sort by

53 publications mentioning gga-let-7a-3

Open access articles that are associated with the species Gallus gallus and mention the gene name let-7a-3. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 132
In late larval up to the young adult stages, this suppression is removed and let-7 is processed to the mature microRNA, which effectively downregulates lin-41. [score:6]
Since Lin-28 is also a known target of let-7, the fish retina exemplifies the autoregulatory mechanism of the microRNA and its target in a regeneration inducing process (Ramachandran et al., 2010). [score:6]
Let-7 is upregulated in the last larval stage (L4), and by downregulating lin-41 mRNA, allows the animal to fully mature. [score:6]
In this context, loss of SOX2 as well as overexpression of let-7 (specifically of let-7i) led to the inhibition of neuronal differentiation (Cimadamore et al., 2013). [score:5]
In order to generate different levels of Chinmo throughout MB development, let-7 and miR-125 co-transcribed from the let-7-C locus, contribute to the progressive downregulation of chinmo in vivo. [score:5]
Neurons degrading due to e. g., the consequences of Alzheimer’s disease release the microRNA let-7. Extracellular elevated let-7 molecules are sensed by the Toll-like receptor 7 (TLR 7) which is expressed in cortical neurons. [score:5]
Thus, let-7-C mediated downregulation of Abrupt regulates the transition between different subsets of MB neurons. [score:5]
Let-7 and miR-125 regulate chinmo expression directly via binding sites in the 3′UTR of the transcription factor. [score:5]
Notably, the expression of let-7-C appears to be dependent on Ecdysone signaling, a key regulator for morphological transitions during insect development (Robbins et al., 1968). [score:5]
Expression and activation of Lin-28 inhibits let-7 and leads to the maturation of the NPCs, which are derived from human ES cells (Cimadamore et al., 2013). [score:5]
To ensure precise timing of activity for instance during neuronal differentiation, let-7 interacts with one of its classical targets in an autoregulatory cycle. [score:4]
microRNA Mo del organism Function Citation Development let-7 Drosophila Maturation of neuromuscular junction (NMJ) Caygill and Johnston (2008), Sokol et al. (2008) Mushroom body (MB) differentiation Kucherenko et al. (2012), Wu et al. (2012) Human neural precursor cells embryonic stem cells Pluripotency Rybak et al. (2008), Cimadamore et al. (2013) bantam Drosophila Glia cell growth in the brain and optic lobe Reddy and Irvine (2011) Differentiation and number of glia cells in the opticlobe Li and Padgett (2012) miR-279 DrosophilaCO [2] neuron development Cayirlioglu et al. (2008), Hartl et al. (2011) Regeneration let-7 C. elegans AVM neuron axon regeneration Zou et al. (2013) Zebrafish De-differentiation of Mueller glia cells Ramachandran et al. (2010) bantam Drosophila Dendritic aborisation (da) neuron regeneration Song et al. (2012) Degeneration let-7 MouseLoss of cortical neurons through extracellular let-7 Lehmann et al. (2012) Behavior miR-279 Drosophila Regulation of circadian rhythm Luo and Sehgal (2012) While aging, the nervous system progressively loses the ability to rapidly regenerate new cells. [score:4]
All let-7-C microRNAs are strongly upregulated in the transition from the late pupal to early adult stage. [score:4]
Two other recent studies in Drosophila show that the let-7 complex (let-7-C) is a key regulator of the development of the MB (Kucherenko et al., 2012; Wu et al., 2012). [score:3]
In embryonic stem (ES) and embryonic carcinoma (EC) cells, the pluripotency factor Lin-28 binds pre-let-7 and inhibits the last step during let-7 processing and thereby prevents the formation of a mature microRNA (Rybak et al., 2008). [score:3]
In vivo, precocious expression of let-7 and miR-125 in larval stage 1 leads to a sharp decrease of Chinmo levels already in larval stage 3. As a consequence, the adult MB shows strong morphological defects and mis-differentiation of its cell types. [score:3]
In C. elegans let-7 participates in the so-called heterochronic pathway, which regulates the transition between different developmental stages in the worm by timing the division and differentiation of stem cells. [score:3]
As exemplified in the fish retina and fly da neurons blocking the expression of let-7 or bantam enables the cell to increase the levels of pluripotency factors to allow cell growth and thereby regeneration of cells and tissues. [score:3]
The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. [score:3]
Nevertheless, the results of the two publications show that let-7-C is used to sharpen the expression of two potent transcription factors in order to produce different neuronal subtypes. [score:3]
The experiments suggest that in early stages of development a Lin-41/Alg-1 complex is formed and represses the synthesis of let-7 permitting axonal regeneration and extension. [score:2]
Ascl1a regulates Muller glia dedifferentiation and retinal regeneration through a Lin-28 -dependent, let-7 microRNA signalling pathway. [score:2]
The third microRNA of the let-7-C, mir-100, seems not to be involved in the post-transcriptional regulation (Wu et al., 2012). [score:2]
Temporal regulation of metamorphic processes in Drosophila by the let-7 and miR-125 heterochronic microRNAs. [score:2]
Three microRNAs, let-7, bantam, and miR-279 were discovered in forward genetic screens, because their mutants showed substantial developmental phenotypes. [score:2]
Similar to let-7, miR-279 appears to regulate neuronal commitment and differentiation of progenitor cells (Cayirlioglu et al., 2008; Hartl et al., 2011; Table 1). [score:2]
Here, we review recent advances in the understanding of the function of let-7, bantam, and miR-279 in neural development, regeneration and degeneration, and behavior. [score:2]
SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors. [score:2]
Let-7-C gives rise to three different microRNAs, namely (let-7, miR-100, and miR-125), which can act individually but also synergistically on mRNA regulation. [score:2]
While both studies describe effects on MB morphology, the effect of the let-7-C mutation on MB morphology differs in the two studies. [score:2]
FIGURE 2 let-7 regulates neuronal degeneration. [score:2]
