sort by

38 publications mentioning rno-mir-204

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-204. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 393
Other miRNAs from this paper: rno-mir-34a, rno-mir-185, rno-mir-297, rno-mir-488
Given that miR-204 suppressed XRN1 expression (Fig. 3B), it suggests that AR might up-regulate XRN1 expression via its inhibitory effect on miR-204 expression (Fig. 1B). [score:14]
In this loop, androgen up-regulates XRN1, by repressing miR-204 expression, while XRN1 raises AR expression by reducing expression of miR-34a (Fig. 5G). [score:10]
In contrast to the response of p21 [WAF1] to miR-204 and XRN-siRNA, Cyclin D1 and Akt phosphorylation (both at T308 and S473) showed a significant up-regulation in the NEPC cell lines, but a down-regulation in the PAC cell lines overexpressing miR-204 (Fig. 5A and B). [score:9]
Therefore, it is possible that during the development of ADT -driven SCNC, ADT induces an up-regulated expression of miR-204, which, in turn, reduces AR expression, and eventually enables certain prostate tumor clones to assume a more NE phenotype. [score:9]
miR-204 and XRN1 regulate AR expression, and miR-34a is a XRN1 target that down-regulates AR. [score:9]
As shown in Fig. 1C, miR-204 expression was also suppressed by R1881 in PC-3 cells transfected with AR, but not in PC-3 cells transfected with the control vector, indicating that inhibition of miR-204 expression in these cells is AR -dependent. [score:9]
We next studied expression of miR-204 in NEPC cells, which do not expressed AR, by comparing their miR-204 expression with that in PAC cells. [score:7]
miR-204 is down-regulated but XRN is up-regulated in primary PCa specimens. [score:7]
Futhermore, the mutations introduced to the miR-204-pairing sequence in 3-UTR of XRN1 almost reversed the inhibition of luciferase activity by miR-204 (Fig. 3A), indicating that miR-204 directly targeted the 3′-UTR of XRN1. [score:7]
In contrast to the miR-34a inhibitor, the miR-204 inhibitor marginally changed the AR expression after it was co -transfected into LNCaP cells with XRN1-siRNA. [score:7]
XRN1 (5′-3′ exoribonuclease 1) was inferred as a potential target of miR-204 via the algorithms of TargetScan 5.2 (http://targetscan. [score:7]
In support of this, ectopic expression of miR-204 lowered the level of XRN1 protein in all the PCa cell lines tested (Fig. 3B), whereas introduction of the miR-204 inhibitor raised level of XRN1mRNA (Fig. 3C), suggesting that miR-204 is a repressor of XRN1 expression in PCa cells. [score:7]
Androgen down-regulates miR-204 but up-regulates XRN1 in rat ventral prostate. [score:7]
miR-204 expression is down-regulated by AR signaling. [score:6]
Moreover, we detected that R1881 raised level of XRN1 in LNCaP cells, but the up-regulation was significantly blocked in the cells that overexpressed miR-204 (Fig. 3E). [score:6]
miR-204 has been shown to down-regulated in a number of cancers [47- 49], consistent with its potential tumor suppressive role. [score:6]
B. Silencing of AR up-regulates miR-204 expression in LNCaP cells and 22Rv1 cells. [score:6]
miR-204 expression is down-regulated by Androgen in both PAC and NEPC Cells. [score:6]
Expression of miR-204 and XRN1 is down- and up-regulated in human PCa specimens, respectively. [score:6]
Given that XRN1 is a direct target of miR-204 (Fig. 3) and a miR-204-paring sequence was also identified in the 3′-UTR of rat XRN1 mRNA (Fig. 4D), the inverse relationship between miR-204 and XRN1 expression in ventral prostate of castrated rats (Fig. 4D) provided an evidence strongly supporting the presence of AR-miR-204-XRN1 axis in vivo. [score:6]
miR-204 exhibits a dual regulation on PCa growth both in vitro and in vivoTo investigate whether miR-204 affects the growth of PCa cells, we overexpressed miR-204 in different PCa cells, and our results showed that overexpression of miR-204 inhibited the growth of LNCaP and 22Rv1 cells (Fig. 2A), whereas it stimulated PC-3 and CL1 cell growth (Fig. 2B). [score:6]
C. The effect of exogenously-expressed AR on miR-204 expression in PC-3 cells. [score:5]
The four cell lines were transfected with the miR-204 inhibitor or a non -targeting control one day after they were seeded in 96-well plates (20 thousand cells each). [score:5]
miR-204 and XRN1-siRNA repress AR expression and exhibit an dual regulation on key regulators of cell cycle progression in different PCa cells. [score:5]
Furthermore, we found that miR-204 expression was significantly down-regulated in PCa compared to BPH specimens. [score:5]
In another PCa specimen, whereas we observed a strong staining of miR-204 in luminal epithelial cells, a strong expression of XRN1 was detected in the stroma with almost absent expression in luminal epithelial cells (Fig. 6E-d). [score:5]
Taken together, our results strongly suggest that AR is the key suppressor of miR-204 expression in PCa cells. [score:5]
Western blotting analysis showed that miR-204 and XRN-siRNA inhibited AR expression in the two PAC cell lines (Fig. 5A and B). [score:5]
In addition, positive XRN1 expression was inversely associated with recurrence among miR-204 positive patients (N=22), but not in miR-204 -negative patients (Table 2), implying that XRN1 inhibits recurrence in miR-204 positive patients. [score:5]
Ventral prostates were isolated from the three castrated rats at various times after castration, as indicated, and were used to monitor miR-204 expression (B) and for immunoblotting analysis of XRN1 expression (C). [score:5]
In contrast to its tumor suppressive role in PAC cells, miR-204, by targeting XRN1, functions as an oncomiR in NEPC cells. [score:5]
To investigate whether miR-204 affects the growth of PCa cells, we overexpressed miR-204 in different PCa cells, and our results showed that overexpression of miR-204 inhibited the growth of LNCaP and 22Rv1 cells (Fig. 2A), whereas it stimulated PC-3 and CL1 cell growth (Fig. 2B). [score:5]
For analysis of the association between XRN1 expression or miR-204 expression and clinicopathological parameters, chi-square test was performed. [score:5]
The results in Fig. 6E (a and c) indicated a negative miR-204 expression with a strong XRN1 expression in the same PCa specimen. [score:5]
Moreover, when a miR-204 inhibitor was transfected into cells, it significantly stimulated the growth of LNCaP and 22Rv1 cells, but inhibited the growth of CL1 and PC-3 cells (Fig. 2D). [score:5]
