sort by

111 publications mentioning hsa-mir-423 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-423. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 362
In the miR-423-5p mimics + siGSTM1 group, GRP78, p-PERK, p-IRE1α and CHOP expression was up-regulated, whereas in the miR-423-5p inhibitors + GSTM1 group, their expression was down-regulated (all P < 0.05). [score:13]
The ROS levels and MDA and GST activities were upregulated, whereas SOD activity was downregulated in the miR-423-5p inhibitors + siGSTM1 group compared to miR-423-5p inhibitors group (all P < 0.05; Figure 5). [score:10]
The miR-423-5p expression in the miR-423-5p mimics group was upregulated compared to the H/R and NC groups whereas expression of GSTM1 mRNA and protein was down-regulated (all P < 0.05; Figure 3A–3B). [score:10]
The following were the 8 groups: (1) the normal control group without H/R treatment; (2) the H/R group (cells with H/R injury); (3) the negative control (NC) group (cells with H/R injury and transfected with nonsense sequence); (4) the miR-423-5p mimics group (cells with H/R injury and transfected with miR-423-5p mimics); (5) the miR-423-5p inhibitor group (with H/R injury and transfected with miR-423-5p inhibitors); (6) the GSTM1 group (cells with H/R injury and transfected with wild type GSTM1 gene); (7) the siGSTM1 group (cells with H/R injury and transfected with siRNA to GSTM1), and (8) the miR-423-5p inhibitor + siGSTM1 group (cells with H/R injury and transfected with miR-423-5p inhibitors and siRNA to GSTM1). [score:9]
Conversely, ROS levels and MDA and GST were down-regulated, whereas SOD activity was up-regulated in the miR-423-5p inhibitors and GSTM1 groups (all P < 0.05). [score:9]
In the miR-423-5p inhibitors group, miR-423-5p was downregulated and both GSTM1 mRNA and protein was up-regulated (all P < 0.05). [score:9]
Our study confirmed that H/R injury of RPETCs induced miR-423-5p, which down-regulated expression of its target gene, GSTM1. [score:8]
Cell proliferation was downregulated in the miR-423-5p mimics and siGSTM1 groups and upregulated in the miR-423-5p inhibitors and GSTM1 group compared to the H/R group (all P < 0.05). [score:8]
In the miR-423-5p inhibitors + siGSTM1 group, GSTM1 mRNA and protein levels were down-regulated compared to the miR-423-5p inhibitors group (Figure 3A–3B). [score:7]
In the miR-423-5p mimics and siGSTM1 groups, ROS levels and MDA and GST activities were up-regulated, whereas SOD activity was downregulated (all P < 0.05). [score:7]
Our study showed that the miR-423-5p inhibitors reduced GRP78 and CHOP expression and increased GSTM1 expression. [score:7]
The miR-423-5p inhibitors are single-stranded RNA with chemical (2-methoxy) modification carried out after synthesis to ensure that specific binding with mature miR-423-5p would inhibit endogenous miR-423-5p expression. [score:7]
This suggested that renal I/R induced miR-423-5p, which subsequently down-regulated GSTM1 expression. [score:6]
In the siGSTM1 group, the miR-423-5p expression was similar to the NC group (P > 0.05), whereas GSTM1 mRNA and protein was down-regulated (all P < 0.05; Figure 3A–3B). [score:6]
In the GSTM1 group, the miR-423-5p expression was comparable to the NC group (P > 0.05), whereas GSTM1 mRNA and protein was up-regulated (all P < 0.05). [score:6]
We observed that miR-423-5p levels were up-regulated and GSTM1 mRNA and protein levels were down-regulated in I/R rats on days 1, 2 and 7 compared to the sham control group (all P < 0.05; Figure 8). [score:6]
Figure 4(A) Analysis of ER-stress related proteins, GRP78, p-PERK, p-IRE1α and CHOP in (1) normal control, (2) H/R, (3) negative control, (4) miR-423-5p mimics, (5) miR-423-5p inhibitor, (6) GSTM1, (7) siGSTM1 and (8) miR-423-5p inhibitor plus siGSTM1 groups of H/R induced HK-2 cells by western blotting; (B) Relative levels of GRP78, p-PERK, p-IRE1α and CHOP proteins in the 8 experimental groups. [score:5]
FACS analysis of apoptosis in (1) normal control, (2) H/R, (3) negative control, (4) miR-423-5p mimics, (5) miR-423-5p inhibitor, (6) GSTM1, (7) siGSTM1 and (8) miR-423-5p inhibitor plus siGSTM1 groups of H/R induced HK-2 cells by AnnexinV/PI double staining. [score:5]
Figure 9(A) Expression miR-423-5p and GSTM1 mRNA in the renal tissues of I/R, I/R plus miR-423-5p mimics and I/R plus miR-423-5p inhibitors on day 3 by qRT-PCR. [score:5]
Figure 3(A) Levels of miR-423-5p and GSTM1 in (1) normal control, (2) H/R, (3) negative control, (4) miR-423-5p mimics, (5) miR-423-5p inhibitor, (6) GSTM1, (7) siGSTM1 and (8) miR-423-5p inhibitor plus siGSTM1 groups of HK-2 cells by qRT-PCR. [score:5]
Also, cell proliferation in the miR-423-5p inhibitors + siGSTM1 group was lower than the miR-423-5p inhibitors group (Figure 6). [score:5]
These results showed that inhibition of GSTM1 expression by miR-423-5p enhanced ER stress under H/R conditions. [score:5]
In the H/R injury mo del of RPETCs, miR-423-5p mimics and GSTM1 siRNA treatments increased ER stress and oxidative stress, whereas miR-423-5p inhibitors suppressed them. [score:5]
Figure 5(A) FACS analysis of cellular ROS in (1) normal control, (2) H/R, (3) negative control, (4) miR-423-5p mimics, (5) miR-423-5p inhibitor, (6) GSTM1, (7) siGSTM1 and (8) miR-423-5p inhibitor plus siGSTM1 groups of H/R induced HK-2 cells by intracellular DCHF-DA staining. [score:5]
