulating miR-146a-5p. [score:2]
However, knockdown of miR-146a-5p could reverse the role of zhenbao pill in SH-SY5Y cells’ apoptosis (Figure 6B). [score:2]
MiR-146a-5p reversed the role of zhenbao pill on GPR17 expression. [score:2]
Zhenbao pill promotes the recovery of spinal cord function via regulating miR-146a-5p/GPR17. [score:2]
Zhenbao pill promotes the recovery of spinal cord function via regulating miR-146a-5p/GPR17In the part, we verified the mechanism of zhenbao pill on ASCI in vivo. [score:2]
Effect of miR-146a-5p on hind limb motor function. [score:1]
In the ASCI group, the levels of miR-208, miR-124, and miR-146a-5p were decreased, while the levels of miR-103 and miR-21 were increased. [score:1]
The solid line indicated that miR-146a-5p and GPR17 could be combined, and the dotted line indicated that the binding site was mutated. [score:1]
Moreover, bioinformatics analysis found that GPR17 3′-UTR had a binding site with miR-146a-5p. [score:1]
Then, we used DLR assay to detect the regulatory relationship between miR-146a-5p and GPR17. [score:1]
Moreover, bioinformatics analysis showed that GPR17 3′-UTR had a binding site with miR-146a-5p. [score:1]
Additionally, miR-146a-5p has been reported to relieve neuropathic pain in spinal cord [16, 17]. [score:1]
org), we found that GPR17 3′-UTR had a binding site with miR-146a-5p (Figure 4A). [score:1]
In the present study, we investigated the effect of zhenbao pill on the motor function of ASCI rats and the molecular mechanisms involving miR-146a-5p and GPR17, aiming to find new therapeutic targets for ASCI. [score:1]
The luciferase reporter plasmid (LRP) containing wild-type (WT) gene of GPR17 3′-UTR or mutant (MUT) gene of GPR17 3′-UTR was constructed, and SH-SY5Y cells were co -transfected with miR-146a-5p mimics and LRP. [score:1]
Figure 7Effect of miR-146a-5p on hind limb motor function. [score:1]
[1 to 20 of 65 sentences]
7
[+] score: 208
Other miRNAs from this paper: rno-mir-146b, bta-mir-146b, bta-mir-146a
A summary of the relative mRNA expression levels of cytokines in the iris and ciliary body and the cytokine concentration in the aqueous humor is shown in Figure 3. Compared with treatment with MAA, treatment with low-dose or high-dose miR-146a resulted in significant downregulation of mRNA expression of IL-6 (p < 0.01 in both), IFN- γ (p < 0.001 in both), IL-12 (p < 0.001 in both), and IL-1 β (p < 0.001 in both) and upregulation of IL-10 (p < 0.001 in both) and IL-17 (p < 0.01 in both). [score:10]
We proposed that loss of miR-146a inhibition leads to overexpression of NF- κB, resulting in the disease. [score:7]
Following miR-146a injections, downregulation of interleukin- (IL-) 1 β, IL-6, and IL-12 and interferon- (IFN-) γ and upregulation of IL-10 and IL-17 were noted. [score:7]
In one human study of miR-146a and Behcet disease, individuals carrying the rs2910164 CC genotype had lower expression of miR-146a and a lower risk of developing Behcet disease [40]. [score:7]
In our previous work, the expression of miR-146a was significantly downregulated in the course of EAAU. [score:6]
miR-146a is highly expressed in regulatory T cells (Treg) [30, 31] and hence physiologically suppresses the activity of Th1 cells through STAT1 or STAT4 [32]. [score:6]
It was further noted that miR-146a dampens the TCR–NF- κB pathway and inhibits AP-1 activity and IL-2 expression [35, 36]. [score:5]
Effect of miR-146a on NF- κB Expression in the Iris and Ciliary Body by ImmunofluorescenceThe immunofluorescence results are shown in Figure 4. NF- κB expression was observed in the MAA group and the MAA + negative mimic group, but not in the control group. [score:5]
Following miR-146a treatment, the expression of cytokines changed significantly, in that suppression of proinflammatory cytokines such as IL-1 β, IL-6, IL-12p35, and IFN- γ and increase of anti-inflammatory cytokines such as IL-10 were noted. [score:5]
Effect of miR-146a on NF- κB Expression in the Iris and Ciliary Body by Western BlotThe results are shown in Figure 5. In comparison with the control group, the expression levels of NF- κB in the iris and ciliary body were significantly higher in the MAA group and the MAA + negative mimic group. [score:5]
Second, miR-146a treatment suppressed multiple proinflammatory cytokines, such as IL-1 β, IL-6, IL-12p35, and IFN- γ, although it did not suppress IL-17. [score:5]
Expression of miR-146a has been noted to be associated with the risk of some autoimmune diseases [37]. [score:5]
By attenuating tumor necrosis factor (TNF) receptor -associated factor 6 (TRAF6) and interleukin (IL)-1 receptor -associated kinase 1 (IRAK1), miR-146a dampens downstream NF- κB expression and finally inhibits inflammation [18, 19]. [score:5]
In addition to its expression in Treg cells, miR-146a may be relevant to Th17 lineage expression. [score:5]
Compared with treatment with low-dose miR-146a, treatment with high-dose miR-146a significantly reduced mRNA expression of IL-6 (p < 0.01), IFN- γ (p < 0.01), IL-12 (p = 0.01), and IL-1 β (p < 0.001) and upregulation of IL-10 (p < 0.01) and IL-17 (p < 0.01) (Figure 3(a)). [score:5]
Third, the results of immunofluorescence, Western blotting, and EMSA revealed that miR-146a regulated the disease process in an NF- κB -dependent manner. [score:4]
Meanwhile, the downregulation profile of miR-146a was noted much earlier than the cytokine changes and clinical inflammation [11]. [score:4]
For instance, in people with chronic hepatitis B, miR-146a upregulation causes impaired T cell function and contributes to immune defects during chronic viral infection [32]. [score:4]
The author proposed that following the emergence of uveitis, the expression of miR-146a may act as a negative regulator that terminates the inflammation. [score:4]
The decrease in NF- κB expression was even more profound in the group receiving high-dose miR-146a treatment. [score:3]
miR-146a possibly results in Th1 axis suppression by enhancing the activity of Treg and Th17 cells, thus halting the intraocular inflammation process in EAAU. [score:3]
Effect of miR-146a on NF- κB Expression in the Iris and Ciliary Body by Western Blot. [score:3]
The decreased NF- κB expression on immunofluorescence and Western blotting and reduced DNA -binding activity on EMSA were demonstrated following miR-146a treatment. [score:3]
CD3 [+] (the TCR coreceptor) T cells express miR-146 in synovial tissues of people with rheumatoid arthritis [34]. [score:3]
Taken together, the evidence suggests that miR-146a is activated upon activation of TCRs and induces a negative feedback loop in the immune response through inhibition of NF- κB and AP-1. In summary of the above literature, miR-146a can have multiple effects on the immune response (Figure 7). [score:3]
In another SNP study, increased miR-146a expression was noted as a predisposing factor for pediatric uveitis [41]. [score:3]
The concentration of these four key cytokines was further determined with ELISA, in order to elucidate how miR-146a might alter the disease process. [score:3]
In comparison with its other proinflammatory counterparts, IL-17 expression was especially augmented in the miR-146a treatment group. [score:3]
NF- κB expression was reduced following low-dose miR-146a treatment. [score:3]
Meanwhile, the profiles of clinical inflammation, aqueous cell infiltration, histology, NF- κB expression, and cytokine alterations following miR-146a treatment may be a useful guide for further research. [score:3]
These findings may also shed some light on the participation of miR-146a in systemic autoimmune diseases. [score:3]
Effect of miR-146a on Expression of Cytokines. [score:3]
Treatment with low- or high-dose miR-146a sequentially attenuated the expression of NF- κB. [score:3]
First, the effect of miR-146a-treatment in disease amelioration was well shown in clinical scores, leukocyte infiltration in the aqueous humor, and histologic findings. [score:3]
Effect of miR-146a on NF- κB Expression in the Iris and Ciliary Body by Immunofluorescence. [score:3]
In contrast to our results, the expression of miR-146a was significantly elevated in experimental autoimmune uveoretinitis (EAU) in one study [22]. [score:3]
miR-146a dampened intraocular inflammation through the inhibition of NF- κB, resulting in reduced leukocyte infiltration and reduced production of proinflammatory cytokines. [score:3]
First, miR-146a was administered before the disease onset. [score:3]
miR-146a effectively reduced intraocular inflammation in EAAU through the inhibition of NF- κB. [score:3]
Inhibition of IRAK1, TRAF6, and ultimately NF- κB is one of the pivotal actions of miR-146a [28]. [score:3]
Some results from human studies regarding miR-146a in intraocular inflammation were even contradictory to the current molecular knowledge that miR-146a acts as a negative autoimmunity regulator. [score:2]
Nevertheless, the current study is unique in its in vivo design, which helps establish the real influence of miR-146a in a uveitis mo del by a direct therapeutic approach. [score:2]
Generally regarded as an immunological brake, miR-146a regulates multiple pathways involving both innate and adaptive immunity. [score:2]
Apart from SNP studies, our current experiment, which utilizes direct treatment with miR-146a in one uveitis mo del, supports the current notion that miR-146a acts as an immunological brake. [score:2]
In addition to its role in manipulating T cell lineages, current evidence also suggests the possible regulation of miR-146a in T cell receptors (TCRs). [score:2]
In one diabetic rat mo del treated with miR-146a, weekly intravitreal injection of 1.5  μg of miR-146a mimic in Lipofectamine reagent was regarded as clinically safe [25], and therefore, this dose was used in our experiment for the high-dose treatment group. [score:1]
In contrast, NF- κB activity decreased in the miR-146a treatment groups in a dose -dependent manner. [score:1]
Clinical activity scores were significantly lower in rats treated with high-dose miR-146a than in those treated with low-dose miR-146a at day 20 dpi (p = 0.02; n = 10). [score:1]
Effect of miR-146a on DNA-Binding Activity of NF- κB in the Iris and Ciliary Body by EMSA. [score:1]
Group 4: rats received MAA induction + intravitreal injection of low-dose miR-146a (0.5  μg in Lipofectamine reagent) (low-dose miR-146a group). [score:1]
The animals were injected intravitreally with low-dose (0.5  μg) or high-dose (1.5  μg) miR-146a. [score:1]
The findings of both studies suggest the proinflammatory role of miR-146a. [score:1]
The purpose of the present study was twofold: first, to explore the exact roles of miR-146a in the pathogenesis of EAAU, especially the relationships with NF- κB, and second, to determine whether local administration of miRNAs can be a new modality among the armamentarium of uveitis management, in which the local immunotherapy possesses a steroid-sparing character and is potentially devoid of systemic adverse effects. [score:1]
Preliminary miR-146a levels in the iris and ciliary body tissue also showed a steadily increasing trend in the miR-146a -treated groups, a result that was consistent with our treatment goal. [score:1]
If possible, topical or subconjunctival miR-146a administration would be a more realistic treatment choice in the future. [score:1]
To elucidate whether there was any dose -dependent treatment response, we assigned 0.5  μg of miR-146a to the low-dose group. [score:1]
Specifically, miR-146a is regarded as a key immunological player. [score:1]
miR-146a might be a new treatment choice for uveitis. [score:1]
The results are shown in Figure 2. The inflammatory cell count in the aqueous humor was significantly lower in rats treated with low-dose miR-146a than in rats treated with MAA at 7, 10, 15, and 25 dpi (p = 0.02, p < 0.01, p = 0.01, p = 0.04, resp. [score:1]
With the advantages of the possibility of local treatment and its steroid-sparing effect, miR-146a may be a promising choice for the treatment of uveitis. [score:1]
The inflammatory cell count in the aqueous humor was also significantly lower in rats treated with high-dose miR-146a than in rats treated with MAA at 7, 10, 15, and 25 dpi (p < 0.01 for all comparisons; n = 3). [score:1]
Because of the clear relationship with NF- κB, we consider miR-146a a promising candidate for the treatment of uveitis. [score:1]
In conclusion, the current study demonstrated the effects of intravitreal injection of miR-146a in alleviating EAAU. [score:1]
Effect of miR-146a on Clinical Activity Score. [score:1]
Effect of miR-146a on Inflammatory Cells in the Aqueous Humor and the Iris and Ciliary Body Tissues. [score:1]
In our previous experiment, miR-146a and six other miRNAs showed significant dynamic changes in the course of EAAU [11]. [score:1]
T cells lacking miR-146a are hyperactive in both acute antigenic responses and chronic inflammatory autoimmune responses in one mouse mo del [35]. [score:1]
In their study, miR-146a possessed a longer half-life, slightly more than 1 week [24]. [score:1]
Effect of miR-146a on DNA-Binding Activity of NF- κB in the Iris and Ciliary Body by EMSAThe results of EMSA are shown in Figure 6. The DNA -binding activity of NF- κB was significantly higher in the MAA group and the MAA + negative mimic group than in the control group. [score:1]
Treatment with miR-146a significantly attenuated clinical scores and leukocyte infiltration in a dose -dependent manner, a result that was compatible with histological findings. [score:1]
An example of such a miRNA is miR-146a. [score:1]
The effect of intravitreal injection of miR-146a on the clinical activity score is shown in Figure 1. Rats injected with MAA began to develop clinical signs of EAAU at 10 dpi. [score:1]
These findings indicate a promising therapeutic potential of miR-146a in uveitis. [score:1]
Group 5: rats received MAA induction + intravitreal injection of high-dose miR-146a (1.5  μg in Lipofectamine reagent) (high-dose miR-146a group). [score:1]
The activity of innate immune cells, such as macrophages, dendritic cells, and neutrophils, may be dampened following miR-146a treatment. [score:1]
Rats injected with low-dose miR-146a had significantly lower clinical activity scores at 15 and 17 dpi than rats injected with MAA (p < 0.01 and p = 0.02, resp. [score:1]
[1 to 20 of 76 sentences]
8
[+] score: 195
To determine the effects of high glucose on the expression of miR-155 and miR-146a, the HRGECs stimulated with a medium containing 25 mmol/L glucose were cultured at 37°C in 5% CO [2] for 0, 0.5, 1, 2, 4, 8, and 24 h. The expression of both the miR-155 and miR-146a was up-regulated 2 h after the glucose stimulation, peaked after 4 h, and then decreased until 24 h (with a minor increase of the miR-155 expression) relative to the control and the mannitol groups (Figure 6A,B). [score:10]
Furthermore, the addition of PDTC partially repressed the up-regulated expression of TNF-α and TGF-β1 caused by the activation of NF-κB in the miR-155 and miR-146a over -expressing groups. [score:8]
The miRNA expression profiling of the renal biopsy samples was performed by a microarray analysis; then, in situ hybridization and real-time polymerase chain reaction (PCR) were used to determine the localization and expression of two of the miRNAs significantly up-regulated in human DN kidney samples, miR-155 and miR-146a, in the kidney tissues from type 1 and type 2 DN rat mo dels. [score:8]
Thirty-one miRNAs were upregulated by ≥ 2-fold in the DN kidney samples from the DN patients, in which there were two significantly upregulated miRNAs, miR-155 (6.22 ± 2.81-fold) and miR-146a (4.87 ± 1.39-fold). [score:7]
The high glucose -induced up-regulation of TNF-α and TGF-β1 was augmented by the overexpression of miR-155 and miR-146a, thereby increasing renal inflammation and fibrosis and enhancing diabetic GEC injury, which is mediated through the activation of the NF-κB signaling pathway. [score:6]
Under high-glucose conditions, the HRGECs overexpression of miR-155 or miR-146a following the transfection with miR-155 or miR-146a mimics showed an additive effect on the TNF-α and TGF-β1 upregulation. [score:6]
