sort by

28 publications mentioning rno-mir-219a-1

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-219a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 345
We found that NR1 expression was gradually increased after morphine injection (Figure 6A), which was consistent with the changes in CaMKIIγ (Figure 4A), and increased NR1 expression was downregulated by the overexpression of miR-219-5p accompanied with downregulation of CaMKIIγ (Figure 6B, 6C). [score:13]
Based on our experiments, our findings can be summarized as follows: chronic morphine treatment downregulates expression of miR-219-5p, which upregulates the expression of CaMKIIγ. [score:11]
After overexpression of miR-219-5p, the increased expression of CaMKIIγ induced by chronic morphine exposure was significantly downregulated with attenuation of morphine tolerance, indicating that targets CaMKIIγ to regulate morphine tolerance. [score:11]
The expression of NR1 was downregulated after injection of miR-219-5p, and upregulated after injection of miR-219 sponge. [score:9]
Overexpression of miR-219-5p silences the translation of CaMKIIγ, and inhibits expression of NR1, resulting in alleviation of morphine tolerance. [score:9]
Then we investigated the effect of downregulation of miR-219-5p on the expression of CaMKIIγ, we found downregulation of miR-219-5p by miR-219 sponge increased the expression of CaMKIIγ (Figure 4E). [score:9]
In our study, we found that CaMKIIγ expression in the spinal cord was gradually upregulated after chronic morphine treatment, which was negatively correlated with changes in miR-219-5p expression. [score:8]
Moreover, we found the expression of NR1 was also upregulated in rats receiving miR-219 sponge (Figure 6D), and knockdown of CaMKIIγ by siRNA could block this effect (Figure 6E). [score:7]
Our in vitro test also demonstrated that overexpression of miR-219-5p inhibited CaMKIIγ expression. [score:7]
Previous studies reported that miR-219 was highly upregulated in the brain of schizophrenia patients [27], and downregulated in subventricular zone and hippocampus of mice with amyotrophic lateral sclerosis (ALS) [28]. [score:7]
These results were consistent with previous studies [18, 19], indicating that CaMKIIγ was the target of miR-219-5p and overexpression of miR-219-5p decreased CaMKIIγ and NR1 expression in the PC12 cells. [score:7]
Furthermore, qRT-PCR data showed upregulation in miR-219-5p expression in the spinal cord, on the day 10 post-transfection (Figure 2B). [score:6]
Consistent with our findings, Hu et al. [42] found that miR-219 in dorsal root ganglion (DRG) contributed to morphine tolerance by targeting CaMKIIγ to regulate brain-derived neurotrophic factor (BDNF) expression. [score:6]
Our study found that chronic administration of morphine significantly down-regulated the expression of miR-219-5p. [score:6]
Downregulation of miR-219-5p expression in the spinal cord of morphine-tolerant rats. [score:6]
Therefore, these data suggested that overexpression of miR-219-5p alleviated morphine tolerance by targeting CaMKIIγ. [score:5]
Furthermore, our study demonstrated that NR1 expression was correlated with the expression of miR-219-5p. [score:5]
As miR-219-5p has hundreds of target genes, we cannot exclude the possibility that other target genes are involved in the context of morphine tolerance. [score:5]
Overexpression of miR-219-5p decreased CaMKIIγ and NR1 expression in the PC12 cells. [score:5]
Because NR1 was not the target gene of miR-219-5p, the expression change of NR1 following miR-219 disturbance may result from the changes of CaMKIIγ. [score:5]
Chronic morphine treatment inhibits the expression of miR-219-5p. [score:5]
Overexpression of miR-219-5p reversed the increased expression of CaMKIIγ by intrathecal injection of LV-miR-219 rather than LV-NC (Figure 4C). [score:5]
In conclusion, our results show that miR-219-5p is involved in morphine tolerance by targeting CaMKIIγ and then affects NR1 expression. [score:5]
LV-miR-219 induced robust upregulation of miR-219-5p expression in PC12 cell (n = 3, * P < 0.05, compared with LV-NC group, by Student's t-test). [score:5]
miR-219-5p also targets oncogene Sall4 to suppress colon cancer proliferation and invasion [49]. [score:5]
To further explore the interaction between miR-219-5p and CaMKIIγ in morphine tolerance, we first examined whether overexpression of miR-219-5p affected CaMKIIγ expression. [score:5]
Neither miR-219-5p mimic nor lentiviral -mediated overexpression increased the expression of miRNA to an appropriate level for optimal function with minimal side effects. [score:5]
Our in vitro results showed that overexpression of miR-219-5p repressed the expression of NR1 in PC12 cells (Figure 3C). [score:5]
Increasing miR-219-5p expression level by intrathecal administration of lentivirus -mediated miR-219-5p attenuates morphine tolerance and decreases CaMKIIγ and NR1 expression. [score:5]
We found that consecutive intrathecal administration of morphine decreased the expression of miR-219-5p in the spinal cord, and increased the expression of CaMKIIγ. [score:5]