Inhibition of GSTM1 expression by miR-423-5p in H/R induced HK-2 cells. [score:5]
Effects of miR-423-5p mimics and inhibitors on GSTM1 expression in I/R treated rat kidneys. [score:5]
Also, higher rate of apoptosis was observed in the miR-423-5p inhibitors + siGSTM1 group than the miR-423-5p inhibitors group (P < 0.05). [score:5]
Figure 7FACS analysis of apoptosis in (1) normal control, (2) H/R, (3) negative control, (4) miR-423-5p mimics, (5) miR-423-5p inhibitor, (6) GSTM1, (7) siGSTM1 and (8) miR-423-5p inhibitor plus siGSTM1 groups of H/R induced HK-2 cells by AnnexinV/PI double staining. [score:5]
The SOD mRNA and protein levels were lower in the miR-423-5p inhibitors + siGSTM1 group compared to the miR-423-5p inhibitors group (P < 0.05; Figure 5E–5F). [score:4]
SOD mRNA and protein expressions were lower in the miR-423-5p mimics group compared to the miR-423-5p inhibitors group (P < 0.05). [score:4]
The dual-luciferase reporter assay showed that miR-423-5p bound to the 3′UTR of GSTM1 and suppressed its expression. [score:4]
The online bioinformatics software (miRBase Prediction Algorithm) was used to predict target genes which may be regulated by miR-423-5p. [score:4]
These results demonstrated that miR-423-5p negatively regulated GSTM1 expression. [score:4]
In regard to HK-2 cells, the H/R group showed higher miRNA-423-5p expression compared to the normal control group (P < 0.05) with the highest miRNA-423-5p expression at 24 h (Figure 1B). [score:4]
Estimation of proliferation in (1) normal control, (2) H/R, (3) negative control, (4) miR-423-5p mimics, (5) miR-423-5p inhibitor, (6) GSTM1, (7) siGSTM1 and (8) miR-423-5p inhibitor plus siGSTM1 groups of H/R induced HK-2 cells by CCK-8 assay. [score:4]
Figure 6Estimation of proliferation in (1) normal control, (2) H/R, (3) negative control, (4) miR-423-5p mimics, (5) miR-423-5p inhibitor, (6) GSTM1, (7) siGSTM1 and (8) miR-423-5p inhibitor plus siGSTM1 groups of H/R induced HK-2 cells by CCK-8 assay. [score:4]
The levels of GRP78, p-PERK, p-IRE1α and CHOP were higher in the miR-423-5p inhibitors + siGSTM1 group compared to the miR-423-5p inhibitors group (all P < 0.05; Figure 4B). [score:4]
Next, we analyzed the effect of miR-423-5p mimics and inhibitors on the renal function of I/R rats. [score:3]
With a rat mo del of H/R and a rat mo del of I/R injury, the study confirmed the functions of miR-423-5p in the processes of RPETC injury by comparing the expressions and the changes of oxidative stress and ER stress after miR-423-5p treatment. [score:3]
Analysis of miR-423-5p and GSTM1 expression in hypoxia/reoxygenation induced HK-2 cells. [score:3]
This trend was reversed by treating with miR-423-5p inhibitors that increased GSTM1. [score:3]
Also, RPTECs are a vital factor in kidney function and miR-423-5p can regulate renal response to acute injury essential in maintenance of renal function and development of renal injury [2, 12]. [score:3]
These results demonstrated that miR-423-5p inhibition of GSTM1 promote oxidative stress in H/R conditions. [score:3]
Consistent with our data, another study showed that miR-423-5p inhibitors in gastric cancer cells reduced cell proliferation and increased tumor cell invasion [26]. [score:3]
Expression of miR-423-5p and GSTM1 in I/R rat kidney. [score:3]
Inhibition of GSTM1 by miR-423-5p enhances oxidative stress in H/R induced HK-2 cells. [score:3]
However, relative luciferase activity increased in H/R induced HK-2 cells co -transfected with pGL3-GSTM1-WT and miR-423-5p inhibitors (Figure 2C). [score:3]
However, expressions of miR-423-5p and GSTM1 in the H/R and NC groups were similar (both P > 0.05). [score:3]
Inhibition of GSTM1 by miR-423-5p increases cellular apoptosis in H/R induced HK-2 cells. [score:3]
After 3 days, the relative index of renal function and miR-423-5p and GSTM1 expression were determined. [score:3]
, USA) was used to transfect either 50 nM nonsense sequence or 50 nM miR-423-5p mimics, 100 nM miR-423-5p inhibitors, 4 μg pcDNA3.1-GSTM1 plasmids. [score:3]
After I/R treatment of SD rats, miR-423-5p mimics or inhibitors were mixed in a 1: 2 ratio with Entranster™ (Engreen Biosystem Co. [score:3]
Also, when miR-423-5p was inhibited, cell proliferation increased and cellular apoptosis diminished. [score:3]
These results suggested that miR-423-5p inhibition of GSTM1 enhanced apoptosis in HK-2 cells apoptosis in H/R conditions. [score:3]
These results showed that inhibition of GSTM1 by miR-423-5p decreased HK-2 cell proliferation in H/R conditions. [score:3]
Effect of miR-423-5p on GSTM1 expression in I/R rat kidneys. [score:3]
Treatment of rats with miR-423-5p mimics or inhibitors. [score:3]
Inhibition of GSTM1 by miR-423-5p enhances ER stress in H/R induced HK-2 cells. [score:3]
Cell proliferation was similar in H/R, NC and miR-423-5p inhibitors + siGSTM1 groups (P > 0.05). [score:3]
Inhibition of GSTM1 by miR-423-5p decreases cell proliferation in H/R induced HK-2 cells. [score:3]
On the other hand, H/R induced HK-2 cells co -transfected with pGL3-GSTM1-MUT vector and miR-423-5p mimics or miR-423-5p inhibitors demonstrated no change (Figure 2B, 2C). [score:3]
The relative expressions of miRNA-423-5p and GSTM1 mRNA were determined in relation to U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), respectively. [score:3]