Taken together, these results suggest that miR-204 is the important regulator of XRN1 expression in the subgroup of poorly differentiated PCa which did not recur after ADT. [score:4]
These observations indicated that there is an inverse correlation between miR-204 and XRN1 expression in these specimens, supporting that miR-204 is a negative regulator of XRN1 in a subgroup of PCa patients. [score:4]
In addition, given our results strongly suggest that the dual function of miR-204 is decided by the status of AR expression in PCa cells, the adaptive shift of miR-204 towards oncomiR could be another important step following weakening or losing of AR signaling during the development of SCNC. [score:4]
These results revealed that the dual function of miR-204/XRN1 axis is closely associated with its dual modulation of expression of these key regulators of cell cycle progression. [score:4]
Furthermore, the dual regulatory function of miR-204/XRN1 axis was demonstrated by its dual-regulation of some key regulators of cell cycle, including pAKT, p21 [WAF1] and Cyclin D1 (Fig. 5A and B). [score:4]
XRN1, as a miR-204 target, is a dual regulator of PCa cell growth. [score:4]
These results strongly suggested that down-regulation of AR by miR-204 or XRN-siRNA generates profound downstream signaling changes. [score:4]
Together, these results indicate that androgen down-regulates miR-204 in PAC cells. [score:4]
miR-204 was one of several miRs that was down-regulated by androgen (Supplementary Table 2). [score:4]
Identification of XRN1, a potential target of miR-204 that participates in the dual regulation of PCa cell growth. [score:4]
Such a dual yet opposite regulatory function of miR-204 was also observed by our study of miR-204 target XRN1 (Fig. 3). [score:4]
These results indicated that miR-204 is down-regulated by androgen in ventral prostates of rats. [score:4]
These findings have not only provided a novel mechanistic insight into ADT -induced NED, but also established a strong rationale for us to develop a cell type-specific strategy targeting miR-204 as a novel therapeutic approach against prostatic SCNC. [score:3]
For evaluation of the correlation between XRN1 expression and miR-204 expression in clinical prostate specimens, linear regression analysis was carried out. [score:3]
We showed that miR-204 has a tumor suppressive function in PAC cells, but acts as an oncomiR in NEPC cells (Fig. 2). [score:3]
In contrast to miR-204, XRN1 was induced by androgen but inhibited by castration in rat ventral prostates (Fig. 4C). [score:3]
However, the correlation coefficient was −0.304 (p<0.05) in the 45 BPH specimens, indicating the presence of inverse association between expression of epithelial XRN1 and miR-204 in BPH. [score:3]
Finally, we also analyzed the association between XRN1 and clinicopathological parameters in the specimens with and without miR-204 expression (Table 2). [score:3]
Positive XRN1 expression was associated with higher Gleason scores only in miR-204 negative patients (N=99). [score:3]
miR-204 -expressing recombinant lentivirus and its control virus were purchased from Kangchen Bio-tech (Shanghai, China). [score:3]
Expression of miR-204 affects association of XRN1 expression with clinicopathological characteristics of PCa. [score:3]
Inverse correlation of miR-204 and XRN1 expression in the ventral prostates of rats. [score:3]
However, miR-204 expression was also shown high in some cancers such as melanomas [50]. [score:3]
As shown in Table 1, expression of XRN1 and miR-204 did not show a significant association of with the pathological stage, Gleason score and recurrence. [score:3]
Finally, our results further showed that miR-204 expression was significantly higher in the two NEPC cell lines (i. e. PC-3 and CL1) than that in the two PAC cell lines (i. e. LNCaP and 22Rv1) (Fig. 1E). [score:3]
The results strongly suggested that XRN1 has a different prognostic value in clinical PCa depending on miR-204 expression. [score:3]
Here we used a TMA that included 135 PCa specimens to analyze the association between miR-204 expression and PCa, and our result showed that lower levels of miR-204 (Fig. 6B) and higher levels of XRN1 (Fig. 6D) in primary PCa than that in the control samples, respectively. [score:3]
However, castration dramatically increased expression of miR-204 (Fig. 4B). [score:3]
miR-204 modification of the correlation of XRN1 expression with clinicopathological parameters. [score:3]
Figure 5(A-B) Western blot analyses of PCa cells infected with miR-204 -expressing virus or transfected with XRN1-siRNA. [score:3]
4 day after infected with miR-204 -expressing virus or the control virus, 22Rv1 cells (E), CL-1 cells (F) and PC-3 cells (G) (2×10 [6] each) were injected subcutaneously into the right flank of male nude mice (8 mice/group). [score:3]
Our results showed that miR-204 is primarily expressed in the epithelium of PCa and BPH (Fig. 6A). [score:3]
Expression XRN1 and miR-204 across clinicopathological parameters. [score:3]
Consistent with our in vitro observation (Fig. 2A-C), our results showed that overexpression of miR-204 in 22Rv1 tumor cells resulted in a time -dependent reduction of tumor volume (Fig. 2E). [score:3]
An elevated expression of miR-204 was also previously reported in PCa, in which only 5 PCa specimens without pathological information were used [51]. [score:3]
Figure 2(A and B) Cell growth of different PCa cell lines in the presence or absence of miR-204 overexpression by lentivirus. [score:3]
By contrast, overexpression of miR-204 significantly promoted the growth of CL1 (Fig. 2F) and PC-3 (Fig. 2G) tumors in nude mice. [score:3]
The positive rate of miR-204 expression was 66.7% (32/48) in BPH specimens vs 18.5% (25/135) in PCa specimens (p<0.0001) (Fig. 6B). [score:3]
In conclusion, we have demonstrated that AR-miR-204-XRN1-miR-34a feedback loop (Fig. 5F) plays an important role in regulating growth of PAC cells. [score:2]
Subsequently, after the synthetic androgen analog R1881was added to the culture at 48 and 72 hours post androgen withdrawal, the level of miR-204 expression decreased when compared to the control (Fig. 1A). [score:2]
These results again demonstrated the dual yet opposite role of miR-204 in regulation of tumor growth of PAC and NEPC in vivo. [score:2]
Furthermore, when an AR-siRNA was transfected into 22Rv1 (an androgen-independent but androgen responsive PAC cell line [30]) and LNCaP cells, miR-204 expression increased by 2.51 folds and 2.12 folds, respectively, compared to those cells transfected with control GFP-siRNA (Fig. 1B). [score:2]
