sort by

19 publications mentioning gga-mir-17

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-17. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 155
For example, miR-520b suppressed tumour formation in breast cancer and hepatocellular carcinoma by targeting MAP3K2 and cyclin D1, miR17/20a inhibited tumour growth via targeting the MAP3K2-Erk5 pathway in vivo [43], and miR-26a promoted glioblastoma cell growth in vitro via targeting MAP3K2 [30]. [score:11]
To further understand the mode of action for miR-17-5p/20a in inhibiting MAP3K2 expression, miR-17-5p and miR-20a inhibitors were respectively transfected into DF1 cells, and MAP3K2 mRNA and protein expression were examined using qRT-PCR and IP-western blot analyses. [score:9]
The gene expression results showed that, compared with pCMV-HA vector, c-Myc overexpression increased the expression of the pri-miR-17-92 cluster transcript and mature miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a, suggesting that c-Myc regulates chicken miR-17-92 cluster expression (Fig.   9c). [score:9]
The increased E2F1 expression may reflect the combinatorial effects of the positive E2F1 regulator, c-Myc, whose expression was induced by miR-17-92 cluster overexpression, and the negative E2F1 regulator, miR-17/20a, encoded by the miR-17-92 cluster. [score:9]
The pri-miR-17 -92 expression was normalized to NONO mRNA level, and the mature miRNA expression was normalized to U6 snRNA expression level. [score:7]
However, two members of the miR-17-92 cluster (miR-17 and miR-20a) can posttranscriptionally downregulate E2F1 expression [11], thus counterbalancing the positive feedback loop of E2F1 and c-Myc. [score:6]
However, the miR-17-92 cluster postranscriptionally suppresses E2F1 expression through its two members (miR-17-5p and miR-20a). [score:5]
Sarhan RA Targeting E2F1 and c-Myc expression by microRNA-17-5p represses interferon-stimulated gene MxA in peripheral blood mononuclear cells of pediatric systemic lupus erythematosus patientsDiscov. [score:5]
The miRNA-17-5p inhibitor, miRNA-20a inhibitor and negative control were purchased from Ribobio (Guangzhou, China). [score:5]
At 30% confluency, the cells were respectively transfected with the miRNA-17-5p inhibitor, miRNA-20a inhibitor, miRNA negative control (miR-NC), siMAP3K2 and its corresponding negative controls (siNC) using Lipofectamine 2000 (Invitrogen, Life Technologies, USA) according to the manufacturer’s instructions. [score:5]
In the present study, we demonstrated that miR-17-5p/20a regulates chicken cell proliferation by targeting chicken MAP3K2 (Fig.   2 and 4). [score:4]
For example, miR-17 and miR-19a directly target MAPK1 [20], miR-17-5p can activate p38 MAPK-HSP27 signalling [51], and miR-20a-5p can activate MAPK/ERK and cAMP/PKA signalling pathways [52]. [score:4]
To further verify whether miR-17-5p/20a directly targets MAP3K2, four nucleotides within the two putative miRNA binding sites were mutated in the reporter psi-CHECK2-MAP3K2-3′UTR-WT to generate the MAP3K2 3′UTR mutant reporter (psi-CHECK2-MAP3K2-3′UTR-MUT). [score:4]
The luciferase reporter results showed that the activity of psi-CHECK2-MAP3K2-3′UTR-MUT was significantly higher than that of psi-CHECK2-MAP3K2-3′UTR-WT, suggesting that these miR-17-5p and miR-20a directly target the 3′UTR of MAP3K2. [score:4]
Figure 4MAP3K2 is directly targeted using miR-17-5p/20a. [score:4]
Ma H MicroRNA-17~92 inhibits colorectal cancer progression by targeting angiogenesisCancer. [score:4]
The results showed that both miR-17-5p and miR-20a inhibitors could inhibit the proliferation of DF1 cells compared with the negative control group (miR-NC) (Fig.   4e), in contrast with the effect of the miR-17-92 cluster on the proliferation of DF1 cells, suggesting that miR-17-5p and miR-20a mediate the promotive effect of the miR-17-92 cluster in the chicken cell proliferation. [score:4]