In comparison to the H/R group, we observed increased apoptosis in the miR-423-5p mimics and siGSTM1 groups and decreased in the miR-423-5p inhibitors and GSTM1 groups (all P < 0.05; Figure 7). [score:3]
Apoptotic rate was similar in the H/R, NC and miR-423-5p inhibitors + siGSTM1 groups (P > 0.05). [score:3]
A nonsense sequence, miR-423-5p mimics and inhibitors, and siRNA to GSTM1 (siGSTM1) were purchased from GenePharma Co. [score:3]
Increased miRNA-423-5p expression in H/R induced HK-2 cells and I/R treated rats. [score:3]
Increased miRNA-423-5p expression in kidney tissues after acute I/R and hypoxia/reoxygenation induced HK-2 cells. [score:3]
This demonstrated that renal function improved upon miR-423-5p inhibition in I/R rats. [score:3]
Effect of miR-423-5p mimics and inhibitors on renal function of I/R rats. [score:3]
To further explore the consequences of and the negative regulation of GSTM1 by miR-423-5p in RPETC injury, we analyzed of the status of ER stress and oxidative stress. [score:2]
In conclusion, our study demonstrates that miR-423-5p negatively regulates GSTM1 during renal cell injury, thereby affecting the repair process by enhancing oxidative stress and ER stress. [score:2]
These results further showed that negative regulation of GSTM1 by miR-423-5p promoted oxidative stress during renal cell injury. [score:2]
We observed that on day 3, high serum creatinine and urea nitrogen levels in the I/R and I/R + miR-423-5p mimics group and lower serum creatinine and urea nitrogen levels in the I/R + miR-423-5p inhibitors group compared to the sham group (all P < 0.05; Table 2). [score:2]
In addition, miR-423-5p negatively regulated autophagy and cell cycle in hepatocellular carcinoma cells [27]. [score:2]
But, if GSTM1 is regulated by miR-423-5p is not known. [score:2]
This suggested that negative regulation of GSTM1 by miR-423-5p influences cell proliferation and apoptosis during renal injury. [score:2]
On day 3, we observed higher miR-423-5p levels in the rat kidneys of I/R and I/R + miR-423-5p mimics group and lower miR-423-5p levels in the I/R + miR-423-5p inhibitors group compared to the sham group (all P < 0.05; Figure 9). [score:2]
This suggested that miR-423-5p increased ER stress in RPETCs by negatively regulating GSTM1. [score:2]
Further, on day 3, GSTM1 mRNA and protein levels were lower in the I/R and I/R + miR-423-5p mimics groups and higher in the I/R + miR-423-5p inhibitors group compared to the sham group (all P < 0.05; Figure 9). [score:2]
Analysis of miR-423-5p and GSTM1 levels in sham and I/R rat kidneys. [score:1]
Therefore, our study aims to explore the miR-423-5p effect on RPTECs. [score:1]
In this study, cells treated with miR-423-5p mimics demonstrated enhanced ROS and MDA and GST activities, whereas SOD activity was reduced. [score:1]
Figure 1(A) Estimation of miRNA-423-5p levels in kidney tissues of sham and I/R rats by qRT-PCR. [score:1]
Therefore, as described in the methods, we constructed the GSTM1 luciferase reporter vector to analyze the specific binding between miR-423-5p and GSTM1 3 ‘UTR. [score:1]
Figure 8(A) Estimation of miR-423-5p and GSTM1 mRNA levels in the kidneys of sham and I/R group rats on days 1, 3, 7, 14 and 21 by qRT-PCR. [score:1]
The miRBase software was used to predict the binding sites of miR-423-5p in the 3′ UTR with the binding site of miR-423-5p was cloned into pGL3 vector (Promega Corp. [score:1]
The miR-423-5p levels determined tumor cell growth in gastric cancer and predicted heart failure [10, 11]. [score:1]
Note: *denotes P < 0.05 in comparison with the NC group; GSTM1, Glutathione-S-transferase (GST) M1; miR-423-5p, microRNA-423-5p; HK-2 cells, human renal tubular epithelial cells; NC, negative control. [score:1]
Also, miR-199a-3p, miR-let-7i-5p and miR-423-3p are involved in maintaining renal function and response to renal injury [12]. [score:1]
Figure 2(A) Predicting miR-423-5p binding sites in GSTM1 sequence by miRBase. [score:1]
To detect miR-423-5p and GSTM1 mRNA levels by qRT-PCR, RNA was extracted from the 8 groups of experimental HK-2 cells or the rat kidneys according to the manufacturer’s instructions (Promega Corp. [score:1]
Note: *denotes P < 0.05 compared with the normal control group; # denotes P < 0.05 compared with H/R group; & denotes P < 0.05 compared with miR-423-5p inhibitors group; miR-423-5p, microRNA-423-5p; GSTM1, Glutathione-S-transferase (GST) M1; ER, endoplasmic reticulum; GRP78, 78 kDa glucose-regulated protein; CHOP, C/EBP homology protein; NC, negative control; H/R, hypoxia/reoxygenation. [score:1]
The result showed that the specific binding site of miR-423-5p was presented in the sequence of GSTM1 3′UTR (Figure 2A). [score:1]
Dual luciferase reporter analysis of miR-423-5p binding to GSTM1 3′UTR. [score:1]
Note: *denotes P < 0.05 in comparison with sham or normal control group; I/R, ischemia/reperfusion; qRT-PCR, quantitative real-time polymerase chain reaction; miR-423-5p, microRNA-423-5p. [score:1]
The miR-423-5p -binding site in the pGL3-GSTM1-WT plasmid was mutated to generate the pGL3-GSTM1-mutant-type (MUT) plasmid. [score:1]
This suggested that miRNA-423-5p played a role in renal injury. [score:1]
Therefore, miR-423-5p inhibitors can be potentially therapeutic for RPTEC injury and need to be investigated. [score:1]
In this study, miR-423-5p increased RPETC apoptosis and decreased cell proliferation. [score:1]