Function of AR/miR-204/XRN1/miR-34a loop could be regulated by many factors associated with PCa progression. [score:2]
miR-204 exhibits a dual regulation on PCa growth both in vitro and in vivo. [score:2]
Given that miR-204 and XRN1 are regulated by AR (Figs. 1 and 3), these results established an AR-miR-204-XRN1-miR-34a feedback loop functionally active in PAC cells (Fig. 5G). [score:2]
miR-204 has a dual regulation on the growth and colony formation of PCa cells. [score:2]
Together, all these results demonstrated that miR-204 plays a dual yet opposite regulatory role in growth of different PCa cells in vitro. [score:2]
Figure 3 (A) Luciferase assay of the reporter gene with wild-type (WT) or mutant (MU) 3′-UTR of XRN1 in LNCaP cells infected with or without miR-204 -expressing lentivirus. [score:2]
In the present study, we identified an AR-miR-204-XRN1 signaling axis in PCa cells, and revealed its dual yet opposite role in mediating growth of PAC and NEPC cells. [score:1]
These results indicated that silencing of XRN1 recapitulates the dual yet opposite function of miR-204 in mediating growth of different PCa cells. [score:1]
Our results showed that miR-204 gradually decreased as the prostate index (gross weight of prostate/weight of whole animal ×100%) increased (Fig. 4A). [score:1]
E. Relative levels of miR-204 in untreated PCa cell lines as indicated. [score:1]
Notably, miR-204 was hardly observed in the stroma of the samples. [score:1]
miR-34a, miR-204 (RiboBio, Guangzhou), AR-siRNA and XRN1-siRNA (GenePharma, Shanghai) were transfected into cells using Lipofectamine 2000 (Invitrogen). [score:1]
To further evaluate the impact of miR-204 on PCa growth in vivo, we used a xenograft mo del in nude mice injected with the PCa cells infected with either miR-204 -expressing virus or the control virus. [score:1]
Taken together, these results indicated the presence of AR-miR-204-XRN1 signaling axis in PCa cells. [score:1]
Consistent with this, miR-204 and XRN-siRNA also increased levels of p21 [WAF1] in two PAC cell lines (Fig. 5A and B). [score:1]
Consistent with this, our results showed that miR-204 levels increased gradually after the LNCaP cells were incubated in the medium with charcoal-stripped FBS that was depleted of androgen (Fig. 1A). [score:1]
We further used two adjacent consecutive TMA sections to investigate whether there is an inverse relationship between the expression of miR-204 and XRN1 in PCa specimens. [score:1]
Therefore, our analysis further expands AR-miR-204-XRN1 axis to AR-miR-204-XRN1-miR-34a feedback loop. [score:1]
Figure 6(A) A representative LNA-ISH of miR-204 in clinical PCa specimens. [score:1]
Similarly, an opposite effect of miR-204 on the clonogenicity of LNCaP/22Rv1 and PC-3/CL1 cell lines was also observed (Fig. 2C). [score:1]
The delivery of miR-204 by viral infection was performed according to the manufacturer's instructions. [score:1]
Bottom, The 33-bp sequences in the 3′-UTRs of rat XRN1 mRNA (from nt3731 to nt3763) and human XRN1 mRNA (from nt4619 to nt4651) including the base-pairs (underlined) complementary to seed sequence of miR-204. [score:1]
Shown are miR-204 RT-PCR results in PC-3 cells transfected with AR (PC-3-AR) and control vector (PC-3-vector). [score:1]
A moderate/strong miR-204 staining in the epithelium of a PCa specimen (b) and a BPH specimen (c). [score:1]
To further understand the pathological relevance of miR-204 and XRN1 in PCa, we performed the LNA-ISH analysis and IHC to measure expression of miR-204 and XRN1in PCa specimens mounted on TMA slices. [score:1]
The sequence of LNA probes for miR-204 (Exiqon, Vedbaek, Denmark) was: 5′DIG-AGGCATAGGATGACAAAGGGAA-3′DIG. [score:1]
[1 to 20 of 103 sentences]
2
[+] score: 65
In our study, it was found that IR could down-regulate miR-204 together with up-regulated LC3-II protein. [score:7]
We found that IR induced cardiomyocytes autophagy, together with down-regulation of miR-204 and up-regulation of LC3-II protein. [score:7]
According to the bioinformatics of Targetscan, miR-204, which has anti-apoptosis effect [23], may regulate the expression of LC3-II. [score:6]
So the present study was undertaken to see whether miR-204 was dysregulated by ischemia-reperfusion (IR), and if it may inhibit autophagy during hypoxia-reoxygenation by regulating LC3. [score:5]
We found that miR-204, which has anti-apoptosis effect, may also regulate LC3 expresion through the 9 complementary bases, according the bioinformatics of Targetscan. [score:4]
It was found that miR-204 was down-regulated by IR. [score:4]
When miR-204 mimic was transferred into cardiomyocytes, LC3-II protein was attenuated, and LC3-II protein was up-regulated by AMO-204 which was concentration- dependented as other miRNAs [27]. [score:4]
So it became possible to control the autophagy under a beneficial threshold by regulating miR-204 expression, for protecting the cardiomyocyte against IR injury. [score:4]
But it is still unknown how did IR regulated the expression of miR-204, and this will be our next work. [score:4]
IR decreased the expression of miR-204. [score:3]
Our results demonstrated that miR-204 played an important role by regulating LC3-II protein during IR. [score:2]
These studies provided evidence that miR-204 played an important role in regulating autophagy through LC3-IIprotein during IR. [score:2]
But LC3-I was not regulated by miR-204, as the previous study [28]. [score:2]
It has been observed that many miRNAs regulate cell apoptosis, such as miR-1, miR-133, miR-199, miR-208, miR-320, miR-21, and miR-204, etc [18- 23]. [score:2]
These results demonstrated that miR-204 may regulate cardiomyocytes autophagy through LC3-II during IR injury. [score:2]
And, we have found that LC3-II protein was regulated by miR-204, using the method of transferring miR-204 mimic or AMO-204 into the cardiomyocytes, before. [score:2]
The annealing temperature of miRNA-204 was set at 60°C. [score:1]
The aim of this study was to investigate whether miR-204 regulated autophagy by regulating LC3-II protein, which is the marker of autophagosome during myocardial IR injury. [score:1]
Quantitative real-time RT-PCR of miR-204. [score:1]
It was found that IR significantly decreased miR-204 with the method of Real-time PCR. [score:1]
Xiaoyan Zhu carried out the miR-204 transferring into cardiomyocytes, and participated in the sequence alignment of miR-204 mimic and AMO-204. [score:1]
[1 to 20 of 21 sentences]
3
[+] score: 64
Figure S5 Conservation of (A) Timp3 miR-1/206 targeting seed, (B) Rbm24 miR-125b-5p targeting seed, (C) Tgfbr2 miR-204 targeting seed, (D) Csnk2a2 miR-208b targeting seed. [score:9]