MAP3K2 is targeted by miR-17-5p/20a. [score:3]
Figure 3 The predicted binding sites of miR-17-5p and miR-20a in the 3′ untranslated region (3′UTR) of chicken MAP3K2 mRNA. [score:3]
Jiang H Restoration of miR17/20a in solid tumor cells enhances the natural killer cell antitumor activity by targeting Mekk2Cancer. [score:3]
Interestingly, we also observed that the miR-17-5p/20a inhibitor also significantly increased the luciferase activities of the mutant reporter (psi-CHECK2-MAP3K2-3′UTR-MUT) (Fig.   4b), likely reflecting the incomplete loss of interaction between these two miRNAs and their respective mutated binding sites. [score:3]
Together, these data suggest that the miR-17-92 cluster may promote chicken cell proliferation in part via MAP3K2 targeting by its two members, miR-17-5p and miR-20a. [score:3]
These data suggest that miR-17-5p and miR-20a target MAP3K2 by inducing mRNA degradation. [score:3]
To determine whether the miR-17-92 cluster promotes chicken cell proliferation through its two members, miR-17-5p and miR-20a, we tested the effect of miR-17-5p and miR-20a inhibitors on chicken cell proliferation. [score:3]
Among these three different cells, the members of miR-17-92 cluster (miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a) were more highly expressed in DF1 cells than in SV and ICPA-1 cells (p < 0.01) (Fig.   1). [score:3]
In contrast, both miR-17-5p and miR-20a inhibitors highly significantly increased the luciferase activities of psi-CHECK2-MAP3K2-3′UTR-WT in DF1 cells (Fig.   4b). [score:3]
2009.214 19696742 6. Ventura A Targeted deletion reveals essential and overlapping functions of the miR-17 through 92 family of miRNA clustersCell. [score:3]
To verify whether miR-17-5p and miR-20a target chicken MAP3K2, the 3′UTR fragment (598 bp) of chicken MAP3K2 mRNA, containing the two putative binding sites for miR-17-5p/20a, was RT-PCR amplified and cloned into the psi-CHECK2 vector to yield the MAP3K2 3′UTR reporter (psi-CHECK2-MAP3K2-3′UTR-WT). [score:3]
Inhibition of miR-17-5p and miR-20a reduces the proliferation of DF1 cells. [score:3]
In the present study, we provided evidence that two members of miR-17-92 cluster, miR-17-5p and miR-20a, target the MAPK signalling pathway in chicken cells. [score:3]
As shown in Fig.   4c, d, compared with miR-NC (negative control), miR-17-5p and miR-20a inhibitors increased MAP3K2 mRNA by 70.1% and 84.5% (p < 0.05), respectively, at 48 h after transfection. [score:2]
Wang M miR-17-5p/20a are important markers for gastric cancer and murine double minute 2 participates in their functional regulationEur. [score:2]
The miR-17-5p and miR-20a inhibitors were transfected into DF1 cells and cell proliferation was assayed using the CCK-8 kit. [score:2]
The boxed sequences indicate the putative binding sites for miR-17-5p and miR-20a in the 3′UTR of MAP3K2 mRNA. [score:1]
Primer name Primer sequences (5′-3′) Tm (°C) miR-17-5p-F1 ACACTCCAGCTGGGCAAAGTGCTTACAGTGCA 55 miR-17-5p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTACCTG miR-17-3p-F1 ACACTCCAGCTGGGACTGCAGTGAAGGC 55 miR-17-3p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAAGTGC miR-18a-F1 ACACTCCAGCTGGGTAAGGTGCATCTAGTG 55 miR-18a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTATCTGCA miR-19a-F1 ACACTCCAGCTGGGTGTGCAAATCTATGCAA 55 miR-19a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGTTTT miR-20a-F1 ACACTCCAGCTGGG TAAAGTGCTTATAGTGC 55 miR-20a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC miR-92-F1 ACACTCCAGCTGGGTATTGCACTTGTCCC 55 miR-92-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGGCCGG U6-F GCGCGTCGTGAAGCGTTC 55 U6-R GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATA URP GTGCAGGGTCCGAGGT DF1 cells were grown at approximately 30~50% confluence, transfected with either psiCHECK2-MAP3K2-3′UTR-WT or psi-CHECK2-MAP3K2-3′UTR-MUT and designated plasmids or miRNA inhibitors in 24-well plates using Lipofectamine 2000 (Invitrogen, USA). [score:1]