Overexpression of miR-219-5p decreased CaMKIIγ and NR1 expression in PC12 cells. [score:5]
The expression of CaMKIIγ and NR1 was downregulated after PC12 cells were transfected with LV-miR-219 (n = 4, * P < 0.05, compared with LV-NC group, by Student's t-test). [score:5]
It has been reported that miR-219-5p targets EGFR to inhibit glioma cell proliferation and migration [48]. [score:5]
Studies have demonstrated that miR-219 regulates NMDA receptor -mediated neurobehavioral dysfunction and neuropathic pain by targeting calmodulin -dependent protein kinase II γ (CaMKIIγ) [18, 19]. [score:4]
Our study found that miR-219-5p targeted CaMKIIγ to regulate morphine tolerance. [score:4]
We also demonstrated that intrathecal administration of LV-miR-219 prevented the development of morphine tolerance and in turn decreased the expression of CaMKIIγ. [score:4]
Moreover, the basal latencies of tail-flick tests were not significantly different between LV-NC and LV-miR-219 group, indicating that overexpression of miR-219-5p did not have a direct analgesic effect (Figure 2D). [score:4]
There are some studies have reported that miR-219-5p directly targets CaMKIIγ [18, 19]. [score:4]
Overexpression of miR-219-5p attenuates the development of morphine tolerance. [score:4]
It was reported that miR-219-5p targeted CaMKIIγ to regulate NMDA receptor 1 (NR1) function [18]. [score:4]
The increased expression of CaMKIIγ induced by chronic morphine treatment was reduced by overexpression of miR-219-5p (n = 3, * P < 0.05, compared with LV-miR-219+Mor, by one-way ANOVA followed by Bonferroni test). [score:4]
Thus, we hypothesized that miR-219-5p target CaMKIIγ to regulate NMDAR1 (NR1) function in morphine tolerance. [score:4]
These results suggested that overexpression of miR-219-5p prevented and attenuated the development of morphine tolerance. [score:4]
After intrathecal administration of lentivirus, we found that the overexpression of miR-219-5p significantly alleviated morphine tolerance. [score:3]
Recent studies suggest that miR-219 was also involved in the pathophysiology of Alzheimer's disease (AD) and epilepsy [21, 29]. [score:3]
The results indicated successful induction overexpression of miR-219-5p. [score:3]
Compared with the control group, the data showed that miR-219-5p expression of Mor group declined on day 3 after morphine administration, to a minimum on day 7 (Figure 1C), correlating with the development of morphine tolerance (Figure 1A). [score:3]
Santa-Maria et al. [29] reported that dysregulation of microRNA-219 promotes neurodegeneration through post-transcriptional regulation of tau. [score:3]
The target sequence of miR-219 sponge was designed as following: AGAATTGCGTTTGGACAATCA. [score:3]
miR-219-5p was previously recognized as a brain-specific miRNA that was only expressed in the brain [24]. [score:3]
In addition to CaMKIIγ, several other target genes of miR-219-5p have been studied. [score:3]
Considering the importance of NMDA receptor in morphine tolerance [20], we hypothesized that miR-219-5p attenuates morphine tolerance by targeting CaMKIIγ in rats. [score:3]
We treated the rats with miR-219 sponge for 3 consecutive days to decrease the expression of miR-219-5p. [score:3]
This study firstly described the altered expression of spinal miR-219-5p in morphine tolerance. [score:3]
Figure 2 (A) Green fluorescent protein (GFP) was expressed in the lumbar spinal cord (L3~L4) 10 days after injection of LV-miR-219 and LV-NC followed by 7 days of intrathecal saline injection. [score:3]
Therefore, CaMKIIγ, a target gene of miR-219-5p was selected for further study. [score:3]
miR-219-5p targets CaMKIIγ to alleviate morphine tolerance. [score:3]
The expression of miR-219-5p in L4~L5 spinal cord was examined at 3, 5, and 7 days after morphine or saline injection by qRT-PCR. [score:3]
The qRT-PCR data showed that the expression of miR-219-5p was significantly increased in LV-miR-219 -treated cells compared with LV-NC cells (Figure 3B). [score:2]
Moreover, we found that NMDA receptor subunit NR1 was regulated by CaMKIIγ and involved in miR-219-5p mediated attenuation of morphine tolerance. [score:2]
We then investigated the effect of downregulation of miR-219 on morphine tolerance. [score:2]
Together, these results suggested that NR1 is involved in miR-219 mediated regulation of morphine tolerance. [score:2]
These data suggested miR-219-5p in the spinal cord contributes to the development of morphine tolerance. [score:2]
miR-219-5p is deregulated in neuronal dysfunction. [score:2]
Further study is still needed to clarify the specific role of BDNF in miR-219 mediated regulation of morphine tolerance in the spinal cord. [score:2]
NMDAR1 is involved in miR-219 mediated regulation of morphine tolerance. [score:2]
In a previous study, we demonstrated the deregulation of nine different miRNAs in rat spinal cord after chronic morphine injection, including let-7, miR-365 and miR-219-5p (miR-219) [4]. [score:2]
NR1 is involved in miR-219-5p mediated regulation of morphine tolerance. [score:2]