In a murine mo del of chronic kidney disease (CKD), the expression of miR-146a was elevated in B6. [score:5]
Chemically modified RNA oligonucleotides comprising a sequence complementary to mature miR-155 and miR-146a (miR-155 and miR-146a inhibitors) were used to inhibit the miR-155 and miR-146a activities. [score:5]
Surprisingly, some of the candidate targets of miR-155 and miR-146a were involved in the inflammatory responses (data not shown); therefore, we used miR-155 and miR-146a as targets for further study. [score:5]
Furthermore, miR-155 and miR-146a were gradually up-regulated during the development and progression of type 1 and type 2 DN, indicating that they could be activated in a rat DN mo del. [score:5]
In vitro, high glucose induced the over -expression of miR-155 and miR-146a in the HRGECs, which, in turn, increased the TNF-α, TGF-β1, and NF-κB expression. [score:5]
The identification of new and key regulatory miRNAs in DN would be of great importance, and the present study found that among the 32 miRNAs up-regulated in the DN patients, miR-155 and miR-146a were significantly increased and primarily distributed in the GECs, mesangial areas and tubular sections. [score:5]
A, B. The expression of miR-155 and miR-146 under high glucose conditions of different times compared with the control and mannitol group; C, D. Quantification of miR-155 and miR-146a mRNA expression levels with different treating methods on HRGECs by a real-time PCR; E, F. Western blot was used to assess the protein levels of TNF-α and TGF-β with the same treating methods in C and D, glucose group is compared with mannitol group; the high glucose + miR155 inhibitor and high glucose + miR155 mimics are compared to high glucose + scrambled miRNA. [score:4]
Specific miRNAs, such as miR-155 and miR-146a, were initially linked with the inflammatory response by virtue of their potent up-regulation in multiple immune cell lineages by Toll-like receptor ligands, inflammatory cytokines, and specific antigens [15- 17]. [score:4]
Our results demonstrated that miR-155 and miR-146a were up-regulated in the DN patient and experimental animal mo dels and served as a mediator of the glucose -induced TNF-α/TGF-β1-NF-κB pathway. [score:4]
A similar trend was observed for miR-155 and miR-146a expression in the development and progression of DN in the rats with type 2 DN (Figure 5A,B). [score:4]
The expression of both miR-155 and miR-146a was increased more than fivefold in the kidney samples of the DN patients compared with the controls, and the miR-155 expression was closely correlated with the serum creatinine levels (R = 0.95, P = 0.004). [score:4]
Altered miR-155 and miR-146a expression in type 1 and type 2 DN rat kidneys. [score:3]
Together with our findings from the present study, these results lead us to speculate that miR-155 and miR-146a form a regulatory loop in the TNF-α/NF-κB pathway during DN development. [score:3]
Figure 2 The expressions and distribution of miR-155 and miR-146a in the kidneys from DN patients. [score:3]
Figure 4 Expression of miR-155 and miR146a in the STZ -induced rat kidney with type 1 diabetic nephropathy. [score:3]
In the rats with type 1 DN, the rats were sacrificed after the induction of diabetes at 1, 4, and 8 weeks (serum creatinine and urinary protein excretion were shown in Table 3), and a quantitative real-time PCR was used to show that the expression of miR-155 and miR-146a gradually increased during the progression of the DN (Figure 4A,B). [score:3]
In comparison with the NPD control group, the expression levels of miR-146a and miR-155 were significantly increased in the type 2 DN rats from week 0 to week 8 and 16 (Figure 5A,B) (serum creatinine and urinary protein excretion were shown in Table 4). [score:3]
Aberrant expression of miR-155 and miR-146a between healthy and type 2 diabetic human kidney tissues. [score:3]
Our experiments confirmed that high glucose can increase the expression of miR-155 and miR-146a in a time -dependent manner. [score:3]
However, the induction by glucose was clearly blunted by the miR-155 and miR-146a inhibitors, suggesting that miR-155 and miR-146a could significantly induce renal inflammation and fibrosis and contribute to HRGEC injury. [score:3]
Figure 3 Correlation of miR-155, miR-146a expressions and urinary protein excretion, serum creatinine of the DN patients. [score:3]
The miR-155 and miR-146a expression levels were confirmed by a real-time PCR. [score:3]
According to the set time points, the HRGECs (1 × 10 [5] per well) were transfected with miR-155 and miR-146a mimics, inhibitors, and scramble control after 24 h of starvation in a serum-free medium using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
Quantitative real-time PCR was used to detect the expressions of miR-155 (A) and miR-146a (B) in the kidney of the Type 2 diabetic nephropathy mo del. [score:3]
To detect the time -dependent changes in the miR-155 and miR-146a expression, the cells cultured with mediums containing 25 mmol/L glucose were cultured at 37°C in 5% CO [2] for 0, 0.5, 1, 2, 4, 8, and 24 h. They were then collected for a real-time PCR. [score:3]
Quantitative real-time PCR was used to detect the expressions of miR-155 (A) and miR-146a (B) in the kidney of a STZ -induced Type 1 diabetic nephropathy mo del. [score:3]
During the induction and progression of the disease in type 1 and type 2 DN rat mo dels, miR-155 and miR-146a were demonstrated to increase gradually. [score:3]
The linear correlation analysis revealed that the miR-155 expression was closely correlated with the serum creatinine levels (R = 0.95, P = 0.004) but not with the urinary protein excretion levels (R = 0.336, P = 0.461); there were also no significant correlations between the miR-146a and serum creatinine levels (R = 0.531, P = 0.220) or the urinary protein excretion levels (R = 0.360, P = 0.427) (Figure 3). [score:3]
In the present study, therefore, we aimed to clarify the repertoire of miRNAs in the development and progression of DN and the potential regulatory roles of miR-155 and miR-146a in endothelial injury. [score:3]
Quantitative real-time PCR for miR-155 and miR146a expression in the human and the rat kidneys. [score:3]
The precise location and expression levels of the miR-155 and miR-146a were determined using in situ hybridization in the patient and control kidney tissue sections stained with Dig-labeled miR-155 and miR-146a riboprobes. [score:3]
Figure 5 Expression of miR-155 and miR146a in high-fat and high-sugar diet combined with STZ -induced rat kidney with type 2 diabetic nephropathy. [score:3]
To explore the biological effect of miR-155 and miR-146a on the HRGECs under high-glucose conditions, the HRGECs were categorized as the normal control (containing 5 mmol/L glucose), mannitol (20 mmol/L mannitol), high glucose (containing 25 mmol/L glucose), high glucose + miR-155 mimic (50 nmol/L), high glucose + miR-155 inhibitor (100 nmol/L), high glucose + Scrambled miRNA (50 nmol/L), high glucose + PDTC (100 μmol/L), and high glucose + miR155 (50 nmol/L) + PDTC (100 μmol/L) groups. [score:3]
Taken together, these findings indicate that the increased expression of miR-155 and miR-146a in the DN patients and in the experimental DN animal mo dels was found to contribute to inflammation -mediated glomerular endothelial injury. [score:3]
A, B: miR-155 and miR-146a expressions in the kidney of the DN and controls were confirmed by quantitative real-time PCR. [score:3]
Compared with the control group, the expressions of miR-155 and miR-146a were increased at the time points of week 8 and week 16. [score:2]
Human renal glomerular endothelial cells (HRGECs) cultured under high-glucose conditions were transfected with miR-155 and miR-146a mimics, and the transforming growth factor (TGF)-β1, tumor necrosis factor (TNF)-α, and nuclear factor (NF)-κB expressions were examined by western blot, real-time PCR, and an electrophoresis mobility shift assay. [score:2]
This was found to be mediated by NF-κB, as mutations in the NF-κB binding site of the miR-146a promoter impaired the TNF-α activation effect. [score:2]
Taken together, these findings suggest that miR-155 and miR-146a are not only biomarkers but also mediators in the development of DN. [score:2]
In conclusion, the present study provides direct biological evidence for the pathogenic importance of miR-155 and miR-146a in DN. [score:2]
Compared with the normal controls, the expressions of miR-155 and miR-146a were gradually increased from the time point of week 1 to week 8. *p < 0.05. [score:2]
To confirm the miRNA profiling findings in the human subjects, we used a quantitative real-time PCR to measure the expression of miR-155 and miR-146a in both the human and the rat kidneys. [score:1]
In the monocytic leukemia cell line THP-1, Konstantin et al. [8] observed the induction of miR-146a in response to TNF-α. [score:1]
The sequences of the Dig-labeled probes against miR-155 and miR-146a mRNA were as follows: miR-155: 5′-CCCCTATCACGATTAGCATTAA-3′, miR-146a: 5′-AACCCATGGAATTCAGTTCTCA-3′. [score:1]
Determination of the detailed miR-155 and miR-146a mechanisms that cause renal damage in the setting of diabetes could elucidate the pathogenesis of DN and enable improved treatment strategies to be developed. [score:1]
A linear correlation analysis was performed between the miR-155 and urinary protein (A); miR-155 and serum creatinine (B); miR-146a and urinary protein (C); and miR-146a and serum creatinine (D). [score:1]
C, D: was performed to determine the distribution of miR-155 and miR-146a in the kidneys from the DN patients. [score:1]
The role of the NFκB signaling pathway in miR-155 and miR-146a -mediated renal inflammation and fibrosis. [score:1]
miR-155 and miR-146a were further quantified with a TaqMan quantitative real-time PCR. [score:1]
The miR-155 and miR-146a mimics were double-stranded constructs consisting of a guide and passenger strands. [score:1]
MRLc1 than in C57BL/6 mice, which may have been induced by increased miR-146a [29], as observed in our in situ hybridization results. [score:1]
miR-155 and miR-146a were primarily localized in the glomerular endothelial cells, the mesangial areas and the tubular sections in kidneys from DN. [score:1]
Figure 6 Impact of miR-155 and miR-146a on HRGECs. [score:1]
miR-146a expression was not correlated with serum creatinine levels or urinary protein excretion, this lack of correlation could reflect the limited sample size and consequent low statistical power, therefore, it needs our further investigation with more samples. [score:1]
Furthermore, we investigated the mechanisms by which the nuclear factor (NF)-κB signaling pathway mediates the high glucose -induced expression of miR-155 and miR-146a in cultured human renal glomerular endothelial cells (HRGECs). [score:1]
These findings were further confirmed by a quantitative real-time PCR for miR-155 and miR-146a (Figure 2A,B). [score:1]
A strong nuclear activation of NF-κB was observed in the cells from the miR-155 and miR-146a group (Figure 6G,H). [score:1]
[1 to 20 of 63 sentences]
9
[+] score: 184
These findings collectively indicate that miRNA-146a upregulation in SCI may be driven by proinflammatory cytokines, which in turn negatively regulate the proinflammatory cytokines by downregulating the expression of TRAF6 and IRAK1 [31]. [score:10]
miRNA-146a has been certified to downregulate its target genes TNF receptor -associated factor 6 (TRAF6) and IL-1 receptor -associated kinase 1 (IRAK1), which leads to the inhibition of the inflammatory reaction in macrophages, monocytes, astrocytes, and neurons [14– 17]. [score:8]
Conversely, miRNA-146a expression was upregulated 3 and 7 days after surgery, whereas no remarkable expression differences were observed on the first day after surgery (Figure 2) in the SCI + NC group. [score:8]
However, although several studies have reported that IRAK1 and TRAF6 were downregulated following miRNA-146a overexpression [14– 18], the overexpression did not appear to be responsible for the responses that were observed following SCI recovery. [score:8]
Consistent with this outcome, our data demonstrated that miRNA-146a could suppress the inflammation induced by SCI through downregulating IRAK1 and TRAF6. [score:6]
Furthermore, Xie et al. reported that miRNA-146a, IL-1, IL-6, and TNF- α levels were downregulated when inhibiting NF- κB. [score:6]
Remarkable upregulation of miRNA-146a was not detected on the first day after surgery in the SCI + NC group, and also there was no difference in the expression of miRNA-146a during the experiment in the sham group (Figure 2). [score:6]
These results suggested that miRNA-146a may modulate IRAK1 and TRAF6 expression by directly targeting the 3′-UTR of their mRNA. [score:6]
Our data suggested that miRNA-146a played a repressive role in IRAK1 and TRAF6 expression and subsequently downregulated proinflammation cytokines. [score:6]
Another study examined miRNA expression profiles post-SCI in rats using microarrays [19], which confirmed that there were significant and common changes in miRNA-146a expression. [score:5]
This outcome was consistent with a former study that reported that miRNA-146a inhibited the activation of NF- κB [25] and the expression of some other inflammatory mediators, including TNF-a, IL-6, COX-2, and CXCL12 [15, 26, 27], which suggests an anti-inflammatory effect for miRNA-146a. [score:5]
However, our present data showed that SCI did not change miRNA-146a expression in the early phase (1 day), but the expression of miRNA-146a significantly increased in the maintenance phase (3 and 7 days). [score:5]
Therefore, we speculated that miRNA-146a suppressed the expression of TRAF6 and IRAK1 via binding to the 3′ UTR. [score:5]
MicrOFFTM mmu-miRNA-146a antagomir (RIBOBIO, Guangzhou, China) acted as a high-efficiency antagonist for miRNA-146a and was used for inhibiting the expression of miRNA-146a. [score:5]
Our luciferase assay also indicated that miRNA-146a could repress luciferase expression to directly target the 3′ UTR of TRAF6 and IRAK1 (Figure 5). [score:5]
In the negative control (SCI + NC) group, miRNA-146a was increased (P < 0.05), whereas it was obviously downregulated after the miRNA-146a antagomir injection on the third and seventh day after surgery (Figure 2). [score:4]
Then the upregulation of miRNA-146a may have in turn inactivated this pathway via a negative feedback mechanism so that the IRAK1/TRAF6 pathway would not be overactivated. [score:4]
Although accumulated evidence suggests that miRNA-146a may participate in SCI recovery [5, 8, 24], there is still limited knowledge of the miRNA-146a regulatory networks that modulate genes expression. [score:4]
This result implied that the upregulation of miRNA-146a might be activated by proinflammation cytokines. [score:4]
Lukiw recently reported that an upregulated miRNA-146a might be integral to innate immune or inflammatory brain cell responses in prion -mediated infections and to progressive and irreversible neurodegeneration of both the murine and human brain [23]. [score:4]
However, we did not test whether an overdose of miR-146a mimic could improve the motor function after SCI, as the miRNA-146a level was already greatly upregulated (about 4 times), and the extra overdose of miR-146a mimic would overaffect the inflammatory reaction, which may be possibly harmful to the SCI recovery. [score:4]
IRAK1 and TRAF6 Were Regulated by miRNA-146aCompared to miRNA-146a, the expression of genes IRAK1 and TRAF6 presented the opposite regulation mo del (Figure 3). [score:4]
How miRNA-146a modulates the downstream target genes in SCI is still unknown, given that TRAF6 and IRAK1 play an important role in neuroinflammation [20, 21], and miRNA-146a acts as a key regulator of the inflammatory reaction [15, 16]. [score:4]
In this study, we determined the role of miRNA-146a in SCI and tried to find out how it participated in SCI recovery by regulating its target genes (TRAF6 and IRAK1) using a rat SCI mo del. [score:4]
