sort by

22 publications mentioning gga-mir-16-1

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-16-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 432
The results showed that overexpression of miR-16-5p inhibited the proliferation of myoblasts, promoted the expression of apoptosis-related genes, and downregulated myoblast differentiation marker genes. [score:10]
More importantly, after overexpression of miR-16-5p, the mRNA and protein levels of SESN1 were significantly decreased, while inhibition of miR-16-5p upregulated expression of SESN1 mRNA and protein (Fig.   4c, d). [score:10]
Here, we demonstrated a transient expression pattern of miR-16-5p during embryonic skeletal muscle development, and found that it was upregulated during chicken muscle fiber formation, indicating its potential role in muscle development. [score:8]
Because each miRNA could regulate up to hundred target genes [31], we performed an in silico analysis of miRNA-16-5p targets, and identified that the seed sequence of miR-16-5p could perfectly match the 3′ UTR of SESN1, which was also differentially expressed between WRR and XH chickens. [score:8]
In general, SESN1 has been identified as a direct target of miR-16-5p, and miR-16-5p regulates myoblast development by suppressing SESN1. [score:8]
Conversely, miR-16-5p inhibition significantly downregulated the expression of p21 and resulted in a fewer number of G0/G1 and increased S phase cells (Fig.   1d, f). [score:8]
In conclusion, our findings reveal that miR-16-5p could inhibit myoblast proliferation, promote myoblast apoptosis, and repress myoblast differentiation by directly binding and suppressing SESN1 expression. [score:8]
i, j The mRNA and protein expression levels of p53 after overexpression and inhibition of miR-16-5p in CPMs. [score:7]
NC, negative control To verify the biological effects of miR-16-5p on myoblast apoptosis, the mRNA expression levels of several apoptosis-related genes, including Cytochrome c (Cyt c), Fas, Caspase 8, Caspase 3, and Caspase 9, were examined by quantitative PCR (qPCR) after overexpression or inhibition of miR-16-5p in CPM. [score:7]
To verify the biological effects of miR-16-5p on myoblast apoptosis, the mRNA expression levels of several apoptosis-related genes, including Cytochrome c (Cyt c), Fas, Caspase 8, Caspase 3, and Caspase 9, were examined by quantitative PCR (qPCR) after overexpression or inhibition of miR-16-5p in CPM. [score:7]
e, f The mRNA and protein expression levels of myoblast differentiation marker genes with miR-16-5p overexpression and inhibition in QM-7 cells. [score:7]
Rivas MA Downregulation of the tumor-suppressor miR-16 via progestin -mediated oncogenic signaling contributes to breast cancer developmentBreast Cancer Res. [score:7]
Oligonucleotide sequences in this study are showed in Table  3. Table 3 Oligonucleotide sequences in this study Fragment name Sequences (5′ to 3′) miR-16-5p mimic UAGCAGCACGUAAAUAUUGGUG miR-16-5p inhibitor CACCAAUAUUUACGUGCUGCUAsi- SESN1 CCTTGCTTCCTTCACGTTT For SESN1 overexpression plasmid construction, the full-length sequence of SESN1 was amplified from chicken breast muscle cDNA by PCR, and cloned into the expression plasmid, pcDNA-3.1 vector (Promega, Madison, WI, USA) by using the NheI and XhoI restriction sites. [score:7]
Oligonucleotide sequences in this study are showed in Table  3. Table 3 Oligonucleotide sequences in this study Fragment name Sequences (5′ to 3′) miR-16-5p mimic UAGCAGCACGUAAAUAUUGGUG miR-16-5p inhibitor CACCAAUAUUUACGUGCUGCUAsi- SESN1 CCTTGCTTCCTTCACGTTTFor SESN1 overexpression plasmid construction, the full-length sequence of SESN1 was amplified from chicken breast muscle cDNA by PCR, and cloned into the expression plasmid, pcDNA-3.1 vector (Promega, Madison, WI, USA) by using the NheI and XhoI restriction sites. [score:7]
b, d The protein expression levels of several cleaved caspases with miR-16-5p overexpression and inhibition in CPMs. [score:7]
To study the role of miR-16-5p in chicken skeletal muscle development, we explored its molecular function and found that miR-16-5p could directly suppress SESN1 to regulate myoblast proliferation and apoptosis via the p53 signaling pathway. [score:6]
In order to further understand the molecular mechanism by which miR-16-5p regulates gene expression, we predicted its target genes on the miRDB (http://www. [score:6]
Briefly, miR-16-5p inhibits expression of both mRNA and protein of SESN1 by directly binding to the 3′ UTR of SESN1. [score:6]
Moreover, we examined the expression of p53 after overexpression or inhibition of miR-16-5p, and opposite results were observed compared to SESN1 (Fig.   5i, j). [score:6]
Fig. 8Briefly, miR-16-5p inhibits expression of both mRNA and protein of SESN1 by directly binding to the 3′ UTR of SESN1. [score:6]
In contrast, apoptosis-related genes were downregulated and inactivated after inhibition of miR-16-5p (Fig.   2c, d). [score:6]