Molitoris JK McColl KS Distelhorst CW Glucocorticoid -mediated repression of the oncogenic microRNA cluster miR-17~92 contributes to the induction of Bim and initiation of apoptosisMol. [score:1]
The figure shows that MAP3K2 has two putative binding sites for miR-17-5p/20a in its 3′UTR and the two putative binding sites are highly conserved in various animal species. [score:1]
In the present study, we demonstrated that the miR-17-92 cluster promotes chicken cell proliferation through its two members, miR-17-5p and miR-20a (Fig.   2). [score:1]
In the present study, we demonstrated that miR-17/20a mediates the promotive effect of the miR-17-92 cluster on cell proliferation. [score:1]
For example, miR-17-5p promoted cell proliferation in gastric [39] and colorectal cancer cell lines [40], and miR-20a promoted cell proliferation in human lung cancer [41] and multiple myeloma [42]. [score:1]
Yang F miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathwayHepatology. [score:1]
In addition, the MAP3K2 3′UTR mutant reporter psi-CHECK2-MAP3K2-3′UTR-MUT was also generated using gene synthesis by Invitrogen, in which the sequence GUGA was mutated to ACUG within both the predicted miR-17-5p and miR-20a binding sites, respectively. [score:1]
Bioinformatics analysis showed that chicken MAP3K2 mRNA contained two putative binding sites for miR-17-5p/20a at nucleotides 52-58 and 243-250 in its 3′UTR, and these two putative miRNA binding sites were conserved among chickens and other animal species (Fig.   3). [score:1]
The miR-17-92 cluster can generate at least six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) from the same primary transcript [5]. [score:1]
[1 to 20 of 44 sentences]
2
[+] score: 49
Previous studies have validated the connection between AGO2 and early disease-related death in MM patients [34], and AGO2 silencing has been shown to inhibit cell viability in MM cell lines through decreased miR-106a, miR-106b, miR-17-5p and miR-20b expression and consequent further activation of the cyclin -dependent kinase inhibitors p21Waf1/Cip1 and p27Kip1 [29]. [score:9]
Our study, however, revealed a novel role and mechanism of AGO2 as an enhancer of myeloma angiogenesis through miRNA dysregulation, including the upregulation of pro-angiogenic miRNAs such as the let-7 family members and the miR-17/92 cluster and downregulation of the anti-angiogenic miRNA miR-145. [score:8]
The miR-17/92 cluster targets the pro-apoptotic gene Bim to suppress MM apoptosis [30]. [score:5]
Previous studies revealed that the miR-17/92 cluster enhanced angiogenesis by downregulating the anti-angiogenic TSP1 and connective tissue growth factor (CTGF) [16, 20]. [score:4]
The pro-angiogenic let-7 family miRNAs, the miR-17/92 cluster and the anti-angiogenic miRNA miR-145 play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
The pro-angiogenic miRNAs of the let-7 family and the miR-17/92 cluster, along with the anti-angiogenic miRNA miR-145, play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
The miR-17/92 cluster (which encodes miR-17, −18a, −19a/b, −20a and −92-1) is overexpressed in tumour cells [19]. [score:3]
The validated targets of the miR-17/92 cluster include TSP-1, CTGF, TIMP-1 and ITG5a. [score:3]
Most let-7 family members and 2 miR-17/92 cluster members (miR-17a and miR-92-1), all known pro-angiogenic miRNAs, were positively regulated by AGO2 whereas anti-angiogenic miRNAs such as miR-145 and miR-361 were negatively regulated by AGO2. [score:3]
Consistent with the array data, let-7a-1, miR-17 and miR-92-1 expression decreased in the H929-si-AGO2 and LP-1-si-AGO2 cell lines and increased in the U266-pcDNA3-AGO2 and OCI-My5-pcDNA3-AGO2 cell lines compared with the respective controls (p < 0.05). [score:2]