The authors could show that the phenotype is accompanied by increased levels of the broad-complex, tramtrack, and bric-a-brac (BTB) transcription factor Abrupt in let-7 mutants (Caygill and Johnston, 2008) corroborating a previous finding that Abrupt ensures the remo deling of the larval NMJ to achieve its adult shape and function (Hu et al., 1995). [score:1]
In contrast, let-7 uses a new and different mechanism in the context of neuronal degeneration. [score:1]
The second study revealed that let-7-C also influences the timing of α′/β′ to α/β transition via the Chinmo related BTB transcription factor Abrupt (Kucherenko et al., 2012). [score:1]
Strong alleles of let-7 mutants cause a severe phenotype of a blasting vulva (Reinhart et al., 2000). [score:1]
An unconventional role for miRNA: let-7 activates Toll-like receptor 7 and causes neurodegeneration. [score:1]
INITIAL DISCOVERY OF Let-7, Bantam, AND miR-279. [score:1]
An unexpected role of let-7 was revealed in a study on signaling mechanisms leading to neuronal degeneration (Lehmann et al., 2012). [score:1]
A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
In neural stem cells, lin-28 is repressed by let-7 and miR-125. [score:1]
Drosophila let-7 microRNA is required for remo deling of the neuromusculature during metamorphosis. [score:1]
In this context, the microRNA involved and responsible for increased axonal length and regeneration is let-7 (Figure 1). [score:1]
MECHANISMS OF Let-7 REGULATION. [score:1]
Although no anatomical phenotype was detected, let-7 mutant flies show defects in locomotion, flight, and also fertility (Sokol et al., 2008). [score:1]
In a recent study, the RNA sensing receptor Toll-like 7 (TLR 7) in cortical neurons of mice was shown to bind extracellular enriched let-7 released by degenerating neurons (Figure 2). [score:1]
Let-7 REGULATES CELLULAR DIFFERENTIATION OF THE NMJ AND OTHER BRAIN STRUCTURES. [score:1]
Interestingly, Lin-41 co-immunoprecipitates with Alg-1, which constitutes a key factor for let-7 biogenesis. [score:1]
In this case, let-7 acts as an extracellular signaling molecule. [score:1]
Steroid -induced microRNA let-7 acts as a spatio-temporal code for neuronal cell fate in the developing Drosophila brain. [score:1]
In silico analysis predicted a strong interaction of let-7 with the transcription factor Abrupt. [score:1]
Mutants of let-7 exhibited the same phenotype in AVM neurons as alg-1 mutants. [score:1]
Let-7-complex microRNAs regulate the temporal identity of Drosophila mushroom body neurons via chinmo. [score:1]
Weak mutant alleles of let-7 lead to a reiteration of larval patterns of cell division, and the animal fails to differentiate. [score:1]
The study showed that in order to stop AVM axons from extending, Lin-41 is strongly repressed by let-7 in late adult stages. [score:1]
Here, an increase in let-7 levels in degenerating neurons induces cell death of cortical neurons. [score:1]
[1 to 20 of 55 sentences]
2
[+] score: 75
Our study, however, revealed a novel role and mechanism of AGO2 as an enhancer of myeloma angiogenesis through miRNA dysregulation, including the upregulation of pro-angiogenic miRNAs such as the let-7 family members and the miR-17/92 cluster and downregulation of the anti-angiogenic miRNA miR-145. [score:8]
Therefore, we suggest that let-7a might promote myeloma angiogenesis by inhibiting its target (i. e. HIF-3α) and subsequently triggering VEGF expression. [score:7]
Herein, we found that the hypoxia-inducible factor (HIF)-3α (HIF-3α), a VEGF regulator, was a target of let-7a according to target-prediction software. [score:6]
In ECs, the downregulation of both enzymes decreased the capillary-sprouting and tubule-forming activities induced by regulatory miRNAs, including the let-7 family members and miR-27b [17]. [score:5]
let-7 family member miRNAs have been shown to be pro-angiogenic and to promote tumour angiogenesis by inhibiting the anti-angiogenic factors thrombospondin-1 (TSP-1) and tissue inhibitor of metalloproteinase-1 (TIMP-1) [16, 17]. [score:5]
let-7a targets HIF-3α, a regulator of VEGF. [score:4]
These results revealed that HIF-3α was a direct target gene of let-7a and therefore might mediate AGO2 -induced MM angiogenesis. [score:4]
However, the targets of the other let-7 family members are unclear. [score:3]
For the first time, we used a luciferase activity assay and Western blotting to validate that HIF-3α was truly a direct target of let-7a in MM. [score:3]
The pro-angiogenic miRNAs of the let-7 family and the miR-17/92 cluster, along with the anti-angiogenic miRNA miR-145, play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
The pro-angiogenic let-7 family miRNAs, the miR-17/92 cluster and the anti-angiogenic miRNA miR-145 play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
Most let-7 family members and 2 miR-17/92 cluster members (miR-17a and miR-92-1), all known pro-angiogenic miRNAs, were positively regulated by AGO2 whereas anti-angiogenic miRNAs such as miR-145 and miR-361 were negatively regulated by AGO2. [score:3]
Figure 7 AGO2-related let-7a targets HIF-3α. [score:3]
qRT-PCR and Western blotting ascertained that HIF-3α expression was slightly elevated in the LP-1-si-AGO2 line but decreased again after the addition of let-7a mimics (Figure  7A,B). [score:3]
The real-time PCR (A) and Western blot (B) detection of the HIF-3α expression levels in LP-1-si-AGO2 cells after transfection with a negative control and let-7a mimics. [score:3]
let-7a overexpression resulted in a significant decrease in the luciferase activity of the pmirGLO-reporter vector containing the HIF-3α 3′-UTR but not of the vector containing the corresponding mutant. [score:3]
In particular, many of these commonly dysregulated miRNAs are well-known angiogenic miRNAs, including the let-7 family members (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7f-2, let-7 g and let-7i), 2 miR-17/92 cluster members (miR-17a and miR-92-1), miR-145 and miR-361. [score:2]
A luciferase reporter assay further demonstrated that let-7a mimics could inhibit the HIF-3α luciferase activity (Figure  7C). [score:2]
Of interest, the miRNAs regulated positively by AGO2 included most let-7 family members (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7f-2, let-7 g and let-7i) and 2 miR-17/92 cluster members (miR-17a and miR-92-1), which are known pro-angiogenic miRNAs. [score:2]
Previous studies have identified the miR-17/92 cluster, let-7 family and miR-145 as the modulators of angiogenesis [41]. [score:1]