In this study, we report that miR-16-5p could inhibit myoblast proliferation, promote myoblast apoptosis, and repress myoblast differentiation by directly binding to the 3′ UTR of SESN1, which is also differentially expressed. [score:6]
NC, negative control In order to further understand the molecular mechanism by which miR-16-5p regulates gene expression, we predicted its target genes on the miRDB (http://www. [score:6]
The results showed that overexpression of miR-16-5p could promote the upregulation and activation of apoptosis-related genes (Fig.   2a, b). [score:6]
a, c mRNA levels of several apoptosis-related genes induced by miR-16-5p overexpression and inhibition in CPMs. [score:5]
e, f Cell cycle analysis of CPMs 48 h after overexpression and inhibition of miR-16-5p, using propidium iodide staining for DNA content. [score:5]
Conversely, inhibition of miR-16-5p promoted their expression (Fig.   3d, f). [score:5]
We found that overexpression of miR-16-5p inhibited myoblasts proliferation, promoted myoblasts apoptosis, and repressed myoblast differentiation. [score:5]
m, n Cell cycle analysis of QM-7 cells 48 h after overexpression and inhibition of miR-16-5p. [score:5]
h, j Myotube area (%) of CPMs 72 h after overexpression and inhibition of miR-16-5p. [score:5]
NC, negative control Meanwhile, myoblast differentiation marker genes, including MYOG, MYOD, and MyHC, were analyzed by qPCR after overexpression or inhibition of miR-16-5p in both CPM and QM-7 cells. [score:5]
The expressions of these marker genes were all significantly downregulated in the miR-16-5p mimic transfected cells compared to control cells (Fig.   3c, e). [score:5]
NC, negative controlMeanwhile, myoblast differentiation marker genes, including MYOG, MYOD, and MyHC, were analyzed by qPCR after overexpression or inhibition of miR-16-5p in both CPM and QM-7 cells. [score:5]
e, f Annexin V-FITC and propidium iodide (PI) dual staining detection of the apoptosis of CPMs after overexpression and inhibition of miR-16-5p, as determined by flow cytometry. [score:5]
After immunofluorescence staining, we found miR-16-5p overexpression repressed myoblast differentiation and significantly reduced the total areas of myotubes (Fig.   3g, h), while inhibition of miR-16-5p promoted myoblast differentiation (Fig.   3I, j). [score:5]
h, j Proliferation rates of CPMs with miR-16-5p overexpression and inhibition. [score:5]
g, h Annexin V-FITC and PI dual staining detection of the apoptosis of QM-7 cells after overexpression and inhibition of miR-16-5p, as determined by flow cytometry. [score:5]
Fig. 2 a, c mRNA levels of several apoptosis-related genes induced by miR-16-5p overexpression and inhibition in CPMs. [score:5]
c, d The relative mRNA and protein expression of p21 after transfection with miR-16-5p mimic and inhibitor in chicken CPMs. [score:5]
c, d The mRNA and protein expression levels of myoblast differentiation marker genes from miR-16-5p mimic and inhibitor transfected CPMs. [score:5]
The contrary results were found with miR-16-5p overexpression or inhibition (Fig.   5f). [score:5]
c, d The mRNA and protein expression levels of SESN1 from miR-16-5p mimic and inhibitor transfected CPMs and QM-7 cells. [score:5]
NC, negative control To unveil the functions of miR-16-5p, we performed overexpression and inhibition experiments to assess its role in cell proliferation and viability. [score:5]
Altogether, these data demonstrated that miR-16-5p directly targets SESN1 to regulate the p53 signaling pathway, and therefore affecting myoblast proliferation and apoptosis. [score:5]
p, r Proliferation rates of QM-7 cells with miR-16-5p overexpression and inhibition. [score:5]
In chicken primary myoblast (CPM), overexpression of miR-16-5p promoted p21 mRNA and protein expression, and significantly increased the number of cells that progressed to G0/G1 and reduced the number of S phase cells (Fig.   1c, e). [score:5]
The increased expression of miR-16-5p in embryonic development suggested that miR-16-5p was probably involved in skeletal muscle development. [score:5]
NC, negative controlTo unveil the functions of miR-16-5p, we performed overexpression and inhibition experiments to assess its role in cell proliferation and viability. [score:5]
There is evidence that miR-16-5p is involved in growth and development, as well as disease occurrence 27– 30. [score:4]
Breast muscle tissues were used to detect the expression of miR-16-5p and SESN1 in the process of chicken embryonic development. [score:4]
Taken together, these results demonstrated that SESN1 was a direct target of miR-16-5p. [score:4]
e, f Western blotting analysis of γ-H2AX protein levels after SESN1 (e) and miR-16-5p (f) overexpression and knockdown in CPMs. [score:4]
SESN1 is a direct target of miR-16-5p. [score:4]
Fig. 4Identification of SESN1 as a direct target of miR-16-5p. [score:4]
NC, negative control During breast muscle development in XH chickens, miR-16-5p was expressed at embryonic days 11 (11E) and subsequently increased and peaked at 19E (Fig.   1a). [score:4]