Further, the levels of miR-423-5p and GSTM1 mRNA and protein normalized on days 14 and 21 (all P > 0.05; Figure 8). [score:1]
These results confirmed that miR-423-5p specifically bound to GSTM1-3′UTR. [score:1]
[1 to 20 of 101 sentences]
2
[+] score: 205
Training-Induced Downregulation of HCN4 and I [f] and Resulting Sinus Bradycardia Is result of Upregulation of miR-423-5pWe hypothesized that the training -induced upregulation of miR-423-5p results in the downregulation of HCN4 and, consequently, a lower heart rate. [score:13]
In the exercise-trained mouse, we then identified an upregulation of miR-423-5p (regulatory microRNA) and Nkx2.5 (transcription factor)—further experiments showed that Nkx2.5 can upregulate miR-423-5p and miR-423-5p can downregulate HCN4. [score:11]
In addition, we show that HCN4 is a novel target for post-transcriptional repression by miR-423-5p and the training -induced downregulation of HCN4 and I [f], and consequently, the bradycardia is the result of an upregulation of Nkx2.5 and consequently miR-423-5p in the sinus node. [score:9]
We selected miR-423-5p for further study because it was predicted to target HCN4, it was significantly upregulated using both next-generation sequencing (2.8-fold increase above baseline) and qPCR (8.1-fold increase above baseline), and it produced the largest suppression of luciferase activity among the miRs tested. [score:8]
After applying a 5% Benjamini–Hochberg false discovery rate correction, miR-5099, miR-486-3p, miR-423-5p, Let-7d-3p, miR-676-3p, miR-181b-5p, and Let-7e-5p were significantly upregulated and miR-10b-5p downregulated (Figure 2E, hatched bars). [score:7]
We hypothesized that the training -induced upregulation of miR-423-5p results in the downregulation of HCN4 and, consequently, a lower heart rate. [score:7]
Training-Induced Downregulation of HCN4 and I [f] and Resulting Sinus Bradycardia Is result of Upregulation of miR-423-5p. [score:7]
Further experiments showed that in the sinus node of swim-trained mice, upregulation of miR-423-5p (intronic miR) and its host gene, NSRP1, is driven by an upregulation of the transcription factor Nkx2.5. [score:7]
We conclude from these data that the upregulation of miR-423-5p in the sinus node after training involves an upregulation of the transcription factor, Nkx2.5. [score:7]
In the mouse, evidence suggests that the downregulation of HCN4 and I [f] is the result of an upregulation of Nkx2.5 and, consequently, miR-423-5p. [score:7]
Upregulation of miR-423-5p appeared to be restricted to the trained sinus node—basal expression of miR-423-5p was lower in the atrium and ventricle and was unaltered by training (Figure 3F). [score:6]
2– 4 Inhibition of miR-423-5p (especially because upregulation of miR-423-5p could be restricted to the sinus node; Figure 3F) could be an alternative therapeutic strategy to electronic pacemaker implantation for pathological sinus node dysfunction seen in some veteran athletes. [score:6]
It is possible that miR-423-5p is one of 20% of intronic miRs that are predicted to inhibit expression of their host gene. [score:5]
Although Figure 3A through 3C shows that miR-423-5p targets HCN4, it is possible that it has other targets. [score:5]
Interaction between miR-423-5p and HCN4 was confirmed by a dose -dependent reduction in HCN4 3′-untranslated region luciferase reporter activity on cotransfection with precursor miR-423-5p (abolished by mutation of predicted recognition elements). [score:4]
Furthermore, mutation of predicted miR-423-5p binding sequences in the HCN4 3′- UTR (Figure 3B) abolished the effect of miR-423-5p on reporter expression (Figure 3C). [score:4]
[31] In this case, whether Nkx2.5 upregulates both NSRP1 and miR-423-5p may depend on the precise circumstances. [score:4]
B, Anti-miR abolishes training -induced upregulation of miR-423-5p in sinus node. [score:4]
F, Upregulation of miR-423-5p by Nkx2.5. [score:4]
HCN4 Is Target Gene for miR-423-5p. [score:3]
[39] Previously, the plasma level of miR-423-5p has been reported to be elevated in heart failure, acute myocardial infarction, stable coronary artery disease, and patients undergoing cardiac surgery. [score:3]
Both HCN4 mRNA and intrinsic heart rate showed a significant inverse correlation with expression of miR-423-5p (Figure 3D and 3E). [score:3]
Linear regression analysis showed that the sinus node expression level of miR-423-5p explained 68% of the variation in HCN4 (Figure 3D; R [2] = 0.68) and 46% of the variation in spontaneous beating rate of the sinus node (Figure 3E; R [2] = 0.46). [score:3]
[17] Using the wi dely used algorithms RNA22, [18] PITA, [19] and TargetScan Mouse v7.1, [20] we identified putative recognition sites for miR-423-5p (Online Figure II) and miR-486-3p (data not shown) within the mouse HCN4 3′-UTR sequence. [score:3]
miR-423-5p contributes to training -induced bradycardia by targeting HCN4. [score:3]
A separate study demonstrated that the suppressive effect of the anti-miR on miR-423-5p persisted for up to 3 weeks after administration (Online Figure IV). [score:3]
Nabiałek E Wańha W Kula D Circulating microRNAs (miR-423-5p, miR-208a and miR-1) in acute myocardial infarction and stable coronary heart disease. [score:3]
miR-423-5p could be a therapeutic target for pathological sinus node dysfunction in veteran athletes. [score:3]
miR-423-5p expression is shown in H9c2 cells not transfected (control) or transfected with Nkx2.5. [score:3]