let-7 family members are known as pro-angiogenic miRNAs. [score:1]
The mimic sequences were as follows: miRNA -negative control (miRNA-NC) mimics, UUCUCCGAACGUGUCACGUTT, ACGUGACACGUUCGGAGAATT; hsa-mir-92-1 mimics, AGGUUGGGAUCGGUUGCAAUGCU, AGCAUUGCAACCGAUCCCAACCU; hsa-let-7a mimics, UGAGGUAGUAGGUUGUAUAGUU, AACUAUACAACCUACUACCUCA and hsa-mir-145 mimics, GUCCAGUUUUCCCAGGAAUCCCU, AGGGAUUCCUGGGAAAACUGGAC. [score:1]
[1 to 20 of 22 sentences]
3
[+] score: 47
The major function of the let-7 family is to target genes, which promote the terminal differentiation in development, and to suppress tumor growth by targeting oncogenes such as Myc and Ras [6]. [score:8]
Top amongst them were miRs reported to decrease tumor metastasis and invasion (miR-194, miR-103, miR-29) [21, 22], inhibit cell proliferation (let-7 family, miR-215) [23], induce apoptosis (miR-125) [24], and tumor suppressors (let-7 family, miR-125, miR-106) [25, 26] to mention but a few. [score:5]
The expression of let-7 family members is down-regulated in many types of cancer when compared to normal tissue and during tumor progression, it is associated with poor prognosis [23, 27]. [score:5]
It is still unknown if quercetin may also lead to Notch downregulation in PDA and if it is mediated by let-7 signaling. [score:4]
In the present study, we demonstrate by miR profiling that members of the let-7 family are in the top upregulated miRs after quercetin treatment of PDA cells. [score:4]
Let-7 miRs have also been identified to regulate Notch signaling pathways [8], known to regulate many cellular processes, including cell proliferation, apoptosis, migration, invasion, angiogenesis and normal development [9]. [score:4]
Recently, we demonstrated the up-regulation of let-7a by quercetin in PDA cells by qRT-PCR analysis [12]. [score:4]
The miR-let-7 (from “lethal”) is one of the first identified miRs [7] and the expression levels of let-7 members are significantly low in human cancers. [score:3]
Inhibition of tumor growth in human non-small cell lung cancer xenografts and the KRAS-G12D transgenic mouse mo del have resulted from therapeutic delivery of let-7 in either the form of a let-7 mimic or a virus [34]. [score:3]
Let-7 is a tumor suppressor miR and one of the earliest identified miRs per se. [score:3]
Among the top 24 differentially regulated candidates were several miRs, which were known to be deregulated in pancreatic cancer, among them the miR-29 and let-7 families (Figure 1A). [score:3]
miR-34 is the first miR replacement therapy in clinical trials by the company Mirna Therapeutics, with let-7 in the pipeline [35]. [score:1]
[1 to 20 of 12 sentences]
4
[+] score: 43
Our results show that miRNAs display a wide variety of expression profiles over the whole life of the silkworm, including continuous expression from embryo to adult (miR-184), up-regulation over the entire life cycle (let-7 and miR-100), down-regulation over the entire life cycle (miR-124), expression associated with embryogenesis (miR-29 and miR-92), up-regulation from early 3 [rd ]instar to pupa (miR-275), and complementary pulses in expression between miR-34b and miR-275. [score:18]
miR-100 and let-7 were up-regulated from 1 [st ]instar to 3 [rd ]molt, maintained over the 4 [th ]and 5 [th ]larval stages (Additional file 7), and highly expressed from early to late 4 [th ]instar larvae and fifth-instar day 2 and day 7 larvae (Figure 3C). [score:6]
In total, 15 miRNAs were highly expressed throughout pupal and adult stages by microarray, among which 10 were common to both sexes and 9 were robustly expressed over the whole life cycle (including miR-252, miR-1, and let-7a) (Additional files 9 and 10). [score:5]
Simultaneous expression of miR-125 and let-7 during Drosophila development is synchronized with the high- titer ecdysone pulses that initiate metamorphosis [62]. [score:4]
In contrast, both microarray and analyses confirmed that let-7 and miR-100 were coordinately up-regulated, gradually accumulating from late 1 [st ]molt until the 3 [rd ]molt stage (Figure 1A, C, Additional file 4). [score:4]
In contrast, miR-100 and let-7 were initially expressed in late 2 [nd ]instar larvae, and accumulated to high levels in late 3 [rd ]molt larvae, with obvious fluctuations during the early larval stages. [score:3]
Small and large miRNA transcripts were detected in pre-laid eggs and embryos, and were identified as miR-8, miR-252 and let-7 (indicated with a red arrow in Figure 2B). [score:1]
Alternative probes of the specific miRNAs clearly yielded identical results (let-7a and let-7a#; miR-275 and miR-275#). [score:1]
A number of miRNAs were also confirmed in females by (let-7a, let-7b, miR-8, and miR-2a) (Figure 5B). [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 40
At the same time as the miR-302 family and miR-222 are down-regulated, eleven miRNAs related to the let-7 family are up-regulated, as well as 2 additional miRNAs associated with cellular differentiation (Table S7) [54]. [score:7]
Duck NC cells at HH25 have down-regulated the miR-302 family and up-regulated some of the miRNAs associated with cellular differentiation (i. e. the let-7 family), though not as many as chicken NC (Table S7). [score:7]
In agreement with this, let-7a, let-7a*, let-7c*, let-7d, let-7f, let-7g, let-7i, and let-7k are up-regulated by 1.4- to 27.9-fold at HH25 in all three species, while let-7c is up-regulated at HH25 only in chicken and quail (Table S7). [score:7]
Taken together, these miRNA changes, including differential expression of let-7, miR-302, and miR-30 families (Table S7), indicate that the HH20 to HH25 developmental window may be a critical transition phase in which multipotent NC cells begin to differentiate to form the various tissues of the face. [score:4]
These include miR-30c-2*, miR-129-5p which targets the stem cell regulator SOX4 [55], [56], the differentiation-promoting miR-137 [57], and the let-7-related miR-100* and miR-125b-2* [58]. [score:4]
In addition, given that a number of miRNAs related to let-7 and cellular differentiation are only up-regulated in the chicken and quail at HH25 (Table S7), the timing of this transition may be slightly delayed in the morphologically different duck, perhaps allowing a more prolonged period of proliferation. [score:4]
In all, 9 of 10 detectable members of the let-7 family are up-regulated in chicken and quail NC by HH25 (Table S7). [score:4]