In order to confirm whether miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6, the 3′-UTR sequence of IRAK1 and TRAK6 was cloned into the 3′ site of the luc2 reporter gene on a plasmid (Promega, USA) to construct a report plasmid. [score:4]
In this sense, inhibition of miRNA-146a could positively regulate proinflammatory cytokines in the rat SCI mo del. [score:4]
Thus, overexpression of miRNA-146a at 7 days after surgery for SCI may be a consequence of an increase in proinflammatory cytokines on previous time (1 day). [score:3]
Moreover, the former study indicated that miRNA-146a negatively regulated the inflammatory response in human gingival fibroblasts by directly binding to the IRAK1 3′-UTR [28]. [score:3]
Increasing expression of miRNA-146a was found in animal SCI mo dels [5, 8]. [score:3]
2.4. miRNA-146a Inhibition. [score:3]
Also, Lu et al. [18] demonstrated that miRNA-146a could attenuate neuropathic pain by suppressing TRAF6 signaling in the spinal cord. [score:3]
Overexpression of miRNA-146a in the Animal Mo del of SCI. [score:3]
Compared to miRNA-146a, the expression of genes IRAK1 and TRAF6 presented the opposite regulation mo del (Figure 3). [score:3]
Therefore, miRNA-146a may serve as a powerful potential therapeutic target for SCI. [score:3]
Furthermore, there is now accumulating evidence suggesting that miRNA-146a participates in the regulation of the innate immune response, which is well known for its regulation of the TLR signaling pathway and proinflammatory cytokines [11– 13]. [score:3]
In fact, Nakasa et al. [29] reported that TNF α and IL-1 β could induce miRNA-146a expression in human rheumatoid arthritis synovial fibroblasts. [score:3]
Therefore, we speculated that miRNA-146a could not only contribute to SCI recovery through inhibition of the IRAK1/TRAF6 pathway but also could be induced by proinflammatory cytokines downstream of the IRAK1/TRAF6 signaling pathway (Figure 8). [score:3]
IRAK1 and TRAF6 Were Regulated by miRNA-146a. [score:2]
In order to detect a direct interaction between miRNA-146a and the IRAK1/ TRAF6 3′-UTR, we, respectively, cloned the IRAK1/ TRAF6 3′-UTR sequence downstream of the luciferase reporter gene. [score:2]
The putative role of miRNA-146a in SCI is still based on in silico predictions, and no direct evidence is reported. [score:2]
After SCI surgery, the rats were divided into 3 distinct groups: one group was injected with miRNA-146a antagomir negative control (SCI + NC), one group was injected with miRNA-146a antagomir (SCI + antagomir), and the last group was given laminectomies without the injection (sham). [score:1]
However, the proinflammatory cytokines kept increasing when the animals were injected with miRNA-146a antagomir (SCI + antagomir) (P < 0.05, Figure 6). [score:1]
The inflammatory cytokines (including TNF- α, IL-1 β, IL-6, IL-12, and RANTES) levels were determined to examine the effects of miRNA-146a on the levels of cytokines at the injured region. [score:1]
Accumulating evidence suggests that miRNA-146a acts as a modulator of the innate immune response and affects the inflammatory cytokine levels in immunological and other brain cell types. [score:1]
But we do not disavow the possibility that overdose of miR-146a mimic may improve the motor function after SCI, which should be certified by further experiment. [score:1]
However, there is currently limited information regarding the role of miRNA-146a and its mechanism of action. [score:1]
Taganov et al. have also shown that miRNA-146a can be induced by NF- κB activation [16]. [score:1]
[1 to 20 of 47 sentences]
10
[+] score: 153
Other miRNAs from this paper: rno-mir-146b, rno-mir-155
In turn, miR-146a could inhibit the activation of NF-κB mediated inflammation via suppressing its target genes expression like IRAK1 and TRAF6 (Li et al., 2015; Lo et al., 2017). [score:9]
In fact, it has been uncovered that miR-146a could suppress the expressions of the NF-κB -mediated inflammatory mediators like COX-2, TNF-α, IL-6 and IL-1β by targeting the 3′-UTR of IRAK1 and TRAF6 mRNA, which are the downstream adaptors of TLRs (Taganov et al., 2006). [score:7]
It has been reported that miR-146a could inhibit NF-κB -mediated signaling pathway by suppressing its target genes, including IRAK1 and TRAF6, which was closely involved in inflammatory and oxidative processes (Liu et al., 2017). [score:7]
Moreover, it was demonstrated that the expression of miR-146a was down-regulated in hippocampus tissues of diabetic rats (Yavari et al., 2016) as well as in the serum of T2DM patients, which may serve as a biomarker of the chronic inflammatory condition (Baldeon et al., 2014). [score:6]
However, there is doubt that whether TQ exerted anti-inflammatory and anti-oxidative effects via increasing the expression of miR-146a, which could suppress the NF-κB signaling pathway. [score:5]
NF-κB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
miR-146a regulates glucose induced upregulation of inflammatory cytokines extracellular matrix proteins in the retina and kidney in diabetes. [score:5]
Furthermore, it was verified that miR-146a could alleviate hyperglycemia induced endothelial inflammation by inhibiting NAPDH oxidase 4 expression (Wang et al., 2014a). [score:5]
Recently, miR-146a was recognized as a potent regulator in inflammatory reaction in various diseases associated with inflammation and oxidative stress (Su et al., 2016; Wan and Li, 2018). [score:4]
MicroRNA-146a-5p mediates high glucose -induced endothelial inflammation via targeting interleukin-1 receptor -associated kinase 1 expression. [score:4]
MicroRNA-146a decreases high glucose/thrombin -induced endothelial inflammation by inhibiting NAPDH oxidase 4 expression. [score:4]
However, there were some disadvantages in our study because we did not directly intervene miR-146a expression to observe its impact on inflammation and oxidative stress. [score:4]
FIGURE 7 The potential mechanisms of miRNA-146a in regulating inflammation and oxidative stress in the brain of chronic T2DM mo dels (activation steps are represented by solid lines and inhibitory effects are represented by dashed lines). [score:4]
The correlations between miR-146a level and the expressions of MDA (Aa) (R [2] = 0.740, p < 0.01), p22phox (Ab), (R [2] = 0.690, p < 0.05), HO-1 (Ac), (R [2] = 0.823, p < 0.01), and SOD (Ad), (R [2] = 0.842, p < 0.01) in the hippocampus. [score:3]
In the cerebral cortex, the correlations between miR-146a level and the expressions of COX-2 (Bb), (R [2] = 0.872, p < 0.01), TNF-α (Bc), (R [2] = 0.895, p < 0.01), and IL-1β (Bd), (R [2] = 0.848, p < 0.01). [score:3]
In addition, miR-146a was reported to exert anti-inflammatory effect in the pathogenesis of various diabetic complications like diabetic nephropathy, retinopathy, neuropathy, cardiovascular disorders, even tending to be a potential biomarker of inflammatory status in these diseases (Yousefzadeh et al., 2015; Bhatt et al., 2016; Chen et al., 2017b; Feng et al., 2017). [score:3]
In this study, the expression of miRNA-146a significantly decreased in cT2DM group ([∗∗] p < 0.01 vs. [score:3]
The expression level of miR-146a was determined using 2 [-ΔΔCt] and normalized using U6 snRNA level as an internal quantitative control. [score:3]
Modulation of hippocampal gene expression of microRNA-146a/microRNA-155-nuclear factor-kappa B inflammatory signaling by troxerutin in healthy and diabetic rats. [score:3]
The difference may be explained by the fact that the expression of miR-146a is dependent on the tissue type, duration of diabetes, and gene polymorphism apart from severity of inflammation (Kaidonis et al., 2016). [score:3]
The correlations between miR-146a level and the expressions of MDA (Ba), (R [2] = 0.935, p < 0.01), p22phox (Bb), (R [2] = 0.796, p < 0.05), HO-1 (Bc), (R [2] = 0.940, p < 0.01), and SOD (Bd), (R [2] = 0.876, p < 0.01) in the cerebral cortex. [score:3]
In addition, miR-146a expression was found obviously decreased in the serum of subjects with T2DM as well as other tissues affected by chronic hyperglycemia like heart, retina, dorsal root ganglion neurons, and hippocampus, which was negatively correlated to the inflammatory state (Wang et al., 2014b). [score:3]
Then, cDNA of miR-146a was synthesized by Mir-X miRNA First-Strand Synthesis Kit (Takara, Japan) while the cDNA of mRNA for target genes including p22phox, IRAK1, TRAF6, and NF-kB p65, was synthesized by PrimeScript [TM] RT Master Mix (Takara, Japan). [score:3]
Interestingly, TQ relieved the inflammation and oxidative stress status accompanied with increased expression of miR-146a. [score:3]
Apolipoprotein E enhances microRNA-146a in monocytes and macrophages to suppress nuclear factor-kappaB -driven inflammation and atherosclerosis. [score:3]
In the hippocampus, the correlations between miR-146a level and the expressions of COX-2 (Ab), (R [2] = 0.861, p < 0.01), TNF-α (Ac), (R [2] = 0.809, p < 0.01), and IL-1β (Ad), (R [2] = 0.909, p < 0.01). [score:3]
The expression of miR-146a can be induced by pro-inflammatory factors and ROS via activating the transcription factor NF-κB, which located at the upstream of the promoter of miR-146a. [score:3]
Impaired miR-146a expression links subclinical inflammation and insulin resistance in Type 2 diabetes. [score:3]
We also examined the mRNA levels of IRAK-1, TRAF6, and NF-κB p65 using qRT- PCR and the results showed the similar changes with the protein expressions (Figures 6E,F), which were negatively correlated with the miR-146a level. [score:3]
Therefore, further research is needed to detect the role of miR-146a in regulating inflammation and oxidative stress in brain impairment of T2DM rats. [score:2]
Deregulation of NF-small ka, CyrillicB-miR-146a negative feedback loop may be involved in the pathogenesis of diabetic neuropathy. [score:2]
Overall, our results indicated that increased status of inflammation and oxidative stress contributed to brain impairment in cT2DM rats, which may be negatively regulated by miR-146a. [score:2]
In addition, the level of miR-146a in the brain may indirectly serve as a negative biomarker of the severity of chronic inflammation and oxidative stress in the brain of cT2DM rats (Figure 7). [score:2]
Knock-out of miR-146a in the mice under diabetic condition resulted in increased pro-inflammatory phenotype and macrophage infiltration (Bhatt et al., 2016). [score:2]
Our results indicated that miR-146a might regulate the inflammation and oxidative stress status in the brain of cT2DM mo dels via NF-κB signaling pathway. [score:2]
MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. [score:2]
It has been uncovered that the level of miR-146a was reversely associated with chronic inflammatory and oxidative processes via a negative feedback regulation. [score:2]
Decreased serum level of miR-146a as sign of chronic inflammation in type 2 diabetic patients. [score:1]
It implied that the level of miR-146a was elevated because of the decreased status of inflammation and oxidative stress, which tended to be a credible comprehensive indicator of inflammation and oxidative stress. [score:1]
FIGURE 5Analysis of the correlation between miR-146a and oxidative status. [score:1]
There existed negative correlations between miR-146a and inflammatory mediators including COX-2, TNF-α, and IL-1β in the hippocampus of cT2DM group (Figures 4Ab– d R [2] = 0.861, p < 0.01; R [2] = 0.809, p < 0.01; R [2] = 0.909, p < 0.01, respectively) and in the cerebral cortex (Figures 4Bb– d R [2] = 0.872, p < 0.01; R [2] = 0.895, p < 0.01; R [2] = 0.848, p < 0.01; respectively). [score:1]
FIGURE 4Analysis of the correlations between miR-146a and inflammatory mediators. [score:1]
Paradoxically, the level of miR-146a was found increased in the sciatic nerve and kidney tissues in chronic T2DM rats. [score:1]
We observed that change in miR-146a was negatively correlated with the levels of oxidant indicators including MDA and p22phox in the hippocampus (Figures 5Aa,b R [2] = 0.740, p < 0.01; R [2] = 0.690, p < 0.05) and in the cerebral cortex (Figures 5Ba,b R [2] = 0.935, p < 0.01; R [2] = 0.796, p < 0.05). [score:1]
While the level of miR-146a was positively correlated with the antioxidant proteins including HO-1 and SOD in the hippocampus (Figures 5Ac,d R [2] = 0.823, p < 0.01; R [2] = 0. 842, p < 0.01) and in cerebral cortex (Figures 5Bc,d R [2] = 0.94, p < 0.01; R [2] = 0.876, p < 0.01). [score:1]
Consistent with previous studies, our study also found the level of miR-146a decreased along with increased level of inflammation in the brain of chronic T2DM rats, while in the TQ group, miR-146a level increased along with reduced inflammation and oxidative stress status. [score:1]
Recently, increasing studies suggested that miR-146a played a vital role in inflammatory process in various disorders including diabetes (Balasubramanyam et al., 2011; Cheng et al., 2013; Li et al., 2015). [score:1]
Subsequently, quantitative real-time PCR (qRT-PCR) of miR-146a was performed with the Mir-X miRNA qRT-PCR SYBR Kit (Takara, Japan) in Applied Biosystem 7300 (Applied Biosystems, Foster city, CA, United States). [score:1]
The role of miR-146a in dorsal root ganglia neurons of experimental diabetic peripheral neuropathy. [score:1]
Recent studies highlighted that miR-146a was closely involved in oxidative stress induced by hyperglycemia (Wan and Li, 2018). [score:1]
MiR-146a Might Regulate Inflammation and Oxidative Stress Status via NF-κB Signaling Pathway. [score:1]
Pearson correlation analysis demonstrated that the change in miR-146a was negatively correlated with the levels of inflammatory mediators. [score:1]
miR-146a mediates inflammatory changes and fibrosis in the heart in diabetes. [score:1]
The level of miR-146a in the hippocampus (Aa) and cerebral cortex tissues (Ba) by qRT-PCR. [score:1]
Convincing data has shown that miR-146a plays a vital role in inflammatory process in various disorders including diabetes mellitus (Balasubramanyam et al., 2011). [score:1]
Analysis of the Correlations Between miR-146a and Inflammation Status. [score:1]
Analysis of the Correlation Between miR-146a and Oxidative Stress Status. [score:1]
[1 to 20 of 57 sentences]
11
[+] score: 79
Other miRNAs from this paper: rno-mir-21, rno-mir-155
To be specific, expressions of miR-155 and miR-21 were downregulated and miR-146a was upregulated after acupuncture treatment. [score:9]
Relatively, expression level of miR-146a was down-regulated significantly in mo del group than in control group and up-regulated significantly in acupuncture group than in mo del group, and there was no significance between acupuncture and control group. [score:9]
Previous studies have suggested the involvement of miRNAs in CAG; we further proved that expressions of miR-155 and miR-21 were upregulated and miR-146a was downregulated in gastric tissues of CAG rats. [score:9]
Relatively, expression level of miR-146a was downregulated significantly in the mo del group compared to that in the control group and upregulated significantly in the acupuncture group compared to that in the mo del group, and there was no significance between the acupuncture and control group. [score:7]
Previous researches have demonstrated that downregulation of miR-146a expression could trigger inflammation response via NF- κB -dependent immunity signaling by increasing thymic stromal lymphopoietin pathway (TSLP) level [43]. [score:6]
These results have suggested that miR-155, miR-21, and miR-146a are potential targets of NF- κB, which are involved in an important signaling pathway in CAG [44], and efficacy of acupuncture in treatment of CAG may take effect by modifying expressions of miR-155, miR-21, and miR-146a via NF- κB pathway, thus to alleviate inflammation reaction of gastric mucosa. [score:5]
Additionally, significant improvements of histological changes in CAG rats after altering NF- κB/miR-155/miR-21/miR-146a expression levels are powerful evidence to validate therapeutic roles of NF- κB-miR-155/miR-21/miR-146a signaling in response to acupuncture treatment. [score:3]