However, these regulatory roles were negated by co-overexpression of miR-16-5p and SESN1 (Fig.   4e–h). [score:4]
Our findings are partly based on the function of miR-16-5p in suppressing SESN1 that regulates the proliferation and apoptosis of myoblast via the p53 signaling pathway, as well as p53-independent myoblast differentiation (Fig.   8). [score:4]
Identification of SESN1 as a direct target of miR-16-5p. [score:4]
Furthermore, our rescue test also showed that co-overexpression of miR-16-5p and SESN1 could neutralize the regulatory roles of miR-16-5p in myoblasts. [score:4]
During breast muscle development in XH chickens, miR-16-5p was expressed at embryonic days 11 (11E) and subsequently increased and peaked at 19E (Fig.   1a). [score:4]
Conversely, miR-16-5p inhibition repressed myoblast apoptosis, suggesting that miR-16-5p has a positive regulatory effect on myoblast apoptosis (Fig  2f, h). [score:4]
b The relative expression of miR-16-5p from miR-16-5p mimic transfected CPMs and QM-7 cells. [score:3]
Fig. 1 a The relative expression of miR-16-5p in chicken embryonic breast muscle. [score:3]
In addition, the 5-ethynyl-2′-deoxyuridine (EdU) assay and cell counting kit-8 (CCK-8) assay demonstrated that miR-16-5p overexpression significantly repressed myoblast viability, while its inhibition promoted their proliferation (Fig  1g–l). [score:3]
The results showed that the seed sequence of miR-16-5p could perfectly match the 3′ UTR position 388–395 of chicken SESN1 mRNA, which suggested SESN1 was a potential target of miR-16-5p (Fig.   4a). [score:3]
To confirm whether miR-16-5p directly targets the 3′ UTR of SESN1, a dual-luciferase reporter assay was carried out in embryonic chicken fibroblast cell line DF-1 cells. [score:3]
Our findings present a novel mo del that elucidates the regulatory mechanism of how miR-16-5p controls muscle development. [score:3]
In both CPM and QM-7 cells, overexpression of miR-16-5p promoted myoblast apoptosis, as revealed by a higher apoptotic cell ratio and fewer viable cells (Fig.   2e, g). [score:3]
As differentiation progressed, the expression level of miR-16-5p significantly decreased, which suggested that miR-16-5p was involved in the process of myoblast differentiation (Fig.   3b). [score:3]
However, how Gga-miR-16-5p regulates the development of skeletal muscle in chicken is still unknown. [score:3]
Moreover, the relative luciferase activity was significantly decreased with the overexpression of miR-16-5p. [score:3]
The relative expressions of miR-16-5p were detected after 48 h of transfection with miR-16-5p mimic (Fig.   1b). [score:3]
miR-16-5p inhibits myoblast proliferation. [score:3]
Moreover, we transfected CPMs with miR-16-5p mimic or inhibitor, and then induced myoblast differentiation. [score:3]
Rinnerthaler, G. et al. miR-16-5p is a stably-expressed housekeeping microRNA in breast cancer tissues from primary tumors and from metastatic sites. [score:3]
b The relative expression of miR-16-5p during CPM differentiation. [score:3]
a The relative expression of miR-16-5p in chicken embryonic breast muscle. [score:3]
In our previous miRNA sequencing data, we found that miR-16-5p was differentially expressed between WRR and XH chickens. [score:3]
In our previous RNA-seq study (accession number GSE62971), we found that miR-16-5p was differentially expressed between fast and slow growth in chicken. [score:3]
In our previous RNA-seq study, we found that both miR-16-5p (accession number GSE62971) [16] and SENS1 (accession number GSE72424) [17] were differentially expressed between WRR and XH chickens (Supplementary File  1). [score:3]
g, i MyHC staining of myoblasts at 72 h after transfection of miR-16-5p mimic and inhibitor in CPMs. [score:3]
On the contrary, G0/G1 cells decreased while S phase cells increased significantly (Fig.   1n), and proliferation was significantly promoted after miR-16-5p inhibition (Fig. 1q, r, t). [score:3]
miR-16-5p inhibits myoblast differentiation. [score:3]
Additionally, we also confirmed that miR-16-5p was involved in myoblast differentiation by targeting SESN1. [score:3]
Mo del of miR-16-5p -mediated regulatory network for myoblast proliferation, apoptosis, and differentiation. [score:2]
MiR-16-5p overexpression significantly increased the number of cells in G0/G1, and significantly decreased the number of S phase cells (Fig.   1m). [score:2]
This was suggestive that miR-16-5p was a potential regulatory factor of SESN1. [score:2]
Recent studies have shown that miR-16-5p plays a regulatory role in the molecular machinery that enhances muscle protein synthesis in response to protein ingestion following concurrent exercise [11]. [score:2]
NC, negative control The present study reveals a role for miR-16-5p in myoblast proliferation, apoptosis, and differentiation. [score:1]
s, t Cell growth was measured following the transfection of miR-16-5p mimic and inhibitor in QM-7 cells. [score:1]
