sort by

10 publications mentioning dre-mir-199-1

Open access articles that are associated with the species Danio rerio and mention the gene name mir-199-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 14
e Heat maps profiles for change in expression of selected miRNAs Table 2 Cold shock -induced differential expression of known miRNAs miRNA Mature miRNA sequence Fold change Up-regulated miRNAs  Dre-mir-29b-1 UAGCACCAUUUGAAAUCAGUGU 3.90  Dre-mir-99-2 AACCCGUAGAUCCGAUCUUGUG 2.04  Dre-mir-99-1 AACCCGUAGAUCCGAUCUUGUG 1.79  Dre-mir-92a-2 UAUUGCACUUGUCCCGGCCUGU 1.75  Dre-mir-2184 AACAGUAAGAGUUUAUGUGCU 1.73 Down-regulated miRNAs  Dre-mir-737 AAUCAAAACCUAAAGAAAAUA −1.71  Dre-mir-9-2 UCUUUGGUUAUCUAGCUGUAUGA −1.75  Dre-mir-363 AAUUGCACGGUAUCCAUCUGUA −1.79  Dre-mir-125b-2 UCCCUGAGACCCUAACUUGUGA −1.91  Dre-mir-199-1 CCCAGUGUUCAGACUACCUGUUC −2.79 After eliminating miRNAs whose expression might be changed due to development process during incubation (control vs normal). [score:14]
[1 to 20 of 1 sentences]
2
[+] score: 11
Similarly, miR-126 is expressed in heart and miR-199 in epidermis and skeleton, both with minimal neural expression (Wienholds et al., 2005). [score:5]
zb1, we designed a DNA fragment with target sequences for miR1-3p, miR126-3p, and miR199-5p. [score:3]
We constructed a UAS:epNTR-TagRFPT reporter vector, which comprises a fusion of enhanced-potency nitroreductase to TagRFPT followed by the ocean pout antifreeze protein 3′ UTR, which we modified to include miR-1, miR-126, and miR-199 target sites (utr. [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 7
Other miRNAs from this paper: dre-mir-196a-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-210, dre-mir-214, dre-mir-219-1, dre-mir-219-2, dre-mir-221, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-21-1, dre-mir-21-2, dre-mir-25, dre-mir-30e-2, dre-mir-101a, dre-mir-103, dre-mir-107a, dre-mir-122, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-126a, dre-mir-129-2, dre-mir-129-1, dre-mir-130b, dre-mir-130c-1, dre-mir-130c-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-135c-1, dre-mir-135c-2, dre-mir-140, dre-mir-142a, dre-mir-142b, dre-mir-150, dre-mir-152, dre-mir-462, dre-mir-196a-2, dre-mir-196b, dre-mir-202, dre-mir-203b, dre-mir-219-3, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-mir-455-1, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-135b, dre-mir-135a, dre-mir-499, dre-mir-738, dre-mir-429b, dre-mir-1788, dre-mir-196c, dre-mir-107b, dre-mir-455-2, dre-mir-222b, dre-mir-126b, dre-mir-196d, dre-mir-129-3, dre-mir-129-4
The expression of dre-miR-140* and dre-miR-199* was similar to that of their respective mature miRNAs. [score:3]
For example, dre-miR-30e, dre-miR-199, dre-miR-219 and dre-miR-462 showed similar bias for both mature and star strands. [score:1]
The relative abundance of miR-199* and miR-199 determined by qRT-PCR further confirmed the pyrosequencing data (Figure 5C). [score:1]
Dre-miR-30e, dre-miR-199, dre-miR-219 and dre-miR-462 showed similar strand-bias towards both mature and star strands, suggesting that both strands may be incorporated into the RISC complex. [score:1]
Dre-miR-30e, dre-miR-199, dre-miR-219 and dre-miR-462 showed similar strand-bias of both mature and star strands. [score:1]
[1 to 20 of 5 sentences]
4
[+] score: 4
In addition, Juan et al. [39] showed that the expression of miR-199/214 might be regulated by PcG-proteins during skeletal muscle cell differentiation. [score:4]
[1 to 20 of 1 sentences]
5
[+] score: 4
This is also in agreement with previous studies showing similar patterns of expression for miR-199 and miR-214 in different systems 15, 20, 21. [score:3]
We searched for conserved putative skeletal transcription factor binding sites (TFBS) in a 2.5 kilobase (kb) region upstream of pre-miR-199 (putative Dnm3os promoter) of human, mouse, Xenopus, medaka, stickleback, Tetraodon, fugu and zebrafish. [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 3
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
By contrast, we identified 12 miRNAs corresponding to 9 families (miR-199, miR-140, miR-152, miR-214, miR-205, miR-200, miR-183, miR-182, miR-96) that displayed highly enriched expression in the olfactory system (Figure 1A). [score:3]
[1 to 20 of 1 sentences]
7
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
[1 to 20 of 1 sentences]
8
[+] score: 1
Furthermore, miR-214 is clusterized (with miR-199) and intronic of Dnm3 gene as reported in mammals [35]. [score:1]
[1 to 20 of 1 sentences]
9
[+] score: 1
Most of them bind to one viral gene, except for miR-199-5p and miR-153a-3p, which were predicted to bind to two viral genes (Table S4). [score:1]
[1 to 20 of 1 sentences]
10
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Although zebrafish miRNAs have been examined in numerous studies [25, 27, 41– 43], our analysis revealed novel paralogs of 18 miRNAs that do not currently have zebrafish records in miRBase (version 21), including miR-181a, miR-20a, miR-23b, miR-24, miR-29a, miR-103, miR-128, miR-148, miR-181b, miR-199, miR-204, miR-212, miR-221, miR-338, miR-724, miR-2184, let-7b and let-7e. [score:1]
[1 to 20 of 1 sentences]