We evaluated the effect of miR-219-5p overexpression on the development of morphine tolerance, intrathecal injection of the lentiviral miR-219-5p (LV-miR-219) and the negative control (LV-NC) 3 days before consecutive saline or morphine injection in rats. [score:2]
To examine the specific contribution of miR-219-5p to the development of morphine tolerance, a lentiviral vector -mediated miR-219-5p was intrathecally injected in rats. [score:2]
Our study expands our knowledge of the functional role of miR-219-5p and provides a novel and promising strategy for the treatment of morphine tolerance. [score:1]
Our data support the role of miR-219-5p in attenuating morphine tolerance. [score:1]
However, the anti-nociceptive effect of morphine was not fully restored by LV-miR-219, suggesting the possible role of other miRNAs or unknown mechanisms. [score:1]
Lentiviral vector -mediated miR-219-5p (LV-miR-219) was purchased from Genepharma. [score:1]
We investigated the effect of miR-219-5p overexpression on CaMKIIγ and NR1 by transfecting PC12 cells with LV-miR-219 and LV-NC. [score:1]
Figure 3(A) GFP was visualized in PC12 cells after transfection with lentiviral miR-219-5p (LV-miR-219) and lentiviral negative control (LV-NC), Scale bar = 100 μm. [score:1]
Moreover, intrathecal injection of CaMKIIγ siRNA partially abolished miR-219 sponge induced decline of %MPE after morphine injection (Figure 4F, 4G). [score:1]
Our findings indicate that miR-219-5p may represent a novel treatment for morphine tolerance. [score:1]
Further studies are still needed to elucidate the precise mechanisms and potential side effects of miR-219-5p involved in attenuating morphine tolerance, and investigate other target genes of miR-219-5p in the context of morphine tolerance. [score:1]
CaMKIIγ is responsible for miR-219-5p induced attenuation of morphine tolerance. [score:1]
For naive rats, miR-219 sponge (20 μg, 4 μL) and scramble miRNA was intrathecal injected daily for 3 consecutive days, for rats receiving continuous morphine, they were intrathecal injected for 3 consecutive days just after morphine injection. [score:1]
We found that miR-219 sponge could attenuate the antinociceptive effect of morphine and produce thermal hyperalgesia in naive rats (Figure 2E, 2F). [score:1]
To gain further insight into the mechanism of miR-219-5p in morphine tolerance, we investigated the expression of CaMKIIγ in the context of morphine tolerance. [score:1]
To investigate the possible link between miR-219-5p and morphine tolerance, we first analyzed the temporal changes in miR-219-5p expression of the spinal cord of rats using qRT-PCR. [score:1]
The Western blot data showed that LV-miR-219 treatment dramatically decreased the protein levels of both CaMKIIγ and NR1 (Figure 3C). [score:1]
CaMKIIγ siRNA (sense 5′-GGAUAUGCCGACUUCUGAATT-3′, antisense 5′-UUCAGAAGUCGGGCAUAUCCTT-3′) (40 μM, 4 μL) and control siRNA were also intrathecal injected for 3 consecutive days after morphine or miR-219 sponge injection. [score:1]
The sequence of miR-219-5p was designed as follows: TGATTGTCCAAACGCAATTCT and cloned into pGLV3/H1/GFP+Puro vector. [score:1]
Thus we cannot deny the possibility that BDNF may act as a mediator in miR-219-CaMKIIγ-NR1 pathway in the study. [score:1]
Control = saline (10 μL, twice daily) intrathecal injection for 7 days; Mor = Morphine (10 μg/10 μL, twice daily) intrathecal injection for 7 days; LV-miR-219/LV-NC+Mor = LV-miR-219 or LV-NC (10 μL) plus 7 days morphine infusion (10 μg/10 μL, twice daily). [score:1]
Consistent with previous study, we also found blocking miR-219-5p induced thermal hyperalgesia, indicating its potential role in pain management [19]. [score:1]
However, in rats exposed to LV-miR-219, chronic morphine administration failed to induce morphine tolerance, and on day 7 after morphine administration, morphine still had antinociceptive effect, with a 70% MPE (Figure 2C). [score:1]
In vivo, LV-miR-219 was intrathecally injected via catheter 3 days before the induction of morphine tolerance. [score:1]
To further explore the role of miR-219-5p in morphine tolerance, we investigated the relevant target genes. [score:1]
miR-219 sponge, scramble miRNA, CaMKIIγ siRNA and control siRNA were purchased from Genepharma. [score:1]
[1 to 20 of 94 sentences]
2
[+] score: 109
Interestingly, the LII up-regulated miR-26b and miR-126 are implicated in Alzheimer’s disease (Absalon et al. 2013; Kim et al. 2014), while the LDeep up-regulated miR-219 and miR-7a/b are implicated in schizophrenia (Beveridge and Cairns 2012), diseases which both show pathologies in LII. [score:11]
Through in situ hybridizations, we confirmed the layer and cell-type expression of miR-143, which is up-regulated in LII stellate cells but also expressed in smaller cells in LII and LIII and LV pyramidal cells, and miR-219-5p, which is expressed in ependymal cells, oligodendrocytes, and glia—primarily in LV and LVI. [score:10]