The SESN1-3′ UTR mutant plasmid was generated by changing the binding site of miR-16-5p from TGCTGCT to TATCAGT. [score:1]
The mutant sequence in miR-16-5p binding site is highlighted in red. [score:1]
The recombinant reporter vectors (pmirGLO- SESN1-WT and pmirGLO- SESN1-MT) were co -transfected with miR-16-5p mimic or mimic-normal control (NC). [score:1]
Gga-miR-16-5p is the mature miRNA which results from the two precursor miRNAs (gga-miR-16-1 and gga-miR-16-2), with a mature sequence of 22 nt. [score:1]
miR-16-5p facilitates myoblast apoptosis. [score:1]
We found that the luciferase activity of the wild-type group (SESN1-3′ UTR-WT) was significantly decreased after transfection with miR-16-5p mimic, whereas no significant difference was observed in the mutant group (SESN1-3′ UTR-MT) (Fig.   4b). [score:1]
a The potential binding site of miR-16-5p in the SESN1 mRNA 3′ UTR. [score:1]
miR-16-5p represses myoblast differentiation. [score:1]
miR-16-5p represses myoblast proliferation. [score:1]
miR-16-5p promotes myoblast apoptosis. [score:1]
k, l Cell growth was measured following the transfection of miR-16-5p mimic and inhibitor in CPMs. [score:1]
[1 to 20 of 101 sentences]
2
[+] score: 132
Other miRNAs from this paper: gga-mir-15a, gga-mir-16-2, gga-mir-15b, gga-mir-15c, gga-mir-16c
Integrating with GWAS results, only miR-16 locates nearby two of the most significantly associated loci (rs14916980 and rs13972116; Supplementary Table S1), which reached genome-wide significance on chicken growth 8. Also, miR-16, the most differentially expressed gene with 3.4-fold down-regulation, plays a critical role in organ growth and development. [score:7]
To verify this, mimic miR-16 was used to up-regulate the expression of miR-16 in DF-1 chicken embryo fibroblast cells (Fig. 4A). [score:6]
Expression analysis revealed that miR-16 expression in the muscle tissue of birds with the homozygous deletion type (low-weight line, n = 4) was much higher than that in the homozygous insertion type (high-weight line, n = 4) (Fig. 1D), while miR-15a showed no significant change (not show), which is consistent with our liver transcriptomic data. [score:5]
Elevating miR-16 expression also suppressed DF-1 chicken embryo fibroblast cell growth. [score:5]
After transfection in DF-1 chicken embryo fibroblast cells and 36 h of culture, the mature miR-16 expression in the insertion types was significantly lower than that in the deletion types (p <  0. 01), while mature miR-15a expression exhibited little changes (Fig. 3E). [score:5]
To search for potentially causal mutations affecting miR-16 expression, we focused on detecting variations in flanking regions of the miR-15a-16 cluster in F0 individuals of Xinghua & White Recessive Rock intercross lines. [score:4]
To determine the relationship between the mutation and miRNA expression level, real time PCR was performed to detect mature miR-15a and miR-16. [score:4]
Additionally, miR-16 promotes cell apoptosis via regulating the Bcl2 gene in tumors and liver disease 26 27. [score:4]
In summary, through co-localization of a QTL for body weight identified by GWAS and elements differentially expressed in liver, we have fine mapped miR-16 as the major candidate gene likely linked to a causal mutation for several growth and body composition traits. [score:4]
The result is of interest that this short insertion mutation is significantly correlated with miR-16 decreased expression in chicken liver and muscle tissues. [score:4]
Our results were consistent with previous reports, in that our study also indicated that miR-16 impacted chicken embryonic development by significantly inhibiting DF-1 chicken embryo fibroblast cell proliferation. [score:4]
We identified a 54-bp insertion close to miR-16 as a causal mutation that likely impacts body weight gain by disrupting miR-16 expression. [score:4]
Collectively, these results confirmed that the insertion mutation in the primary transcript induced a special alternative splicing pattern and decreased mature miR-16 expression. [score:4]
miR-16 inhibits DF-1 chicken embryo fibroblast cell proliferation. [score:3]
In vitro, miR-16 induced G1 arrest in A549 cells by targeting multiple cell cycle genes such as CCND1, CCND3 and CCNE1 20. [score:3]
Mimic miRNA (Qiagen) were used to overexpress miR-16, with negative random RNA mimic as a control. [score:3]
54-bp insertion induces alternative splicing resulting in decreased miR-16 expression. [score:3]
A 54-bp insertion was correlated with miR-16 expression. [score:3]
The curves show that miR-16 significantly inhibited DF-1 chicken embryo fibroblast cell proliferation. [score:3]
Our results supported miR-16 as a highly likely candidate gene, based upon location in the major QTL region by GWAS, and significantly different expression in liver and muscle tissue of fast- versus slow-growing chickens. [score:3]
The showed that miR-16 significantly inhibited DF-1 chicken embryo fibroblast cell proliferation and this effect was constant until 72 h (Fig. 4B). [score:3]
