sort by

13 publications mentioning gga-mir-19a

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-19a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 376
In the in vitro experiments, the over -expression of gga-miR-19a resulted in a significant increase in NF-κ B, TNF-α and MyD88 expression at mRNA levels in DF-1 cells (Figures 10A–C), whereas gga-miR-19a inhibitor drastically inhibited NF-κ B, TNF-α and MyD88 expression at the mRNA level (Figures 11A–C). [score:11]
We demonstrated that gga-miR-19a was significantly up-regulated in MG-infected DF-1 cells relative to its expression in non-infected DF-1 cells (Figure 8A), whereas the expression of ZMYND11 mRNA was significantly down-regulated (Figure 8B). [score:11]
A random miRNA mimics that had not been found to suppress any chicken target genes (denoted as miR-19a-NC), and a random miRNA inhibitor that had not been found to promote any chicken target genes (denoted as miR-19a-Inh-NC) were also designed and synthesized to serve as the negative controls. [score:9]
These results also confirm that gga-miR-19a was up-regulated in cells and tissues infected by MG and could directly and negatively regulate ZMYND11 expression by binding to the 3′UTR of ZMYND11 mRNA. [score:8]
In summary, our results strongly suggest that the up-regulation of gga-miR-19a represses the expression of ZMYND11 in MG-infected cells and tissues, which in turn activates the NF-κB signaling pathway and promotes cell proliferation and the expression of pro-inflammatory cytokines to defend against MG infection. [score:8]
Conversely, NF-κ B, TNF-α, and MyD88 expression were greatly inhibited by the over -expression of miR-19a-Inh (Figures 11A–C). [score:7]
ZMYND11 is the direct target of gga-miR-19aTo further clarify whether gga-miR-19a directly targets to the 3′-UTR of ZMYND11, we used a luciferase reporter gene assay (psi-CHECK™-2), where the firefly luciferase gene was fused to the entire 3′-UTR of ZMYND11 (Luc- ZMYND11), and the Renilla luciferase was used for normalization. [score:6]
These results suggest that gga-miR-19a positively regulates the activity of the NF-κB signaling pathway in inflammation by inhibiting ZMYND11 expression. [score:6]
The up-regulation of miR-19a and miR-19b promotes cervical carcinoma cell proliferation and invasion by targeting CUL5 (Xu et al., 2012). [score:6]
These results indicate that gga-miR-19a down-regulates ZMYND11 expression through binding to the ZMYND11 3′-UTR in DF-1 cells. [score:6]
Altogether, these results indicate that gga-miR-19a inhibited ZMYND11 gene expression by directly binding to its complementary sequence in the 3′-UTR of ZMYND11 in a sequence-specific manner. [score:6]
Our previous deep sequencing results showed that some host miRNAs were aberrantly expressed, and gga-miR-19a was up-regulated in lungs of MG-infected SPF chicken embryos (unpublished lab data). [score:6]
Furthermore, we identified ZMYND11 as a gga-miR-19a target and followed up with a detailed miRNA regulation of ZMYND11 expression, the cell cycle, cell proliferation and the NF-κB signaling pathway in the context of MG infection. [score:6]
Our results suggest that gga-miR-19a might play a critical regulatory role in activating the NF-κB signaling pathway to produce pro-inflammatory cytokines by suppressing ZMYND11 expression. [score:6]
By transient transfection, gga-miR-19a was over-expressed in DF-1 cells at 88.9 times the level of endogenous gene expression (miR-19a-NC) (Figure 3A). [score:5]
In contrast, the endogenous gga-miR-19a was reduced 8.5-fold in the cells transfected with gga-miR-19a inhibitor (Figure 4A), which led to the increased expression of ZMYND11 at both the mRNA and protein levels at 48 h post-transfection (Figures 4B,C). [score:5]