All of the known targets that are involved in the development of oligodendrocytes from oligodendrocyte precursor cells displayed negatively correlated expression patterns with miR-219-5p, although few were differentially expressed between layers (Supplementary Analyses SA4, Supplementary Fig.  7). [score:8]
Expression patterns of mRNAs that are the most likely miR-143 (d) and miR-219-5p (f) targets (rho < −0.5 and the best TargetScan 6.0 or 7.0 context score). [score:7]
Predicted targets of miR-219-5p, irrespective of correlation with miR-219-5p expression, were enriched in neuron development terms (Fig.   5e). [score:6]
Further support for the role of miR-219-5p in myelination is that Ubash3b (alias Sts-1) inhibits endocytosis of EGFR (Raguz et al. 2007) and therefore possibly plays an indirect role in oligodendrocyte development, which involves EGFR signaling (Palazuelos et al. 2014). [score:5]
Correlating gene expression with miR-219-5p expression. [score:5]
Fig. 5Analyses of predicted, conserved mRNA targets expressed in the MEC of miR-143 (a–d) and miR-219 (e, f). [score:5]
By analyzing for enriched ontology terms for their predicted, negatively correlated target genes, we found that miR-219-5p appears to regulate myelination, while miR-143 likely contributes to the specification of neuronal subtypes. [score:4]
The top predicted gene targets of miR-219-5p, Fads2, Pdgfra, and Ubash3b, indicate a role for this miRNA in regulation of myelination. [score:4]
The two miRNAs with the lowest p value up-regulated in LDeep (miR-219 and miR-338) are involved in oligodendrocyte differentiation (Barca-Mayo and Lu 2012). [score:4]
The miRNA most significantly up-regulated in LDeep, miR-219-5p, plays an important role in oligodendrocyte differentiation and myelination, which generally begins around P10. [score:4]
The most significant up- and down-regulated miRNAs in LII (miR-143 and miR-219-5p, respectively) were validated by in situ hybridization. [score:4]
At P2/P9, miR-219-5p had similarly low expression in LII and LDeep compared to the later time points, but its expression increased between P9 and P23, reaching a maximum level at P23/P45 when it also had a distinct laminar profile (Fig.   1f). [score:4]
Likely targets of miR-143 and miR-219-5p. [score:3]
However, the gene involved in final maturation and myelin maintenance, Elovl7, had a positively correlated expression pattern with miR-219-5p. [score:3]
The Pdgfra gene is a known target of miR-219-5p involved in differentiation of oligodendrocyte precursor cells (OPCs) into mature oligodendrocytes (Barca-Mayo and Lu 2012), which corresponds well with the in situ labeling of miR-219-5p in oligodendrocytes presented here. [score:3]
Oligodendrocytes are the main cell types involved in myelination, and the Fads2 gene, a second target of miR-219-5p, is also involved in myelination (Peters et al. 2014). [score:3]
e Gene ontology enrichment analysis for validated and predicted, conserved targets of miR-219-5p. [score:3]
Using the same criteria as for miR-143, we found 16 genes that had opposite expression to miR-219-5p between both ages and layers. [score:3]
We also examined miR-219-5p, which was the most significantly up-regulated miRNA of the deeper layers compared to LII, and which was not detected in the FACS-sorted stellate cells. [score:3]
However, known targets of miR-219-5p include several genes involved in the process of differentiating neuronal stem cells to myelinating oligodendrocytes (Barca-Mayo and Lu 2012). [score:3]
Thus, miR-219-5p likely regulates oligodendrocyte differentiation in the MEC in a layer-specific fashion, a role which is similar to its known function in other brain areas. [score:2]
Consistent with the microarray data, there was hardly any miR-219-5p signal in LII, a weak signal in LIII, and a much stronger signal in LV and VI (Fig.   4f). [score:1]
e– h miRNA in situ hybridization on sagittal brain slices from a P23 rat using LNA-probes for miR-143 (e, g) and miR-219-5p (f, h). [score:1]
[1 to 20 of 25 sentences]
3
[+] score: 62
Downregulation of miR-219 in MS may thus contribute to impaired OPC differentiation and consecutive lack of remyelination in MS. [score:4]
c Percentage of CSF samples with undetected miR-219 in cohort 2. d Scatter plot of relative expression levels of miR-219 in CSF of individuals with detectable miR-219 levels of cohort 2. Mean miR-219 levels in CSF of individuals with detectable miR-219 were similar in all groups. [score:3]
This suggests that the differentiation failure of OPCs into mature oligodendrocytes in MS might be (partially) due to the lack of miR-219 expression. [score:3]
There was no correlation between CSF miR-219 levels and age, disease duration, CSF erythrocyte count, or CSF leukocyte count. [score:3]
Pre-amplification has a higher chance of resulting in false positive signals, especially in miRNAs with very low expression levels such as miR-219. [score:3]
In particular, decreased miR-219 expression was identified in both white matter and gray matter lesions. [score:3]
No differences in mean expression levels were observed between groups (data not shown), but again, individuals with undetectable miR-219 were more frequent in the MS patients’ groups (Fig. 1e). [score:3]