Forty-six genes and miR-15a/16 were successfully detected (Fig. 1A), of which three genes (SUCLA2, CKAP2 and miR-16) exhibited significantly decreased expression in the high weight lines. [score:3]
Through analysis of liver transcriptome differencess between high- and low-weight lines, we reduced the number of candidate genes locatedin the QTL region to three major candidates that showed differential expression, SUCLA2, CKAP2 and miR-16. [score:3]
Take together, our findings revealed a novel causal mutation in miR-16 contributing to genetic regulation of body weight. [score:3]
Another 8 birds from XH and WRR (n = 4 per population) were used to confirm miR-16 expression pattern. [score:3]
miR-16 suppressed embryonic fibroblast proliferation. [score:3]
A 54-bp insertion mutation in the upstream of precusor was identified to be a causative mutation that disrupted miR-16 genesis and contributed to weight gain during most of the growth phase. [score:3]
Although miR-15a and miR-16-1 are produced from the same primary cluster, the expression levels vary. [score:3]
A 54-bp insertion mutation in 145-bp upstream of precursor miR-15a-16 was identified as the causal mutation, resulting in increased body weight, bone size and muscle mass by disrupting alternative splicing during miR-16 biogenesis. [score:3]
For miR-16-1, the two loci of rs13972116 and rs14916980, located up- and down-stream of the precursor showed a large effect on chicken growth 8. Thus, we hypothesized that miR-16 should be a causal gene regulating chicken growth. [score:2]
Therefore, it is reasonable to propose that miR-16-1 was the regulator responsible for the control of growth. [score:2]
The miR-16 family induces cell cycle arrest in most cancer cells by regulating multiple cell cycle genes 20. [score:2]
Alternative isoform analysis demonstrated that the insertion mutation introduced three novel alternative splicing sites instead of 5′ terminal splicing site of mature miR-16. [score:2]
Fst statistical analysis also demostrated that the growth-advantagious allele of the miR-16 insertion mutation was approaching fixation in the fast-growing commercial lines (Fst >  0. 4) during recent artificial selection after long-term domestication. [score:2]
As expected, these observations were generally consistent with our previous results that the 54-bp insertion introduced two novel alternative splicing sites in the mutation region but few splicing sites were detected in the miR-16 5′ terminus. [score:2]
How to cite this article: Jia, X. et al. A short insertion mutation disrupts genesis of miR-16 and causes increased body weight in domesticated chicken. [score:2]
These data revealed that miR-16-1 has an independent transcriptional unit with more than 5-kb of primary RNA transcript. [score:1]
Five types of alternative splicing sites were detected in the insertion individuals without 5′ terminal splicing of mature miR-16, while 3 types of normal alternative splicing sites were detected in the 5′ terminal of mature miR-15 and miR-16 for the deletion individuals (Fig. 3A; Supplementary Table S4). [score:1]
In both in vivo tissue and in vitro cell experiments, the insertion type resulted in lower abundance of mature miR-16. [score:1]
Identification of miR-16-1 as the major candidate gene. [score:1]
20 nM mimics miR-16 and negative random RNA were transfected into cell lines, separately. [score:1]
20 nM mimic miR-16 and negative random RNA were transfected in DF-1 chicken embryo fibroblast cells, respectively (n = 6). [score:1]
Integrated analysis of QTLs with liver transcriptome supported miR-16-1 as a major candidate. [score:1]
However, no study has yet addressed the impacts of miR-16 on embryo growth. [score:1]
Collectively, these data suggest that miR-16 might affect body growth by repressing growth of various cell types and inducing apoptosis. [score:1]
To investigate the impacts of insertion mutation on mature miR-16, fragments of about 1300 bp in length including the miR-15a-16 precursor and mutation region were constructed into pcDNA3.1(+). [score:1]
[1 to 20 of 46 sentences]
3
[+] score: 121
bcl-2 is a target gene of miR-15a but not miR-16 in chicken lung tissues under hypoxiamiR-15a and miR-16 negatively regulate bcl-2 by directly binding to a particular sequence in the 3′-UTR of bcl-2 and inhibiting its translation [21], [31]. [score:9]
Our observation of hypoxia -induced miR-15a expression (Fig. 1B) and reduced Bcl-2 protein levels at E19 (Fig. 2C) indicated an inverse relationship between miR-15a and Bcl-2 protein expression, which suggested a causative role for miR-15a in the downregulation of bcl-2. However, as a cluster member of miR-15a, miR-16 was identified as hypoxia insensitive. [score:8]
miR-15a and miR-16, two members of the miR-15a/16 cluster, play a role in proapoptosis regulation by inhibiting the translation of the antiapoptotic protein Bcl-2 via binding to the 3′-untranslated region (3′-UTR) of bcl-2 mRNA [21]. [score:8]