What is more, downstream targets of miR-155/miR-21/miR-146a including I-kappa B kinase epsilon, Fas -associated death domain protein [40], and TSLP [43] have been reported. [score:3]
In conclusion, we proposed that acupuncture may exert its therapeutic effects via NF- κB-miR-155/miR-21/miR-146a signaling, including (1) changes of transcription factors (such as NF- κB); (2) changes of miRNAs (miR-155/miR-21/miR-146a); (3) changes of downstream targets (such as TSLP, remaining inconclusive). [score:3]
Figure S3 showed that acupuncture may exerts its therapeutic effects via NF- κB-miR-155/miR-21/miR-146a signaling, which including (1) changes of transcription factors (such as NF- κB, which evoked by H. pylori infection, physical damage or chemical damage); (2) changes of miRNAs (miR-155/miR-21/miR-146a); (3) changes of downstream targets (such as TSLP, remain inconclusive). [score:3]
Possible limitations of the study include the fact that exact function of miR-155/miR-21/miR-146a, interaction between NF- κB, miR-155, miR-21, and miR-146a, and existence of NF- κB-miR-155/miR-21/miR-146a signaling and its definite downstream targets in response to acupuncture therapy remain inconclusive, which require further researches in the future work. [score:3]
Furthermore, Liu et al. demonstrated that overexpression of miR-146a in chronic gastritis could significantly decrease activity of nuclear factor-kappa B (NF- κB) pathway [24], a well-known signaling pathway of inflammation response, suggesting that miR-146a might play a crucial role in a negative feedback loop to modulate gastric mucosa inflammation. [score:3]
However, there is no definite conclusion on downstream targets of NF- κB-miR-155/miR-21/miR-146a signaling. [score:3]
In conclusion, previous researches have indicated that miR-155, miR-21, and miR-146a may function as inflammation regulators in CAG. [score:2]
Previous researches have shown that miR-155, miR-21, and miR-146a were associated with gastritis [22, 24– 26], indicating that miR-155, miR-21, and miR-146a may function as inflammation regulators in CAG. [score:2]
Therefore, our findings implied that acupuncture may act through transcription factors and subsequent epigenetic changes, such as NF- κB-miR-155/miR-21/miR-146a signaling. [score:1]
Correlations among miR-155, miR-21, and miR-146a. [score:1]
And there were negative correlation relationships between miR-146a and miR-155/miR-21, respectively, indicating antagonism effects of them on CAG. [score:1]
2 [−ΔCt] Values of miR-155, miR-21, and miR-146a. [score:1]
2 [−ΔCt] Values of miR-155, miR-21, and miR-146a Table 4 (and Figure S2) showed 2 [−ΔCt] values of miRNAs obtained from different groups. [score:1]
The abovementioned findings suggested that miR-155, miR-21, and miR-146a were involved in the pathogenesis of CAG and might play an important role in modulation effect of acupuncture in treatment of CAG. [score:1]
Another important miRNA associated with gastritis is miR-146a. [score:1]
Recently, increasing researches have suggested involvement of miRNAs in different processes of gastric carcinogenesis [21, 22], especially miR-155, miR-21, and miR-146a [22– 24]. [score:1]
Fold change (RQ = 2 [−ΔΔCt]) values of miR-155, miR-21, and miR-146a were shown in Table 5. Pearson's test results indicated that there were a positive correlation relationship between miR-155 and miR-21 and negative correlation relationships between miR-146a and miR-155/miR-21, respectively. [score:1]
[1 to 20 of 24 sentences]
12
[+] score: 77
Biochemical pathways potentially regulated by miRNAs differentially expressed in retina of Aβ -injected rats (Figure 3 and Table 4A) and in serum of AMD patients (Figure 4 and Table 4B) have been identified through the web server DIANA-miRPath v. 3. MiR-27a, miR-146a, and miR-155 (Figure 3 and Table 4A), which were up-regulated in retina of Aβ -injected rats, top scored as associated to TGF-β (p = 1 E-10) and prion diseases (p = 2 E-11) pathways. [score:9]
With exception of miRNA-155, down-regulated in serum of AMD patients and in serum of Aβ injected rats, six miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-126) showed an up-regulation in serum of AMD patients. [score:7]
We found down-regulation of miR-155 in serum of AMD patients and Aβ injected rats; whereas we found up-regulation of miR-155 in the retina of Aβ injected rats, along with miR-27a and miR-146a. [score:7]
Furthermore, regulation of prion diseases pathway by miR-27a, miR-146a, and miR-155, reinforces the hypothesis that AMD can be a protein misfolding disease, such as AD, due to deposition of Aβ oligomers in drusen bodies. [score:6]
In accordance to the finding of Ménard et al. (2016), we found that miR-146a is up-regulated in plasma of AMD patients and in the retina of Aβ -injected rats; furthermore this miRNA is dysregulated also in AD patients (Kiko et al., 2014; Müller et al., 2014; Denk et al., 2015; Ménard et al., 2016). [score:5]
In fact, miR-155 and miR-27a can target 42 genes involved in the TGF-β pathway (DIANA-miRPath), while miR-146a can target genes involved in inflammatory pathways (Toll-like receptor, NF-κB, TNF signaling pathways). [score:5]
Interestingly, miRNA-146a is found also down-regulated in cerebrospinal fluid (CSF) of AD patients (Kiko et al., 2014; Müller et al., 2014; Denk et al., 2015). [score:4]
Analysis of these 13 miRNAs revealed that 7 miRNAs showed a significant up-regulation in serum of AMD patients in comparison to control group (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-155, and miR-126). [score:4]
In particular, up-regulation of miR-9, miR-23a, miR-27a, miR-34a, miR-126, and miR-146a was found in serum of AMD patients. [score:4]
Intravitreal injection of Aβ induced the up-regulation of three miRNAs in rat retina: miR-27a, miR-146a, and miR-155 (Table 2 and Figure 1). [score:4]
Recently, miRNAs were analyzed in vitreous and plasma of exudative AMD patients, by means of non-biased miRNA arrays and validation with qPCR; miRNA-146a was found to be significantly up-regulated both in vitreous and plasma of AMD patients (Ménard et al., 2016; Berber et al., 2017). [score:4]
In conclusion, the modified miRNA levels we found in rat retina (miR-27a, miR-146a, miR-155) and serum of AMD patients (miR-9, miR-23a, miR-34a, miR-126, miR-27a, miR-146a, miR-155) suggest that, among others, miR-27a, miR-146a, and miR-155 have an important role in AMD and could represent suitable biomarkers and appealing pharmacological targets. [score:3]
Incidentally, we showed that changes in circulating levels of some miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-126, miR-146a, miR-155) as found in AMD patients are associated to Alzheimer's disease and modulate genes involved in neurodegenerative and inflammatory pathways. [score:3]
The following groups of miRNAs were analyzed: miR-27a, miR-146a, miR-155 miR-9, miR-23a, miR-27a, miR-34a, miR-126,miR-146a, miR-155 miR-155 GraphPad Prism (version 4.0; GraphPad Software, San Diego, CA, USA) was used for statistical analysis and graphical representation of miRNA differential expression data. [score:3]
Three miRNAs were found to be dysregulated both in AMD patients and in retina of Aβ -injected rats (miR-27a, miR-146a, miR-155). [score:2]
Figure 3 Scatter distribution of pathways regulated by miR-27a, miR-146a, and miR-155. [score:2]
The potential link between AMD and AD is also in line with the deregulation of insulin receptor signaling by miR-27a, miR-146a, and miR-155 (Giuffrida et al., 2012; Gontier et al., 2015; Takach et al., 2015; Han et al., 2016; Sajan et al., 2016; Table 4A). [score:2]
Differential regulation of microRNA-146a and microRNA-146b-5p in human retinal pigment epithelial cells by interleukin-1β, tumor necrosis factor-α, and interferon-γ. [score:2]
MiR-27a, miR-146a, and miR-155 have been reported to be associated to the inflammatory pathways mTOR, TNFα, HIF signaling, and NF-κB (Romano et al., 2015). [score:1]
[1 to 20 of 19 sentences]
13
[+] score: 77
In agreement with the aforementioned studies, the dramatic downregulation of miR-146a over the disease course possibly causes the NF- κB activation and Th1 clonal expansion and, ultimately, the intraocular inflammation observed in this disease. [score:8]
Meanwhile, miR-146a-5p, miR-147b, and miR-155-5p were significantly downregulated from day 7 and were repressed along the disease course, reaching the lowest level of expression at day 15. [score:8]
As current evidence clearly delineated the regulation between miR-146a and NF- κB, and the immune -inhibitory role has been consistently validated through various autoimmune diseases and uveitis, miR-146a can be a promising therapeutic target. [score:8]
Additionally, the Th1 lineage is normally suppressed by miR-146a through the targeting of STAT-1 expression and the activation of Treg cells [37]. [score:7]
In situ hybridization in the iris/ciliary body tissue over the 14 days following disease induction (Figure 4) confirmed the reduced expression of miR-146a-5p and enhanced expression of miR-182-5p in the eyes examined. [score:7]
miR-146a-5p, miR-155-5p, miR-147b, and miR-223-3p were downregulated, while miR-182-5p, miR-183-5p, and miR-9-3p were upregulated. [score:7]
While the miR-146a gene is transcriptionally activated in response to NF- κB activation, it inhibits TRAF6 and IRAK1 and, hence, dampens NF- κB expression [20, 22, 23]. [score:5]
The decreased expression of miR-146a in a Chinese population with Behçet's disease has also been noted [40]. [score:5]
By attenuating tumor necrosis factor (TNF) receptor -associated factor 6 (TRAF6) and interleukin- (IL-) 1 receptor -associated kinase 1 (IRAK1), miR-146a was observed to affect downstream NF- κB expression and, finally, inhibit inflammation [22, 23]. [score:5]
Among the miRNAs studied, miR-146a-5p, miR-155-5p, miR-182-5p, and miR-183-5p are four particularly crucial miRNAs for the following reasons: they all show significant differential profiles in the disease course; they all regulate NF- κB pathway, and miR-146a-5p and miR-155-5p are regarded as potent immunological drivers; they all have been reported in some uveitis mo dels. [score:4]
Genetic studies on human uveitis revealed the association of the downregulated genotype of a single nucleotide polymorphism of miR-146a, rs2910164, with increased susceptibility to juvenile idiopathic arthritis [38] and microvascular leakage in pediatric uveitis [39]. [score:4]
The expression levels of miR-146a-5p, miR-155-5p, miR-182-5p, and miR-183-5p in iris/ciliary bodies and popliteal lymph nodes are shown in Figure 3. The levels of miR-146a-5p and miR-155-5p in the popliteal lymph nodes reached their lowest point earlier, on day 7, while those in the iris/ciliary body tissue kept decreasing until day 15 after immunization. [score:3]
The regulation of miR-146a and NF- κB is bidirectional and encompasses both innate and adaptive immunity. [score:3]
Oligonucleotide probes specific for the two selected miRNAs (miR-146a-5p and miR-182-5p) were labeled at the 5′ end with digoxigenin. [score:1]
The eight miRNAs studied were miR-155b-5p, miR-21-5p, miR-146a-5p, miR-9-3p, miR-147b, miRNA-183-5p, miRNA-182-5p, and mi -RNA-223-3p. [score:1]
The earlier changes of miR-146a-5p and miR-155-5p in the popliteal lymph nodes than in the iris/ciliary bodies also demonstrate the immunoanatomical fact that antigen presentation with T cell maturation has already taken place in the closest draining lymph node. [score:1]
[1 to 20 of 16 sentences]
14
[+] score: 77
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
These miRNAs were chosen as representative of the different patterns that were observed: up-regulation (miR-21-5p) or down-regulation (miR-222-3p) during latency; up-regulation (miR-181c-5p) or down-regulation (miR-500-3p) in the chronic period; up-regulation (miR-146a-5p) or down-regulation (miR-551b-3p) in the entire course of the disease. [score:21]
Continuing modifications in the expression pattern of miRNAs in the course of chronic epilepsy support the hypothesis that epileptogenesis is a dynamic process that continues even after the initial diagnosis of the disease, i. e. after the initial spontaneous seizures 1. The comparison between chronic epileptic rats and the human cases identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that are similarly up-regulated in expression levels in both species. [score:10]
Continuing modifications in the expression pattern of miRNAs in the course of chronic epilepsy support the hypothesis that epileptogenesis is a dynamic process that continues even after the initial diagnosis of the disease, i. e. after the initial spontaneous seizures 1. The comparison between chronic epileptic rats and the human cases identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that are similarly up-regulated in expression levels in both species. [score:10]
Finally, other subsets of miRNAs were either up-regulated (miR-23a-3p, miR132-3p, miR-146a-5p, miR-154-3p, miR-181d-5p, miR-212-3p, miR-212-5p, miR-344b-5p, miR-380-3p, miR-410-3p, miR-433-3p and miR-3584; Fig. 2, Supplementary Fig. S4), or down-regulated (miR-29c-5p, miR-30a-5p, miR-30c-2-3p, miR-30e-3p, miR-138-5p, miR-140-3p, miR-551b-3p and miR-652-3p; Fig. 2, Supplementary Fig. S5) during all phases of the disease. [score:9]
Second, the chronic phase was accompanied by significant alterations in miRNA expression in the rat GCL, and comparison with data from epileptic patients identified several miRNAs (notably miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that were up-regulated in both human and rat epileptic hippocampus. [score:6]
We identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that were up-regulated in both epileptic humans and rats (Table 1). [score:4]
Cluster 3 was composed by two up-regulated microRNAs, miR-142-3p and miR-146a-5p. [score:4]
The other 24 performed the analysis in plasma samples obtained from the trunk blood, reporting an increase in miR-142-5p levels during the acute phase, miR-21-5p in the early stage and of miR-146a-5p in the chronic stage, that reflect parallel changes in miRNAs expression observed in the brain. [score:3]
In fact, the expression patterns of miR-20b-5p, miR-142-3p, miR-181d-5p, miR-212-5p, miR-344b-5p and miR-674-3p were identical to those observed using the microarray, and those of miR-21-5p and miR-146a-5p were very similar, although not identical (Fig. 4). [score:3]
Moreover, the comparison displayed similar changes in expression levels between epileptic (human cases and rats) and controls, except for miR-146a-5p, that increased more in rats than in humans (fold change equals 21.24 in rats and 3.63 in humans). [score:3]
In keeping with this idea, evidence in the literature supports that miR-146a-5p regulates the astrocyte -mediated inflammatory response by influencing IL-1β, IL-6 and COX-2 signaling 24 30. [score:2]
Cluster 3 (that includes miR-142-3p and miR-146a-5p) and cluster 4 (including miR-181c-5p and miR-181c-5p) are connected to the “cytokine-cytokine receptor interaction” signaling pathway, which suggests a neuroinflammatory role for those miRNAs. [score:1]
Interestingly, miR-23a-5p and miR-146a-5p are in common with the other two rat data sets that were taken as primary comparator in this 23 24. [score:1]
[1 to 20 of 13 sentences]
15
[+] score: 75
In contrast, miR21 expression was up-regulated in contused subjects (p [miR21] < 0.001), and there was no change in the expression of miR146a. [score:8]
This overall pattern replicates key components of our earlier study (Strickland et al., 2011), which showed that a contusion injury down-regulates miR1, miR129, and miR124, and up-regulates miR21 and miR146a. [score:7]
A step-wise linear regression analysis revealed that variation in miR124, miR21, and miR146 accounted for a significant proportion of the variation in IGF-1 mRNA expression, and that miR21 and miR124 accounted for variation in BDNF mRNA expression, suggesting that both BDNF and IGF-1 regulation involves a network of miRNAs. [score:6]