Fig. 1Expression of miR-219 in CSF of MS patients and controls. [score:3]
Multiple sclerosis Cerebrospinal fluid Biomarkers miRNA miR-219 miR-150 Multiple sclerosis (MS) is the most common chronic inflammatory demyelinating central nervous system (CNS) disease of young adults worldwide [1]. [score:3]
The differences in the amount of undetectable samples from the different cohorts in our study can be explained by the different analytic methods used, which included a pre-amplification step in cohorts 1 and 2, not performed in cohort 3. This step was omitted in cohort 3 as pre-amplification has a higher chance of resulting in false positive signals, especially in miRNAs with very low expression levels such as miR-219. [score:3]
Absence of CSF miR-219 expression correlates with MS diagnosis in three independent cohorts. [score:3]
This study therefore particularly looked into the specificity of miR-219 decrease in MS compared to a wide range of other neurological diseases for which a molecular biomarker does not necessarily have clinical relevance in differentially diagnosing MS. [score:2]
However, mean relative expression of miR-219 in individuals with detectable miR-219 did not significantly differ in MS patients compared to controls in this cohort (Fig. 1d). [score:2]
Differentiation of neural precursor cells, including OPCs, is—amongst others—regulated by miR-219 [14– 18]. [score:2]
Mean relative expression of miR-219 in individuals with detectable miR-219 was significantly lower in CSF of SPMS and PPMS patients compared to NHI (Fig. 1b). [score:2]
a Percentage of CSF samples with undetected miR-219 in cohort 1. b Scatter plot of miR-219 relative expression levels in CSF of individuals with detectable miR-219 levels of cohort 1. miR-219 levels were significantly decreased in SPMS and PPMS compared to controls. [score:2]
Previously, we identified decreased miR-219 expression in tissue of MS patients compared to controls. [score:2]
All three cohorts of MS patients and controls revealed that absence of miR-219 detection in CSF is consistently associated with MS. [score:1]
OR above 1 denotes a positive association between the non-measurability of miR-219 expression and MS. [score:1]
Therefore, once the issues described above are evaluated further and more experience is gained, miRNAs, and more specifically, miR-219, may emerge as promising biomarkers for use in accurate diagnosis, prognosis, and treatment options in MS disease. [score:1]
e Percentage of CSF samples with undetected miR-219 in cohort 3. f Scatter plot of miR-150 relative expression levels in CSF of individuals with detectable miR-150 levels of cohort 3. miR-150 levels were significantly increased in RRMS compared to PPMS, and in relapse-onset (RRMS, SPMS) compared to progressive-onset (PPMS). [score:1]
Again, miR-24 and miR-16 were detected in all samples, while the proportion of individuals with undetectable miR-219 was higher in the MS patients’ groups (Fig. 1c). [score:1]
In this cohort, the OR for a diagnosis of MS (RRMS, SPMS, and PPMS) versus controls (IND and NIND) was 39.7 (p = 0.0002) times higher if CSF miR-219 was undetectable (Table 2). [score:1]
In contrast, miR-219 could not be detected in all samples (Fig.   1a). [score:1]
In addition, there is a strong positive association between undetectable miR-219 and the diagnosis of MS (OR 2.9 and 39.7 in cohorts 2 and 3, respectively). [score:1]
In mouse and rat, miR-219 is required for this differentiation. [score:1]
Future studies will therefore be necessary to further evaluate the performance of miR-219 in more clinically pertinent situations in which MS cannot be differentiated from other neurological diseases that mimic the MS phenotype. [score:1]
The odds ratio (OR) for a diagnosis of progressive MS (SPMS and PPMS) versus NHI was 20.8 (p = 0.0294) times higher if CSF miR-219 was undetectable (Table  2). [score:1]
The omission did result in less measurable total miRNA providing 38 MS and 8 controls with sufficient total miRNA to be included in the analysis of miR-219 expression. [score:1]
In mouse and rat, miR-219 is required for both oligodendrocyte differentiation and myelination [14– 18]. [score:1]
The OR for a diagnosis of MS (RRMS, SPMS, PPMS, CIS) versus controls was 2.6 (p = 0.0262) times higher if CSF miR-219 was undetectable, and the OR for a diagnosis of progressive MS versus non-MS was 3.6 (p = 0.0165) times higher if CSF miR-219 was undetectable (Table 2). [score:1]
miR-219 absence of detection was not correlated with gender or EDSS. [score:1]
In this study, we therefore assessed the biomarker performance of CSF miR-219 for MS diagnosis. [score:1]
[1 to 20 of 33 sentences]
4
[+] score: 32
Despite extensive disagreement, several microRNAs showed concordant changes in expression across studies; these included the upregulation of miR-223 and miR-21 and the downregulation of miR-124 and miR-219, which were observed in most, if not all, of the examined studies. [score:9]