These miRNAs belong to the 19 member let-7 family of miRNAs, the expression of which has been associated with cellular differentiation [54]. [score:3]
[1 to 20 of 8 sentences]
6
[+] score: 38
Additionally, growth factors can also suppress let-7 expression through MAPK signaling pathway (Dangi-Garimella et al., 2009), which is inactivated in dwarf chicken (Luo et al., 2016). [score:5]
Let-7b, a member of the let-7 miRNA family, has been found to inhibit chicken growth by repressing growth hormone receptor (GHR) gene expression (Lin et al., 2012). [score:5]
Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J. 28, 347– 358. [score:5]
Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. [score:4]
The let-7 family is one of the first identified miRNAs and known to be differentially expressed between embryo and mature tissues (Yanaihara et al., 2006). [score:3]
GHR gene defection would lead to the decrease of IGF1, which is able to negatively alter let-7 family expression (Martin et al., 2012). [score:3]
H19/let-7/LIN28 reciprocal negative regulatory circuit promotes breast cancer stem cell maintenance. [score:2]
The temporal patterning microRNA let-7 regulates several transcription factors at the larval to adult transition in C. elegans. [score:2]
Post-transcriptional regulation of the let-7 microRNA during neural cell specification. [score:2]
Ezh2 regulates the Lin28/let-7 pathway to restrict activation of fetal gene signature in adult hematopoietic stem cells. [score:2]
The let-7 miRNA family is conserved across diverse animals, functions to control late temporal transitions during development (Grosshans et al., 2005). [score:2]
During the last decade, the involvement of let-7 in regulating cell differentiation has been analyzed in various contexts, including neural cell specification, stem cell maintenance and hematopoietic progenitor differentiation (Wulczyn et al., 2007; Oshima et al., 2016; Peng et al., 2017). [score:2]
Let-7b, a member of the let-7 family, is characterized to be highly conserve, tissue specific, and has important roles in regulating cell development (Pasquinelli et al., 2000; Gao et al., 2014). [score:1]
[1 to 20 of 13 sentences]
7
[+] score: 37
Relation of S. japonicum miRNA expression to life cycle stageUsing the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:5]
Analysis of sja-let-7, sja-miR-71 and sja-bantam expression by stem-loop RT-real time PCR revealed highly stage-specific expression patterns. [score:5]
Sja-let-7 expression was lowest in the miracidium stage, increased during the sporocyst stage, peaked during the cercaria stage, and then proceeded to decrease for the remainder of the organism's lifespan within the mammalian host. [score:3]
Expression of sja-let-7, sja-miR-71 and sja-bantam were analyzed in six stages of the life cycle, i. e. egg, miracidium, sporocyst, cercaria, schistosomulum, and adult worm, by a modified stem-loop reverse transcribed polymerase chain reaction (RT-PCR) method developed in our laboratory. [score:3]
The let-7 miRNA is active during the last larval stage in C. elegans, promoting the transformation from larva to adult, and is also highly expressed in the late third instar larval stage of D. melanogaster when a pulse of the ecdysone triggers puparium formation and onset of metamorphosis [26]. [score:3]
The expression pattern during the life cycle of S. japonicum indicates that sja-let-7 might take part in the transformation from miracidium to sporocyst in the snail intermediate host. [score:3]
Using the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:3]
The role of let-7 during metamorphosis in Drosophila and in C. elegans development is well documented for C. elegans and D. melanogaster [4]. [score:2]
miRNA egg miracidium sporocyst cercaria schistosomulum male adult worm female adult worm sja-let-7 1.15±0.96 0.02±0.02 0.24±0.22 5.92±4.02 0.60±0.41 0.75±0.35 0.59±0.13 sja-mir-71 8.68±5.06 3.21±2.17 4.57±0.79 1257.92±565.47 0.91±0.34 1.93±1.41 1.65±0.36 sja-bantam 4.50±2.67 1.69±0. [score:1]
5, 6, 7 and 8 were the amplification plot of sja-let-7, sja-mir-71, alpha tubulin and sja-bantam, respectively, using the no-RT control. [score:1]
In this study, we firstly identified five authentic miRNAs in S. japonicum by constructing and screening parasite cDNA library of size-fractionated RNAs: sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1. [score:1]
miRNA Sequence Size (nt) S. japonicum contig (LSBI, Shanghai) a S. mansoni shortgun reads (Sanger) b Clones c Δ G° [folding] (kcal/mol e) sja-let-7 GGAGGUAGUUCGUUGUGUGGU 21 CNUS0000067197: 5856–5876 shisto12670f07: 651–671 5 −30.8 sja-miR-71 UGAAAGACGAUGGUAGUGAGA 21CNUS0000007682(-) d: 3100–3120 shisto8708d10: 353–372 1 −34.5 sja-bantam UGAGAUCGCGAUUAAAGCUGGU 22 CNUS0000021739: 2223–2244shisto5226g02(-) d: 325–346 6 −22.9 sja-miR-125 UCCCUGAGACCCUUUGAUUGUC 22 CNUS0000024724:7691–7712 Smp_contig001766:3162–3183 2 −25.6 sja-miR-new1 UCCCUGAGACUGAUAAUUGCUC 22CCON0000000380 (-) d:353325–353346:15–36 shisto8125f02.p1k 4 −29.2 alocation of the miRNA sequence within the published chromosomal sequence of S. japonicum. [score:1]
Hence, herein we have tentatively designated the five novel miRNAs from S. japonicum as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Figure S8 The amplification plot of sja-let-7, sja-mir-71, sja-bantam and alpha tubulin. [score:1]
Alignments of the miRNAs with corresponding family members indicated that four of them belong to a metazoan miRNA family: let-7, miR-71, bantam and miR-125. [score:1]
Membranes were incubated with five different biotin-labeled probes (1: sja-let-7, 2: sja-miR-71, 3: sja-bantam, 4: sja-miR-125 and 5: sja-miR-new1). [score:1]
The novel miRNAs were designated as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Alignments with known miRNA sequences indicated that four of the five novel S. japonicum miRNAs belong to four different metazoan miRNA families, i. e. let-7, miR-71, bantam, and miR-125 (Figure 3, S3 and S4). [score:1]
[1 to 20 of 18 sentences]
8
[+] score: 35
In fact, lin-4 and let-7 family miRNAs are originally discovered as regulators of developmental timing in C. elegans [17, 18], which precisely control the transition of four larval stages by down -regulating particular targets [19]. [score:6]
Three members, let-7a, let-7b and let-7g expression levels increased, conversely, the other five members, let-7c, let-7f, let-7i, let-7j and let-7k expression levels decreased from BO to AO. [score:5]