In particular, many of these commonly dysregulated miRNAs are well-known angiogenic miRNAs, including the let-7 family members (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7f-2, let-7 g and let-7i), 2 miR-17/92 cluster members (miR-17a and miR-92-1), miR-145 and miR-361. [score:2]
Of interest, the miRNAs regulated positively by AGO2 included most let-7 family members (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7f-2, let-7 g and let-7i) and 2 miR-17/92 cluster members (miR-17a and miR-92-1), which are known pro-angiogenic miRNAs. [score:2]
Previous studies have identified the miR-17/92 cluster, let-7 family and miR-145 as the modulators of angiogenesis [41]. [score:1]
Previous studies have identified an association between the critical miR-17/92 cluster genes and pathogenesis and poor prognosis in MM patients [30, 31]. [score:1]
[1 to 20 of 14 sentences]
3
[+] score: 29
These miRNAs were divided into three groups according to their expression levels in the fat broiler line, 4 highly expressed (gga-miR-21, gga-miR-148a, gga-miR-103, gga-miR-101) (2 [-ΔCt] >0.7), 4 moderately expressed (gga-miR-100, gga-miR-146a, gga-miR-92, gga-miR-2188) (0.7>2 [-ΔCt]>0.08), and 7 lowly expressed (gga-miR-1a, gga-miR-130a, gga-miR-221, gga-miR-19a, gga-miR-181b, gga-miR-458, gga-miR-17–3p) (2 [-ΔCt]<0.08) (Table 2). [score:9]
The most significantly differentially expressed were gga-miR-206 (3.5-fold), gga-miR-31 (2.5-fold), gga-miR-3535 (2.5-fold), gga-miR-17–3p (2.3-fold), gga-miR-429 (2.3-fold) and gga-miR-200b (2.2-fold), and in comparison, gga-miR-454 (-2.9-fold) and gga-miR-1b (-2.7-fold) were those mostly down-regulated in the fat line (Fig. 4). [score:6]
In mammals, a number of miRNAs have been demonstrated to target genes involved in adipogenesis and lipid metabolism, such as the regulation on the proliferation of adipose tissue-derived mesenchymal stem cells by miR-21 and miR-196a [4– 6]; the enhancement of adipogenesis by miR-103, miR-224 and the miR-17–92 cluster [7– 9]; the impairment of adipogenesis by the let-7 family, miR-448, miR-15a and miR-27 [10– 13]; the regulation of adipocyte lipid metabolism by miR-27a and miR-143 [13– 15]; and the important role of miR-33 on the repression of sterol transporters reported in numerous studies [16– 24]. [score:5]
As a member of the miR-17–92 cluster, miR-17–3p can target RB and fatty acyl desaturase genes [61, 62], and enhance 3T3-L1 differentiation [9]. [score:3]
After qRT-PCR analyses, gga-miR-101 was also found to be significantly differentially expressed, and gga-miR-1a and gga-miR-17–3p were suggestively significant. [score:3]
Four miRNAs significantly differentially expressed between the fat and lean chicken lines detected by deep sequencing were included in the list, i. e. gga-miR-101, gga-miR-2188, gga-miR-1a and gga-miR-17–3p. [score:3]
[1 to 20 of 6 sentences]
4
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
MicroRNA-17-92a upregulation by estrogen leads to Bim targeting and inhibition of osteoblast apoptosis. [score:7]
Mdm2 is negatively regulated by several miRNAs including miR-192 (Pichiorri et al., 2010), miR-194 (Pichiorri et al., 2010), miR-215 (Pichiorri et al., 2010), miR-221 (Kim et al., 2010), and miR-17 (Li and Yang, 2012) in different cellular contexts; however, whether these or other miRNAs regulate Mdm2 expression during the CNS development must be determined. [score:6]
Stress response of glioblastoma cells mediated by miR-17-5p targeting PTEN and the passenger strand miR-17-3p targeting. [score:5]
Although from the beginning of the spinal cord development the p2 progenitors express the pMN marker, Olig2, it is repressed by miR-17-3p through development progression, thus ensuring the proper specification of the pMN/p2 boundary and the production of V2 interneurons (Chen et al., 2011a). [score:5]