For the microRNAs that were downregulated at 3 dpo, miR-29c and miR-107 were significantly repressed in the injured animals compared only to the control group, whereas miR-219-5p was significantly downregulated in comparison to both the control and the sham groups. [score:6]
Expression changes respect to control/sham 1 dpo 7 dpo Name Liu Present Liu Present rno-miR-130b 1.42 NE rno-miR-146a 1.72 INC S rno-miR-15b 1.15 DEC NS rno-miR-17 1.74 INC NS rno-miR-18a 2.71 NE 3.41 NE rno-miR-200c 4.12 NE rno-miR-206 3.26 NE rno-miR-20a 1.69 NC rno-miR-20b-5p 1.83 NE rno-miR-21 1.37 INC S rno-miR-214 2.01 INC NS rno-miR-219-5p −1.82 DEC S rno-miR-221 1.1 NE rno-miR-223 3.58 INC S 3.4 INC S rno-miR-24-2* 2.41 DEC NS rno-miR-290 3.66 INC NS 2.96 DEC S rno-miR-378 1.31 INC NS rno-miR-410 −1.21 NE rno-miR-466b 3.05 DEC S rno-miR-541 1.11 INC S rno-miR-874 2,8 NEData restricted to microRNAs with significant changes in expression (2-fold or greater) according to Liu et al. [6]. [score:5]
The death of specific cell types may explain the downregulation of microRNAs that are associated with neurons, such as miR-124 and miR-128 [48], and those associated with oligodendrocytes, such as miR-219, miR-138, and miR-338 [49], [50]. [score:4]
Conversely, the expression of miR-219-5p, miR-107 and miR-29c were repressed at 7 dpo. [score:3]
MicroRNAs miR-21, miR-223, miR-146a, and miR-219-5p showed significant expression changes in our study (identified with both a t-test and a Rank Product test) as well as in other reports [6], [25]. [score:3]
Among the microRNAs listed above, the miR-219-5p level was within the most reduced microRNA levels at 7 dpo from the array data. [score:1]
We validated the changes in the levels of the microRNAs miR-21, miR-223, miR-146a, miR-219-5p, miR-29c, miR-468, miR-145 and miR-107 using Q-PCR. [score:1]
[1 to 20 of 8 sentences]
5
[+] score: 25
Another duo, miR-219 and its putative gene target Dazap1 were upregulated by prenatal stress in newborns, suggesting parallel regulatory interference in gene expression. [score:9]
Dazap1 is a gene related to mRNA surveillance, i. e. regulation of gene expression, which is a putative target for miR-219. [score:6]
Thus, stress through regulation of miR-219 may interfere with developmental neuronal plasticity and behaviour. [score:3]
Ptplb and Dazap1 are targets for miR-103 and miR-219, respectively. [score:3]
Disruption in NMDA receptor function through miR-219 regulation results in aberrant hyperlocomotor behaviour in mice [28]. [score:2]
miR-219 modulates excitatory synaptic plasticity through N-methyl-D-aspartate (NMDA) glutamate receptors [28], [75]. [score:1]
Notably, miR-219 may be implicated in the pathology of schizophrenia and bipolar affective disorders [30], both of which are closely linked to prenatal stress [20], [18] and altered HPA axis activity [74], [14], [16]. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 23
Of the 123 miRNAs, 15 were differentially expressed in the AS and CS mo del groups, of these, four were significantly upregulated (rno-miR-296, rno-miR-141, rno-miR-382 and rno-miR-219-5p; Table IV) and 11 were downregulated (significantly downregulated, rno-miR-135a and rno-miR-466b; Table V). [score:12]
Of these 15 miRNAs, rno-miR-296, rno-miR-141, rno-miR-382 and rno-miR-219-5p were significantly upregulated, particularly miR-296 (Table IV), and 11 were downregulated (miR-135a and miR-466b were significantly downregulated, particularly miR-135a; Table V). [score:10]
In conclusion, rno-miR-296, rno-miR-141, rno-miR-382, rno-miR-219-5p, miR-135a and miR-466b may be involved in stress at the molecular level, thus causing myocardial injury. [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 20
These selected miRNAs included the seven most strongly upregulated miRNAs (miR-330, miR-338, miR-223, miR-20a, miR-181a, miR-592, miR-212) in the Ago2 IP at 30 min, the only downregulated miRNA (miR-29b) in the Ago2 IP at 30 min, and the three most strongly upregulated miRNAs (miR-219, miR-384, let-7f) in the Ago2 IP at 120 min post-HFS (significant by t-test with Dunn–Bonferroni correction and 1-Way ANOVA with LSD test). [score:10]
When comparing miRNA Ago2/input expression ratios, eight miRNAs (miR-384, miR-29b, miR-219, miR-592, miR-20a, miR-330 miR-223, and miR-34a) exhibited increases relative to the contralateral dentate gyrus, whereas five miRNAs (miR-let7f, miR-338, miR-212, miR-19a, and miR-326) showed decreases in this ratio. [score:3]
Five miRNAs (miR-384, miR-29b, miR-219, miR-592, and miR-20a) exhibited 2 to 5-fold greater increases in expression in the Ago2 immunoprecipitate than in the input samples, relative to contralateral control values (Figures 3C,D). [score:3]
Target gene list sizes for miRNAs with activity -dependent association with Ago2 for the 8 enhanced miRNAs were 97 (miR-20a), 156 (miR-219), 58 (miR-223), 114 (miR-29b), 30 (miR-330), 91 (miR-34a), 156 (miR-384), and 53 (miR-592) and for the 5 depleted miRNAs were 52 (let-7f), 55 (miR-338), 47 (miR-212), 255 (miR-19a), 32 (miR-326). [score:3]