The seed sequence of gga-miR-19a is underlined, and the matching or complementary nucleotides between gga-miR-19a and ZMYND11 3′-UTR are indicated; (B) The predicted secondary structure of the RNA duplex of gga-miR-19a and the ZMYND11 3′-UTR target site (Red: Target sequence; Green: gga-miR19a); (C) Sequence alignment of ZMYND11 3′-UTR from different species. [score:5]
The over -expression of gga-miR-19a accelerated the cell cycle progression to promote proliferation by enhancing the percentages of DF-1cells in the S and G2 phases (Figure 6), whereas the gga-miR-19a inhibitor repressed proliferation of the DF-1 cells by inducing the G1 phase arrest (Figure 7). [score:5]
Figure 11Inhibition of gga-miR-19a reduces NF-κ B, TNF-α and MyD88 expression. [score:5]
Name Sequences (5′-3′) gga-miR-19a mimics UGUGCAAAUCUAUGCAAAACUGA AGUUUUGCAUAGAUUUGCACAUU gga-miR-19a NC sense UUCUCCGAACGUGUCACGUTT gga-miR-19a NC antisense ACGUGACACGUUCGGAGAATT gga-miR-19a inhibitor UCAGUUUUGCAUAGAUUUGCACA gga-miR-19a inhibitor NC CAGUACUUUUGUGUAGUACAA Mycoplasma strains and cell cultureMG-HS is a virulent strain isolated from a chicken farm in Hubei province, China (Bi and Ji, 1988; Bi and Xu, 1997). [score:5]
To determine the effects of gga-miR-19a on NF-κB activity, DF-1 cells were transfected with gga-miR-19a, miR-19a-NC, miR-19a-Inh or miR-19a-Inh-NC for 48 h. The over -expression of gga-miR-19a, but not miR-19a-NC, resulted in a significant increase in NF-κ B, TNF-α, and MyD88 expression (Figures 10A–C). [score:5]
To identify the targets of gga-miR-19a, we carried out a bioinformatics analysis using targetScan (http://www. [score:5]
Furthermore, gga-miR-19a and its target gene ZMYND11are potential diagnostic biomarkers and therapeutic targets in the prevention and treatment of mycoplasmosis. [score:5]
ZMYND11 was listed as a potential gga-miR-19a target gene based on its high score (score 98), and the highly conserved target site on the 3′-UTR of ZMYND11 in a wide range of species, including human, mouse, dog, monkey, platypus, etc. [score:5]
After miR-19a inhibitor was transfected into DF-1 cells (miR-19a-Inh), the expression of gga-miR-19a was significantly repressed. [score:5]
Figure 3 Gga-miR-19a inhibits ZMYND11 expression. [score:5]
Name Sequences (5′-3′) gga-miR-19a mimics UGUGCAAAUCUAUGCAAAACUGA AGUUUUGCAUAGAUUUGCACAUU gga-miR-19a NC sense UUCUCCGAACGUGUCACGUTT gga-miR-19a NC antisense ACGUGACACGUUCGGAGAATT gga-miR-19a inhibitor UCAGUUUUGCAUAGAUUUGCACA gga-miR-19a inhibitor NC CAGUACUUUUGUGUAGUACAA MG-HS is a virulent strain isolated from a chicken farm in Hubei province, China (Bi and Ji, 1988; Bi and Xu, 1997). [score:5]
The conserved target sequences are highlighted; (D) Predicted function of the target gene of gga-miR-19a. [score:5]
Potential gga-miR-19a targets were predicted by TargetScan (http://www. [score:5]
These results were consistent with the predictions obtained by bioinformatics, and indicated that MG-infection could enhance the expression of gga-miR-19a, NF-κ B, TNF-α and MyD88, but inhibited that of ZMYND11. [score:5]
Together, the results suggest that the up -expression of gga-miR-19a inhibits MG infection by improving cell proliferation through inducing the transition from the G1 phase to the S and G2 phases. [score:5]
In the in vivo experiments, MG infection resulted in a significant increase of gga-miR-19a, NF-κ B, TNF-α and MyD88 expression but a dramatic decrease in ZMYND11 expression (Figures 9A–E). [score:5]
Figure 4 Inhibition of gga-miR-19a increases ZMYND11 expression. [score:5]
Using miRNA deep sequencing, we previously found that gga-miR-19a was up-regulated in infected chicken embryonic lung tissues (unpublished lab data). [score:4]
MicroRNA and transcription factor co-regulatory network analysis reveals miR-19 inhibits CYLD in T-cell acute lymphoblastic leukemia. [score:4]
In this study, we further demonstrate that gga-miR-19a is significantly up-regulated in MG-infected chicken embryonic lungs and DF-1 cells. [score:4]