Very recently, Alvarellos et al (2013) [22] report that the developmental changes of Lin28/ let-7 expression in hypothalamus may lead to puberty onset of rats. [score:4]
LIN28A and LIN28B are the homologs of heterochronic gene LIN28 in Caenorhabditis elegans, which encode RNA -binding proteins that inhibit the maturation of the let-7 family microRNAs (miRNAs) [14]. [score:3]
However, let-7a, let-7b and let-7g expression levels are showed to decrease in the hypothalamus of 1-day-old and 36-week-old chicken [33]. [score:3]
Conversely, let-7a, let-7b, miR-132 and miR-145 show opposite expression profiles. [score:3]
Except for the let-7 family, totally 15 miRNAs were found to have more than four times expression changes (|log2fold-change| > 2.0) between BO and AO. [score:3]
The increased expression trends for let-7a and let-7b have also been observed in hypothalamus of rat during puberty onset [22] and in whole brains of aging mice [38]. [score:3]
The results suggest that multiple miRNAs, not just restricted to the sole let-7 family, may be involved in timing the rapid development of chicken gonads. [score:2]
It revealed the diverse functions of the let-7 family members. [score:1]
As expected, the let-7 family was contained in the list. [score:1]
Changes in the c-Myc/ Lin28b/let-7 pathway are also detected in mo dels of delayed puberty by manipulation. [score:1]
[1 to 20 of 12 sentences]
9
[+] score: 34
It has also been reported that miR-30c, let-7a, let-7b and let-7c were up-regulated, while miR-30d, miR-29a and miR-26a were down-regulated in rat granulosa cells treated with FSH for 12 h, which suggests that these miRNAs participate in FSH -mediated progesterone biosynthesis of granulosa cells [45]. [score:7]
In this study, gga-let-7b is up-regulated while gga-let-7 g, gga-miR-17-3p gga-miR-30d, gga-miR-29a, gga-miR-26a and gga-miR-181a are all down-regulated in the mature ovary compared with the immature ovary. [score:6]
A recent study showed that the activated estrogen receptor can suppress the expression of BAX by up -regulating a group of miRNAs including hsa-let-7 family members in endometrial adenocarcinoma and precancerous lesions [47]. [score:6]
The let-7 miRNA family was also expressed abundantly in ovary and oocyte of bovines [28, 29, 38, 39], as well as in murine ovaries and testis [40]. [score:3]
In addition, we found that two members of the let-7 miRNA family, gga-let-7b and gga-let-7 g, exhibited significantly differential expression, although the fold-changes were lower at 1.292- and 1.366-fold, respectively. [score:3]
The following 15 miRNAs were dominantly expressed in the two libraries: gga-miR-10a, gga-miR-146c, gga-miR-101, gga-miR-21, gga-let-7a, gga-let-7b, gga-let-7c, gga-let-7j, gga-let-7f, gga-let-7 k, gga-miR-30a-5p, gga-miR-30e, gga-miR-148a, gga-miR-100 and gga-miR-126. [score:3]
In the sexually mature chicken ovary library, gga-miR-10a and gga-miR-21 were the two most frequently sequenced miRNAs, and the let-7 miRNA family was another abundant cluster with let-7a being the most abundantly expressed miRNA. [score:3]
For example, in the immature ovary, gga-let-7 family abundance varied from 855 reads (gga-let-7d) to 415,122 reads (gga-let-7a). [score:1]
However, in the immature ovary, gga-let-7a (415,122 reads) and gga-let-7j (413,833 reads) were the most abundant (Additional file 1: Table S2). [score:1]
The three most abundant miRNAs in the chicken ovary are gga-miR-10a, gga-let-7 and gga-miR-21. [score:1]
[1 to 20 of 10 sentences]
10
[+] score: 18
As a lung tumor suppressor in humans, overexpression of let-7 results in inverse expression of RAS, a potential oncogene, and inhibits lung tumor cell growth [79]. [score:9]
It was reported to exert a negative effect on cell number and positive effect on the fraction of cells in the G2/M cell cycle phase following peripheral introduction of let-7 in primary fibroblasts by targeting and down -regulating the cell division cycle 34 (Cdc34) gene, indicating its crucial influence on cell cycle control [80]. [score:4]
Introduction of let-7 family members in mouse embryonic stem cells (ESCs) can suppress continuous self-renewal resulting from a lack of DiGeorge syndrome critical region gene 8 (Dgcr8), which enables silencing of this program. [score:3]
Additionally, Glazov et al. found that the total number of let-7 family reads increased significantly during embryonic stages on days 5, 7, and 9, particularly let-7b, with maximum reads on day 9 [47]. [score:1]
After identification in C. elegans, let-7 miRNAs have been shown to play vital roles in mediating cell proliferation and differentiation. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 17
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
Similar miRNA profiles were observed in 18SSI and 18DSI, with the presence of identically expressed high-abundance miRNA, such as miRNA-1, miRNA-71b-5p and let-7. By contrast, in 23DSI and 23SSI, most of these high-abundance miRNAs were down-regulated. [score:6]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
For example, their levels of miR-1c, miR-1a, miR-1, miRNA-71b-5p, and let-7 were far lower than those in 18 DSI or 18SSI. [score:1]
We found the level of high-abundance miRNAs such as miR-1, miR-1a, miR-1c, miR-71b-5p, and let-7 to be higher in 18DSI and 18SSI than in 23DSI and 23SSI. [score:1]
[1 to 20 of 5 sentences]
12
[+] score: 17
A total of 42 TF–miRNA–mRNA interactions involving 1 TF (CTCF), 3 differentially expressed miRNAs (gga-let-7 g, gga-miR-196-2, and gga-miR-1635) regulated by CTCF and 42 differentially expressed mRNAs (also predicted miRNA targets) are summarised for the IBDV-stimulated group. [score:8]
Of these miRNAs, gga-let-7 g, gga-miR-196-2, gga-miR-1635, gga-miR-1603 and gga-miR-21 were significantly upregulated in IBDV-infected DCs. [score:4]
Gga-let-7 regulates TGFBR1 and LIN28B during the differentiation process in early chick development [31]. [score:3]
Our study recognised three TF–miRNA networks in IBDV-stimulated DCs (CTCF-Let-7 g, CTCF-miR196-2, and CTCF-miR1635). [score:1]
Three TF–miRNA networks were also identified in IBDV-stimulated DCs (CTCF-Let-7 g, CTCF-miR196-2 and CTCF-miR1635). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 15
The other abundantly expressed miRNAs family in our libraries was gga-let-7, which also was reported to have abundant expression in chicken skeletal muscle [40]. [score:5]