HPASM cells were selected since they express most of the miR-204 pathway components [33], together with the mRNA targets Timp3, Rbm24 and Csnk2a2 mRNA, and provide a mo del for assessing the translatability of predicted miR/mRNA interactions derived from rat, dog and monkey heart tissues. [score:7]
TGF-β receptor 2 (Tgfbr2) has been functionally associated with cardiovascular diseases [30], [32], [48], [53] and miR-204 was observed to directly inhibit Tgfbr2 mRNA in a direct manner both in HPASM cells and in a luciferase assay, thus extending the potential roles for miR-204 in cardiac pathogenesis. [score:6]
A subset of microRNAs (miR-1, miR-125b-5p, miR-204 and miR-208b) was selected for further cross-species analysis and their expression level relative to heart apex is shown in Figure 4. MiR-1 was highly expressed in all rat, dog and cynomolgus monkey heart structures except valves. [score:5]
Interestingly, Tgfbr2 was shown to be directly targeted by miR-204 in human epithelial cells [32], providing us with a suitable positive control for further confirmatory experiments. [score:4]
MiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR. [score:3]
We selected 4 genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2), respectively targeted by miR-1, miR-125b, miR-204 and miR-208b, for further analysis. [score:3]
Confirmation of microRNAs Distribution by in situ HybridizationMiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR. [score:3]
In contrast, expression profiles of miR-204/Tgfbr2 in canine and cynomolgus monkey, as well as miR-208b/Csnk2a2, in cynomolgus monkey were positively correlated. [score:3]
In summary, we have demonstrated that four genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2) important for cardiac/muscular physiology are post-transcriptionally regulated by miR-1, miR-125b-5p, miR-204 and miR-208b and exhibit conserved cardiac tissue miR-mRNA interactions across species. [score:2]
We have also identified novel microRNA -mediated post-transcriptional mRNA regulatory interactions with potentially important roles in cardiac/muscle physiopathology including miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2. [score:2]
MiR-125b-5p and miR-204 were highly enriched in the valves of all 3 species compared to all other structures although it is noteworthy that significant miR-125b-5p expression was observed in non-valve structures in dog. [score:2]
Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
Figure S6 Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in the cardiac structures in 1 human donor. [score:1]
Here we focused on the characterization of four microRNAs, including myocardial specific miR-1 and miR-208b and valve enriched mir-204 and miR-125b-5p, based on their distinct heart-structure-specific distribution patterns and known roles in cardiac physiology, disease and pathological remo deling. [score:1]
0052442.g007 Figure 7 (A–D) Real-Time RT-PCR of Timp3, Rbm24, Tgfbr2 and Csnk2a2 in HPASM cells transfected with mimics for miR-1, miR-125b-5p, miR-204, miR-499 and miR-208b or with a mimic microRNA negative control. [score:1]
No signal for miR-204 was detected in the myocardium (Figure 5C), while valvular endothelial cells were clearly stained (Figure 5A and B) under the same conditions. [score:1]
The ISH signal for miR-1 was more intense in the myocardium than in the valves (Figure 5G, H and I), and staining for miR-204 and 125b-5p was more intense in the valves than in the rest of the heart (Figure 5A to F), ISH of the liver-enriched miR-122 was performed and used as a negative control (Figure 5J, K and L). [score:1]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
0052442.g005 Figure 5Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
0052442.g006 Figure 6 Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
Similarly to miR-204, miR-125b-5p showed a strong signal in the cardiac valves and could not be detected in the ventricular cardiomyocytes (Figure 5D, E and F). [score:1]
Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in cardiac structures across species. [score:1]
miR-204 in valves (A–B) and ventricle (C). [score:1]
While signals for miR-1 and miR-125b-5p were strong, miR-204 was at the limit of detection, consistent with its relatively low abundance as determined by microRNA sequencing (Table S8). [score:1]
Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
[1 to 20 of 27 sentences]
4
[+] score: 48
Among the nine T-cell miRNAs affected by TNF-α and downregulated in RA T cells, the expression levels of miR-139-3p, miR-204, miR-214, and miR-760 were increased in patients using biologic agents. [score:6]
Each scatter spot representing average normalized expression level of miRNA in three repeats of each treatment; (b) 13 miRNAs exhibiting aberrant expression in Jurkat cells cultured with TNF-α (20 ng/mL) for 7 days; (c) decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 in RA T cells miRNA, compared with normal T cells. [score:6]
Initially, our studies showed that among the expression of T cell miRNAs affected by TNF-α in Jurkat cells, the expression levels of miR-139-3p, miR-204, miR-760, miR-383, miR-524-5p, miR-136, miR-548d-3p, and miR-214 were significantly decreased in RA T cells. [score:5]
The expression levels of 12 miRNAs, including miR-139-3p, miR-204, miR-760, miR-432, miR-524-5p, miR-136, miR-548d-3p, miR-206, miR-214, miR-383, miR-224, and miR-887 were significantly lower, whereas the expression level of miR-146a was significantly higher, in Jurkat cells after being cultured with TNF-α for 7 days (fold change > 4, p < 0.05, Fig.   1b). [score:5]
Among other miRNAs affected by TNF-α in RA T cells, miR-204 was found to be downregulated in human retinal pigment epithelial cells after exposure to a mixture of inflammatory cytokines containing interferon gamma, TNF-α, and IL-1 beta [36]. [score:4]
The expression levels of miR-204 showed a significant correlation with the use of biologic agents. [score:3]
The expression levels of miR-139-3p, miR-204, miR-214, and miR-760 increased in RA patients receiving biologic agents. [score:3]
The expression levels of miR-139-3p, miR-204, miR-214, and miR-760 increased in RA patients using biologic agents. [score:3]
RA patients of male sex had a significant 0.27-fold decrease (p = 0.019; 95% CI 0.09–0.78) and the use of biologic agents had a significant 4.48-fold increase (p = 0.001; 95% CI 2.02–9.90) in miR-204 expression levels. [score:3]
Decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 were noted in RA T cells. [score:3]
Expression levels of miR-139-3p, miR-204, miR-214, and miR-760 were correlated with the use of biologic agents. [score:3]
The fold changes of expression levels for these miRNAs were 0.42-fold for miR-139-3p, 0.43-fold for miR-204, 0.13-fold for miR-760, 0.32-fold for miR-524-5p, 0.45-fold for miR-136, 0.19-fold for miR-548d-3p, 0.37-fold for miR-214;0.36-fold for miR-383, and 0.14-fold for miR-887, compared with controls. [score:2]
The expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 was found to be significantly lower in RA T cells (p < 0.05), compared with controls (Fig.   1c). [score:2]
[1 to 20 of 13 sentences]
5
[+] score: 46
Unexpectedly, miR-93 miR-204 and miR-302d, which target Nurr1 long 3’ UTR mRNA variant, are expressed in the vmDNA mesencephalon while miR-93 and miR-302d, but not miR-204 express in dmDNA (Fig 4B). [score:7]
The longest 3’UTR variant of Nurr1 mRNA expresses in the mesencephalon during development along with miR-204, miR-302d and miR-93, which specifically regulate this variant of Nurr1. [score:5]
The above results prompted us to study a potential role of miR-204, miR-93 and miR-302d regulating Nurr1 expression in dopamine neurons. [score:4]
D. Effect of miR-204, miR-93, miR-17, miR-302d, miR-455, miR-212 or miR-30a overexpression on Nurr1 3’ UTR long. [score:3]
F. Effect of miR-204 or miR-93 overexpression on Nurr1 3’UTR short. [score:3]
B. Stem-loop RT-PCR showing the expression of miR-93, miR-204 and miR-302d in the developing mesencephalon. [score:3]
Conversely, miR-204, miR-93 and miR-302d transfected along with the reporter fused to the long 3’UTR Nurr1 mRNA variant, significantly decreased luciferase expression (Fig 3D). [score:3]
As shown in Fig 3F, miR-204 and miR-93 did not change luciferase activity indicating the specificity of their effect controlling the expression of Nurr1 mRNA long variant. [score:3]
F. Primary culture cells of E18 were transfected with control vector (Control) or an equivalent molar amount of miR-93, miR-204 and miR-302d (miRNAs) at DIV1 and were analyzed at DIV3 (48 hrs after transfection) or DIV4 (72 hrs after transfection) by indirect immunofluorescence. [score:2]
In conclusion, Nurr1 mRNA with the longest 3'UTR undergoes a specific regulation by miR-204, miR-93 and miR-302d. [score:2]
Taken together these results indicate that the Nurr1 3’UTR long mRNA variant is specifically regulated by the miR-204, miR-93 and miR-302d. [score:2]
Co-transfection of miR-204, miR-302d and miR-93 in primary culture of mesencephalon dopamine neurons resulted in a significant reduction of Nurr1 protein. [score:1]
The precursor sequences of the miR-145, miR-302d, miR-130a, miR-204, miR-93, miR-17, miR-455, miR-212 and miR-30a were cloned on pEGP-CE vector, acquired from Cell Biolabs Inc (7758 Arjons Drive San Diego, CA 92126 USA). [score:1]
Therefore, to test the effect in a gain of function approach, a mix of the 3 miRNAs (miR-204, miR-93 and miR-302d) were transfected to cultured dopamine neurons. [score:1]
miR-93, miR-204 and miR-302d decrease Nurr1 protein in dopamine neurons. [score:1]
The seed sites of miRNAs selected for the specific part of the long 3’UTR are: miR-204 in nucleotide 870, miR-212 in nucleotide 1014, miR-93 and miR-302d in nucleotide 1063, miR-17 in nucleotide 1070, miR-455 in nucleotide 1177 and miR-30a in nucleotide 1279. [score:1]
Seven miRNAs were selected: miR-17, miR-204, miR-455, miR-30a, miR-212, miR-302d and miR-93. [score:1]
miR-204, miR-93 and miR-302d decrease Nurr1 protein levels in cultured dopaminergic neurons. [score:1]
The intersection of these 3 databases gave 14 miRNAs in common and we choose miR-204, miR-30a, miR-302d, miR-212, miR-93, miR-17 and miR-455 for further experimentation. [score:1]
Briefly, about 10 ng of small RNA was subjected to reverse transcription using MMLV-RT, a universal primer: 5’-ATACTCCAGCTGAGTCTCAACTGGTGTCGTGGAGTC-3’ and a specific reverse primer for each target miRNA: miR-93: 5’- ACACTCCAGCTGGGGGAAGTG CTAGCTCAGCAGTAGG-3’, miR-204: 5’-ACACTCCAGCTGGGCCAGTGATGACAA TTGAACG-3’ and miR-302d: 5’-ACACTCCAGCTGGGCATGCAGTGGCACACAAAG-3’. [score:1]
[1 to 20 of 20 sentences]
6
[+] score: 42
Regarding changes in the expression profiles of miRNA mediated by adenoviral transduction, up-regulation of miR-2137 and miR-204-5p and down-regulation of miR-210-3p were also confirmed (Fig 6D, 6E and 6G), being the expression levels of miR-210-3p and miR-204-5p in Ad-transduced B13 cells similar to those displayed by rat islets. [score:11]
Interestingly, PNM overexpression in B13 cells upregulated the expression of miR-137-3p, miR-135a-5p and miR-204-5p and repressed the expression of miR-210-3p to the same levels of those detected in rat islets, highlighting the potential role of these miRNAs in the reprogramming process. [score:10]
Furthermore, expression levels of miR-137-3p, miR-135a-5p, miR-204-5p, miR-210-3p in reprogrammed B13 cells were consistent with the expression levels detected in rat islets and markedly differed from those displayed by rat exocrine tissue. [score:5]
Among the overexpressed miRNAs, miR-148a, miR-335, miR-132 and miR-204 were identified, all of which have been reported to be overexpressed in β cells in comparison with α cells [44], suggesting that adenoviral transduction aids in cellular reprogramming toward a β cell lineage. [score:5]
Notably, here we show that miR-204 expression levels in Ad-PNM reprogrammed B13 cells mirrored those of pancreatic islets. [score:3]
In particular, miR-204 is one of the most highly–enriched miRs in β-cells (100-fold higher expression in β cells as opposed to α-cells) and has recently been shown to play an important role in the control of insulin production [45]. [score:3]
Relative miRNA expression levels of miR-200c-3p (A), miR-141-3p (B), miR-325-3p (C), miR-2137 (D), miR-210-3p (E), miR-181a-5p (F), miR-204-5p (G), miR-455-3p (H), miR-137-3p (I), miR-135a-5p (J), miR-384-5p (K) in rat exocrine fractions, rat islets, AR42J cells, B13 cells and B13 transduced with Ad-GFP or Ad-PNM at 4 days post-transduction, quantified by individual qPCR assays. [score:2]
0145116.g006 Fig 6Relative miRNA expression levels of miR-200c-3p (A), miR-141-3p (B), miR-325-3p (C), miR-2137 (D), miR-210-3p (E), miR-181a-5p (F), miR-204-5p (G), miR-455-3p (H), miR-137-3p (I), miR-135a-5p (J), miR-384-5p (K) in rat exocrine fractions, rat islets, AR42J cells, B13 cells and B13 transduced with Ad-GFP or Ad-PNM at 4 days post-transduction, quantified by individual qPCR assays. [score:2]