MicroRNA-19 (miR-19) regulates tissue factor expression in breast cancer cells. [score:4]
Figure 2Gga-miR-19a directly targets to ZMYND11. [score:4]
MiR-19a/b modulate the metastasis of gastric cancer cells by targeting the tumour suppressor MXD1. [score:4]
gga-miR-19a negatively regulates ZMYND11 expression. [score:4]
miR-19a acts as an oncogenic microRNA and is up-regulated in bladder cancer. [score:4]
ZMYND11 is the direct target of gga-miR-19a. [score:4]
Our preliminary deep sequencing data revealed that gga-miR-19a is up-regulated in MG-infected embryonic lungs (unpublished lab data), which suggests that gga-miR-19a might play a crucial role in the response to MG infection. [score:4]
miR-19a is up-regulated in a variety of human cancers, including lung cancer (Navarro et al., 2009), colon cancer (Zhang J. et al., 2012), cervical carcinoma (Xu et al., 2012), breast cancer (Zhang et al., 2011), gliomas (Jia et al., 2013), gastric cancer (Wu et al., 2014), and bladder cancer (Feng et al., 2014). [score:4]
Expression of gga-miR-19a, ZMYND11, NF-κB, TNF-α,and MyD88in MG-infected DF-1 cells and chicken embryonic lungsIt was shown that ZMYND11 could negatively regulate the NF-κB signaling pathway in chickens by DAVID analysis (Figure 1D). [score:4]
The functions of the target genes of gga-miR-19a in chickens were analyzed using DAVID Bioinformatics Resources 6.7 (http://david. [score:3]
As expected, the expression of ZMYND11 showed a pattern opposite that of gga-miR-19a on the 4, 5, 11, and 12th days post-infection (Figure 9B). [score:3]
In summary, our results suggest that gga-miR-19a enhances DF-1 cell proliferation by inhibiting MG propagation. [score:3]
Moreover, we identified ZMYND11 as the target gene of gga-miR-19a (Figure 2). [score:3]
Figure 7 The effect of gga-miR-19a inhibitor on the distribution of DF-1 cells in the cell cycle. [score:3]
As both gga-miR-19a and ZMYND11 are highly conserved in a wide range of species, including human, dog, cow, chimpanzee, mouse, rat, monkey and platypus (Figure 1C), the results will provide valuable insights into the relationship between miRNAs and target genes in other species. [score:3]
At 72 h post-transfection, although the cell viability of the two control groups, miR-19a-NC (MG+) and miR-free (MG+), remained low, a remarkable increase in DF-1 cell proliferation was observed in the cells over-expressed gga-miR-19a. [score:3]
To further clarify whether gga-miR-19a directly targets to the 3′-UTR of ZMYND11, we used a luciferase reporter gene assay (psi-CHECK™-2), where the firefly luciferase gene was fused to the entire 3′-UTR of ZMYND11 (Luc- ZMYND11), and the Renilla luciferase was used for normalization. [score:3]
MicroRNA-19a and -19b regulate cervical carcinoma cell proliferation and invasion by targeting CUL5. [score:3]
Prediction of the target gene of gga-miR-19a. [score:3]
Figure 9Effects of MG infection on the expression of gga-miR-19a, ZMYND11, NF-κ B, TNF-α and MyD88 in the lungs of chicken embryos. [score:3]
By using qPCR and a Western blot, we studied the expression of ZMYND11 in DF-1 cells that were transfected with miR-19a, miR-19a-NC, miR-19a-Inh or miR-19a-Inh-NC. [score:3]
Next, we examined the effect of gga-miR-19a on endogenous ZMYND11 expression in detail. [score:3]
miR-19a and miR-19b over -expression in gliomas. [score:3]
Next, we studied the effects of miR-19a inhibitor on cell proliferation. [score:3]
Moreover, the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1) has been reported to be frequently over-expressed in human cancers and has oncogenic activity (He et al., 2005; Men dell, 2008). [score:3]
ZMYND11 3′-UTR luciferase activity was significantly inhibited by gga-miR-19a, whereas no effect on luciferase activity was observed in the miR-19a-NC -transfected cells (Figure 2). [score:3]