The family of let-7 miRNAs has been shown to play vital roles in mediating cell proliferation and differentiation, in particular, gga-let-7b has demonstrated a role in growth regulation through targeting GHR [26]. [score:4]
The let-7 family was also expressed abundantly in the breast muscle libraries, five of them (gga-let-7a, gga-let-7c, gga-let-7f, gga-let-7j and gga-let-7k) are in the list of the top 20 abundant miRNAs. [score:3]
miRNAs Normalized Reads Total Reads WRRh WRRl XHh XHl gga-miR-133a 3,558,683 3,069,071 1,997,286 2,607,787 11,232,827 gga-miR-133c 3,350,936 2,885,440 1,878,925 2,449,209 10,564,510 gga-miR-133b 3,326,848 2,864,578 1,864,721 2,431,274 10,487,421 gga-let-7a 1,699,621 1,513,865 857,210 1,133,532 5,204,228 gga-miR-22-3p 1,333,233 1,145,421 712,464 988,186 4,179,304 gga-miR-30a-5p 1,213,468 1,148,128 790,893 930,507 4,082,996 gga-miR-26a 1,212,635 1,054,689 691,456 1,006,522 3,965,302 gga-miR-30d 851,887 813,262 583,932 667,002 2,916,083 gga-miR-181a-6p 918,452 836,452 485,661 650,836 2,891,401 gga-miR-10a-5p 943,686 782,180 420,809 663,401 2,810,076 gga-miR-10b 911,725 757,564 398,852 633,567 2,701,708 gga-miR-30e 799,679 730,832 501,718 596,218 2,628,447 gga-let-7j 848,972 756,205 428,182 566,165 2,599,524 gga-let-7f 398,292 363,598 206,995 274,333 1,243,218 gga-miR-148a 288,585 300,432 144,015 180,973 914,005 gga-miR-146c-5p 224,147 207,782 171,443 132,712 736,084 gga-let-7k 211,853 206,518 118,297 155,412 692,080 gga-let-7c 242,661 189,820 111,118 139,257 682,856 gga-miR-199-3p 168,417 152,158 75,346 121,460 517,381 gga-miR-126-5p 139,914 109,805 89,607 86,681 426,007 Differentially expressed miRNAs were identified by DEGseq analysis (fold change > 1.5 or < 0.66; p-value < 0.05; q-value < 0.01), as a result, 200, 279, 257 and 297 miRNAs were detected in four comparisons of WRRh vs. [score:3]
[1 to 20 of 4 sentences]
14
[+] score: 14
For example, the three members of the let-7 family (let-7a, let-7f, let-7k) are broadly expressed across tissues [36] and tissue enrichment has been found for miR-499-5p and −3p in heart [37], miR-122-5p in liver [38], miR-202-5p in testis [39] and gga-miR-107-3p in brain tissues [40] (Table 2). [score:3]
A great variability in the number of target genes per miRNA was observed, ranging from six for gga-miR-184-3p to 276 for hsa-let-7a-3p. [score:3]
Given that in mice the overexpression of the let-7 family leads to decreased fat mass and body weight [50], our data suggest a fundamental role of the let-7 family in response to intense selection for metabolic traits in these lines. [score:3]
Together with other members of the let-7 family, miR-let-7f regulates the glucose metabolism in multiple organs [50] and has an important role in the control of fasting glucose concentration [51]. [score:2]
This set includes five mature miRNAs (hsa-let-7a-3p, ccr-miR-133a-5p, mmu-miR-144-5p, aca-miR-21-3p and hsa-miR-30c-2-3p), which are present in miRBase as Gallus gallus mature miRNAs with a different 3′ editing (Table 2). [score:1]
a Difference with hsa-let-7a-3p: extra C in 3′. [score:1]
It is remarkable that the three other mature miRNAs encoded by the let-7 family (gga-miR-let-7a-5p and-3p, and gga-miR-let-7k-5p) were found to be more abundant in the R+ than in the R− line (Figure 4, Table S1). [score:1]
[1 to 20 of 7 sentences]
15
[+] score: 13
For instance, few proteins (IRAK1, IRAK2, and TRAF6) within TLR signaling have been confirmed as direct targets of miR-146 (O'Neill et al., 2011); signal molecules MyD88, TAB2, SHIP1, and SOCS1 were targets of miR-155 (Eulalio et al., 2012); and cytokines IL-6 and IL-10 are targeted by Let-7 (Stae del and Darfeuille, 2013). [score:8]
Previous studies have shown that miRNAs, such as miR-146a, miR-155, and Let-7 and their targets are involved in the regulation of immune response to Salmonella or lipopolysaccharide infection in mice (O'Neill et al., 2011; Schulte et al., 2011; Eulalio et al., 2012) and swine (Bao et al., 2014, 2015; Yao et al., 2016a, b). [score:4]
Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 13
By using three different endogenous control miRNAs (U6, 5S, and 18S), the results have all showed that two miRNAs (gga-miR-181b-5p_R + 1 and gga-miR-30b-5p) had significantly lower expression levels in matured livers than the postnatal livers, and the expression level of another four miRNAs (gga-let-7a-5p, gga-miR-2954_R + 2, gga-miR-21-5p, and gga-miR-122-5p) were significantly increased in matured livers (Fig.   3), which were consistent with the miRNA-seq data. [score:5]
In additional, of the top 10 abundantly differentially expressed miRNAs identified in this study, some of them, such as miR-21 [20], miR-30c [14], miR-191 [21], let-7a and miR-22 [22] have also been reported to play important roles in the liver development. [score:4]
Moreover, we also found that miRNA-30 family and let-7 family were significantly differentially expressed between the postnatal and matured livers and were abundant in the liver, whose important roles in the liver development have been proved 14, 22. [score:4]
[1 to 20 of 3 sentences]
17
[+] score: 12
In zebrafish, upon retinal injury, Müller glia cells express the proneural gene ascl1a along with lin-28, generating a regulatory loop in which ascl1a regulates lin-28, which in turn negatively regulates the miRNA Let-7[29]. [score:6]
During in vitro differentiation of mouse embryonic carcinoma cells to neural and glial fates, Lin-28 can alter the cell fate independently of let-7; in addition, overexpression of Lin-28 increases neurogenesis in the same cell types [33]. [score:3]
Lin-28 is an important regulator of let-7 miRNAs, and it has a functional role in organismal growth and metabolism, tissue development, somatic reprogramming and cancer (reviewed in [32]). [score:3]
[1 to 20 of 3 sentences]
18
[+] score: 11
One study revealed that the let-7 family of miRNA is downregulated in the regenerating newt auditory epithelium [32]. [score:4]
One study revealed that the let-7 family of miRNA are downregulated in the newt inner ear after hair cell injury [32]. [score:4]
An interesting translational correlate to this finding is that let-7 reduces tumor growth in a rodent mo del of lung cancer, providing additional evidence for the antiproliferative effects of this particular family of miRNA [93]. [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 10
Methylation, post-translation modifications, and Lin28 genes regulate the let-7 family. [score:4]
