sort by

18 publications mentioning gga-mir-10b

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-10b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 31
Stage-by-stage examinations revealed further expression patterns, such as emergence at specific time-points during embryogenesis and up-regulation of miRNA groups in late embryos (miR-1 and bantam), expression associated with stage transition between instar and molt larval stages (miR-34b), expression associated with silk gland growth and spinning activity (miR-274), continuous high expression from the spinning larval to pupal and adult stages (miR-252 and miR-31a), a coordinate expression trough in day 3 pupae of both sexes (miR-10b and miR-281), up-regulation in pupal metamorphosis of both sexes (miR-29b), and down-regulation in pupal metamorphosis of both sexes (miR-275). [score:20]
For example, the miR-10b-5p/3p pair was down-regulated in whole-life profiling, but stage-by-stage examination revealed up-regulation of these miRNAs during embryogenesis, followed by down-regulation during the early and late larval stages. [score:10]
After a further 12 h (24 h Em), 12 miRNAs were detected soon after egg release from diapause, including the 7 "early" miRNAs and others observed for the first time (miR-252, miR-8, miR-2a, miR-79, and miR-10b-3p). [score:1]
[1 to 20 of 3 sentences]
2
[+] score: 25
a ADIPOR2 is targeted by miR-20b and let-7c, b INSIG1 is targeted by miR-182, miR-183, and miR-454, c MAPK4K4 is targeted by miR-29a, d FASN is targeted by miR-107, e FADS2 is targeted by let-7c, f ELOVL2 is targeted by miR-10b, g HMGCS1 is targeted by miR-18a, and h MSMO1 is targeted by miR-20b and miR-454 To further explore miRNA regulatory networks associated with the metabolic switch, we identified potential metabolic mRNA targets for let-7c, miR-20b, and miR-183 using in silico target prediction in combination with IPA pathway analysis. [score:22]
ELOVL2 mRNA is a predicted target of miR-10b, which decreased posthatch (Fig. 3f). [score:3]
[1 to 20 of 2 sentences]
3
[+] score: 19
Therefore, although little is known about the specific functions of several of these miRNAs (e. g. miR-31, miR-101, miR-200b, miR-10b, miR-460, miR-15b, miR-16 and miR203) during muscle development, the close relationship between their targets and myogenesis regulation demonstrates a potential role during muscle development. [score:6]
Seven (miR-101, miR-10a, miR-10b, miR-1677, let-7f, miR-31, and miR-205b) were expressed at higher levels in layers, and ten (miR-203, miR-200b, miR-16c, miR-15b, miR-15c, miR-460, miR-429, let-7c, miR-2188, and gga-miR-N2) were expressed at higher levels in broilers. [score:5]
Little is known about the functional roles of the remaining eight (miR-31, miR-101, miR-200b, miR-10b, miR-460, miR-15b, miR-16 and miR-203) during muscle development. [score:2]
Taken together, these observations suggest that miR-206 and miR-10b could play important roles at different stages during muscle development. [score:2]
Six of these miRNAs (miR-31, miR-10a, miR-10b, miR-16C and two let-7 members) have been implicated in skeletal muscle regeneration or development [39- 42]. [score:2]
Recent studies have reported that miR-10 contributes to retinoic acid -induced smooth muscle cell differentiation [41], and may be important during the early stage of embryonic myogenesis [59]. [score:1]
Interestingly, Rathjen and colleagues recently performed miRNA profiling in chicken somites and demonstrated that among the 85 detectable known miRNAs, gga-miR-10b was the most abundant (113,106 reads), whereas gga-miR-206 was much less abundant (259 reads) [59]. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 11
From the most highly expressed miRNAs, we found miR-10b and miR-205a were also found to be differentially expressed at the eighth embryonic day in chicken, which targeted genes ALDH1A3 and GALGA_5AKI_KRT19, respectively [10]. [score:7]
The miRNAs miR-10a and miR-10b are reportedly involved in cell proliferation and regulation of the cell cycle [31]. [score:2]
The miRNAs miR-10a and miR-10b are close homologs, differing only by a single central nucleotide [29]. [score:1]
The most abundant miRNAs were gga-miR-10a and gga-miR-10b, which represented more than 2,000,000 TPM within 18 libraries. [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 10