Figure 8Effects of MG infection on the expression of gga-miR-19a, ZMYND11, NF-κ B, TNF-α, and MyD88 in DF-1 cells. [score:3]
Figure 10Over -expression of gga-miR-19a activates NF-κ B, TNF-α and MyD88 in DF-1 cells transfected with gga-miR-19a or the negative control. [score:3]
Consistent with these results, this study found that gga-miR-19a expression was significantly increased in MG-infected DF-1 cells (Figure 8A) and chicken embryonic lungs on the 4, 5, 11, and 12th days post-infection (Figure 9A). [score:3]
Taken together, these results indicate that gga-miR-19a inhibits MG propagation, and promotes the proliferation of DF-1 cells by affecting the cell cycle. [score:3]
On the 4, 5, 11, and 12th days post-infection (equivalent to the 12, 13, 19, and 20th days of egg hatching), the expression of gga-miR-19a was significantly higher in MG-infected chicken embryonic lungs (Figure 9A). [score:3]
gga-miR-19a mimics significantly decreased ZMYND11 expression at both the mRNA level and protein levels at 48 h post-transfection (Figures 3B,C). [score:3]
gga-miR-19a target analysis. [score:3]
Figure 6 The effect of the over -expression of gga-miR-19a on the distribution of DF-1 cells in the cell cycle. [score:3]
As in the in vivo experiments, the expression patterns of NF-κ B (Figure 9C), TNF-α (Figure 9D) and MyD88 (Figure 9E) in lungs were similar to those of gga-miR-19a throughout the test stages after infection. [score:3]
The duplex and minimum free energy (mFE) between gga-miR-19a and 3′-UTR of its potential targets were estimated by RNA hybrid (http://bibiserv. [score:3]
As a result, the cell viability of the blank MG- group and the test group over -expressing gga-miR-19a (MG+) reached the same level at 72 h post-transfection (Figure 5A). [score:3]
TNF-α is a novel target of miR-19a. [score:3]
Figure 1 Bioinformatics analysis of the target genes of gga-miR-19a. [score:3]
Expression of gga-miR-19a, ZMYND11, NF-κB, TNF-α,and MyD88in MG-infected DF-1 cells and chicken embryonic lungs. [score:3]
gga-miR-19a might play an important role in the pathogenesis of MG infection by regulating the MyD88/NF-κB signaling pathway. [score:2]
The over -expression of gga-miR-19a significantly increased the percentage of the S and G2 phases cells, whereas the percentage of the G1 phase cells was significantly decreased compared to that in the control groups except for the blank (MG-) (Figure 6). [score:2]
miR-19 regulates the activity of the NF-κB signaling pathway to produce pro-inflammatory cytokines in inflammation (Gantier et al., 2012). [score:2]
The sequences of all the primers used in this study are listed in Table 1. The sequences of RNA oligonucleotides are shown in Table 2. A gga-miR-19a mimics (denoted as miR-19a) and an inhibitor (denoted as miR-19a-Inh) were designed and synthesized by GenePharma (Shanghai, China). [score:2]
gga-miR-19 target dual-luciferase reporter assay. [score:2]
miR-19a might regulate the NF-κB signaling pathway in inflammation (Gantier et al., 2012; Ye et al., 2012). [score:2]
gga-miR-19a regulates the NF-κB signaling pathway in DF-1 cells. [score:2]
To construct the dual luciferase reporter plasmid, the 3′-UTR region of ZMYND11 covering the predicted gga-miR-19a binding site was amplified by RT-PCR using the cDNA extracted from the chicken embryo lung tissues as the template. [score:1]
However, when miR-19a-Inh was transfected into the DF-1 cells, the luciferase activity was significantly increased, even in the presence of gga-miR-19a. [score:1]
Firstly, 200 μl of Opti-MEMI ReduMced Serum and 6 μl of Lipofectamin 2000 (Invitrogen Life Technologies, USA) were added to centrifuge tube A. Next, 7.5 pmol of miR-19a, miR-19a-NC, miR-19a-Inh or miR-19a-Inh-NC, and 200 μl of Opti-MEMI ReduMced Serum were added to tube B and reacted for 5 min at room temperature. [score:1]