Previous studies of the let-7 family have largely focused on tumor suppression mechanisms [46], and studies investigating the family’s role in growth and development are rare. [score:2]
Deletion, or mutation of the function of let-7, may lead to defects in the transformation of nematodes from their larval to adult stage [44]. [score:2]
The let-7b miRNA is a member of the let-7 family. [score:1]
There are 13 homologs in the let-7 family in the human genome, clustered into eight sites [45]. [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 9
As illustrated in Fig 3, 7 miRNAs including miR-29c, miR-217, miR-375, miR-215, miR-19b, miR-133a and let-7a had relatively low and stable expression levels (P < 0.05) in early period, and increased significantly (P < 0.01) from 12 to 13 weeks when the gonads entered into rapid development. [score:4]
The developmental change of let-7a in hypothalamus is suggested to result in puberty onset in rats [33]. [score:2]
miR-375 and let-7a also play roles in regulation of insulin sensitivity and glucose metabolism [41, 42, 43]. [score:2]
According to previous reports and our sequencing results, 9 miRNAs, including miR-29c-3p, miR-375, miR-215-5p, miR-9-5p, miR-19b-3p, miR-133a-3p, let-7a, miR-217-5p and miR-155 were determined as candidates. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 9
Luciferase activity derived from firefly luciferase (FL)-ban sensor, renila luciferase (RL)- numb 3´UTR, or RL- numb 3´UTR [mut] reporters in response to ban-5P miRNA co -expression was normalized with values from let-7A control miRNA co -expression. [score:5]
In translational reporter assays, the addition of numb 3´-UTR made the translation of the luciferase reporter specifically sensitive to the presence of ban but not let-7 miRNA (Fig 4A). [score:4]
[1 to 20 of 2 sentences]
22
[+] score: 8
In mammals, a number of miRNAs have been demonstrated to target genes involved in adipogenesis and lipid metabolism, such as the regulation on the proliferation of adipose tissue-derived mesenchymal stem cells by miR-21 and miR-196a [4– 6]; the enhancement of adipogenesis by miR-103, miR-224 and the miR-17–92 cluster [7– 9]; the impairment of adipogenesis by the let-7 family, miR-448, miR-15a and miR-27 [10– 13]; the regulation of adipocyte lipid metabolism by miR-27a and miR-143 [13– 15]; and the important role of miR-33 on the repression of sterol transporters reported in numerous studies [16– 24]. [score:5]
The top 10 abundant miRNAs included the let-7 miRNA family (let-7a, j, b, f, c, and k), gga-miR-148a, gga-miR-146c, gga-miR-10a, and gga-miR-21. [score:1]
Moreover, gga-let-7a and gga-let-7j were the most frequently sequenced miRNA in both lines (>18%) (Figs. 2 and 3). [score:1]
The let-7 miRNA family was the most abundant, representing 83.3% and 79.46% of the total reads in lean and fat broilers, respectively. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 8
Increased expression of Wnt genes and let-7 miRNAs in the Harderian gland may increase the efficiency of this lymphoid tissue, by serving as a home to progenitor or naïve lymphocytes that can quickly be differentiated or activated in response to a stimulus. [score:3]
Post-transcriptional regulation of the let-7 microRNA during neural cell specification. [score:2]
The Harderian gland may utilize Wnt genes and let-7 miRNAs to control or stall cell differentiation. [score:1]
Previously, increased levels of let-7 pri-miRNA were found in undifferentiated embryonic stem cells (Wulczyn et al., 2007). [score:1]
The let-7 family of microRNAs. [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 7
Transfection of miR-2 (A), Let-7a (B), bantam (C), miR-8 (D and E), miR-31 (F), miR-1989 (G), and miR-3479 mimics (H) into HEK293T or Hela cells led to a significant reduction of luciferase activity from co -transfected plasmids containing their corresponding target regions. [score:3]
1005423.g003 Fig 3Transfection of miR-2 (A), Let-7a (B), bantam (C), miR-8 (D and E), miR-31 (F), miR-1989 (G), and miR-3479 mimics (H) into HEK293T or Hela cells led to a significant reduction of luciferase activity from co -transfected plasmids containing their corresponding target regions. [score:3]
Furthermore, co-transfection in these experiments with antisense miR -mimics (miR-2 and let-7a) led to de-repression of luciferase (Fig 3A and 3B). [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
a induces neuronal lineage commitment of cultured mouse NSCs by targeting lin-28 which inhibits pre-let-7 processing by Dicer in ESCs and thus, contribute to the maintenance of the NSCs self-renewal capacity (Rybak et al., 2008). [score:5]
A feedback loop comprising lin-28 and controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
let-7. miR-124. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
In addition the miRNAs clusters that were significantly down-regulated miR-15/16 and let-7 are typically down-regulated in stem cells and cancer [62- 64]. [score:7]
[1 to 20 of 1 sentences]
27
[+] score: 7
Mice fed a HFD and overexpression of let-7 had impaired glucose tolerance and IR, despite having normal insulin production and secretion levels [254]. [score:3]
The let-7 family of miRNAs also participates in the regulation of IR. [score:2]
Moreover, the administration of anti-miRNA let-7 partially diminished the effects of HFD on IR in experimental studies on mice and humans [255]. [score:1]
In addition, plasma values of let-7a and 7f are significantly lower in patients with T2DM. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Interestingly, Xue et al. (2008) showed that three of the miRNAs that we find in serum (sja-bantam, sja-miR-71 and sja-let-7) are expressed during all the stages of parasite development but are enriched in the cercariae, suggesting that they may be important during the initial stages of schistosome infection [65]. [score:4]
The other 2 miRNAs, sma-miR-10-5p and sma-let-7-3p, were excluded from analysis because they are highly similar to homologous mouse miRNAs that are present at >100 fold higher read frequencies (Table S3). [score:1]
22875816:+ 3sma-let-7-3p 3 CAUACAACCGACUGGCUUUCC S_mansoni. [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 6
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 6
Among other miRNAs, we found that the let-7 miRNA family was another abundant cluster with let-7f-5p being the most abundantly expressed miRNA. [score:3]