Seven miRNAs (miR-384, miR-29b, miR-219, miR-592, miR-20a, miR-330, and miR-223) showed enhanced, NMDAR -dependent association with Ago2. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 19
While miR-142-5p and miR-219-5p were upregulated on the 3rd day after ventral combined with dorsal root avulsion, miR-17 and miR-199a-5p were upregulated on the 14th day after ventral combined with dorsal root avulsion and were predicted to target VGLUT1. [score:9]
miR-142-5p and miRNA-219-5p, which were upregulated on the 3rd day; and miR-17 and miR-199a-5p, which were upregulated on the 14th day. [score:7]
In the present study, by using the miRWalk database, we determined that the following altered miRNAs target the VGLUT1 gene: miR-142-5p, miR-219-5p, miR-17 and miR-199a-5p. [score:3]
[1 to 20 of 3 sentences]
9
[+] score: 19
The most relevant pathway of the targets of miR-219a-5p was related to Joubert syndrome, which exhibits a malformed brainstem and cerebellum and difficulty balancing [20]. [score:3]
In addition, the most relevant pathway of the targets of miR-219a-5p was related to Joubert syndrome, which exhibits a malformed brainstem and cerebellum [20]. [score:3]
Consistent with previous reports, many of the identified pathways related to the targets of miR-219a-5p were involved in intracellular signal transmission. [score:3]
Major portions of the pathways related to miR-219-5p targets were related to intracellular signal transmission. [score:3]
It also seems possible that miR-219a-5p regulates vestibular compensation. [score:2]
Artificial cerebrospinal fluid, miR-218a-5p antagomir, miR-219a-5p antagomir, or miR-221-3p agomir were administered into the intracerebroventricular space continuously for 1 week using the brain infusion cannula. [score:1]
Therefore, we expected that miR-219a-5p would alter the activity of MVN neurons. [score:1]
However, in the animals in which miR-218a-5p (c) and miR-219a-5p 5p (d) antagomirs were administered, very few BrdU -positive cells were observed. [score:1]
Thirty-six rats were randomly divided into four groups: the control group (n = 9), which received artificial cerebrospinal fluid (aCSF) containing (mm): 124 NaCl, 5 KCl, 1.2 KH [2]PO [4], 1.3 MgSO [4], 2.4 CaCl [2], 26 NaHCO [3] and 10 d-glucose; the 218a-5p group (n = 9), which received the miR-218a-5p antagomir (Qiagen, Hilden, Germany); the 219a-5p group (n = 9), which received the miR-219a-5p antagomir (Qiagen); and the 221-3p group (n = 9), which received the miR-221-3p agomir (Qiagen). [score:1]
Kocerha et al. (2009) reported that miR-219 was reduced in the prefrontal cortex after disruption of N-methyl-D-aspartate (NMDA) -mediated glutamate signaling, affecting the NMDA signaling cascade, which is crucial for neurotransmission and synaptic plasticity in the brain. [score:1]
[1 to 20 of 10 sentences]
10
[+] score: 17
Althogether these studies strongly suggest that an up-regulation of most, if not all, members of the let-7 and miR-7 families and of the miR-132/212 cluster marks hypothalamus development while miR-9, miR-124a, miR-145 and miR-219 displayed nucleus-specific regulations of expression. [score:8]
Let-7b, miR-124a and miR-9 displayed no expression differences in MPN between P15 and P30 while let-7a, miR-7, miR-132, miR-145 and miR-219 displayed up-regulations. [score:6]
Our data established that miR-124, miR-145 and miR-219 are steadily expressed in ARC/ME from stages P4 to P28 (see Supplemental Table S4). [score:3]
[1 to 20 of 3 sentences]
11
[+] score: 15
Furthermore, other researchers have also reported that miR-219 is down-regulated following the continuous application of morphine and can regulate NMDA receptor signaling [36]. [score:5]
In our previous study, We have confirmed that miR-219-5p can attenuate morphine tolerance by targeting CaMKIIγ [12]. [score:3]
However, on the one hand, we identified miR-219-5p and miR-219b, which have both previously been reported to function in the suppression of the proliferation, migration and invasion of cells [37, 38]. [score:3]
Among ncRNAs, some studies have reported that miRNAs are involved in the development of morphine tolerance [7, 8], including the let-7 family, miR-23b [9], miR-133b, miR-339 [10], miR-365 [11] and miR-219-5p [12]. [score:2]
Recent research about miR-219 has mainly concentrated on the functions of miR-219-5p, and the other isoform, i. e., miR-219b, has not been studied in detail. [score:1]
Whereas in the present study, we predicted that miR-219b, rather than miR-219-5p, would exert this function. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 11
As well characterized examples, miR-9 has been shown to regulate embryonic neurogenesis by targeting the transcription factor TLX [8]; miR-219 [9] and miR-338 [10] have been identified as regulators of oligodendrocyte differentiation; miR-124 have been shown to promote neuronal differentiation and regulate adult neurogenesis [11, 12]; and miR-134 have been shown to regulate dendritic spine morphology through inhibiting the local translation of Limk1 [13]. [score:9]