DF-1 cells were transfected with miR-19a -Inh or the negative control. [score:1]
Three control groups, including miR-19a-NC (MG+), miR-free (MG+) and blank (MG−), were used. [score:1]
The DF-1 cells were transfected with gga-miR-19a, miR-19a-NC, miR-19a-Inh or miR-19a-Inh-NC. [score:1]
DF-1 cells were transfected with gga-miR-19a or miR-19a-NC and were incubated for 4 h. The cells then were infected with MG-HS strain. [score:1]
To elucidate the biological significance of gga-miR-19a in MG-HS pathogenicity, we transfected DF-1 cells with gga-miR-19a mimics and then infected the cells with 7 μl of MG-HS strain at 10 [10] CCU/ml [denoted as miR-19a (MG+)]. [score:1]
On the 4, 5, 11, and 12th days post-infection, the lungs of infected chicken embryos were processed, and the expression of gga-miR-19a (A), ZMYND11 (B), NF-κ B (C), TNF-α (D), and MyD88 (E) were measured by RT-qPCR. [score:1]
DF-1 cells were then transfected with miR-19a, miR-19a-NC, miR-19a-Inh or miR-19a-Inh-NC, as described above. [score:1]
Three control groups, including miR-19a-Inh-NC (MG+), miR-free (MG+) and blank (MG−), were used. [score:1]
gga-miR-19a promotes the proliferation of MG-infected DF-1 cells by inducing the G1 phase transition into the S and G2 phases. [score:1]
Figure 5 The effect of gga-miR-19a on DF-1 cell proliferation. [score:1]
DF-1 cells were transfected with gga-miR-19a, miR-19a-NC, miR-19a-Inh or miR-19a-Inh-NC and were incubated for 4 h. The cells were then infected with the MG-HS strain. [score:1]
One was transfected with miR-19a-NC and then infected with 7 μl of MG-HS strain at 10 [10] CCU/ml [denoted as miR-19a-NC (MG+)]; the second was infected with only 7 μl of MG-HS strain at 10 [10] CCU/ml [denoted as miR-free (MG+)]; and the third group consisted of the uninfected DF-1cells [denoted as blank (MG−)]. [score:1]
On the contrary, gga-miR-19a-Inh arrested the cell cycle progression at the G1 phase (Figure 7). [score:1]
A miR-19 regulon that controls NF-κB signaling. [score:1]
Next, 200 ng of the luciferase reporter plasmid and 10 pmol of miR-19a, miR-19a-NC, miR-19a-Inh or miR-19a-Inh-NC were also transfected into DF-1 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
miR-21, miR-17 and miR-19a induced by phosphatase of regenerating liver-3 promote the proliferation and metastasis of colon cancer. [score:1]
The Ct (2 [−ΔΔCt]) method was used to calculate relative expression of gga-miR-19, ZMYND11, NF-κ B, MyD88, and TNF-α (Livak and Schmittgen, 2001). [score:1]
DF-1 cells were transfected with miR-19a-Inh or miR-19a-Inh-NC and were incubated for 4 h. The cells were then infected with MG-HS strain. [score:1]
5S -RNA was used as an internal control for miR-19a, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for ZMYND11, NF-κ B, TNF-α and MyD88. [score:1]
As expected, miR-19a-Inh-NC did not have effects on ZMYND11 3′-UTR luciferase activity (Figure 2). [score:1]
Four control groups, including miR-19a-NC (MG+), miR-19a-Inh-NC (MG+), miR-free (MG+) and the blank (MG−), were used. [score:1]
[1 to 20 of 107 sentences]
2
[+] score: 21
The gene expression results showed that, compared with pCMV-HA vector, c-Myc overexpression increased the expression of the pri-miR-17-92 cluster transcript and mature miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a, suggesting that c-Myc regulates chicken miR-17-92 cluster expression (Fig.   9c). [score:9]
For example, miR-17 and miR-19a directly target MAPK1 [20], miR-17-5p can activate p38 MAPK-HSP27 signalling [51], and miR-20a-5p can activate MAPK/ERK and cAMP/PKA signalling pathways [52]. [score:4]
In addition, bioinformatics analysis showed that miR-19a targets K-RAS and RAF1, two principal components of the MAPK signalling pathway [20]. [score:3]
Among these three different cells, the members of miR-17-92 cluster (miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a) were more highly expressed in DF1 cells than in SV and ICPA-1 cells (p < 0.01) (Fig.   1). [score:3]