The let-7 miRNA family is abundantly expressed in bovines [69– 71] and in murine ovaries and testis [72]. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 5
Another recent study has shown that the two RNAse III endonucleases dicer and drosha inhibit the expression of thrombospondin-1 by controlling the levels of let-7 and miR-27b, thus modulating angiogenesis [23]. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 5
A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence. [score:3]
For example, the members of the let-7 microRNA family [10] and miR-105 can regulate mRNA level of TLR4 and TLR2 respectively [11]. [score:2]
[1 to 20 of 2 sentences]
33
[+] score: 5
Moreover, lncRNA H19, which is highly expressed in the developing embryo and in adult muscle, functions as a molecular sponge for the let-7 family of miRNAs, and thereby regulates muscle differentiation (Kallen et al., 2013). [score:4]
The imprinted H19 lncRNA antagonizes let-7 microRNAs. [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 4
Let-7 was down-regulated to induce the release of cytokine IL6 (interleukin 6) and IL10 to participate in the regulation of immune response to Salmonella infection in macrophages [14]. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 4
These genes also localize in 7 genomic clusters, together with mir-100 and mir-125 miRNA families (see previous study on the evolution of the let-7 miRNA cluster in [73]). [score:1]
Evolution of the let-7 microRNA Family. [score:1]
Another obvious loss in birds is cluster F, containing two let-7 microRNA paralogs. [score:1]
In addition, the microRNA family let-7 is the most diverse microRNA family with 14 paralogs in human. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 4
The miRNA let-7c, a member of the let-7 miRNA family, was downregulated in the liver upon hatching (Fig. 3e). [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 3
The first two miRNAs, lin-4 and let-7, were discovered as important post-transcriptional regulators for the development of Caenorhabditis elegans in the early larval stage [11]. [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
Some host miRNAs, including gga-miR-let-7, gga-miR-199a-1, gga-miR-26a, gga-miR-181a, and gga-miR-16, were expressed at lower levels in MDV -induced tumors than non-infected spleens, indicating their potential importance in tumorigenesis. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
According to previous experimental studies, DICER1 was found targeted by nine miRNAs: hsa-let-7a, - 7b, - 7c, and -7d, hsa-mir-18a, -103, -107, -374a, and -519a [52]– [55]. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
The reproducibility of these results was tested by Taqman RT-PCR, selecting 18 miRNAs (hsa-let-7a, hsa-miR-141, hsa-miR-143, hsa-miR-145, hsa-miR-17, hsa-miR-182, hsa-miR-191, hsa-miR-199a-5p, hsa-miR-200a, hsa-miR-200b, hsa-miR-222, hsa-miR-29b, hsa-miR-34a, hsa-miR-424, hsa-miR-15a, hsa-miR-199a-3p, hsa-miR-26b, hsa-miR-361-3p) previously showing at least a three-fold modulation in expression in a wide panel of PDAC cell lines 49. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
Let-7b, which belongs to the highly conserved let-7 family, plays a crucial role in development and cell maturation [35]. [score:2]
Johnson C. D. Esquela-Kerscher A. Stefani G. Byrom M. Kelnar K. Ovcharenko D. Wilson M. Wang X. Shelton J. Shingara J. The let-7 microRNA represses cell proliferation pathways in human cells Cancer Res. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 3
All values were normalized to the expression of the endogenous let-7a, and levels were calculated as fold -expression change relative to those from uninfected 265L cells. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
A number of microRNAs (e. g., let-7, miR-199a-1, 26a) are expressed at lower levels in MDV -induced tumors, highlighting the potential importance of this class of molecules in tumorigenesis. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 2
Six of these miRNAs (miR-31, miR-10a, miR-10b, miR-16C and two let-7 members) have been implicated in skeletal muscle regeneration or development [39- 42]. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 2
The discovery of the regulatory miRNA let-7 in C. elegans in 2000 [10], with homologs in other species including humans, caused researchers to reconsider the idea that miRNAs may have a more widespread function within cells. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
Since the discovery of the first two miRNA genes, lin-4 [1, 2] and let-7 [3, 4], much has been learned about the structure, biogenesis and function of miRNAs [5- 7]. [score:1]
Some, the let-7 family for example, maintain almost identical mature forms in evolution. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 1
Data normalized to gga-let-7a. [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
Since the first microRNA (miRNA) Lin-4 was discovered in nematode in 1993 [1], and the function of miRNA let-7 was subsequently demonstrated [2], miRNAs began to attract the attention of researchers and subsequently they have become an intense and focused area of biological research. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
Further, deep sequencing detected let-7, miR-21, and miR-30 in rainbow trout eggs, which indicated that these miRNAs may play roles in controlling egg quality [21]. [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
The imprinted H19 lncRNA antagonizes let-7 microRNAs. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
In MDV infected CEFs, gga-mir-29b,-196,-133a,-10b,-30d were increased, and gga-mir-let-7a, 7b, 7f and gga-mir-1a, mir-130a were decreased [87]; of these only gga-mir-10b was increased in our data. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
Seven conserved families all were DE with P ≤ 0.05, including let-7 (let-7a, -7b, -7c,-7f, -7g, -7i, -7j, and -7k), miR-130 (miR-130a, and -130b), miR-146 (miR-146a, -146b, and -146c), miR-15 (miR-15a, -15b, and -15c), miR-181 (miR-181a and -181b), miR-29 (miR-29a, -29b and -29c), and miR-30 (miR-30a, -30b, -30c, -30d, and -30e). [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Edge R. E. Falls T. J. Brown C. W. Lichty B. D. Atkins H. Bell J. C. A let-7 microRNA-sensitive vesicular stomatitis virus demonstrates tumor-specific replicationMol. [score:1]
[1 to 20 of 1 sentences]