Other miRNAs from this paper: gga-mir-155, gga-mir-148a, gga-mir-137, gga-mir-21
MiR-10b is highly upregulated in breast cancer and triggers metastasis of tumor cells [37]. [score:3]
Close examination of the list of DMR -associated miRNAs revealed several immune-related miRNAs, e. g. gga-miR-155, gga-miR-148a (H3K4me3), gga-miR-10b and gga-miR-137 (H3K27me3). [score:1]
The varying responses in the two chicken lines particularly around gga-miR-155, gga-miR-10b and gga-miR-137, also suggested the possible contribution of these miRNAs to differential MD-resistance. [score:1]
Immune-related microRNAs, e. g. gga-miR-155 and gga-miR-10b, bore chromatin signatures, which suggested their contribution to MD-susceptibility. [score:1]
D) Gga-mir-10b and E) Gga-mir-137 exhibit increased H3K27me3 marks in line L6 [3] at 10 dpi, while both infected and control L7 [2] birds have high H3K27me3 levels. [score:1]
Two miRNAs associated with seemingly opposite effects in breast cancer, gga-miR-10b and gga-mir-137, both exhibited putative epigenetic silencing in the resistant line. [score:1]
In addition, several immune-related miRNAs, e. g. gga-miR-155 and gga-miR-10b, were associated with differential chromatin marks and could contribute to increased MD-susceptibility in line L7 [2] chickens. [score:1]
MiR-10b initiates tumor invasion and metastasis in breast cancer [37], while miR-137 reduces the proliferative and migratory capacities of breast cancer cells [39]. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 9
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 9
Among the known miRNAs, miR-10b-5p, gga-miR-148a-3p, gga-miR-22-3p and gga-miR-133a-3p were relatively high expressed in all three stages of chicken skeletal muscle development. [score:4]
These included miRNAs (miR-222a, miR-499-5p, miR-126-5p, miR-10b-5p, miR-22-3p, let-7f-5p, miR-181a-5p and miR-215-5p) (Figure 6) and differentially expressed genes (CPEB3, SUCLA2, MUSTN1, FGFR3 and ABHD3) (Figure 7). [score:3]
In this group, miR-10b-5p, miR-148a-3p and miR-133a-3p were the most abundant accounting for 79,359, 171,817 and 404,782 of total normalized miRNA reads from the E11, E16 and P1 libraries, respectively. [score:1]
The 20 most abundant miRNAs in the three groups were ordered by the average proportion of each miRNA and included miR-148a-3p, miR-22-3p, miR-10b-5p, miR-181a-5p, miR-133a-3p, miR-126-5p, let-7f-5p, miR-10a-5p, miR-30c-5p, miR-146c-5p (Supplementary Table 1). [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 8
Expression patterns of 15 miRNAs identified using RT-PCR agreed with those identified using deep sequencing, miR-101, miR-10a, miR-10b, miR-1677, let-7f, and miR-31 were higher in layers, while miR-200b, let-7c, miR-16c, miR15b, miR-15c, miR460, miR-429, miR-2188, and the novel miR-N2 were higher in broilers. [score:3]
Intriguingly, miR-10 has been shown decreases expression of several Hox genes in zebrafish [78]. [score:3]
Notably, the novel miR-10a was confirmed with a high number of reads (28,660), and miR-10b was the most abundant (113,106) among known miRNAs, implying that these two miRNAs are related during somite development. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 8
Other miRNAs from this paper: gga-mir-30b, gga-mir-194, gga-mir-29c, gga-mir-143
The array results demonstrated that the expression levels of miR-10b, miR-192, miR-194, and miR-197 were up-regulated more than 10-fold; whereas those of miR-143, miR-150, miR-28, miR-29c, miR-30b, miR-320a, miR-328, and miR-451a were up-regulated 5- to 10-fold in the glutamate -treated group as compared to α-MSH + glutamate -treated group (Supplementary Table S3, Fig. 5A). [score:8]
[1 to 20 of 1 sentences]
10
[+] score: 8
Of the top 20 abundantly expressed miRNAs identified, some, such as miR-133, miR-10b, miR-26a, miR-30e and gga-miR-30a were also abundantly expressed in chicken somites [41]. [score:5]