In this sense, mice lacking the miR-17/92 cluster present a dorsal shift in pMN/p2 boundary and incorrect production of V2 interneurons (Chen et al., 2011a). [score:1]
Mir-17-3p controls spinal neural progenitor patterning by regulating Olig2/Irx3 cross-repressive loop. [score:1]
Therefore, Olig2 repression mediated by miR-17-3p is crucial for the correct patterning of ventral spinal NPs domains and thus, it is possible that other miRNAs also participate in NPs specifications in different CNS regions. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 14
In vitro target assay for effects of chicken miR-17-3p, miR-22* and miR-1764 on expression of the STAT1 transcript. [score:4]
0076784.g010 Figure 10 In vitro target assay for effects of chicken miR-17-3p, miR-22* and miR-1764 on expression of the STAT1 transcript. [score:4]
In the presence of miR-17-3p, miR-22* and miR-1764 which target the 3′UTR of STAT1, the intensities of GFP signals (21.3±3.4% in control vs. [score:3]
For the dual fluorescence reporter assay, the fusion contained the DsRed gene and either miR-1689* for Sp1; miR-17-3p, miR-22* or miR-1764 for STAT1; miR-1562 for ANGPTL3 and miR-138 for p20K which were designed to be co-expressed under control of the CMV promoter (pcDNA-DsRed-miRNA). [score:2]
6.0±3.1% in miR-17-3p; p<0.01, 4.3±2.1% in miR-22*; p<0.01 and 4.4±2.6% in miR-1764; p<0.01) were decreased, respectively (Figure 10C and 10D). [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 14
The miR17-92 cluster comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92-1), and it has been shown to accelerate adipocyte differentiation by negatively regulating the tumor-suppressor Rb2/p130 32. [score:4]
It is noteworthy that several of these miRNAs (gga-miR-17-5p, gga-miR-19a, gga-miR-19b and gga-miR-20a) were DEMs here (fold change 1.85 to 7.23) and were up-regulated in AbF from birds with high AbF contents. [score:4]
Eleven of these (miR-204, miR-19a-3p, miR-19b-3p, miR-30d, miR-26a, miR-122-5p, miR-103-3p, miR-27b-3p, miR-92-3p, miR-142-3p, and miR-17-5p) have been implicated, directly or indirectly, in fat deposition; 9 showed a high fold-change (miR-3535, miR-144-3p, miR-30e-5p, miR-301b-3p, miR-215-5p, miR-200a-3p, miR-133a-3p, miR-133c-3p, and miR-146b-5p). [score:3]
Specifically, the integrated analysis of DEMs and DEGs suggests that nine miRNAs (gga-miR-19a-3p, miR-19b-3p, miR-17-5p, miR-30d, miR-26a, miR-103-3p, miR-27b-3p, miR-142-3p, and miR-92-3p) and three genes (ACSL1, FADS2 and ABCD3) are strong candidate miRNAs and genes involved in regulating the accumulation of AbF in chickens. [score:2]
Some of the DEMs identified by deep sequencing (miR-19a-3p, miR-19b-3p, miR-30d, miR-26a, miR-30a-5p, miR-122-5p, miR-103, miR-125b, and miR-17-5p) are known to influence mammalian lipid metabolism. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 12
Circular RNA circ-ITCH inhibits bladder cancer progression by sponging miR-17/miR-224 and regulating p21, PTEN expression. [score:6]
circ-ITCH regulated the expression of p21 and PTEN to inhibits bladder cancer progression by sponging miR-17/miR-224 (Yang et al., 2018). [score:6]
[1 to 20 of 2 sentences]
8
[+] score: 9
Foshay K. M. Gallicano G. I. miR-17 family miRNAs are expressed during early mammalian development and regulate stem cell differentiation Dev. [score:5]
Let-7b is a key regulator of development [35], while miR-17-5p, miR-20a and miR-20b are members of miR-17 family, which play important roles during embryo development [63]. [score:4]
[1 to 20 of 2 sentences]
9
[+] score: 8
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
Pullamsetti et al. have reported that miR-17 inhibition alleviated the vascular remo deling as well as the right ventricular hypertrophy in mouse with PH, and the over expressed miR-17 caused an increased proliferation of smooth muscle cells in human [6]. [score:5]