In addition, differences in expression of miR124 were accounted for by variation in the expression of miR1, miR129-2, and miR146a, suggesting that these miRNAs may be co-regulated. [score:6]
FIGURE 4 Correlation analyses to assess the relationship between miR146a miRNA expression and expression of miR1, miR21, and miR124 following SCI. [score:5]
Our previous study showed that miR1, miR124, and miR129 were significantly down-regulated following a spinal cord contusion, while miR146a and miR21 were transiently induced (Strickland et al., 2011), and that these miRNAs were sensitive to opioid analgesics like morphine (Strickland et al., 2014). [score:4]
For example, miR124 suppresses activation of resting microglia and macrophages prior to injury, and both miR21 and miR146a have been shown to negatively regulate astrocyte activation following SCI (Ponomarev et al., 2011; Bhalala et al., 2012; Iyer et al., 2012; Willemen et al., 2012; Kynast et al., 2013). [score:4]
We found that the contusion injury increased expression of miR21 and miR146a at 1 h relative to the sham control. [score:3]
FIGURE 1 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 1 h following tailshock treatment. [score:3]
Contused rats exhibited increased miR21 and miR146a expression 1 h after shock treatment. [score:3]
FIGURE 2 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 1 day following tailshock treatment. [score:3]
miR1 and miR146a exhibited an overall difference across spinal regions because expression was somewhat less in the ventral portion. [score:3]
Both miR21 [F [(2,13)] = 15.4, p < 0.0003] and miR146a [F [(2,13)] = 6.2, p < 0.01] were significantly increased following SCI (all post hoc comparisons relative to sham control, p < 0.02), and exposure to intermittent tail shock did not result in further alterations of miRNA expression (Figure 1). [score:3]
FIGURE 3 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 7 days following tailshock treatment. [score:3]
There was also a significant interaction effect of time and treatment on miR124 expression, and of time, treatment, and spinal region on miR1, miR129-2, and miR146a (all Fs > 3.68, p < 0.05). [score:3]
The change in miR146 appeared, in contrast, to fade over days, with the only significant increase observed in the dorsal region of shocked rats at 1 day. [score:1]
Three main clusters of miRNAs correlate significantly together: miR1 correlates with miR21, miR124, miR129-2, and miR146a, miR124 correlates with miR1, miR129-2, and miR146a, and miR146a correlates with miR1, miR21, and miR124. [score:1]
For IGF-1, the analyses revealed that miR124, miR21, and miR146a (in that order) each accounted for an independent proportion of the variance (all Fs > 6.36, p < 0.05), and together explained 42.3% of the variance. [score:1]
miR1 miR21 miR124 miR129-2 miR146a BDNF mRNA Pearson correlation 0.069 0.332** -0.289* -0.164 0.154 Sig. [score:1]
MicroRNA-146a: a key regulator of astrocyte -mediated inflammatory response. [score:1]
Pearson’s correlations indicated a significant correlation between miR1 (black diamonds), miR21 (white squares), and miR124 (gray triangles), and miR146a (Pearson’s r = 0.59, P < 0.001, Pearson’s r = 0.69, P < 0.001, and Pearson’s r = 0.39, P < 0.005, respectively). [score:1]
miR1 miR21 miR124 miR129-2 miR146a miR1 Pearson correlation 0.282* 0.575** 0.349** 0.589** Sig. [score:1]
We previously reported that miR1, miR21, miR124, miR129-2, and miR146a were significantly affected by a spinal cord contusion (Strickland et al., 2011). [score:1]
mRNA Primers Forward Reverse BDNF TGGACATATCCATGACCAGAAA CACAATTAAAGCAGCATGCAAT IGF-1 CCGCTGAAGCCTACAAAGTC GGGAGGCTCCTCCTACATTC GAPDH AGTATGTCGTGGAGTCTACTG TGGCAGCACCAGTGGATGCAG miRNA Primers/cat# Target Sequence Sequence reference hsa-miR-1/#204344 UGGAAUGUAAAGAAGUAUGUAU MIMAT0000416 hsa-miR-21-5p/#204230 UAGCUUAUCAGACUGAUGUUGA MIMAT0000076 hsa-miR-124-3p/#204319 UAAGGCACGCGGUGAAUGCC MIMAT0000422 hsa-miR-129-2-3p/# 204026 AAGCCCUUACCCCAAAAAGCAU MIMAT0004605 hsa-miR-146a-5p/# 204688 UGAGAACUGAAUUCCAUGGGUU MIMAT0000449 U6 snRNA/# 203907 All data were analyzed using SPSS software version 18 (SPSS; Chicago, IL, USA). [score:1]
Post hoc univariate ANOVAs indicated a main effect of time on miR1, miR21, miR124, and miR146a, a main effect of treatment on miR1, miR21, miR124, and miR129-2, and a main effect of spinal region on miR1 and miR146a (all Fs > 9.14, p < 0.005). [score:1]
In combined analysis of data obtained from both dorsal and ventral spinal cord, and at both 1 and 7 days, there were significant correlations between miR1 and miR21, miR124, miR129-2, and miR146a (Figure 4A), between miR124 and miR1, miR129-2, and miR146a, and between miR146a and miR1, miR21, and miR124 (for all Pearson’s rs, p < 0.05, see Table 3; Figure 4B). [score:1]
[1 to 20 of 26 sentences]
16
[+] score: 66
Other miRNAs from this paper: rno-mir-146b
In fact, upregulation of miR146a has been detected in active multiple sclerosis lesions [51], in human Alzheimer disease (AD) brain [52] and in prion disease [50], [53], indicating an underlying common inflammatory response to different neurological insults. [score:8]
miRNA-146a transcripts were used as the target gene in order to validate the best reference genes for normalization of relative expression in epileptogenesis induced by PILO. [score:5]
Particularly, for the analysis of the expression of mir146 (used here as target gene) in the epileptogenic process, the U6snRNA has been used as a reference gene, also, without previous validation [22], [39]– [42]. [score:5]
In order to validate the results obtained, we conducted a relative expression analysis of the miRNA-146a gene, whose mRNA expression pattern in the hippocampus of animal mo dels of TLE is known [22], [25], [42], [45], comparing all experimental and control groups. [score:5]
Conversely, when reference genes were individually employed for normalization, we failed to detect upregulation of miRNA-146a in the hippocampus of epileptic rats. [score:4]
In fact, four independent studies using RT-qPCR showed the up-regulation of miR-146a in the hippocampus of rat and human with epilepsy, even using a normalization approach based on only one reference gene (U6snRNA) and without prior stability analysis [22], [40]– [42]. [score:4]
Indeed, in PILO and electrical stimulation TLE mo dels, prominent upregulation of miRNA-146a was evident at 1-3 week after SE and persisted in the chronic phase [22], [39]– [42]. [score:4]
miR-146a can be induced by different pro-inflammatory stimuli and has been shown to be upregulated in experimental mo dels of epilepsy, as well as in human TLE. [score:4]
This is in line with other studies supporting an immunomodulatory role ascribed to miR-146a in several human neurodegenerative diseases associated with a strong inflammatory component [49], [50]. [score:3]
Thus, Iyer et al. [45] observed that seizures alone may not account for changes in miR-146a expression. [score:3]
It remains unclear how the induction of mir146 expression may contribute to the etiopathogenesis of TLE. [score:3]
In human TLE with hippocampal sclerosis, increased astroglial expression of miR-146a was observed mainly in regions where neuronal cell loss and reactive gliosis occurred [22]. [score:3]
Similarly, Iyer et al. [45] showed an overexpression of mir-146a in epilepsy -associated glioneuronal lesions. [score:3]
In fact, mir146 is overexpressed in all epilepsy associated condictions tested, including PILO and electrical stimulation TLE mo dels and human TLE with hippocampal sclerosis [22], [39]– [42]. [score:3]
Moreover, emerging data suggest that miR-146a is induced as a negative-feedback regulator of the glial -mediated inflammatory response associated to the epileptogenic process [22], [42], [45]. [score:2]
Interestingly, under our experimental conditions, the use of a reference gene individually for normalization leads to the relative transcript levels of the mir-146a gene to be different from those obtained with the best combinations of genes, and hence probably less accurate. [score:1]
Accordingly, when normalized using the best combination of two or three reference genes, we observed that miR-146a transcript levels were significantly increased in the chronic stage. [score:1]
Finally, as a validation strategy, we used each one of the candidate reference genes to measure PILO -induced changes in miRNA-146a, a gene whose expression pattern variation in PILO -injected mo del is known [42]. [score:1]
Relative quantities of miR-146a in the hippocampus of the systemic PILO- injected rats upon different normalization approaches. [score:1]
In order to evaluate the functional significance of the results obtained for reference genes, we conducted a relative expression analysis of the miR-146a gene, whose pattern is already described for the PILO -injected mo del. [score:1]
Using the best combination of three reference genes for normalization, miRNA-146a transcripts were found to be significantly increased in the chronic stage, which is consistent with the pattern reported in different mo dels. [score:1]
The diagram shows mean levels of miR-146a transcripts in naive animals, epileptogenesis (0 h and 24 h) and chronic period. [score:1]
[1 to 20 of 22 sentences]
17
[+] score: 65
Several microRNAs involved in inflammation have also been shown to undergo changes in expression following astrocyte activation in vitro [101], including the upregulation of miR-146 and the downregulation of miR-455, which is in agreement with our results. [score:9]
This would likely be the case for the observed increases in the expression of the cell death inducers caspase 3 [69], [70] and Fas [71], the expression of which parallels the decreased expression of their regulators, the let7/miR-98 family members miR-96 and miR-146a. [score:8]
Moreover, the microRNAs miR-103, miR-107, miR-133a, miR-145, mir146a and miR-98, which presented altered expression at 7 days after SCI in both Liu's study [6] and ours, demonstrated significant alterations in the expression of their targets, according to De Biase et al. [7]. [score:7]
Conversely, changes in microRNA expression may reduce the activation of the inflammatory NF-κB Ρpathway; for example, this may have occurred via the decreased expression of miR-124 and miR-181b at 3 and 7 days after injury and the increased expression of miR-15, miR-223 and miR-146a (Table 8). [score:7]
For miR-146a and miR-145, no significant variations in expression were found, although there was a trend toward downregulation. [score:6]
Interestingly, miR-146a upregulation is driven by NF-κB, which in turn is negatively regulated by this microRNA [88], [95]. [score:5]
Expression changes respect to control/sham 1 dpo 7 dpo Name Liu Present Liu Present rno-miR-130b 1.42 NE rno-miR-146a 1.72 INC S rno-miR-15b 1.15 DEC NS rno-miR-17 1.74 INC NS rno-miR-18a 2.71 NE 3.41 NE rno-miR-200c 4.12 NE rno-miR-206 3.26 NE rno-miR-20a 1.69 NC rno-miR-20b-5p 1.83 NE rno-miR-21 1.37 INC S rno-miR-214 2.01 INC NS rno-miR-219-5p −1.82 DEC S rno-miR-221 1.1 NE rno-miR-223 3.58 INC S 3.4 INC S rno-miR-24-2* 2.41 DEC NS rno-miR-290 3.66 INC NS 2.96 DEC S rno-miR-378 1.31 INC NS rno-miR-410 −1.21 NE rno-miR-466b 3.05 DEC S rno-miR-541 1.11 INC S rno-miR-874 2,8 NEData restricted to microRNAs with significant changes in expression (2-fold or greater) according to Liu et al. [6]. [score:5]
Nakanishi et al. [5] observed similar changes in miR-223 and miR-124 expression, which were also observed by Liu et al. [6], and these studies also identified coincident expression changes in miR-21, miR-146a, and miR-17, among others. [score:5]
Thus, overexpression of miR-146a at 7 dpo may be a consequence of an increase in NF-κB on previous days [96], which in turn may have caused the inactivation of this pathway via a negative feedback mechanism. [score:3]
A similar conclusion was reached by Strickland et al. [44], who reported a significant correlation between BBB functional score and the expression levels of specific microRNAs (miR-129-2 and miR-146a). [score:3]
When the changes in expression were analyzed at 7 dpo, miR-21 and miR-146a levels were found to be significantly increased at 7 dpo in comparison to the control and sham groups. [score:3]
MicroRNAs miR-21, miR-223, miR-146a, and miR-219-5p showed significant expression changes in our study (identified with both a t-test and a Rank Product test) as well as in other reports [6], [25]. [score:3]
We validated the changes in the levels of the microRNAs miR-21, miR-223, miR-146a, miR-219-5p, miR-29c, miR-468, miR-145 and miR-107 using Q-PCR. [score:1]
[1 to 20 of 13 sentences]
18
[+] score: 64
Likewise, down-regulation of miR-146a (1.905±0.26) was followed by an increased expression of its target mRNA, PTPN1 (5.175±0.28). [score:8]
miR-29a, miR-144, miR-150, miR-192 and miR-320 showed an up-regulation from that of control samples whereas miR-30d, miR-146a and miR-182 showed down-regulation. [score:7]
Binding of insulin to insulin receptor may be suppressed by several inhibitors such as PTPN1, a potential mRNA target of miR-146a. [score:7]
miR-150, miR-182 and miR-30d showed contrasting expressions in IFG and T2D while miR-146a was down-regulated in both cases. [score:6]
miR-146a expression was the lowest in the adipose (−4.62±0.036) while miR-30d which was postulated to participate in insulin gene transcription [49], showed the lowest expression in pancreas (−2.81±0.004). [score:5]
However, reduced expression of miR-146a may lift the suppression of PTPN1 gene, allowing the latter to impair insulin signaling. [score:5]
miR-144, miR-146, miR-182 and miR-192 showed a lower expression compared to the other miRNAs in the three insulin target tissues as well as in the pancreas. [score:4]
We identified miR-146a, miR-182 and miR-30d to be among the highly down-regulated miRNAs across all five sources. [score:4]
Among the novel miRNAs (miR-144, miR-146a, miR-150 and miR-182) identified, miR-144 had the highest up-regulation upon T2D in most tissues. [score:4]
We have found that down-regulation of miR-146a to be greater in T2D than IFG (Fig. 5B, 6A). [score:4]
The eight miRNAs (miR-144, miR-146a, miR-150, mR-182, miR-192, miR-29a, miR-30d and miR-320) which were previously identified in the rat study showed similar expression in the patients' blood miRNAs. [score:3]
The authors investigated the expression of seven diabetes-related miRNAs (miR-9, miR-29a, miR-30d, miR-34a, miR-124a, miR-146a and miR-375), four (miR-29a, miR-30d, miR-175 and miR-146a) of which were also found to be dysregulated in our study. [score:2]
We have also identified eight important miRNAs (miR-144, miR-146a, miR-150, miR-182, miR-192, mir-29a, miR-30d and miR-320) that could participate in the regulation of insulin signaling as well as useful in distinguishing different stages of diabetes progression. [score:2]
However during the course of our study, involvement of miR-146a in diabetes was reported by another group of researchers along with other diabetes-related miRNAs [58], [59]. [score:1]
Predictions: miR-144/ IRS1; miR-146a/ PTPN1; miR-150/ GLUT4 and CBL; miR-182/ FOXO1; miR-192/ INSR; miR-30d/ INS; miR-29a and miR-320/ AKT2. [score:1]
Employing miRNA microarray and stem-loop real-time RT-PCR, we identify four novel miRNAs, miR-144, miR-146a, miR-150 and miR-182 in addition to four previously reported diabetes-related miRNAs, miR-192, miR-29a, miR-30d and miR-320a, as potential signature miRNAs that distinguished IFG and T2D. [score:1]
[1 to 20 of 16 sentences]
19
[+] score: 56
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Of the three ZT06 groups that illustrated differential expression of miRNAs due to CD, emphasis was placed on the two-week chronic ZT06 group due to the differential expression of miRs 146a and 146b, and miR-127 (Figures 5A-5B and 6A). [score:11]
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Differentially expressed miRNAs based on Illumina sequencing in all the circadian-disrupted samples and their links to breast cancer development and circadian rhythms. [score:10]