9 miRNAs were present in two categories; 5 of them were common between Tables 1 and 2 (miR-181a-5p, miR-204-5p and miR-2137, miR-421-3p and miR-483-3p), two miRNAs were present in both Tables 2 and 3 (miR-148a-5p and piR-335-3p) and the remaining two miRNAs were classified both in Tables 1 and 3 (miR-137-3p and miR-455-3p). [score:1]
[1 to 20 of 9 sentences]
7
[+] score: 37
Likewise, miR-204 inhibits osteogenic differentiation of mesenchymal stem cells through direct suppression of Runx2 [27]. [score:6]
To investigate if miRNAs that regulate adipocyte or osteocyte differentiation is compromised in SVF cells from old rats (30 mo), the levels of miR-143 [26] and its target gene ERK5 and miR-204 (which directly inhibits osteogenic factor-Runx2) [27] were determined in the preadipocytes isolated from both groups of rats before (baseline) and after subjecting to ex-vivo adipocyte differentiation. [score:5]
Moreover, miR-204 was activated post-adipogenesis in 6 mo SVF derived cells to inhibit Runx2; however, this process was not seen in older rats, resulting in increased levels of Runx2 in these cells. [score:3]
This supports the hypothesis that miRNA mediated adipogenic differentiation was impaired in aging preadipocytes which was accompanied by an inability of adipogenic miR-204 to suppress RunX2 and other factors (PPARg). [score:3]
The role of miR-143 and miR-204 and its target genes on the altered preadipocyte function in young (6 months old) and old (30 months old) Fischer 344 x Brown Norway Hybrid (FBN) rats were studied. [score:3]
However, after differentiation, only the young cells (6 mo rats) had significantly higher expression of miR-143 (2.4 fold, p<0.01) and miR-204 (13.7 fold, p<0.005) (post-adipogenesis) (Figures 3 & 4 A and B). [score:3]
MiR-143 that regulates adipogenic differentiation and miR-204 that regulates osteogenic differentiation and their target genes, were measured in SVF cells isolated from 6 mo and 30 rats (n = 8/group) before and after adipocyte differentiation using mirVana assays. [score:2]
0059238.g004 Figure 4MiR-143 that regulates adipogenic differentiation and miR-204 that regulates osteogenic differentiation and their target genes, were measured in SVF cells isolated from 6 mo and 30 rats (n = 8/group) before and after adipocyte differentiation using mirVana assays. [score:2]
Levels of miR-143 (regulator of adipogenic pathway) and miR-204 (regulator of osteogenic pathway) were quantified in the total RNA fraction isolated from the preadipocytes (5×10 [5]) using kit (AM1558) and respective primers: miR-143 (AM30045) and miR-204 (MIMAT0000877) on the MyiQ Bio-Rad real-time PCR system. [score:2]
An increase in miR-143 and miR-204 after adipocyte differentiation in 6 mo rats but not in 30 mo rats was observed. [score:1]
The impaired differentiation capacity with aging correlated with altered levels of miRNAs involved in adipocyte differentiation (miRNA-143) and osteogenic pathways (miRNA-204). [score:1]
miR-143, 8A; ERK5 mRNA, 8B; ERK5 protein, 8C; PPARg mRNA, 8D; Runx2, 8E; and miR-204, 8F. [score:1]
miR-143, 4A; miR-204, 4B; PPARg, 4C; ap2, 4D; and Runx2, 4E. [score:1]
miR-143, 3A; miR-204, 3B. [score:1]
The lower levels of Runx2 mRNA levels with premir-143 in young rat SVF derived cells (Figure 8E ) was probably due to the significant induction of miR-204 (11.18 fold, p<0.05) (Figure 8F ) in these cells post-adipogenesis. [score:1]
Increases in miR-143 levels by premir transfection enhanced the adipogenic differentiation capacity of young adipose SVF derived cells with a concomitant increase in PPARg and miR-204. [score:1]
As observed in Figure 3A and B, the levels of both miR-143 and miR-204 were not significantly different in the young and old preadipocytes before adipocyte differentiation (pre-adipogenesis). [score:1]
[1 to 20 of 17 sentences]
8
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Interestingly, one of the key validated targets for miR-204-5p is SPARC (secreted protein acidic and rich in cysteine), a matricellular protein that regulates cell adhesion, matrix assembly and remo deling [44], and one whose spatial pattern of mRNA expression closely resembles that of miR-204-5p. [score:6]
Among the clearest examples of these, miR-196b-5p experienced a 45-fold increase in expression between the caput and caudal regions, while conversely miR-204-5p was down-regulated by approximately 39-fold over the same regions (Fig 5C). [score:6]
Specific examples include miR-204-5p, which was down-regulated by approximately 39-fold between the caput/caudal regions, and has an estimated 530 predicted gene targets in the mouse [43]. [score:6]
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 4 sentences]
9
[+] score: 14
let7b, let7c, miR29b, miR29c and miR204 showed significant, gradual up-regulation (>2 times) after birth and during progression of lens development (ED16<4W<14W). [score:5]
Relative expression levels of miRNAs, let-7b, let-7c, miR-29a, miR-29c, miR-204, miR-126, miR-451 in ED16, 4W and 14W lenses are represented as histograms with normalized averages ± SD. [score:3]
2XUp  let-7b poly (ADP-ribose) polymerase family, member 3, Glutaredoxin-2, Fibroblast growth factor 20 (FGF-20), FGF -binding protein 1, Multiple EGF-like domains 6 precursor, Hsp70 -binding protein 1, IGF2 mRNA -binding protein 3, Myc proto-oncogene protein (c-Myc), Hsp70 -binding protein 1 (HspBP1), FGF receptor activating protein 1, Tumor protein p53-inducible nuclear protein 1, Vimentin, Thioredoxin mitochondrial precursor (Mt-Trx)  let-7c poly (ADP-ribose) polymerase family, member 3, Vascular endothelial growth factor C precursor (VEGF-C), FGF-20, IGF2 mRNA -binding protein 3, Glutaredoxin-2, NF-kappa-B essential modulator (NEMO) (NF-kappa-B essential modifier), Hsp70 -binding protein 1, c-Myc, Heat shock factor 2-bindlng protein, AQP-2, Tumor protein p53-inducible nuclear protein 1, Vimentin, Mt-Trx  miR-29a Tropomyosin alpha-1 chain (Tropomyosin-1) (Alpha-tropomyosin), glutathione peroxidase 7, PDGF B-chain, Dicer1  miR-29c Tropomyosin-1, Dicer1, TGF-beta-2, glutathione peroxidase 7, PDGF A-chain, Multiple EGF-like domains 6 precursor, FGF receptor–activating protein 1, SMAD 6, AQP-11  miR-204* Tropomyosin-1, Hsp70 -binding protein 1, Mitogen-activated protein kinase 4, Gamma crystallin D, IGFBP-1, Glutathione S-transferase P (GST class-pi), Sulfiredoxin 1 To predict genes targeted by miRNAs, Sanger miBase Software was utilized. [score:3]