The miR-17-92 cluster can generate at least six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) from the same primary transcript [5]. [score:1]
Primer name Primer sequences (5′-3′) Tm (°C) miR-17-5p-F1 ACACTCCAGCTGGGCAAAGTGCTTACAGTGCA 55 miR-17-5p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTACCTG miR-17-3p-F1 ACACTCCAGCTGGGACTGCAGTGAAGGC 55 miR-17-3p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAAGTGC miR-18a-F1 ACACTCCAGCTGGGTAAGGTGCATCTAGTG 55 miR-18a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTATCTGCA miR-19a-F1 ACACTCCAGCTGGGTGTGCAAATCTATGCAA 55 miR-19a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGTTTT miR-20a-F1 ACACTCCAGCTGGG TAAAGTGCTTATAGTGC 55 miR-20a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC miR-92-F1 ACACTCCAGCTGGGTATTGCACTTGTCCC 55 miR-92-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGGCCGG U6-F GCGCGTCGTGAAGCGTTC 55 U6-R GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATA URP GTGCAGGGTCCGAGGT DF1 cells were grown at approximately 30~50% confluence, transfected with either psiCHECK2-MAP3K2-3′UTR-WT or psi-CHECK2-MAP3K2-3′UTR-MUT and designated plasmids or miRNA inhibitors in 24-well plates using Lipofectamine 2000 (Invitrogen, USA). [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 16
Accessing the detailed page, we further acquired that miR-19a regulates H3K4me3 states of the miR-17-92 cluster through directly targeting Egr2 and Jardi1b and influences DNA methylation of H3R8 and H4R3 by repressing PRMT5. [score:5]
Similarly, the epigenetic modifications that can affect miR-19a could be searched in the ‘Epigenetic Modification Affects miRNA Expression’ section. [score:3]
The searching result page shows nine records indicating that H3K4me3, H3K79me2, histone acetylation and DNA methylation can all affect miR-19a expression in diverse conditions (Figure 2b). [score:3]
To this end, we merged the aforementioned regulatory information and created a molecular network to reflect the interaction between miR-19a and diverse epigenetics (Figure 2c). [score:2]
Taking miR-19a as an example, we learned that miR-19a can both affect H3K4me3 states in human macrophage and control DNA methylation modification of human leukemia and lymphoma cells through querying in the ‘MiRNA Regulates Epigenetic Modifications’ section (Figure 2a). [score:2]
Figure 2. Searching result and integrated network of ‘miR-19a’. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 15
The expression level of miR-218-5p, miR-30-5p and miR-19-3p was downregulated by estrogen. [score:6]
As shown in Figure 3A, miR-218-5p, miR-30a-5p, miR-30b-5p, miR-30e-5p, miR-19a-3p, and miR-19b-3p were significantly downregulated in 17 β-estradiol treated groups (p < 0.01). [score:4]
Three miRNA clusters (miR-218-5p, miR-19-3p, and miR-30-5p) from 46 differentially expressed miRNA were found to potentially bind to the 3′UTR of ELOVL5 in the present study (Figure 2B). [score:3]
Among them, we found the seed sequences of miR-218-5p, miR-19a-3p, miR-19b-3p, miR-30a-5p, miR-30b-5p, miR-30d-5p, and miR-30e-5p were complementary with the 3′UTR of ELOVL5 (Figure 3A). [score:1]
Two miRNA (miR-124a-3p and miR-124b) and four miRNA clusters (miR-19-3p, miR-218-5p, miR-124-3p, and miR-30-5p) shared by three databases were found to be potentially combine the 3′UTR of ELOVL5, respectively (Figure 2A,B and Figure S3). [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 14
The miR17-92 cluster comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92-1), and it has been shown to accelerate adipocyte differentiation by negatively regulating the tumor-suppressor Rb2/p130 32. [score:4]
It is noteworthy that several of these miRNAs (gga-miR-17-5p, gga-miR-19a, gga-miR-19b and gga-miR-20a) were DEMs here (fold change 1.85 to 7.23) and were up-regulated in AbF from birds with high AbF contents. [score:4]