Figure 5 A. Mean relative expression of miR-146a based on Illumina sequencing, * p-adjusted < 0.1, N = 6. B. Mean relative expression of miR-146b based on Illumina sequencing, * p-adjusted < 0.1, N = 6. C. Western immunoblotting images of phospho-NFκB (p65) and β-actin from a 6% SDS-PAGE gel for the two-week chronic ZT06 group. [score:5]
The present study shows that CD results in a direct increase of NF-κB activity in mammary tissues and that this activity may be linked to CD -induced downregulation of miR-146a and 146b (Figure 5). [score:5]
The expression of miR-146a and 146b has been shown to suppress NF-κB activity [33, 34]. [score:5]
A. Mean relative expression of miR-146a based on Illumina sequencing, * p-adjusted < 0.1, N = 6. B. Mean relative expression of miR-146b based on Illumina sequencing, * p-adjusted < 0.1, N = 6. C. Western immunoblotting images of phospho-NFκB (p65) and β-actin from a 6% SDS-PAGE gel for the two-week chronic ZT06 group. [score:5]
In the two-week chronic ZT06 group, two miRNAs from the same gene family, miR-146a and 146b, were downregulated (Table 2). [score:4]
Finally, in the two-week chronic ZT06 group, both miR-146a and miR-146b, which belong to the same gene family, were downregulated (Tables 1 & 2). [score:4]
This indicates that CD causes aberrant expression of Tudor-SN, which may be linked to increased NF-κβ activity through CD -induced repression of miR-146a and 146b. [score:3]
In terms of its link to cancer progression, Tudor-SN has been shown to promote resistance to apoptosis and to be induced by NF-κB, which as mentioned above, was increased in the CD -induced tissues through potentially decreased miR-146a and 146b expression (Figure 5) [45, 49]. [score:3]
With respect to miR-146a and 146b activity, the results illustrated higher quantities of the transcriptionally active form of NF-kappaB (Figure 5). [score:1]
[1 to 20 of 11 sentences]
20
[+] score: 54
The cluster and heatmap of all detected rat miRNAs in this study are plotted and shown in Figure 1. The miRNA microarray differential analysis resulted in 24 significantly deregulated miRNAs as shown in Table 1, and the heatmap of these 24 aberrantly expressed miRNAs is plotted and shown in Figure 2. Among the 24 significantly deregulated miRNAs, 9 miRNAs (miR-146a, -211, -203, -210, -152, -31, -23a, -34a, -27a) were up-regulated and 15 miRNAs (miR-138*, -301a, -136, -153, -19a, -135b, -325-5p, -380, -190, -33, -542-3p, -144, -542-5p, -543, -296*) were down-regulated (differentially expressed miRNAs were defined by a fold-change >1.5, either up-regulated or down-regulated; * p <0.05). [score:19]
As seen in Figure 3, the expression levels of miR-146a, miR-210 and miR-27a were up-regulated, while the expression levels of miR-135b and miR-33 were down-regulated (* p < 0.05). [score:11]
The miRNA microarray detected 9 up-regulated miRNAs (miR-146a, -211, -203, -210, -152, -31, -23a, -34a, -27a) and 15 down-regulated miRNAs (miR-138*, -301a, -136, -153, -19a, -135b, -325-5p, -380, -190, -542-3p, -33, -144, -542-5p, -543, -296*). [score:7]
There were some common differentially expressed miRNAs in the two studies; e. g., both detected an up-regulation of the inflammation -associated miR-146a and the apoptotic miR-23a. [score:6]
The five differentially expressed miRNAs (miR-146a, miR-210, miR-27a, miR-135b and miR-33) in the TLE rat hippocampus as detected by the Rat miRNA microarray were confirmed using qPCR (Data are presented as the mean ± SEM, * p <0.05; n = 6/TLE rats, n = 6/control). [score:3]
To validate the altered expression of miRNAs as detected by miRNA microarray, miR-146a, miR-210, miR-27a, miR-135b and miR-33 were selected for confirmation by quantitative real-time PCR. [score:3]
Some of the deregulated miRNAs (miR-146a, miR-210, miR-27a, miR-135b and miR-33) were confirmed using qPCR. [score:2]
Interestingly, the significantly deregulated inflammation -associated miR-146a detected in a TLE patient by Aronica et al. [9] and in the rat mo del of TLE by Song et al. [17] and our research was not identified in Kan’ work. [score:2]
Before Kan’s work in human TLE, Aronica et al. had also published a paper focused on a single inflammation -associated miR-146a in TLE patients [9]. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 42
It has been reported that the expression of miR-146a, miR-155, and miR-132 is upregulated in monocytes after exposure with TNF-α [38], but our study showed only the expression miR-146a was increased in T cells after chronic exposure to TNF-α. [score:8]
Li et al. showed that TNF-α upregulated miR-146a expression in RA T cells [11]. [score:6]
Li J Wan Y Guo Q Zou L Zhang J Fang Y Altered microRNA expression profile with miR-146a upregulation in CD4+ T cells from patients with rheumatoid arthritisArthritis Res Ther. [score:6]
The expression levels of 12 miRNAs, including miR-139-3p, miR-204, miR-760, miR-432, miR-524-5p, miR-136, miR-548d-3p, miR-206, miR-214, miR-383, miR-224, and miR-887 were significantly lower, whereas the expression level of miR-146a was significantly higher, in Jurkat cells after being cultured with TNF-α for 7 days (fold change > 4, p < 0.05, Fig.   1b). [score:5]
A differential expression pattern between systemic lupus erythematosus and RA T cells was found in the expression of miR-146a and miR-21 [5]. [score:5]
Initial analysis revealed 12 miRNAs were significantly lower, whereas the expression level of miR-146a was significantly higher in Jurkat cells after being cultured with TNF-α for 7 days. [score:3]
Li et al. showed that the expression level of miR-146a was increased in CD4+ T cells of RA patients and was closely correlated with TNF-α level [11]. [score:3]
Therefore, the pathologic role of decreased expression of miR-214 in T cells from patients with RA might be an insufficient negative feedback to stop the inflammatory response similar to the role of miR-146a in the immunopathogenesis of RA [5]. [score:3]
Our results also showed that the expression of miR-146a increased in Jurkat cells after being cultured with TNF-α, but not in RA T cells. [score:3]
[1 to 20 of 9 sentences]
22
[+] score: 42
Upregulation or downregulation of miRNAs previously implicated in aGvHD pathogenesis such as the miR-17-92 cluster, miR-29a, miR-29b, miR-146a, or miR-155 did not reach significance in the NanoString analysis. [score:7]
miR-146a is also suggested to regulate differentiation of Th1 cells and more recently to critically control Treg functions through direct targeting of STAT1 (14). [score:5]
Particular miRNAs associated with aGvHD include miRNAs that enhance T-cell activation, such as miR-155 (4, 10), miR-142 (11), miR-29a, miR-29b, and the miR-17-92 cluster (12), and miRNAs that repress T-cell activation, such as mir-146a (13), which is also upregulated in T regulatory cells (Tregs) (14). [score:5]
These miRNAs were not among the significantly differentially expressed miRNAs as detected by the NanoString analyses, but we clearly observed higher expression levels of miR-146a and miR-155 in skin tissue, but not in intestines, liver, and lung, by qRT-PCR. [score:5]
miR-146a is shown to target Traf6 and Irak and thereby negatively regulate cytokine signaling and activation of the transcription factor NF-κB (33). [score:4]
We found clear upregulation of miR-146a and miR-155, but not of miR-29a, miR-29b, miR-19b, or miR-20a in skin (Figure 4A and data not shown). [score:4]
Figure 4 Upregulation of miR-146a and miR-155 in skin but not liver, lung, and intestines during aGvHD. [score:4]
The expression of miR-146a and miR-155 is induced by lipopolysaccharide, which in the context of aGvHD is released as a consequence of breached epithelial barriers during pretransplantation irradiation. [score:3]
Differential Expression of miR-146a and miR-155 in Skin. [score:3]
The miR-17-92 cluster, miR-146a, and miR-155 have been previously implicated in aGvHD, where they are shown to regulate different aspects of T cell allo-activation (4, 10, 12, 13, 30) or T helper cell differentiation (31). [score:2]
[1 to 20 of 10 sentences]
23
[+] score: 26
Although the mechanism of miR-146 -mediated tumor suppression is still unclear, EGF-R was identified as a target of this miR [42]. [score:5]
Increased miR-146 and a subsequent decline of EGF-R expression are associated with decreased proliferation, and inhibited invasion and migration of tumor cells in breast, pancreatic and gastric cancer [43, 44]. [score:5]
The rejuvenating effects of miR-146 on fibroblasts are associated with inhibition of IL-6 expression [40], a key mediator of the senescence -associated secretory phenotype [41]. [score:5]
Mouse miR-146 knockout mo dels strongly support a role for miR-146 as a tumor suppressor for myelo-lymphoid cells [45]. [score:4]
Meanwhile, miR-146 may appears to act as a tumor suppressor for many solid and hematological malignancies [42]. [score:3]
Globally (among abundant and non-abundant miRs), miR-146a was 87-fold up-regulated in human CDC-EVs compared with MSC-EVs (p<0.01; Figure 6C) and only 6.2-fold higher compared with rat-CDC-EVs. [score:2]
Both IL-6 and EGF-R were negatively modulated by CDC-EVs in our study, supporting the simplistic idea that CDC-EVs may act as a source of miR-146 as one possible anti-oncogenic mechanism. [score:1]
Next, in comparing EV miRs (Figure 6B), we observed that miR-146a was exclusive for human CDC-EVs and miR-92a was exclusive for human and rat CDC-EVs among the most abundant miRs. [score:1]
[1 to 20 of 8 sentences]
24
[+] score: 24
This is consistent with the up-regulation of miR-31a-3p and-5p and down-regulation of miR-146a-5p in SHR as compared to WKY. [score:6]
MiR-146a, which was downregulated in the current study, has also been related to cardiovascular disease. [score:5]
However, in contrast to our study, miR-146a was found to be up-regulated in human atherosclerosis [27]. [score:4]
In endothelial cells, down-regulation of miR-146a is associated with production of extracellular matrix proteins in the context of diabetes [29]. [score:4]
WKY 6 weeks 5 months rno-miR-31a-5p 5.8 5.5 rno-miR-31a-3p 2.8 7.8* rno-miR-31a-3p 3.5 16.9* rno-miR-146a-5p 0.5 0.3* The upper part lists miRNAs that are differentially expressed upon maturation in WKY and SHR (5 months vs. [score:3]
In addition, at 5 months of age a significant decrease in the expression of miR-146a-5p was found in SHR as compared to WKY (Fig 2B). [score:2]
[1 to 20 of 6 sentences]
25
[+] score: 23
Other miRNAs from this paper: rno-mir-21, rno-mir-223, rno-mir-155
Since in our experiment the sucrose group rats had a mild hyperglycemia, we think that, as others have suggested, miR-146a upregulation through EVs may be an anti-inflammatory mechanism important in the controls of insulin sensitivity induced by inflammatory mediators [25]. [score:4]
Thus, it is possible that upregulation of circulating miR-146a on hyperglycemia may start in EVs, as seen in our chronically exposed rats. [score:4]
The changes seen in the expression of miR-146a and miR-155 may reflect part of the functional adaptations after a chronic exposure to high sucrose, in this case probably related to the innate immune response. [score:3]
In patients with newly diagnosed type 2 diabetes miR-146a is elevated [24] and may diminish as disease progresses [23]. [score:3]
In a mo del of endotoxemia in mice, it has been reported that exosomal miR-146a inhibits while miR-155 promotes the inflammatory response in some contexts [29]. [score:3]
The higher levels of miR-146a observed only in the RNA from the plasma EVs in the sucrose group may consider that miR-146a levels are associated with several diseases, including diabetes [23, 24]. [score:3]
Thus, the alternated increase of miR-146a and reduction miR-155 in plasma EVs could be part of the miRNA -mediated modulation of the inflammatory response. [score:1]
The relative abundance of miRNAs present in plasma EVs was miR-223 > miR-21 > miR-155 > miR-146a (Figure 3). [score:1]
Such is the case of miR-21, miR-146a, miR-155, and miR-223 [9– 11]. [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 22
To replicate the findings obtained using TLDA array plate, we selected three miRNAs that were upregulated (mir-124, miR-218, miR-29a) and three, miRNAs that were downregulated (miR-146a, miR-200c, miR-155) based on their highest degree of significance by chronic CORT treatment and re-analyzed their expression individually by qPCR. [score:9]
When most significantly upregulated or downregulated miRNAs (for example, miR-124, miR-218, miR-146a and miR-155) were further analyzed, we found that these miRNAs had at least three simple GR elements (Supplementary Figure 1). [score:7]
[60] Several axonal guidance, cytoskeleton and cell adhesion genes (ABL1, EPHA10, NFATC1, PLCB3, ACTC1) that are critical for structural plasticity [61] are predicted to be targeted by miR-351 and miR-146a. [score:3]
For example, miR-218, miR-324-5p, miR-365 and miR-146a were localized on chromosome 10; miR-764-5p and miR-351 on chromosome X; miR-101 and miR-30e on chromosome 5; miR-582 and miR-137 on chromosome 2; miR-153 and miR-203 on chromosome 6; miR-124 and 181a on chromosome 3 and miR-135a*/miR-135a-3p and let-7i on chromosome 7. Some of the miRNAs that were localized on the chromosome and in close proximity showed the same direction of changes. [score:2]
We confirmed this finding by analyzing the six most significant CORT -induced altered miRNAs (miR-218, miR-124, miR-29a, miR-146a, miR-200c, miR-155) by qPCR. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 20
The results of this study showed that miR-146a-5p, which is reported to suppress activation and proliferation of HSCs through directly targeting of the Wnt1 and Wnt5a genes [20], was differently expressed in the liver. [score:8]
MiR-335 is reportedly involved in the inhibition of proliferation, migration, and invasion of hepatic stellate cells (HSCs), while miR-146a-5p suppresses activation and proliferation of HSCs in nonalcoholic fibrosing steatohepatitis, and miR-18a-5p increases differentiation of vascular smooth muscle cells. [score:5]
The expression patterns validated by qPCR agreed with those of the microarray data, which confirmed that miR-335, miR-18a-5p, and miR-146a-5p were expressed in the liver (Fig.   4). [score:5]
Thus, our results suggest that miR-146a-5p and miR-335 might play important roles in the regulation of hepatic fibrosis at the post-transcriptional level following C. sinensis infection. [score:2]
[1 to 20 of 4 sentences]
28
[+] score: 19
The unique miRNA expression patterns distinguishing the ASH group from the control group were composed of six downregulated (miR-199a-3p, miR-214, miR-93, miR-146a, miR-191 and let-7b) and six upregulated (miR-129, miR-490, miR-21, miR-503, miR-183 and miR-185) miRNAs. [score:9]
Similarly, the specific miRNA profile of AFL consisted of five downregulated (miR-93, miR-451, miR-221, miR-17-5p and miR-146a) and three upregulated (miR-200c, miR-490 and miR-195) miRNAs, in comparison to the control group. [score:7]
Wiskott-Aldrich syndrome protein family member 1 (Wasf1), which was found to be regulated by miR-17-5p, miR-93, miR-191, miR-451, miR-146a and miR-140, has been shown to be a protective alcohol-responsive gene in the prefrontal cortex of human alcoholics (38). [score:2]
Among the dysregulated miRNAs, miR-490 exhibited an increment in the ASH and AFL groups, while miR-140, miR-7a, miR-451, miR-93, miR-146a and miR-191 levels exhibited a decline in the ASH and AFL groups compared with the respective controls (Table II). [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 18
Interestingly, among the miRNAs found to be upregulated in exosomes in response to cytokines, several of them including miR-146a, miR-146b, miR-195, miR-290a-3p, miR-362-3p and miR-497 are known to be involved in cell death [29- 34]. [score:4]
Overexpression of miR-146a (Additional file 1: Figure S1) resulted in a time -dependent elevation of the level of this miRNA recovered in the exosome preparations (Figure  2D). [score:3]
Overexpression of miR-146a in MIN6B1 cells. [score:3]