Miyamoto S Usami S Kuwabara Y Horie T Baba O Hakuno D Nakashima Y Nishiga M Izuhara M Nakao T Nishino T Ide Y Nakazeki F Wang J Ueyama K Kimura T Ono K Expression patterns of miRNA-423-5p in the serum and pericardial fluid in patients undergoing cardiac surgery. [score:3]
To verify these predicted binding sites and experimentally establish HCN4 as a genuine target, we fused the HCN4 3′-UTR to a luciferase reporter gene (pHCN4-3′ UTR) and determined luciferase activity in H9c2 cells cotransfected with pHCN4-3′ UTR and synthetic precursors to miR-423-5p and miR-486-3p. [score:3]
Figure 3F suggests that miR-423-5p is preferentially expressed by the sinus node, and this raises the question of whether the sinus node is the source of miR-423-5p in heart failure. [score:3]
Surprisingly, Nkx2.5 had little effect on expression of NSRP1 (Online Figure IX), but it resulted in a robust increase in miR-423-5p (Figure 5F). [score:3]
Figure 3. HCN4 (hyperpolarization-activated cyclic nucleotide gated channel 4) is a target gene for miR-423-5p. [score:3]
miR-423 is located in the first intron of its host gene, NSRP1, and both are transcribed in the same sense direction (Figure 5A). [score:2]
All miRs tested significantly supressed luciferase activity relative to a control (scrambled) miR, although suppression was modest on transfection with miR-1 and miR-486-3p (34%; data not shown) compared with miR-423-5p (Figure 3A). [score:2]
[46] While our data suggest a prominent role for miR-423-5p in regulating HCN4, we cannot rule out a role for other miRs. [score:2]
Luo P He T Jiang R Li G MicroRNA-423-5p targets O-GlcNAc transferase to induce apoptosis in cardiomyocytes. [score:2]
Intriguingly, the anti-miR did not alter the heart rate in vivo in sedentary animals, despite successful knockdown of miR-423-5p (Online Figure V); the effect of the anti-miR was, therefore, restricted to the trained mouse. [score:2]
To test this, miR-423-5p was knocked down in vivo via 3 daily intraperitoneal injections of cholesterol-conjugated anti-miR-423-5p (anti-miR) in sedentary mice and in trained mice at day 25 to 27 of the swimming protocol (Figure 4A). [score:2]
Figure 5. Nkx2.5 regulation of miR-423-5p. [score:2]
Knockdown of miR-423-5p with anti-miR-423-5p reversed training -induced bradycardia via rescue of HCN4 and I [f]. [score:2]
[42] In these studies, although the source of miR-423-5p may be the myocardium, it is not known from what part of the heart it originates. [score:1]
After 2 weeks of detraining (after 4 weeks of training), there was a partial restoration of miR-423-5p (Figure 3G). [score:1]
Figure 4. Anti-miR to miR-423-5p reverses training -induced bradycardia and blunts HCN4 (hyperpolarization-activated cyclic nucleotide gated channel 4) channel remo deling. [score:1]
Computational predictions highlighted a prominent role for miR-423-5p. [score:1]
Control of miR-423-5p in the Trained Sinus Node. [score:1]
B, Predicted miR-423-5p binding sites in HCN4 3′-UTR and corresponding sequence of mutant HCN4 3′-UTR tested. [score:1]
miR-423-5p (determined by quantitative real-time reverse transcription polymerase chain reaction [qPCR]) in sinus node of vehicle- or anti–miR -treated sedentary and trained mice shown (n=6/5/5/5). [score:1]
G, Expression of miR-423-5p (measured by qPCR) in sinus node is partially restored on detraining (right). [score:1]
We observed a dose -dependent effect of miR-423-5p on luciferase activity of pHCN4-3′ UTR (Figure 3C). [score:1]
F, Expression of miR-423-5p (measured by quantitative real-time reverse transcription polymerase chain reaction [qPCR]) in atrium and ventricle is low and unaltered by training. [score:1]
qPCR analysis confirmed the majority of these changes (including in miR-423-5p; Figure 2F). [score:1]
[6] At day 28, that is, 3 days after the first administration, qPCR analysis showed a dramatic reduction in the level of miR-423-5p (Figure 4B). [score:1]
These findings demonstrate a specific interaction between miR-423-5p and HCN4, and the predicted recognition elements identified in the HCN4 3′ -UTR contribute to this. [score:1]
Luciferase activity is shown 24 h after cotransfection with different amounts of wild-type or mutant miR-423-5p. [score:1]
C, Luciferase reporter assay showing dose -dependent repression of HCN4 by miR-423-5p and loss of repression by mutation of HCN4 3′-UTR. [score:1]
A, map of NSRP1 gene (solid blocks show exons with introns in between) showing location of Nkx2.5 binding sites and intronic location of the miR-423 gene. [score:1]
D, Relationship between HCN4 mRNA and log miR-423-5p in sedentary and trained mice (n=5/5). [score:1]
In the mouse, the training -induced bradycardia is reversed by blocking the action of miR-423-5p. [score:1]
Blocking miR-423-5p with an anti-miR reversed the training -induced sinus bradycardia. [score:1]
[1 to 20 of 61 sentences]
3
[+] score: 92
Based on our dual-fluorescent protein vector system, we found that sv40-miR-S1-5p and hsa-miR423-5p downregulate the expression of common artificial target mRNAs. [score:8]
Nevertheless, the orthologous role of viral miR-S1-5p with cellular miR423-5p also implies that SV40-encoded miRNA not only autoregulates its viral gene expression but also may regulate cellular gene expression, which may play roles in virus-host interactions. [score:7]