This research highlighted the potential role of specific miRNAs in disease progress [23], like miR-21, miR-204, miR-17, miR-155, miR-138 and miR-30c in human and rat mo dels of PAH [7, 8, 28, 29]. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 8
miRiad roles for the miR-17–92 cluster in development and disease. [score:4]
Moreover, the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1) has been reported to be frequently over-expressed in human cancers and has oncogenic activity (He et al., 2005; Men dell, 2008). [score:3]
miR-21, miR-17 and miR-19a induced by phosphatase of regenerating liver-3 promote the proliferation and metastasis of colon cancer. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 7
In this study, gga-let-7b is up-regulated while gga-let-7 g, gga-miR-17-3p gga-miR-30d, gga-miR-29a, gga-miR-26a and gga-miR-181a are all down-regulated in the mature ovary compared with the immature ovary. [score:6]
Another study showed that a lack of miR17-5p and let-7b resulted in corpus luteum insufficiency and infertility in mice and that exogenous administration of the two miRNAs could prevent this phenotype [46]. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 6
3.4Wang et al. identified 32 known miRNAs from skeletal muscle of Arbor Acres commercial chickens, of which 12 form five clusters: miR-133a-1-miR-1a-2, miR-23b-miR-24, miR-99a-let-7c, miR-92-miR-19b-miR-18a-miR-17, and miR-30e-miR-30c-1, suggesting that most miRNAs co-express in skeletal muscle [85]. [score:3]
Wang et al. identified 32 known miRNAs from skeletal muscle of Arbor Acres commercial chickens, of which 12 form five clusters: miR-133a-1-miR-1a-2, miR-23b-miR-24, miR-99a-let-7c, miR-92-miR-19b-miR-18a-miR-17, and miR-30e-miR-30c-1, suggesting that most miRNAs co-express in skeletal muscle [85]. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 6
The miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels (accounting for 12.4% of the miRNAome) in the BP25 cell line. [score:3]
In addition, miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels, accounting for 12.4% of the miRNAome in BP25. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 3
The reproducibility of these results was tested by Taqman RT-PCR, selecting 18 miRNAs (hsa-let-7a, hsa-miR-141, hsa-miR-143, hsa-miR-145, hsa-miR-17, hsa-miR-182, hsa-miR-191, hsa-miR-199a-5p, hsa-miR-200a, hsa-miR-200b, hsa-miR-222, hsa-miR-29b, hsa-miR-34a, hsa-miR-424, hsa-miR-15a, hsa-miR-199a-3p, hsa-miR-26b, hsa-miR-361-3p) previously showing at least a three-fold modulation in expression in a wide panel of PDAC cell lines 49. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 1
Some miRNAs are present in the genome as a cluster, such as the miR17–92 cluster with six pre-miRNAs encoded in a ∼1 kb pri-miRNA. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Within these clusters, the mir-92-mir-19b-mir-20a-mir-19a-mir-18a-mir-17, which is equivalent to the mammalian mir-17-92 cluster, and mir-302b-mir-302c-mir-1811-mir-302a-mir-302d-mir-367 cluster were the biggest clusters containing six miRNAs. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Namely, mammalian and amphibian genomes contain three loci of clustered microRNAs from the mir-17 and mir-92 families [72]. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
A total of eight miRNAs were identified, including let-7d, miR-17, miR-24, miR-194, miR-195, miR-298, miR-374 and miR-721, which could potentially bind to the 3′-UTR of COUP-TFII mRNA (Figure 1a). [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
The family defining bootstrap cutoff values are tree-specific, and are set to be the smallest bootstrap value of the reference miRNA families (let7, mir-124, mir-17 and mir-1, See additional file 3: Reference miRNA families) in each input tree. [score:1]
[1 to 20 of 1 sentences]