Some of these miRNAs, i. e. rno-miR-34c, rno-miR-449a, rno-miR-301b, rno-miR-532-5p, rno-miR-219-5p, rno-miR-451, and rno-miR-152, were even 10-fold more abundant at E10 than at any other stages, providing a hint that these 7 miRNAs may play important roles in the regulation of progenitor cell proliferation. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 10
Other miRNAs that approached significance included miR-3553, miR-24-3p, miR-219a-5p, miR-411-5p (upregulated due to stress) and miR-3577 (downregulated due to stress). [score:7]
Indeed, miRNAs that were differentially expressed in stress are recognized biomarkers of mental health, including miR-10a-5p in depression 65, miR-219a-5p in schizophrenia 66 and miR-182 in fear memory, depression and synaptic plasticity 67. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 9
The abnormal expression of multiple miRNAs was also reported to be associated with the occurrence of neural tube defects [13], abnormal expression of miR-219 led to N-methyl-D-aspartate (NMDA) receptor- associated neurobehavioral disorders [11], and abnormal expression of miR-124 was observed in Alzheimer's disease [14]. [score:9]
[1 to 20 of 1 sentences]
15
[+] score: 7
Within the PFC of antibiotic -treated rats, we again found a significant decrease in the expression of miR-219a-5p (Fig. 4k), another miRNA found to be differentially expressed in our GF mice; however, the direction of the change was opposite. [score:6]
Sequencing -based studies have found miR-219a-2-3p/miR-219-3p to be altered in the basolateral amygdala following social defeat [46]. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 7
Other miRNAs from this paper: rno-mir-219a-2, rno-mir-219b
Downregulation of miR-219 enhances brain-derived neurotrophic factor production in mouse dorsal root ganglia to mediate morphine analgesic tolerance by upregulating CaMKIIγ. [score:7]
[1 to 20 of 1 sentences]
17
[+] score: 4
For example, mature miR-219 is downregulated 2 hours following NMDA receptor -dependent LTP induction without any change in primary and precursor miR-219 [23]. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 4
Although the most upregulated miRNAs in three rats were miR-383, miR-451 and miR-219-5p (with logs [FC]: -2.15, -2.21, -2.60) respectively, we wanted to focus on miRNAs that were altered in different rats simultaneously. [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 4
Recently, miR-219 has been shown to target calcium/calmodulin -dependent protein kinase II gamma subunit [21], which is involved in N-methyl-d-aspartate glutamate receptor -mediated signalling and implicated in schizophrenia. [score:3]
miR-132 has also been related to neuronal morphogenesis [13], [14], and both miR-132 and miR-219 have been shown to modulate the circadian clock [15]. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 3
Other miRNAs from this paper: rno-mir-338, rno-mir-219a-2, rno-mir-219b
To allow oligodendrocyte differentiation and myelin production, SOX6 mRNA is targeted for degradation by two microRNAs (miR) in these cells: miR-219 and miR-338 [40]. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
Six candidate miRNAs that are predicted to target caspase-3 (let-7, miR-138, miR-30b, miR-129, miR-203, and miR-219-5p) and have an aggregate Pct greater than 0.2 were selected (Fig.   1c). [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 2
Other miRNAs from this paper: rno-mir-219a-2, rno-mir-221, rno-mir-219b
miR-219, microRNA contained in EVs derived from dendritic cells and serum, stimulated remyelination in rats [49, 50]. [score:1]
Youth and environmental enrichment generate serum exosomes containing miR-219 that promote CNS myelination. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 2
Other miRNAs from this paper: rno-mir-219a-2, rno-mir-222, rno-mir-219b
On the other hand, miR-219/338 enhance OPC differentiation and maturation 75. [score:1]
Thus, a possible strategy may be to combine these growth factors and miR-219/−338 in our scaffold platform for future SCI treatments. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 2
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ hybridization and immunostaining In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 2
Among the miRNAs that undergo the greatest dynamic regulation at early time points were miR-219 and miR-140 (Figure S1A) and at the later time point were miR-322 and miR-128a (Figure S2B, 3 and 24 h). [score:2]
[1 to 20 of 1 sentences]
26
[+] score: 2
Other miRNAs from this paper: rno-mir-338, rno-mir-219a-2, rno-mir-219b
A possible future strategy might be to check the levels of some SOX6 and HES5 regulators such as miR-219 or miR-338 and their therapeutic potential in stroke [26]. [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 2
This finding is consistent with a previous study that indirectly correlated increased induction of NF-κB pathways to CD -induced promoter methylation of miR-219 [18]. [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, recent rodent studies demonstrated the roles of miR-219 [56], [57] and miR-338 [57] in controlling oligodendrocyte differentiation. [score:1]
[1 to 20 of 1 sentences]