Levels of let-7b, let-7c, miR-29a, miR-29c and miR-204 were dramatically altered during the progression of development. [score:2]
The seven miRNAs (let7b, 7c, miR29a, miR-29c, miR204, miR126, miR51) listed in Table 3 were used for validation experiments. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 14
Downregulation of miR-204 also occurred in PLs and CLs with upregulation of miR-21 in both PLs and CLs. [score:7]
Although expression of miR-204 and miR-328 was variable in lung and PA of the current study, our findings were generally congruent with published data in human PAH specimens [13, 14]. [score:3]
Among these the miR-17–92 cluster, miR-21, miR-145, miR-204 and miR-210 are dysregulated in PASMCs, miR-124 is primarily dysregulated in fibroblasts in the adventitia, and miR-17, miR-21, miR-424, and miR-503 appear to play important roles in PAECs. [score:3]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 13
Other miRNAs from this paper: hsa-mir-204
ATF-2 overexpression promoted human cardiac progenitor cell proliferation, further demonstrating the role played by ATF-2 as a target gene of miRNA-204. [score:5]
Therefore, miRNA-204 is required for human cardiomyocyte progenitor cell differentiation and ATF-2 is a target gene of miRNA-204 in human cardiac progenitor cells. [score:3]
The FOSL1 promoter has multiple ATF-2 binding sites and ATF-2 is a target for SMADS (Kannan et al. 1997) and miRNA-204 (Xiao et al. 2012). [score:3]
This study indicates that miRNA-204 is among the regulators that drive progenitor cell proliferation and differentiation, and miRNA-204 might be used to influence cell fate. [score:2]
[1 to 20 of 4 sentences]
12
[+] score: 12
Treatment Group MiRNA changed Log2 (G/CT) Validated targets 80 kVp/0.1 Gy 2 Low fold change – 80 kVp/0.1 Gy Low signals – – 80 kVp/1 Gy miR-34a 1.55 E2F3, Tagln, INHBB miR-29c −1.02 Tpm1 miR-20b-5p −1.65 – miR-204 −1.39 – 30 kVp/2.5 Gy miR-34a 1.08 E2F3, Tagln, INHBB miR-20b-5p −1.55 – miR-98 −1.16 – miR-127 2.08 – The elevated expression of miR-34a was interesting to us, and we decided to proceed with identifying protein levels of its targets E2F3 and transgelin as well as p53, the key protein in DNA damage response. [score:7]
Treatment Group MiRNA changed Log2 (G/CT) Validated targets 80 kVp/0.1 Gy 2 Low fold change – 80 kVp/0.1 Gy Low signals – – 80 kVp/1 Gy miR-34a 1.55 E2F3, Tagln, INHBB miR-29c −1.02 Tpm1 miR-20b-5p −1.65 – miR-204 −1.39 – 30 kVp/2.5 Gy miR-34a 1.08 E2F3, Tagln, INHBB miR-20b-5p −1.55 – miR-98 −1.16 – miR-127 2.08 – Relative miR expression values are represented in folds in the irradiated cells in comparison to non-irradiated control cells as analyzed by miRNA microarray. [score:5]
[1 to 20 of 2 sentences]
13
[+] score: 12
Male animals had fibrosis and mononuclear cell infiltration severity scores greater than 1.5 times those of females at 78 and 104 weeks of age; thus, the male-biased increase in expression of miR-204 at prior ages (15 and 21 weeks) may be linked, via downregulation of Sirt1, to the age -associated kidney fibrosis seen in our study. [score:6]
Another male-biased miRNA, miR-204 (Figure  7), has been shown to directly target Sirt1, a key regulator of various metabolic processes, including resistance to oxidative stress and fibrosis [55]. [score:5]
Statistically significant sex differences were confirmed for miR-183, miR-204, and miR-142-3p (Figure  7B-D). [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 11
For instance, the up-expressed miR-143 and miR-138 can, respectively, target the genes, HK2 and HK1, which are the crucial enzymes in glycolysis and so that lead to potential glycemia [28, 29]; miR-9 and miR-204 were reported that they can regulate the insulin secretion by targeting the gene, SIRT1 [30– 32], while miR-96 can decrease the expression of NOC2 which is involved in the insulin secretion [33]. [score:10]
Among the 24 specific miRNAs, 13 of them, such as miR-182/196a/381/499a/99a [6], miR-183 [6, 23], miR-409 [23], miR-146b [6, 24], miR-143 [6, 24], miR-148a [24, 25], miR-204 [5], and miR-9 [6], have been reported to involve in T2D process in mouse or rat. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 9
We then used a screening system based on the luciferase reporter plasmid carrying the full-length 3′UTR of the FSHb mRNA and found that 18 miRNAs, specifically miR-433-3p, miR-323-3p, miR-328a-3p, miR-3573-3p, miR-204-5p, miR-206-5p, miR-31a-5p, miR-7a-5p, miR-880-3p, miR-186-5p, miR-503-5p, miR-383-5p, miR-324-5p, miR-505-5p, miR-27b-3p, miR-221-5p, miR-320-3p and miR-21-3p, could suppress the expression of the reporter by more than 30% (Figure 1). [score:5]
Interestingly, we identified 12 other miRNAs (miR-323-3p, miR-328a-3p, miR-3573-3p, miR-204-5p, miR-206-5p, miR-31a-5p, miR-7a-5p, miR-880-3p, miR-186-5p, miR-503-5p, miR-383-5p and miR-320-3p) that might also regulate FSHb expression, and then affected FSH secretion, but their specific effects need to be verified through further experiments. [score:4]
[1 to 20 of 2 sentences]
16
[+] score: 9
The gain of this chromosome arm was previously associated with papillary RCCs [83], and our observation in clear cell RCC implies a possible regulatory relation between miR-204/211 and the genes in this region as an alternate mechanism of up-regulation of this group of genes. [score:5]
One example in ccRCC is the miR-204/211 family, which was significantly down-regulated in ccRCC samples. [score:4]
[1 to 20 of 2 sentences]
17
[+] score: 9
rno-miR-184, rno-miR-347, rno-miR-181a-2-3p, rno-miR-204-5p, rno-miR-132-3p and rno-miR-328b-3p are significantly up-regulated while other 10 miRNAs are significantly down-regulated Fig. 16 Hierarchical clusterings analysis of miRNA expressionprofile for intrauterine infection group and control at P3. [score:9]
[1 to 20 of 1 sentences]
18
[+] score: 7
While miR-184 and miR-204 which were down-regulated in at least one mouse strain in their study, also showed down-regulation in our mo del. [score:7]
[1 to 20 of 1 sentences]
19
[+] score: 7
In contrast, 3 miRNAs (miR-499, miR-1, miR-133a, and miR-466b) were upregulated in the denervated muscle and 3 miRNAs (miR-329, miR-204, and miR-139-3p) were downregulated after 6 months. [score:7]
[1 to 20 of 1 sentences]
20
[+] score: 6
al [27], miR-204 has been shown to be involved in regulating vascular smooth muscle cell calcification both in-vivo and in-vitro and our analysis found miR-204 to be up-regulated and controlling several genes which were enriched for regulation of metabolic processes, phosphorylation and cell proliferation. [score:6]