To our knowledge, our work is the first to document that chicken miR-15a, but not miR-16, regulates apoptosis by directly targeting chicken bcl-2 at a specific target region during later chick lung CCGS development. [score:8]
miR-15a and miR-16 negatively regulate bcl-2 by directly binding to a particular sequence in the 3′-UTR of bcl-2 and inhibiting its translation [21], [31]. [score:7]
We also showed that only miR-15a and not miR-16 was responsive to the oxygen concentration and induced mesenchymal ablation through direct inhibition of the antiapoptotic gene chicken bcl-2 by binding to a unique target region. [score:6]
In human tumors, E2F1 is a positive regulator of miR-15a and miR-16, but only miR-15a inhibits expression of cyclin E [81]. [score:6]
To determine whether the peak value of miR-15a expression was lung specific or was a systemic reaction to hypoxia and whether expression of miR-15a was the same as that of miR-16, we performed real-time PCR for miR-15a and miR-16 using chick embryo lung, heart, brain and liver at E16 and E19. [score:5]
In co -transfected cells, the miR-15a mimic decreased the expression of hRluc and miR-15a mimic inhibitor rescued hRluc activity; no differences were seen for miR-16. [score:5]
Although miR-15a and miR-16 belong to the same cluster and miRNA family, Yin et al. also reported that miR-15a plays a causative role in the regulation of apoptosis by directly targeting bcl-2 during ischemic vascular injury [22]. [score:5]
Hua and colleagues identified a group of regulatory miRNAs, including miR-16, which regulates the expression of vascular endothelial growth factor [67]. [score:5]
The RNA22/PicTar results showed that the target site sequence complemented only with chicken miR-15a, and the TargetScan result suggested that both the chicken miR-15a and miR-16 would work (data not shown). [score:5]
Together, the results suggested that chicken miR-15a decreased chicken bcl-2 translation by directly acting on a miR-15a–specific response element in the 3′-UTR of chicken bcl-2 mRNA and that this effect may be different in chicken bcl-2 as compared with that in human bcl-2. Chicken miR-16, another member of the cluster, did not affect bcl-2 regulation. [score:4]
To further verify whether miR-15a or miR-16 repressed chicken bcl-2 by binding directly to the predicted binding site in its 3′-UTR as shown in human cells [31], we analyzed the complementation of the chicken bcl-2 mRNA (NM_205339.1) and chicken miR-15a/16 using four different prediction algorithms: TargetScan [33], RNA22 [34], DIANA [35], [36], and PicTar [37]. [score:4]
bcl-2 is a target gene of miR-15a but not miR-16 in chicken lung tissues under hypoxia. [score:3]
0098868.g003 Figure 3 bcl-2 is a target gene of miR-15a, but not miR-16 in chicken lung. [score:3]
In this study, our data suggested that the expression of miR-15a, but not miR-16, is sensitive to the oxygen concentration and was significantly increased in lung mesenchymal cells in chicken. [score:3]
miR-16 shows unequal expression among tissues [68]. [score:3]
gga-miR-16 shows no response to hypoxia, and there is no target site for gga-miR-16 in the 3′-UTR region of gga- bcl-2. (B) Mesenchymal cell death/ablation indeed appeared necessary for the formation of a thinner BGB and is promoted by hypoxia (the oxygen concentration). [score:3]
miR-15a and the binding site in the gga- bcl-2 3′-UTR are shown, but miR-16 shows no target site in this part of the sequence. [score:3]
bcl-2 is a target gene of miR-15a, but not miR-16 in chicken lung. [score:3]
We also found differences in hypoxia -induced expression of miR-15a and miR-16 between high-altitude and plain chicks. [score:3]
miR-16 showed a weak response to stress in the embryonic lung (hW). [score:1]
Chicken miR-16, a cluster and family member of chicken miR-15a, does not affect the hypoxia -induced pathway. [score:1]
Thus, miR-16 also appeared to be affected by hypoxia at a time when the respiratory gas exchange was developing. [score:1]
As a cluster and family member, miR-16 was reported to have the same function as miR-15a [21]. [score:1]
However, there were no clear changes in miR-16 in the other groups. [score:1]
We performed the same experiment with chicken miR-16. [score:1]
We identified a small increase in miR-16 from E16 to E19 in embryonic lung in hW (Fig. 1C). [score:1]
In contrast, Cimmino et al. showed that miR-15a and miR-16 promote apoptosis by posttranscriptional gene silencing of bcl-2 [21]. [score:1]
miR-16 may function during BC network formation, which is perpendicular to the long axis of ACs. [score:1]
Hybridization was done using the 5′-digoxigenin–labeled miRCURY LNA microRNA Detection Probes anti-gga-miR-16 and anti-gga-miR-15a (EXIQON, Vedbaek, Denmark). [score:1]
Although miR-16 belongs to the same cluster and family as miR-15a [21], they were differentially sensitive to hypoxia. [score:1]
However, no change was observed with the chicken miR-16 mimic (Fig. 3C). [score:1]