These assays demonstrated that miR-S1-5p and miR423-5p can inhibit the expression of indicator vectors that contain both their own and each other's non-fully complementary target sequences. [score:6]
To further test if miR-S1-5p and miR423-5p are functional orthologs of cellular miRNAs, we asked whether these miRNAs downregulate their predicted biological targets. [score:6]
sv40-miR-S1-5p and hsa-miR423-5p downregulate the predicted biological targets of hsa-miR423-5p. [score:6]
As the native stem-loops of precursor miR423-5p and miR-S1-5p not only express the mature sequences of miR423-5p and miR-S1-5p, respectively, but also express miR423-3p and miR-S1-3p (http://microrna. [score:5]
The tar(s) sequence is a non-fully complementary target of miR-S1-5p, and the tar(423-5) sequence is a non-fully complementary target of miR423-5p (see Figure 4B). [score:5]
org/vert_50/), were also downregulated by both hsa-miR423-5p and sv40-miR-S1-5p. [score:4]
sv40-miR-S1-5p and hsa-miR423-5p share a seed sequence and target common artificial mRNA sequences. [score:3]
The vectors pmiR-S1-5p and pmiR423-5p, based on the above dual-fluorescent reporter vector, were constructed to strongly express miR-S1-5p and miR423-5p, respectively. [score:3]
Some computationally predicted cellular targets of hsa-miR423-5p, such as DMWD and C20orf27, (http://www. [score:3]
Because it was difficult to find any predicted targets of sv40-miR-S1-5p, some predicted genes of miR423-5p were tested. [score:3]
uk/) as byproducts, miR30 -based precursor stem-loops were used to exclusively express miR423-5p and miR-S1-5p [9] (see Figure S2A, B). [score:3]
Thus, the reporter assays demonstrated that targets, such as DMWD and C20orf27, can be negatively regulated by both miR423–5p and miR–S1–5p. [score:3]
sv40-miR-S1-5p and hsa-miR423-5p contain the same seed sequence and target common artificial mRNA sequences. [score:3]
The indicator vectors pmiR-S1-5p:4tar(423-5) and pmiR423-5p:4tar(423-5) were constructed by the stepwise insertion of four copies of miR423-5p non-fully complementary target sequence (tar(423-5)) into the 3′-UTR of the mCherry gene in pmiR-S1-5p and pmiR423-5p using the Bgl II/Hind III and Hind III/EcoR I sites, respectively. [score:3]
Figure S4 Relative expression level determination of miR30, miR423-5p and miR192 using real-time quantitative PCR method. [score:3]
The miRNA expression vector pmiR423-5p was constructed by inserting the miR30 precursor stem-loops based artificial pre-miR423-5p sequences into the EcoR V and Not I sites of. [score:3]
The expression of miR30, miR423-5p and miR192 was compared to mock transfected sample using 2 [–ΔΔCT] method. [score:2]
In this study, two pairs of functional orthologs, sv40-miR-S1-5p and hsa-miR423-5p as well as hiv-1-miR-N367 and hsa-miR192, were demonstrated to be potential functional orthologs. [score:1]
0036157.g004 Figure 4(A) Sequence homology between sv40-miR-S1-5p and hsa-miR423-5p (marked in red). [score:1]
With our newly constructed dual-fluorescent protein reporter system, we demonstrated that sv40-miR-S1-5p may function as an ortholog of cellular hsa-miR423-5p and that hiv1-miR-N367 may function as an ortholog of cellular hsa-miR192. [score:1]
sv40-miR-S1-5p was found to contain a seed sequence identical to that of the human the derived-miRNA hsa-miR423-5p, suggesting that these two miRNAs from different species might be functional orthologs. [score:1]
Together with the above results, these data demonstrate that the SV40-encoded miRNA miR-S1-5p may act as a functional ortholog of the human derived-miRNA miR423-5p. [score:1]
These results demonstrated that SV40-encoded miRNA miR-S1-5p should act as a functional ortholog of the human-derived miRNA miR423-5p. [score:1]
The location of the mature miR-S1-5p and miR423-5p is indicated. [score:1]
The 3′-UTRs of the human genes DMWD and C20orf27, which contain several predicted “seed region” pairing sites of miR423-5p (See Figure S3A, B), were connected to the 3′-UTR of the mCherry gene in vectors pmiR-S1-5p and pmiR423-5p, respectively (http://www. [score:1]
Because the cellular miR423-5p may act as a functional ortholog of SV40 miR-S1-5p, it is possible that cellular miR423-5p may also function during latent viral infection or virus -mediated tumorigenesis. [score:1]
One of the SV40-encoded miRNAs, sv40-miR-S1-5p [7], was found to contain a seed sequence that is identical to that of the human-derived miRNA, hsa-miR423-5p, demonstrating its potential as a functional ortholog of hsa-miR423-5p (see Figure 4A). [score:1]
One of the SV40-encoded miRNAs, sv40-miR-S1-5p [7], was found to contain a seed sequence identical to that of hsa-miR423-5p. [score:1]
A. Secondary structure mo del for artificial pre-miR-S1-5p based on stem-loops of miR-30 precursor; B. Secondary structure mo del for artificial pre-miR423-5p based on stem-loops of miR-30 precursor; C. Secondary structure mo del for artificial pre-miR192 based on stem-loops of miR-30 precursor. [score:1]
A. The 3′UTR sequence of DMWD and the predicted pairing site of hsa-miR423-5p; B. The 3′ UTR sequence of C20orf27 and the predicted pairing site of hsa-miR423-5p; C. The 3′ UTR sequence of PABPC4 and the predicted pairing site of hsa-miR192. [score:1]
[1 to 20 of 32 sentences]
4
[+] score: 48