miRNAs Normalized Reads Total Reads WRRh WRRl XHh XHl gga-miR-133a 3,558,683 3,069,071 1,997,286 2,607,787 11,232,827 gga-miR-133c 3,350,936 2,885,440 1,878,925 2,449,209 10,564,510 gga-miR-133b 3,326,848 2,864,578 1,864,721 2,431,274 10,487,421 gga-let-7a 1,699,621 1,513,865 857,210 1,133,532 5,204,228 gga-miR-22-3p 1,333,233 1,145,421 712,464 988,186 4,179,304 gga-miR-30a-5p 1,213,468 1,148,128 790,893 930,507 4,082,996 gga-miR-26a 1,212,635 1,054,689 691,456 1,006,522 3,965,302 gga-miR-30d 851,887 813,262 583,932 667,002 2,916,083 gga-miR-181a-6p 918,452 836,452 485,661 650,836 2,891,401 gga-miR-10a-5p 943,686 782,180 420,809 663,401 2,810,076 gga-miR-10b 911,725 757,564 398,852 633,567 2,701,708 gga-miR-30e 799,679 730,832 501,718 596,218 2,628,447 gga-let-7j 848,972 756,205 428,182 566,165 2,599,524 gga-let-7f 398,292 363,598 206,995 274,333 1,243,218 gga-miR-148a 288,585 300,432 144,015 180,973 914,005 gga-miR-146c-5p 224,147 207,782 171,443 132,712 736,084 gga-let-7k 211,853 206,518 118,297 155,412 692,080 gga-let-7c 242,661 189,820 111,118 139,257 682,856 gga-miR-199-3p 168,417 152,158 75,346 121,460 517,381 gga-miR-126-5p 139,914 109,805 89,607 86,681 426,007 Differentially expressed miRNAs were identified by DEGseq analysis (fold change > 1.5 or < 0.66; p-value < 0.05; q-value < 0.01), as a result, 200, 279, 257 and 297 miRNAs were detected in four comparisons of WRRh vs. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 5
Therapeutic silencing of miR-10b inhibits metastasis in a mouse mammary tumor mo del. [score:3]
Similarly, we detected three miRNAs (Bantam, miR-3479, and miR-10) in the plasma of mice infected with S. japonicum (Cheng et al., 2013). [score:1]
Moreover, in our recent work, five pathogen-specific miRNAs were identified in the plasma of rabbits infected with S. japonicum, including four known miRNAs (Bantam, miR-3479, miR-10, and miR-3096), and one novel miRNA (sja-miR-8185) (Cheng et al., 2013). [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 5
For instance, although miRNAs are known to predominantly act in translational repression, miR-10 has been recently found to bind a group of transcripts containing a terminal oligo-pyrimidine (TOP) motif and to induce their translation [47]. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 4
Furthermore, expression of several miRs, including miR-10b and miR-196, was detected in the developing limb and found to be involved in the specification of limb development [13, 14]. [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
Others, the mir-10, 99, 100, 125 family for example, diverge in the mature forms (See additional file 8: The mir-10, 99, 100, 125 family). [score:1]
Sequence alignment and selected secondary structure of the miRNAs in the mir-10, 99, 100, 125 family. [score:1]
Click here for file The mir-10, 99, 100, 125 family. [score:1]
The mir-10, 99, 100, 125 family. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Notably, a study published after submission of this manuscript identified 5 miRNAs derived from S. japonicum in the plasma of infected rabbits and 3 of these are identical or homologous to those identified here: bantam, miR-3479-3p and miR-10-5p [70], providing independent validation for the presence of trematode miRNAs in the serum of infected animals. [score:1]
22962218:+ 7 sma-miR-10-5p AACCCUGUAGACCCGAGUUUGG S_mansoni. [score:1]
The other 2 miRNAs, sma-miR-10-5p and sma-let-7-3p, were excluded from analysis because they are highly similar to homologous mouse miRNAs that are present at >100 fold higher read frequencies (Table S3). [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 3
The top five highly expressed miRNAs were gga-miR-215-5p, gga-miR-10b-5p, gga-miR-21-5p, gga-miR-26-5p, and gga-miR-22-3p, accounting for 40.54, 7.76, 6.78, 6.43, and 6.35% of total known miRNA reads, respectively. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 2
In MDV infected CEFs, gga-mir-29b,-196,-133a,-10b,-30d were increased, and gga-mir-let-7a, 7b, 7f and gga-mir-1a, mir-130a were decreased [87]; of these only gga-mir-10b was increased in our data. [score:1]
Of these, nine (gga-mir-1b, gga-mir-7, gga-mir-7b, gga-mir-10b, gga-mir-31, gga-mir-130b, gga-mir-204, gga-mir-215, gga-mir-489) are increased, and five (gga-mir-223, gga-mir-124b, gga-mir-140, gga-mir-183, gga-mir-222a) are decreased in CD30 [hi] cells. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 1
The most abundant miRNA was miR-2188-5p, which represented 19% of total reads, followed by gga-miR-10b (gga-miR-10b-5p in miRBase v20), gga-miR-10a-5p, and gga-miR-146c-5p, which together represented about 36% of the total reads (13.3%, 13.9% and 9.2% respectively). [score:1]
[1 to 20 of 1 sentences]