[1 to 20 of 1 sentences]
21
[+] score: 6
Relative miRNA expression levels were calculated using REL = 2 [− ∆Ct], where ∆Ct = Ct target miRNA – Ct miR-204. [score:3]
Levels were normalized using miR-204 levels. [score:1]
The minimally required total miRNA level was determined by identifying the highest detectable Ct value of miR-204 providing detectable Ct values. [score:1]
Based on the study performed by Bergman and coworkers [29], miR-204 Ct values were used for normalization after confirming high correlation with UniSP6 spike-in Ct levels (Spearman’s rho p < 0.0001, r = 0.7093), qualifying miR-204 as a reference miRNA in CSF. [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 5
Notably, a panel of 11 Runx2 -targeting miRNAs (miR-23a, miR-30c, miR-34c, miR-133a, miR-135a, miR-137, miR-204, miR-205, miR-217, miR-218, and miR-338) is expressed in a lineage-related pattern in mesenchymal cell types [20]. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 5
Blocking the adhesion function of FN1 by inhibiting its expression with miR-204-3p could promote the growth of hepatocellular carcinoma tumor endothelial cells [36]. [score:5]
[1 to 20 of 1 sentences]
24
[+] score: 4
Gain- and loss-of-function miRNA studies and luciferase reporter assays reported that miR-204 [24], miR-133a [25], and miR-30b-c [26] inhibited the osteogenic differentiation of mice VSMCs and human coronary artery smooth muscle cells (SMCs) during β-glycerophosphate -induced calcification through the targeting of RUNX2. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 4
Although different technological platforms have been used for miRNA profiling, there is significant overlap between prognostic signatures described in previous work and several miRNAs that were later identified by more than three independent studies as being downregulated in essential hypertension or associated with vascular remo deling (e. g., miR-221, miR-26a, miR-21, miR-296-5p, and miR-204) [21– 24]. [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 4
In fact, these autophagy linked genes’ mRNA includes, the target sequence for miRNAs related to diverse families 5, 6. The gene networks regulating autophagy pathway were determined using a system biology and unrevealed miR-130, miR-98, miR-124, miR-204, and miR-142 as presumed posttranscriptional modulators of this pathway at different levels [6]. [score:4]
[1 to 20 of 1 sentences]
27
[+] score: 4
Recent studies on miRNAs regulation of cardiac autophagy showed that miR-204 [44] and miR-30a [33] could modulate myocardial autophagy via targeting LC3-II or Beclin-1, respectively. [score:4]
[1 to 20 of 1 sentences]
28
[+] score: 4
Other miRNAs from this paper: hsa-mir-26b, hsa-mir-204, rno-mir-26b
Previously, Courboulin et al. [34] found that miR-204 is downregulated in PASMCs from patients with PAH and PASMCs from rats with monocrotaline -induced PAH. [score:4]
[1 to 20 of 1 sentences]
29
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Several miRNAs were found to be highly expressed in particular tissues: miR-204, -218, and -129-2-3p in brain tissues, miR-30a, -30e, -30d, -200a and -200b in kidney, miR-192 in liver, miR-451 in spleen, miR-21 in spleen and thymus, miR-193b, -378 in LDM muscle. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Compared to the other 2 groups, 21 miRNAs are upregulated in 6-hour group as shown in the upper portion of Fig. 2, miR-9, miR-204, miR-335, miR-23a, miR-708, miR-146a, miR-325-5p, miR-106b, miR-143, miR-140, miR-376b-3p, miR-7a, miR-541, miR-185, miR-499, miR-127*, miR-320, miR-140*, miR-145*, miR-423*, miR-378. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Another subgroup of miRNAs displayed an opposite pattern, i. e. decreased expression during latency: miR-7a-1-3p, miR-107-3p, miR-138-5p, miR-139-3p, miR-186-5p, miR-204-5p, miR-222-3p, miR-324-3p and miR-505-3p were significantly decreased during latency (peak at 4 days after SE), then gradually returned to control levels (Fig. 2, Supplementary Fig. S2). [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 2
MiR-98, miR-124, miR-130, miR-142, and miR-204, might regulate autophagy [25, 26]. [score:2]
[1 to 20 of 1 sentences]
33
[+] score: 2
Finally, there is mixed support for 7 of the miRNAs we reported (mir-129-1, miR-15b-3p, mir-204, miR-29c-3p, miR-301b-3p, miR-495, and mir-9a-2), with some studies showing changes consistent with our data, and other studies showing changes opposite those of our study (15, 31– 33, 38– 47). [score:1]
These include precursor miRNAs mir-204 and mir-299a as well as mature miRNAs miR384-5p, miR-222-3p, and miR-301b-3p. [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 1
Courboulin A Paulin R Giguere NJ Saksouk N Perreault T Meloche J Role for miR-204 in human pulmonary arterial hypertensionJ Exp Med. [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
Moreover, we confirmed the absence of changes in miRNAs affected by maternal (mir375) [37] or paternal stress (mir30a and mir204) [38]. [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
Other miRNAs from this paper: rno-mir-21, rno-mir-25, rno-mir-155
Briefly, the fragments of PTEN-3′-UTR containing miR-204 putative binding region (3′UTR-WT) or mutant PTEN-3′-UTR containing miR-204 putative binding region (3′UTR-Mut) were inserted into a luciferase reporter gene plasmid (Invitrogen). [score:1]
[1 to 20 of 1 sentences]
37
[+] score: 1
Additionally, TBC3711 can be used as a useful tool to further elucidate the role of ET system in recently found factors that are implicated in pulmonary vascular remo delling process, such as signal transducers and activators of transcription-3 (STAT3), nuclear factor of activated T cell (NFAT) and miR-204 [54, 55]. [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
5 mmu-miR-214 -1.7 -6.1 -10.9 mmu-miR-137 -31.7 -6.8 -144.8 mmu-miR-29c -1.8 -10.5 -10.7 rno-miR-532–5p -2.0 -59.1 -126.9 mmu-miR-466d-3p -2.7 -4.2 -9.9 mmu-miR-466d-5p -23.2 -64.7 -105.7 mmu-miR-22 -1.6 -4.6 -9.9 mmu-miR-582–5p -21.3 -59.4 -97.1 mmu-miR-690 -1.9 -2.1 -9.7 rno-miR-421 -21.3 -59.3 -97.0 mmu-miR-193 -4.9 -3. 5 -8.1 mmu-miR-369–5p -20.9 -58.3 -95.3 mmu-miR-27b* -2.1 -2.9 -8.0 mmu-miR-684 -20.8 -58.1 -94.9 mmu-miR-378 -1.6 -4.6 -7.7 mmu-miR-375 -20.6 -57.6 -94.2 mmu-miR-9* -1.9 -18.4 -7.7 mmu-miR-337–5p -20.5 -57.4 -93.8 mmu-miR-204 -2.5 -5.3 -7.5 mmu-miR-15a* -20.3 -56.8 -92.8 mmu-miR-28* -1.9 -3.2 -6.5 mmu-miR-532–5p -19. [score:1]
[1 to 20 of 1 sentences]