As shown in Figure  2, miRNAs known to be expressed at high level in beta-cells [26- 28], such as miR-7, miR-29a and miR-146a, were released in exosomes by MIN6B1 cells and human islets. [score:3]
MIN6B1 cells were transiently transfected for 48 h or 72 h using Lipofectamine 2000 [TM] (Invitrogen) according to manufacturer’s instructions with pMSCV-miR146 (or pMSCV-control plasmid) or with oligo-cel-miR-238 (containing the mature sequence of C. elegans miR-238). [score:1]
MIN6B1 cells were transfected with a control pMSCV plasmid (Ctl) or with a plasmid coding for miR-146a (m146a). [score:1]
D) MIN6B1 cells were transfected with a control pMSCV plasmid (pMSCV-ctl) or with a plasmid coding for miR-146a (pMSCV-m146a). [score:1]
As expected, miR-7, miR-29a and miR-146a released by MIN6B1 cells were protected from confirming that they resided inside the exosomes (Figure  2C). [score:1]
The amount of miR-7, miR-29a and miR-146a recovered in exosomes was measured by qPCR and is expressed as percentage of the corresponding miRNA present inside MIN6B1 cells (A) or human islets (B). [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 17
Other miRNAs from this paper: rno-mir-7a-1, rno-mir-7a-2, rno-mir-7b, rno-mir-27a, rno-mir-145
For example, miR-7 inhibits the invasion and metastasis of cancer cells by regulating Egfr expression [24– 26]; miR-145 inhibits cell proliferation of lung adenocarcinoma by targeting Egfr [27], miR-146a suppresses tumor growth and progression by targeting Egfr in prostate cancer [28]; miR-27a regulates non-small lung cancer by targeting Egfr [29]. [score:17]
[1 to 20 of 1 sentences]
31
[+] score: 17
The most upregulated miRNAs were miR-146a-5p, miR-132-5p, miR-21-5p at 1.63, 1.61, and 1.56-fold of the control, respectively, while the most downregulated miRNAs were miR-29b-3p, miR-352, miR-30e-5p at 0.60, 0.70, and 0.72-fold of the control, respectively. [score:7]
We found common expression of 9 miRNAs (miR-132, miR-137, miR-139, miR-29a, miR-324, miR-352, miR-282, miR-146a, and miR-23a) when our data were compared to a data set describing miRNA expression 60 d after pilocarpine -induced status epilepticus [24]. [score:4]
For example, miR-146a is restricted to astrocytes and is overexpressed in activated astrocytes in human temporal lobe epilepsy and in experimental mo dels [56- 58]. [score:3]
There are 6 common miRNAs (miR-138, miR-301a, miR-33, miR-34a, miR-146a, and miR-23a) between our data set and work of Hu et al. who studied miRNA expression profiles in a pilocarpine -induced mo del of epilepsy [23]. [score:3]
[1 to 20 of 4 sentences]
32
[+] score: 17
Eleven of the altered miRNAs were downregulated (miR-122, miR-93*, miR-872, miR-7*, miR-146a, miR-342-3p, miR-150, miR-139, miR-30a, miR-30e, miR-320), whereas three miRNAs, namely miR-463*, miR-34c* and miR-1188, were upregulated in the RYGB group. [score:7]
In particular, miR-342-3p, miR-320, miR-139-5p and miR-146a were predicted to be involved in multiple neurological transmitter and receptor-related pathways, as well as two major neurodegenerative disease -associated pathways (Parkinson's and Huntingtons diseases), suggesting that RYGB surgery may modulate neurological activity through a miRNA -mediated gut-brain axis. [score:5]
Decreased plasma levels of miR-342-3p, miR-320, miR-139-5p and miR-146a observed in our study suggest RYGB surgery impact on multiple neurodegenerative disease-related pathways. [score:3]
TCA cycle intermediates including citrate, succinate, 2-oxoglutarate and fumarate are positively correlated with miR-143, miR-126-3p, miR-146a, miR-150 and miR-155. [score:1]
In addition to miR-342-3p and miR-34c*, miR-872*, miR-463*, miR-30e, miR-2183, miR-1971, miR-150, miR-146a, miR-1188 and miR-93* all correlate with liver energy metabolism processes, such as glycolysis and glycogenesis involving glucose, glycogen and lactate. [score:1]
[1 to 20 of 5 sentences]
33
[+] score: 17
In a rat mo del of STZ -induced diabetes, miR-146a was downregulated in retinal endothelial cells at 1 month after diabetes onset [26], but was upregulated in the retina and in retinal endothelial cells at 3 months after diabetes onset [27], which agreed with our findings. [score:7]
The negative-feedback effect on NF- κB activation suggests that miR-146a could serve as an alternative target for DR treatment through NF- κB inhibition. [score:5]
Previous work showed that miR-146a was upregulated and functioned in negative-feedback regulation of the nuclear factor (NF)- κB-activation pathway in the retinal endothelial cells of diabetic rats at 3 months after diabetes onset [27]. [score:5]
[1 to 20 of 3 sentences]
34
[+] score: 15
MiRNAs exhibiting old-age expression included miR-21, miR-146a (Figure  6A,C), and members of the miR-29 family (miRa/b/c), which exhibit low expression at young age with increasing expression at older ages (78 and 104 weeks) (Figure  5J-L). [score:7]
Of the nine miRNAs in this IRI-specific expression signature, six showed differential expression in our study (four of which exhibited increasing expression with age, including miR-21, miR-146a, miR-192, and miR-194) (Figure  6). [score:7]
For example, nine miRNAs (miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805, and miR-194) have been identified in C57BL/6 mice as promising biomarkers of kidney injury after renal ischemia reperfusion injury (IRI) [15]. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 14
Mor et al. [13] reported in their study activation of miRNA-146a in the astrocyte activation process in response to LPS and INF- γ. Upregulation of miRNA-146a has been also detected in active multiple sclerosis lesions [40], in human Alzheimer's disease brain [41] and in TLE [22, 42], suggesting a key role of this miRNA in governing astrocyte activation and function in these pathologies. [score:6]
miRNA-146a was upregulated in the activated astrocyte in our work. [score:4]
Iyer et al. [43] found that miRNA-146a was induced as a negative-feedback regulator of the astrocyte -mediated inflammatory response and suggested a role for miRNA-146a -mediated regulation of inflammation in glial cells. [score:3]
Moreover, miRNA-125b and miRNA-146a are involved in astroglial cell proliferation and in the innate immune and inflammatory response [30]. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 14
Other miRNAs from this paper: rno-let-7f-1, rno-let-7f-2, rno-mir-141, rno-mir-221, rno-mir-146b
BCPAP cells express high levels of miR-146-5p, which reduces SMAD4 basal expression [31]. [score:5]
Our hypothesis is that miR-146-5p contributes to regulate cell migration and invasion through the targeting of SMAD4 in normal and tumor thyroid cell lines. [score:4]
Cells overexpressing miR-146-5p (PC-CMV-146b) and control groups (PC-CMV-ø and PCCl3-WT) were cultured and submitted to transwell migration and invasion assays for 24 h. After this period, miR-146b-5p expression (a) and cell viability (b) were evaluated. [score:2]
Geraldo MV Fuziwara CS Friguglieti CU Costa RB Kulcsar MA Yamashita AS MicroRNAs miR-146-5p and let-7f as prognostic tools for aggressive papillary thyroid carcinoma: a case reportArq Bras Endocrinol Metabol. [score:1]
PCCl3-WT: normal thyroid follicular cell line, PC-CMV-ø: cell transfected with an empty vector, PC-CMV-146b: cell transfected with the miR-146-5p genomic region. [score:1]
PCCl3-WT: non tumor rat thyroid follicular cell line, PC-CMV-ø: cell transfected with an empty vector, PC-CMV-146b: cell transfected with the miR-146-5p genomic region. [score:1]
[1 to 20 of 6 sentences]
37
[+] score: 14
Other miRNAs from this paper: rno-mir-19b-1, rno-mir-19b-2, rno-mir-143, rno-mir-145
There are some miRNAs that have been reported to be differentially down-regulated (e. g., miR -29c, -195, -652) or upregulated (miR-146a, -21, miR-143, etc) in activated HSCs, indicating the expression level of miRNA were consistent at certain degree in the process of HSC activation. [score:9]
It has reported that miR-19b decreased COL-I expression 32, while miR-146a induced α-SMA expression 33. [score:5]
[1 to 20 of 2 sentences]
38
[+] score: 14
Other miRNAs from this paper: rno-mir-26a, rno-mir-26b
We found that miR-146a was highly expressed in microglia (but was very low in neurons and astrocytes), consistent with its expression primarily in myeloid lineage cells (O’Connell et al., 2011; Ponomarev et al., 2013). [score:5]
Finally, we screened two miRNAs: miR-26 highly expressed in the CNS (Smirnova et al., 2005), and miR-146a, an important regulator of innate immune responses in microglia (Rom et al., 2010; Saba et al., 2012; Ponomarev et al., 2013). [score:4]
miR-146a was highly expressed in microglia, but as expected, it was nearly undetectable in both astrocytes (P = 0.006) and neurons (P = 0.001). [score:3]
1 TGC TCG CGA CCT CAA TGT A GGT AGA AGC AGA GCG GAC TT JMJD8 Jmjd8 NM_001014116.1 TGG ACG ATT CGG TCT GCT TT ACT CTG TTT CCA TCC CCC TTC Mina53 Mina53 NM_153309.2 ATG CCA AAG AAA GTG AAG CCC GTA GCT CCT CTT TCA CCT GCT PHF2 Phf2 NM_001107342.1 TCA GAC ACC AGA ATG TCC AGC TCG GGC CAG TAG TTT TCC AC PHF8 Phf8 NM_001108253.1 TTT GGG ACC GTG GAC GTT T GTC AGA AAG GCA GCA ACA AGC UTX Kdm6a NM_009483.1 CCA CCC TGC CTA GCA ATT CA CCA CCT GAG GTA GCA GTG TG UTX Uty NM_009484 ATT ATC TCT CAC TAC TGC TGC CC CGA AGA AGC TGC TGT CTA ATC CAC snoRNA135/Snord65 NR_028541.1 AGT ACT TTT TGA ACC CTT TTC CA snoRNA234/Snord70 NR_028554.1 TTA ACA AAA ATT CGT CAC TAC CA mir-26 NR_029742.1 GGT TCA AGT AAT CCA GGA TAG GCT mir-146a NR_031892.1 TGA GAA CTG AAT TCC ATG GGT T were performed on delta C [T] values using Sigma Plot 11.0 software. [score:1]
1 TGC TCG CGA CCT CAA TGT A GGT AGA AGC AGA GCG GAC TT JMJD8 Jmjd8 NM_001014116.1 TGG ACG ATT CGG TCT GCT TT ACT CTG TTT CCA TCC CCC TTC Mina53 Mina53 NM_153309.2 ATG CCA AAG AAA GTG AAG CCC GTA GCT CCT CTT TCA CCT GCT PHF2 Phf2 NM_001107342.1 TCA GAC ACC AGA ATG TCC AGC TCG GGC CAG TAG TTT TCC AC PHF8 Phf8 NM_001108253.1 TTT GGG ACC GTG GAC GTT T GTC AGA AAG GCA GCA ACA AGC UTX Kdm6a NM_009483.1 CCA CCC TGC CTA GCA ATT CA CCA CCT GAG GTA GCA GTG TG UTX Uty NM_009484 ATT ATC TCT CAC TAC TGC TGC CC CGA AGA AGC TGC TGT CTA ATC CAC snoRNA135/Snord65 NR_028541.1 AGT ACT TTT TGA ACC CTT TTC CA snoRNA234/Snord70 NR_028554.1 TTA ACA AAA ATT CGT CAC TAC CA mir-26 NR_029742.1 GGT TCA AGT AAT CCA GGA TAG GCT mir-146a NR_031892.1 TGA GAA CTG AAT TCC ATG GGT T Statistical analyses were performed on delta C [T] values using Sigma Plot 11.0 software. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 13
Of the 30 miRNAs they found upregulated in traumatic spinal cord injury, miR-223, miR-214, miR-20b-5p, miR-17, miR-146a, miR-199a-3p, miR-221-3p, miR-146b, and miR-145 were also upregulated in our study, and among the 16 downregulated miRNAs in traumatic spinal cord injury, miR-34a and miR-338 were also downregulated after ventral combined with dorsal root avulsion in our study. [score:13]
[1 to 20 of 1 sentences]
40
[+] score: 12
Notably, miR-31 and miR-146a were differentially expressed in ZD6/ZD12 esophagus as they were in ZD3 esophagus, albeit at a lower expression level. [score:5]
Using the nanoString platform, miRNA expression profiles distinguished the highly preneoplastic/proliferative marked-ZD esophageal phenotype with a 5-miRNA signature (miR-31, -223, -21, -146b, -146a), from the less proliferative, mild-ZD phenotype with a 3-miRNA signature (miR-146a, -31, -223). [score:3]
These findings show that moderate and mild-ZD induces alterations in miRNA expression, including miR-31 and miR-146a. [score:3]
Similarly, ZD6 esophagus had a 4-miRNA signature (miR-146a, -31, -146b, -27a; up 1.9-1.4 fold) and ZD12 esophagus a 3-miRNA signature (miR-146a, -31, -223; up 1.8-1.4 fold). [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 12
[5– 7] Certain noncoding RNA molecules (microRNAs), such as miR-9, miR-22 (Gene ID: 407004), and miR-146 (Gene ID: 406938), have been reported to modify target gene expressions by targeting their mRNA 3′untranslated regions (UTR). [score:9]
In retrospect, such miRNAs as miR-9, miR-27 (Gene ID: 407018), miR-140 (Gene ID: 406932), and miR-146 have been indicated to be abnormally expressed in OA patients. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 12
Overexpression of miRNA-146a (a brain-enriched miRNA and upregulated in AD patients) led to reduction of Akt activation and induction of proapoptotic caspase-3 to induce cell apoptosis via inhibition of lipoprotein-related protein 2 (LRP2) [9]. [score:8]
2015.00168 26300842 9. Zhang B. Wang L. L. Ren R. J. Dammer E. B. Zhang Y. F. Huang Y. Chen S. D. Wang G. MicroRNA-146a represses LRP2 translation and leads to cell apoptosis in Alzheimer’s disease FEBS Lett. [score:4]
[1 to 20 of 2 sentences]
43
[+] score: 12
Four of the differentially expressed miRNAs (miR-9, miR-143, miR-146a, let-7d) were validated independently in samples from these 3 groups. [score:3]
Four of the differentially expressed miRNAs (miR-9, miR-143, miR-146a, and let-7d) were selected for qPCR validation. [score:3]
We found that miR-146a, miR-9, miR-143 and let-7d might be connected with learning and memory ability through review of the literature and prediction of the target gene[16, 17, 18]. [score:3]
Compared to the other 2 groups, 21 miRNAs are upregulated in 6-hour group as shown in the upper portion of Fig. 2, miR-9, miR-204, miR-335, miR-23a, miR-708, miR-146a, miR-325-5p, miR-106b, miR-143, miR-140, miR-376b-3p, miR-7a, miR-541, miR-185, miR-499, miR-127*, miR-320, miR-140*, miR-145*, miR-423*, miR-378. [score:3]
[1 to 20 of 4 sentences]
44
[+] score: 11
Li J. Huang J. Dai L. Yu D. Chen Q. Zhang X. Dai K. miR-146a, an IL-1β responsive miRNA, induces vascular endothelial growth factor and chondrocyte apoptosis by targeting Smad4 Arthritis Res. [score:3]
Li et al. proposed that expression of miR-146a in chondrocytes contributes to OA pathogenesis by diminishing the response to transforming growth factor β (TGF-β) [18]. [score:3]
Jin L. Zhao J. Jing W. Yan S. Wang X. Xiao C. Ma B. Role of miR-146a in human chondrocyte apoptosis in response to mechanical pressure injury in vitro Int. [score:1]
miR-146a has also received much attention since 2008 although its function in OA pathology is still controversial. [score:1]
Furthermore, more and more individual miRNAs, including miR-27b, miR-34a, miR-140, and miR-146a, have been linked to arthritis pathogenesis [6, 13, 14]. [score:1]
However, a different study supports a mo del in which miR-146a plays a protective anti-inflammatory role in OA [19]. [score:1]
Furthermore, miR-146a was shown to be involved in human chondrocyte apoptosis in response to mechanical injury, and may contribute to the pathogenesis of OA [20]. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 11
Other miRNAs from this paper: rno-mir-21, rno-mir-155
And it has been reported that acupuncture can down-regulate the expression of miR-21, NF-γB p65 and miR-155 and up-regulate the expression of miR-146a in rats with CAG [16]. [score:11]
[1 to 20 of 1 sentences]
46
[+] score: 9
Picking out 7 miRNAs associated with heart failure and taking statistical analysis, our data reveal that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p,rno-miR-146a-5p, and rno-miR-1-3p. [score:4]
Picking out 7 miRNAs associated with heart failure and taking statistical analysis, we found that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p, rno-miR-146a-5p, and rno-miR-1-3p (Figure 5(b)). [score:4]
Among these antiheart failure -associated miRNAs, we explicitly focused on miR-146a, which was predicted to influence myocardial fibrosis through TGF-beta 1/Smad signal transduction pathway during CHF [28, 29]. [score:1]
[1 to 20 of 3 sentences]
47
[+] score: 8
For example, miR-146a can inhibit toll-like receptor signaling pathway-related proteins to suppress the inflammatory response (Li J. et al., 2014; O’Connell et al., 2012; Zhang et al., 2012). [score:5]
One study has shown that serum miR-93, miR-146a, miR-31 are significantly upregulated in VD compared to controls (Dong et al., 2015). [score:3]
[1 to 20 of 2 sentences]