[1 to 20 of 34 sentences]
4
[+] score: 24
Other miRNAs from this paper: gga-mir-15a, gga-mir-16-2, gga-mir-15b, gga-mir-15c, gga-mir-16c
These two microRNAs, gga-miR-15a and gga-miR-16-1, were known to target some key genes such as B-cell leukemia/lymphoma 2 to regulate tumor growth [30], [31]. [score:4]
Green letters indicate the matured sequences of gga-miR-15a or gga-miR-16-1. Combining results of RNA analysis and association analysis, the 3 Mb region of 172–175 Mb with 63 coding genes and two microRNA genes likely contained more than one causal mutations affecting chicken growth and could contain a gene regulatory mechanism. [score:3]
These results indicated some specificity of RNA targeting to FOXO1A and KPNA3 by gga-miR-15a and gga-miR-16-1. 10.1371/journal. [score:3]
Green letters indicate the matured sequences of gga-miR-15a or gga-miR-16-1. Combining results of RNA analysis and association analysis, the 3 Mb region of 172–175 Mb with 63 coding genes and two microRNA genes likely contained more than one causal mutations affecting chicken growth and could contain a gene regulatory mechanism. [score:3]
These results indicated some specificity of RNA targeting to FOXO1A and KPNA3 by gga-miR-15a and gga-miR-16-1. 10.1371/journal. [score:3]
Insulin-like growth factor 1 (IGF1) gene, which involved in mediating growth and development, had a conserved binding site with miR-15 and miR-16 family in human [32], [33]. [score:2]
Two Ensembl coding genes (ENSGALG0000002273 and ENSGALG00000017013) and a NCBI gene (LOC770337) between gga-miR-16-1 and RNASEH2B could not be excluded as potential functional units affecting chicken growth because they were close to highly significant SNP effects, although these three genes had unknown biological functions. [score:1]
The two microRNA genes, gga-miR-15a and gga-miR-16-1, approximately were in 300 Kb∼1 Mb distances to the five most significant SNPs in the 1.5 Mb region. [score:1]
Green letters indicate the matured sequences of gga-miR-15a or gga-miR-16-1. in this study identified novel candidate genes in a 3 Mb GGA1 region and provided strong confirmation of some previously reported QTL effects. [score:1]
The results showed that chicken IGF1 had a conserved binding site with gga-miR-15a and gga-miR-16-1 (MFE = −24.1 and −23.9, Figure 3). [score:1]
The 1.5 Mb region of KPNA3- FOXO1A could be immediate interest for candidate genes that may include FOXO1A, KPNA3, INTS6, gga-miR-15a, gga-miR-16-1 and RNASEH2B. [score:1]
Both gga-miR-15a and gga-miR-16-1 could bind to the mRNAs of FOXO1A and KPNA3 (MFE = −28 and −28.9 for FOXO1A and MFE = −24.3 and −22.9 for KPNA3, Figure 3). [score:1]
[1 to 20 of 12 sentences]
5
[+] score: 16
Let-7b -mediated regulation of GHR expressionThe miRNAs involved in the regulation of GHR were let-7b, miR-15c (miR-16, miR-16c), and miR-181b (Additional file 3: Table S3). [score:5]
However, the target sites of miR-15c, miR-16, miR-16c and miR-181b were far apart from the GHR region. [score:3]
But the target locations of miR-16, miR-16c and miR-181b were distant from the deleted region. [score:3]
Four miRNAs, let-7b, miR-16, miR-16c, and miR-181b, are involved in the regulation of GHR. [score:2]
The miRNAs involved in the regulation of GHR were let-7b, miR-15c (miR-16, miR-16c), and miR-181b (Additional file 3: Table S3). [score:2]
GHR was affected by let-7b, miR-15c, miR-16, and miR-16c. [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 14
A number of miRNAs down-regulated in DT40, including gga-miR-16, -30e, -30d, -30b, -30c, -26a, -147, -15b, and -29a, were also downregulated in CD40L-stimulated cells, suggesting conserved functions of cell division and proliferation. [score:7]
A number of miRNAs, including gga-miR-16, -30e, -30d, -30b, -30c, -26a, -147, -15b, and -29a, down-regulated in DT40 cells were also downregulated in CD40L -treated cells (Figure 3B). [score:7]
[1 to 20 of 2 sentences]
7
[+] score: 13
In addition, miR-15 and miR-16 are negatively correlated with expression of the anti-apoptotic gene BCL-2 [25], which inhibits apoptosis at the level of the mitochondria and is critical for cancer cells [26]. [score:5]
Calin G. A. Dumitru C. D. Shimizu M. Bichi R. Zupo S. Noch E. Aldler H. Rattan S. Keating M. Rai K. Frequent deletions and down-regulation of micro -RNA genes miR15 and miR16 at 13Q14 in chronic lymphocytic leukemia Proc. [score:4]
Cimmino A. Calin G. A. Fabbri M. Iorio M. V. Ferracin M. Shimizu M. Wojcik S. E. Aqeilan R. I. Zupo S. Dono M. MiR-15 and miR-16 induce apoptosis by targeting BCL2 Proc. [score:3]
MiR-15 and miR-16 are located in the 13q14 chromosome region, the partial absence of which was strongly influential in an outbreak of chronic lymphocytic leukemia (CLL). [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
For validation of the microarray results, the miRNAs that displayed the largest fold change were quantified by qRT-PCR and normalized to miR-16 (a total of 6 up-regulated miRNAs and 6 down-regulated miRNAs were examined). [score:7]