However, over -expression of miR-18a, miR-122, and miR-423-5p did not suppress the expression level of TNRC6B and suppression of miR-221 did not induce over -expression of TNRC6B. [score:11]
To clarify the biological links between miRNAs and TNRC6B, we examined the expression pattern of TNRC6B in Huh7 cells by real-time qPCR when expression levels of miR-18a, miR-18b miR-122, miR-221, miR-423-5p, and miR-22 were either over-expressed or suppressed. [score:9]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
TNRC6B on the other hand, was a common target gene in miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 using Targetscan. [score:5]
14.0 and showed that the expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC were expressed significantly lower than in well differentiated HCC. [score:5]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
The expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC had significantly lower expression levels than in well differentiated HCC (p < 0.05) (Table  2). [score:5]
Homo sapiens trinucleotide repeat containing 6B (TNRC6B) was a common hypothetical target gene in miR-221, miR-18a, miR-18b, miR-423-5p, miR-455-3p, miR-1914*, miR-215, miR-122*, let-7b, and miR-22 using miRanda algorithm. [score:3]
[1 to 20 of 8 sentences]
5
[+] score: 38
MiR423 is part of the let-7 family of miRNAs which have been suggested to suppress expression of their downstream target hepatic nuclear factor 4 alpha (HFN4A), and thereby promote stem cell self-renewal [21]. [score:7]
Using miR223 for normalization of miRNA expression levels, we confirmed significantly greater miR423-5p (p<0.05), miR30d (p<0.05), miR10b (p<0.05) and miR126 (p<0.001) expression in patients with low collateral capacity (Fig 3). [score:5]
The present study shows that miR423-5p, miR30d, miR10b and miR126 are up-regulated in plasma of CTO patients with low coronary collateral artery capacity. [score:4]
CFI: collateral flow index; miRNA: microRNA (TIF) No significant correlation seen between relative expression levels of selected microRNAs (A: miR423-5p, B: miR30d, C: miR10b, D: miR126) and collateral flow index (CFI) values. [score:3]
S2 Fig No significant correlation seen between relative expression levels of selected microRNAs (A: miR423-5p, B: miR30d, C: miR10b, D: miR126) and collateral flow index (CFI) values. [score:3]
There was no significant correlation between the expression levels of these miRNAs (miR423-5p, miR10b, miR30d or miR126) with CFI (S2 Fig). [score:3]
We also sought to compare the expression level of these miRNAs (miR423-5p, miR30d, miR10b and miR126) between healthy individuals (n = 19) relative to our CTO patient population (n = 41). [score:3]
We confirmed significantly elevated levels of miR423-5p (p<0.05), miR10b (p<0.05), miR30d (p<0.05) and miR126 (p<0.001) in patients with insufficient collateral network development. [score:2]
Significantly greater miR126, miR30d, miR423-5p and miR10b expression (p-value of 0.011, 0.029, 0.050 and 0.051, respectively) were seen in the plasma of patients with low collateral capacity compared to those with high collateral capacity. [score:2]
In conclusion, we have identified circulating miRNAs associated with insufficient collateral artery function (miR423-5p, miR10b, miR30d and miR126) in CTO patients. [score:1]
With the exception of miR126, the other miRNAs described in this study (miR423-5p, miR10b, miR30d), displayed significant discriminatory power only in a multivariate logistic regression mo del with age and gender. [score:1]
In this study we have identified miR423-5p, miR30d, miR10b and miR126 as circulating biomarkers to discriminate between patients with low versus high collateral artery capacity. [score:1]
MiR423-5p and miR126 have been previously linked to heart failure [17] and atherosclerosis progression [20]. [score:1]
MiR30d has shown to be secreted by cardiomyocytes [26], while miR423-5p has been linked to cardiac origin [29]. [score:1]
However, no other associations were found between the level of miR423-5p, miR30d or miR126 and the level of circulating leukocyte subsets. [score:1]
[1 to 20 of 15 sentences]
6
[+] score: 36
In agreement with our expression direction, Zhou et al. [48] reported down-regulation of miR-423-3p and miR-532-3p in ischemia–reperfusion injury heart grafts. [score:7]
We used miScript Primer Assays for 9 miRNAs (miR-744-5p, miR-648, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-222-3p, miR-423-3p and miR-766-3p) and QuantiTect Primer assays for 9 target genes (CDKN1A, MYC, PTEN, ESR1, ETS1, SOD2, MGMT, KRAS and HNF4A) (Qiagen, Hilden, Germany) to validate the different expression levels of the miRNA and their target genes, which are determined by miRTargetLink prediction software. [score:5]
Out of the eight miRNAs, miR-648 was up-regulated and the seven remaining miRNAs were down regulated (miR-744-5p, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-423-3p and miR-766-3p). [score:5]
Several miRNAs were detected in cardiac tissue at different stages of development and are highly expressed in the fetal heart, including miR-212, miR-210 and miR-423 [41]. [score:4]
As for atrial myocardial samples from infants with CHDs, we found significantly different expression of six miRNAs (miR-210-5p with a P-value of 0.014, miR-423-3p with a P-value of 0.034, miR-143-3p with a P-value of 0.018, miR-564 with a P-value of 0.024, miR-770-5p with a P-value of 0.025, and miR-874-5p with a P-value of 0.040) between prior and after CPB (Fig.   4). [score:3]