48
[+] score: 8
As depicted in Fig 6, among the miRNAs elevated in serum in our study, LPS has been shown to increase expression of miR-10a, miR-100, miR-508/511, miR-30c, and miR-125b in human fibroblast-like synoviocytes [41], increase expression of miR-146a in a human monocyte cell line [42], and increase miR-21 in cultured murine monocytes [43]. [score:5]
Among the individual miRNAs previously associated with endothelial cell and monocyte activation and sepsis in humans and rodents [27– 29], we found increases in our study of miR-16, miR-21, miR-126, miR-146a, miR-150, miR-511, and miR-23b. [score:1]
Among these, miR-150, miR-23b, and miR-146a have been previously identified as potential circulating mediators or biomarkers of inflammatory pathways in sepsis. [score:1]
An in vivo study of LPS administration to rats described amelioration of inflammation in response to a 20-hydroxyeicosatetraenoic acid analog in concert with decreases in miR-150 [40] In a recent review of miRNA in septic patients, changes in circulating levels of miR-150 and miR-146a were common findings, however any consistent association with clinical outcome remains ill-defined [27]. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 8
For instance, miR-223 was strongly up-regulated in hepatic IRI, whereas miR-122 and miR-146a were markedly down-regulated [11– 13]. [score:7]
Several studies have suggested the important roles of miRNAs in I/R injury, such as miR-122, miR-124, miR-146a, miR-223, miR-370 [11– 15]. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 8
Administration of a novel immunosuppressant FK778 or inhibition of miR-146a significantly reduces coronary restenosis and arterial neointima formation, a phenomena that is accompanied by the upregulation of vasorin levels [23, 28– 32]. [score:8]
[1 to 20 of 1 sentences]
51
[+] score: 7
miR-146a and miR-155 displayed similar expression between groups C-C and C-HF of our study (see Supplemental Table 4; padj-values > 3.0E-01). [score:3]
miR-146a and −155 however displayed trends of up-regulation in groups HF-C and HF-HF when compared to group C-C (FCEs: 1.7–2.0; padj-values < 7.0E-02). [score:3]
miR-146a and miR-155 appeared to play specific roles in brain inflammatory responses (Cardoso et al., 2016). [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 7
For instance, over -expression of miR-146a suppresses transforming growth factor-beta (TGF-β) -induced HSC proliferation, and increases HSC apoptosis via its target Smad4 [4]. [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 7
For example, miR-223 regulates TLR-triggered IL-6 and IL-1β production by targeting Signal transducer and activator of transcription (STAT3) [19] and miR-146 exerts negative feedback regulation of TLRs and cytokine receptor signaling via targeting IL-1 receptor -associated kinase (IRAK)1 and TNF receptor -associated factor (TRAF)6 [20]. [score:7]
[1 to 20 of 1 sentences]
54
[+] score: 7
On the other hand, Lukiw et al. suggested that miRNA-146a -mediated modulation of complement factor H (an important repressor of the inflammatory response of the brain) gene expression may in part regulate an inflammatory response in AD brain and in stressed HN cell mo dels of AD [37]. [score:4]
In this context, the rise in miR-146a expression seen in the BFMC group could be related to changes in inflammatory processes; again, further ad-hoc research is needed. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 7
For liver cancer, one recent study reported that miR-21, miR-31, miR-122, miR-221, miR-222 were significantly up-regulated in HCC tissues, whereas miR-145, miR-146a, miR-200c, and miR-223 were found to be down-regulated [15]. [score:7]
[1 to 20 of 1 sentences]
56
[+] score: 6
Moreover, the induction of miR-146a may be protective against lung injury by suppressing TLR4 -induced NF-κB-regulated gene expression and promoting the M2 macrophage phenotype in acute respiratory distress syndrome [21]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
Additionally, miR-146-5p expression was increased in human renal cortices with documented severe kidney injury or fibrosis [44]. [score:3]
The expression of miR-146-5p was shown to be increased with fibrosis in a mouse mo del of folic-acid -induced kidney injury, and in mouse mo dels of ischemia/reperfusion injury and unilateral urethral obstruction -induced fibrosis [44]. [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 6
Factors that may explain the refractory response include the reported age-related decrease in TLR4 expression on splenocytes [38] or the altered p38 MAPK signaling [36], or in the case of peritoneal macrophages [39], the increase in expression of the negative feedback regulator of TLR signaling, miR-146a [40]. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 5
Taganov K. D. Boldin M. P. Chang K. J. Baltimore D. NF-κB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responsesProc. [score:5]
[1 to 20 of 1 sentences]
60
[+] score: 5
Other miRNAs from this paper: rno-mir-203a, rno-mir-203b
For an instance, miR-146a inhibits TGF-β1 -induced HSC differentiation, at least in part, via decreasing the expression of SMAD4 [27]. [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
Other miRNAs from this paper: rno-mir-301a, rno-mir-130a, rno-mir-130b, rno-mir-301b
The qRT-PCR data revealed that the expression of miR-301a, but not miR-146a, was decreased at 2, 6, 12 and 24 h after OGD -induced injury in cultured cortical neurons (Fig.   4a, b). [score:3]
The data are normalized to that in Sham 1. b, The expression of miR-146a in cultured cortical neurons at different time following OGD insult are measured by qRT-PCR. [score:1]
miR-146a is not altered at 2, 6, 12 & 24 h after OGD insult (n = 3, ANOVA test). [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 5
MiR-146a, an IL-1 β-responsive miRNA, impairs TGF- β signaling pathway through the targeted inhibition of Smad4 in cartilage. [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
Dong S. Xiong W. Yuan J. Li J. Liu J. Xu X. MiRNA-146a regulates the maturation and differentiation of vascular smooth muscle cells by targeting NF-κB expression Mol. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Other miRNAs from this paper: rno-mir-132, rno-mir-155
For example, the expression levels of miR-146a, miR-155, and miR-132 decreased by 93 ± 3% with increasing donor age [40]. [score:3]
Furthermore, miR-155 and miR-146a are present in exosomes and pass between immune cells in mice [35]. [score:1]
It was reported that miR-155 and miR-146a were released from dendritic cells within exosomes and were subsequently internalized by recipient dendritic cells in order to reprogram the cellular response to endotoxin [35]. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 4
Several miRNAs are demonstrated that associated with OA development and modulation such as miR-18a (chondrocyte differentiation), miR-27b (controlling the expression of MMP-13), miR-34a (prevention of cartilage degradation), miR-140 and miR-222 (controlling cartilage homeostasis), miR-146 (promotion of inflammatory OA), miR146a (OA cartilage pathogenesis), miR-675 (cartilage repair) [30, 31]. [score:4]
[1 to 20 of 1 sentences]
66
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
Notably, transfection of cells with miR-146a decreased LPS -induced IFNγ. [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 4
Other miRNAs from this paper: rno-mir-34a, rno-mir-96
Previous studies indicated that up-regulation of miR-146a was detected in rat mo dels and patients with temporal lobe epilepsy (TLE) 14, 41, 42, playing a role in the modification of posttranscriptional inflammation. [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 4
Other miRNAs from this paper: rno-mir-338, rno-mir-93
CXC chemokine receptor-4 (CXCR4) signalling has been shown to contribute to the maintenance and development of BCP by activating astrocytes and microglia as well as sensitizing neurons [5], and miR-622 and miR-146a were found to be related to CXCR4 expression [6, 7]. [score:4]
[1 to 20 of 1 sentences]
69
[+] score: 4
Recent studies revealed that miR-19b, miR-30a, miR-301a promoted the progression of periodontitis [4] and miR-146a, miR-98 were upregulated to contribute to the progression of OA [10]. [score:4]
[1 to 20 of 1 sentences]
70
[+] score: 3
The literatures of miR-208 on cardiovascular diseases were more than miR-146. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Overexpression of miR-34a, miR-146a, miR199a-5p or miR-29 in MIN6 cells negatively impacts on beta cell function [6]. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Other miRNAs from this paper: rno-mir-206, rno-mir-146b
Except miR-146, Saos-2 and chondrosarcoma overexpressed these contributory miRNAs. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
Murine macrophages incubated with paclitaxel had significantly increased expression of miR-155, miR-147, miR-146a and miR-132 30. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
To test whether the anti-inflammatory effects of D-4F are related to miR expression, expression of miRs (miR-124a, miR-126, miR-146a, miR-153, miR-155) related to inflammation, BBB integrity and DM were measured in the ischemic brain of control and D-4F treated T1DM stroke rats. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
Li et al. [13] reported spinal miR-146a and -183 cluster expression in osteoarthritic pain of knee joints. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a
Concerning microRNAs (miRNAs), BPA exposure of human placental cell lines has been shown to alter miRNA expression levels, and specifically, miR-146a was strongly induced by BPA treatment. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Zhang L Combination therapy with VELCADE and tissue plasminogen activator is neuroprotective in aged rats after stroke and targets microRNA-146a and the toll-like receptor signaling pathwayArterioscler. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 2
Other miRNAs from this paper: rno-mir-203a, rno-mir-146b, rno-mir-203b, rno-mir-155
MiR-146, miR-155 and miR-203 regulate arthritic inflammatory response and joint destruction 31. [score:2]
[1 to 20 of 1 sentences]
79
[+] score: 2
sham rat) Peers' studies hsa-miR-34a-3p 2.63 upUp, Jess Morhayim[15] hsa-miR-433-3p 1.24 up This study hsa-miR-106b 2.24 up This study hsa-miR-23a 0.48 downDown, Sylvia Weilner[27] hsa-miR-328-3p 0.38 down Down, Sylvia Weilner hsa-miR-29b-3p 2.1 up Up, Jess Morhayim hsa-miR-146a-5p 2.68 up Up, Jess Morhayim hsa-miR-148a-3p 1.85 upUp, Cheng[28] We noted that DKK1 played important role in the development of osteoporosis. [score:2]
[1 to 20 of 1 sentences]
80
[+] score: 2
Previous data suggest that miR-145 may regulate immune cells [12], and that inflammatory responses in the intervertebral disc may be reduced by miR-146a [13]. [score:2]
[1 to 20 of 1 sentences]
81
[+] score: 2
With regard to fracture nonunion, we recently profiled miRNAs in nonunion of the rat femur and identified five miRNAs, miR-31a-3p, miR-31a-5p, miR-146a-5p, miR-146b-5p, and miR- 223-3p that were associated with the development of nonunion [14]. [score:2]
[1 to 20 of 1 sentences]
82
[+] score: 2
The following miRNAs, also present in the VTMs list of Fig 5, were found by RT-PCR to be dysregulated in mouse lung tissue: miR-21, miR-146, miR-20, miR-302, miR-19, miR-98, let-7a, miR-15a. [score:2]
[1 to 20 of 1 sentences]
83
[+] score: 2
Others have been linked to the regulation of vascular smooth muscle cells; these include miR-145, let-7d, miR-24, miR-26a, and miR-146 [13]. [score:2]
[1 to 20 of 1 sentences]
84
[+] score: 2
Our previous study has also shown that combination of miR-21 and miR-146a has a greater protective effect against cardiac ischemia/hypoxia -induced apoptosis [11]. [score:1]
Huang W Combination of microRNA-21 and microRNA-146a Attenuates Cardiac Dysfunction and Apoptosis During Acute Myocardial Infarction in MiceMol Ther Nucleic Acids. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 2
miR-125b, miR-146, miR-150, miR-199a, miR-21, miR-129, miR-341 and miR-451 have been confirmed to play an important role in the different developmental stages of the cardiovascular system (4– 18). [score:2]
[1 to 20 of 1 sentences]
86
[+] score: 2
It is noteworthy that miR-21 and miR-146a, previously linked to DOX -induced apoptosis in cardiomyocytes in vitro [33], [34] or by single administration of a high dose of DOX in vivo [33], were not among the microRNAs regulated by our chronic DOX dosing regime in Sprague Dawley rats. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
Other miRNAs from this paper: rno-mir-10a, rno-mir-10b, rno-mir-26a, rno-mir-26b, rno-mir-146b
Moreover, the endocannabinoid system has come under scrutiny given that several microRNAs such as miR26, miR146, and miR10 are responsible for its gene regulation [28, 29]. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
Other miRNAs from this paper: rno-mir-27a, rno-mir-130b, rno-mir-200a, rno-mir-182
23, 32, 33 Several miRNAs, such as microRNA-130b, [34] microRNA-182, [35] microRNA-146a [36] and microRNA-200a, [37] have been found dysregulated in diabetes. [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 2
Particularly, it has been shown that some microRNAs (miRNAs) (e. g., miR-155, miR-146, miR-150) control the development and responses of the immune system [14]. [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 1
Another study showed that the administration of exosomes containing miRNA-146 from MSCs reduced brain tumors [32]. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
Other miRNAs from this paper: rno-mir-34a, rno-mir-98, rno-mir-187, rno-mir-155
Interleukin-1ß and microRNA-146a in an immature rat mo del and children with mesial temporal lobe epilepsy. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
Other miRNAs from this paper: rno-mir-132, rno-mir-155
Kong H, Yin F, He F, Omran A, Li L, Wu T, Wang Y, Peng J. The effect of miR-132, miR-146a, and miR-155 on MRP8/TLR4 -induced astrocyte-related inflammation. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
For instance, the S100A8 precedes Aβ plaque formation [17], IGFBP-2 drives AD neurodegeneration [18], miR-146a-5p facilitates neuroinflammation in AD pathogenesis [19], and miR-132-3p contributes to tau hyper-phosphorylation [20]. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Chassin C. Kocur M. Pott J. Duerr C. U. Gutle D. Lotz M. Hornef M. W. miR-146a mediates protective innate immune tolerance in the neonate intestine Cell. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
The implications of miR-146a (but not miR-146b) have been shown in chronic renal inflammation [48], human renal cell carcinoma [49] and retinoic acid induction in acute promyelocytic leukemia [50]. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
In addition, the neural progenitor cells isolated by LCM exhibited increases in miR-146a, miR-146b, miR-210, miR-19b and miR-378 and decreases in miR-128, miR-291a-3p, and miR-139-5p (Fig. 3A to 3C), which are consistent with the array data findings. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
This may also explain why miRNAs previously reported in islets upon in vitro cytokine exposure, such as miR-146 and miR-34a, were not confirmed in our study [25]. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
Comparison of whey qPCR analyses using the same volumes of samples showed that levels of some miRNAs, such as let-7c, miR-29a, miR-29c, miR-192, miR-21, miR-146a, miR-150, miR-223, and miR-320, did not change during the lactation period (Fig. 6). [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Recently, some miRNAs, such as miR-146 [29], -34c [30], -30 [31], -532-3p [32] and let-7g [33], have been reported involved in Dox -induced cardiotoxicity. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Other miRNAs from this paper: rno-mir-34a, rno-mir-181a-2, rno-mir-181a-1
MitomiRs in human inflamm-aging: a hypothesis involving miR-181a, miR-34a and miR-146a. [score:1]
[1 to 20 of 1 sentences]