Figure S2Expression of miR-16 in liver and serum over the time course of S. mansoni infection. [score:3]
To account for differences in RNA extraction or qRT-PCR efficiency, the data were normalised to miR-16, which displayed stable expression in the liver during infection (Fig. S2). [score:3]
[1 to 20 of 3 sentences]
9
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Clusters mir-16-1-mir-15a, let-7f-let-7a-1, mir-181a-1-mir-181b-1, let-7j-let-7k, mir-23b-mir-27b-mir-24, and mir-16-2-mir-15b were down-regulated in lungs and mir-181a-1-mir-181b-1 was also down-regulated in tracheae with AIV infection. [score:7]
The miRNAs from five of these clusters (mir-16-1-mir-15a, mir-16-2-mir-15b, let-7f-let-7a-1, let-7j-let-7k and mir-23b-mir-27b-mir-24) identified in both lungs and tracheae were significantly down-regulated in infected lungs compared to non-infected lungs and also had higher expression levels in non-infected lungs than non-infected tracheae. [score:5]
[1 to 20 of 2 sentences]
10
[+] score: 8
Therefore, although little is known about the specific functions of several of these miRNAs (e. g. miR-31, miR-101, miR-200b, miR-10b, miR-460, miR-15b, miR-16 and miR203) during muscle development, the close relationship between their targets and myogenesis regulation demonstrates a potential role during muscle development. [score:6]
Little is known about the functional roles of the remaining eight (miR-31, miR-101, miR-200b, miR-10b, miR-460, miR-15b, miR-16 and miR-203) during muscle development. [score:2]
[1 to 20 of 2 sentences]
11
[+] score: 7
Other miRNAs from this paper: gga-mir-16-2, gga-mir-16c
Duplicate RNA samples were prepared and probed separately for Probes were hybridised in-solution to duplicate RNA samples for detection of shEGFP and mir-16 expression. [score:3]
Expression of the miR-16 effector sequence was detected using the mir-16 RNA probe provided with the mirVana Probe & Marker Kit, (Ambion). [score:3]
Detection of miR-16 as a loading control in all transfected and control RNA samples, confirmed the presence of total small RNAs (Fig. 2). [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 6
miR-16 is considered a tumor suppressor [31], which acts by targeting BCL-2, and repressed expression is consistent with tumorigenesis. [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 5
MiR-101-3p (−2.1-fold) and miR-15c-5p (−1.4-fold) had the most target genes followed by miR-15a, miR-16-5p, miR-214, miR-16c-5p, and miR-181b-5p (Supplementary Table S4), and these miRNAs were all down-regulated in L30 compared with L20. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 4
During HIV infection, the down-regulation of miR-16 results in the activation of the NF-κB signaling pathway, thus enhancing immune responses (Li et al., 2010). [score:4]
[1 to 20 of 1 sentences]
15
[+] score: 3
Typically, tyrosine-protein kinase receptor (CTK-1) can be targeted by three miRNAs, including gga-miR-15c-5p, gga-miR-15a and gga-miR-16-5p. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Some host miRNAs, including gga-miR-let-7, gga-miR-199a-1, gga-miR-26a, gga-miR-181a, and gga-miR-16, were expressed at lower levels in MDV -induced tumors than non-infected spleens, indicating their potential importance in tumorigenesis. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: gga-mir-15a, gga-mir-16-2, gga-mir-16c
Several genes also harbored or were near the 11 suggestively significant SNPs, including gga-miR-16a-1 (MIR16–1), deleted in lymphocytic leukemia 2 (DELU2), SPRY domain containing 7 (SPRYD7), potassium channel regulator (KCNRG) and tripartite motif containing (TRIM13). [score:2]
According to the genome of vertebrates, MIR15A, accompanied by MIR16–1 and DELU2 nearby, forms a DLEU2/miR-15a/16–1 cluster to affect chronic lymphocytic leukemia in cancer research [17, 18]. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 3
To verify the RNA-Seq data, the differential expression of four miRNAs including miR-223, miR-16, miR-205a and miR-222b-5p were validated by qRT-PCR among all four comparisons (Figure 4). [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
Further, miR-16 and miR-223 are involved in muscle cell development in chicken [64]. [score:2]
[1 to 20 of 1 sentences]
20
[+] score: 1
Another miRNA, miR-16, is in clinical trials since early 2015 for mesothelioma and lung cancer [43]. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
In addition, the lncRNA DLEU2 is well conserved across the vertebrates, it is a host gene for two miRNA genes, miR-15 and miR-16, both of which are also well conserved across the vertebrates (see Fig. B in S1). [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Other miRNAs from this paper: gga-mir-15a, gga-mir-16-2, gga-mir-16c
MicroRNA-15a and microRNA-16 impair human circulating proangiogenic cell functions and are increased in the proangiogenic cells and serum of patients with critical limb ischemia. [score:1]
[1 to 20 of 1 sentences]