Eleven of these (miR-204, miR-19a-3p, miR-19b-3p, miR-30d, miR-26a, miR-122-5p, miR-103-3p, miR-27b-3p, miR-92-3p, miR-142-3p, and miR-17-5p) have been implicated, directly or indirectly, in fat deposition; 9 showed a high fold-change (miR-3535, miR-144-3p, miR-30e-5p, miR-301b-3p, miR-215-5p, miR-200a-3p, miR-133a-3p, miR-133c-3p, and miR-146b-5p). [score:3]
Specifically, the integrated analysis of DEMs and DEGs suggests that nine miRNAs (gga-miR-19a-3p, miR-19b-3p, miR-17-5p, miR-30d, miR-26a, miR-103-3p, miR-27b-3p, miR-142-3p, and miR-92-3p) and three genes (ACSL1, FADS2 and ABCD3) are strong candidate miRNAs and genes involved in regulating the accumulation of AbF in chickens. [score:2]
Some of the DEMs identified by deep sequencing (miR-19a-3p, miR-19b-3p, miR-30d, miR-26a, miR-30a-5p, miR-122-5p, miR-103, miR-125b, and miR-17-5p) are known to influence mammalian lipid metabolism. [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 12
These miRNAs were divided into three groups according to their expression levels in the fat broiler line, 4 highly expressed (gga-miR-21, gga-miR-148a, gga-miR-103, gga-miR-101) (2 [-ΔCt] >0.7), 4 moderately expressed (gga-miR-100, gga-miR-146a, gga-miR-92, gga-miR-2188) (0.7>2 [-ΔCt]>0.08), and 7 lowly expressed (gga-miR-1a, gga-miR-130a, gga-miR-221, gga-miR-19a, gga-miR-181b, gga-miR-458, gga-miR-17–3p) (2 [-ΔCt]<0.08) (Table 2). [score:9]
Seven miRNAs (gga-miR-148a, gga-miR-101, gga-miR-100, gga-miR-92, gga-miR-130a, gga-miR-19a and gga-miR-221) with significantly differential expression levels were found (* P<0.05; ** P<0.01). [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 10
Currently, a few studies have indicated that TLRs themselves are directly targeted by miRNAs, and these interactions include the targeting of TLR2 by miR-105[11] and miR-19[48], the targeting of TLR4 by let-7i [10] and the targeting of TLR7 by miR-3148[49]. [score:10]
[1 to 20 of 1 sentences]
8
[+] score: 7
Other miRNAs from this paper: gga-mir-18a, gga-mir-200b, gga-mir-23b, gga-mir-383
Among the predicted miRNA-target relationships, correlations between miR-18a, miR-19a and the target THBS1 are reported to be involved in angiosarcomas 19, while the correlation between miR-200b and target FN1 is associated with ovarian cancer 20. [score:7]
[1 to 20 of 1 sentences]
9
[+] score: 6
In addition, miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels, accounting for 12.4% of the miRNAome in BP25. [score:3]
The miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels (accounting for 12.4% of the miRNAome) in the BP25 cell line. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 5
The networking interactions in these contrast groups identified miR-19a-5p as targeting XIRP1, YBX3, ATP1B1, MAPK6, EGLN1, MAPK6, CAPZB, SELT, EPAS1, NDUFA12, ACTN2, RTN4 and BTBD1. [score:3]
Moreover, in the E11_VS_P1 contrast group, eleven miRNAs (miR-6548-5p, miR-19a-5p, miR-3536, miR-6631-5p, miR-222a, miR-140-3p, miR-92-5p, miR-135a-5p, miR-455-3p, miR-460a-5p and miR-200a-3p), were highly regulated. [score:2]
[1 to 20 of 2 sentences]
11
[+] score: 3
Likewise, miRNAs contained in clade3 and clade4 exhibit greater expression in B19 cells (mir-1627, mir-222b, mir-1633, and mir-19a). [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 3
Analysis also showed that the enrichment of the targets of other miRNAs such as gga-miR-9*, gga-miR-217, gga-miR-19a and gga-miR-23b was also significant. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Within these clusters, the mir-92-mir-19b-mir-20a-mir-19a-mir-18a-mir-17, which is equivalent to the mammalian mir-17-92 cluster, and mir-302b-mir-302c-mir-1811-mir-302a-mir-302d-mir-367 cluster were the biggest clusters containing six miRNAs. [score:1]
[1 to 20 of 1 sentences]