In addition, we selected six miRNAs (miR-328-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-874-5p and miR-93-5p) with low or moderate expression levels based on the array analysis and with known association with cardiac pathologies and its related process [26– 33]. [score:3]
The blue and orange lines indicate the two main clusters of samples To validate the data obtained from the miRNA microarray, RT-qPCR was performed to re-examine the expression level of nine miRNAs, namely miR-328-5p, miR-4750-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p. [score:3]
Similarly, miR-423-5p, miR-193b-3p, and miR-550a-5p showed an altered expression level in patients with heart failure [56, 57]. [score:3]
The significance of the differences in the expression was confirmed for seven miRNAs namely miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p) (P < 0.05) in the atrial myocardial samples from patients with CHDs after CPB compared to before CPB by RT-qPCR (Fig.   3). [score:2]
In addition, we found two miRNAs with border-line P-values (miR-423-3p, P-value = 0.060 and miR-93-5p, P-value = 0.070) (Fig.   4). [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 35
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
It is not surprising owing to their involvement in almost all biological processes as demonstrated by GO functional annotation of the target genes of three (bta-miR-193a-3p, miR-423-5p and miR-30b-5p) of these miRNAs. [score:3]
For example, bta- miR-193a-3p and miR-365-3p for E. coli at 6 h, miR-21-3p and miR-423-5p for E. coli at 12 h, miR-423-5p for E. coli at 24 h, miR-193a-3p for E. coli at 48 h, miR-21-3p for S. aureus at 24 h, and miR-193a-3p and miR-365-3p for S. aureus at 48 h were similarly differentially expressed (P < 0.05) with both methods. [score:3]
The expression of bta-miR-423-5p was highest at 6 hrs (P < 0.001) and returned to 0 hr level by 24 hrs (Figure  2). [score:3]
Similarly, different expression patterns of bta-miR-21-3p for E. coli at 24 h and S. aureus at 12 h, miR-486 for E. coli at 48 h and miR-423-5p for S. aureus at 12 h between the two methods were also observed. [score:3]
The expression of bta-miR-193a-3p and bta-miR-423-5p in control cells was further validated by qRT-PCR. [score:3]
Confirmation of the expression of bta-miR193a-3p and miR-423-5p in control cells by qRT-PCR. [score:3]
The expression of bta-miR-21-3p, miR-365-3p, miR-193a-3p, miR-423-5p and miR-486 in challenged cells was further confirmed by qPCR. [score:3]
Click here for file Confirmation of the expression of bta-miR193a-3p and miR-423-5p in control cells by qRT-PCR. [score:3]
Conversely, the expression of bta-miR-423-5p and bta-miR-un116 decreased with time. [score:3]
Five differentially expressed miRNAs (bta-miR-193a-3p, miR-423-5p, miR-21-3p, miR-365-3p and miR-486) were validated by quantitative RT-PCR using TaqMan [®] miRNA Assays following manufacturer’s recommendations (Applied Biosystems, Foster City, CA, USA). [score:2]
We observed that five miRNAs (bta-miR-193a-3p, miR-423-5p, miR-30b-5p, miR-29c and miR-un116) were differentially expressed (P < 0.05) in at least two time points in control cells as compared to 0 hr (Figure  2). [score:2]
In addition, our study revealed a temporal differential regulation of five miRNAs (bta-miR-193a-3p, miR-423-5p, miR-30b-5p, miR-29c and miR-un116) in unchallenged cells. [score:2]
4100.0921.2220.066 0.040 bta-miR-365-3p1.0510.3580.8790.8900.0960.478 bta-miR-423-5p1.8380.252 0.0461.3040.2970.336 bta-miR-4861.0990.0300.5450.8670.1190.48048hbta-miR-193a-3p0.3530.053 0.0200.3360.026 0.021 bta-miR-21-3p1.0830.1920.6791. [score:1]
010 bta-miR-21-3p2.1540.276 0.0171.0620.2720.819 bta-miR-365-3p0.9300.1150.5680.9940.1060.962 bta-miR-423-5p0.6290.046 0.0040.8120.1060.111 bta-miR-4861.6140.168 0.0321.6300.3420.14224hbta-miR-193a-3p1.2060.0520.0171.3270.1710.140 bta-miR-21-3p1.9420. [score:1]
[1 to 20 of 14 sentences]
8
[+] score: 31
0119646.g005 Fig 5The presence of miRNAs by a) disease groups with three or more members (Group 1: Coronary artery disease, Group 2: Mitral valve insufficiency, Group 3: Aortic stenosis, Group 5: Other cardiovascular disease, and Group 7: Coronary artery disease and aortic stenosis), and b) NYHA grading for miR-423–5p and by c) disease group and d) NYHA grading for miR-423–3p were measured using qPCR. [score:9]
The presence of miRNAs by a) disease groups with three or more members (Group 1: Coronary artery disease, Group 2: Mitral valve insufficiency, Group 3: Aortic stenosis, Group 5: Other cardiovascular disease, and Group 7: Coronary artery disease and aortic stenosis), and b) NYHA grading for miR-423–5p and by c) disease group and d) NYHA grading for miR-423–3p were measured using qPCR. [score:9]
In this study, several previously suggested HF markers, such as miR-423–5p, miR-320a and miR-21–5p, were also detected from the pericardial fluid samples but none of them showed significant differences between the different disease aetiologies or stages of the disease. [score:5]
When samples were divided into groups according to the disease aetiology or NYHA classification, there were no statistically significant differences in the levels of miR-423–5p or miR-423–3p between the groups (Fig. 5). [score:3]
Heart failure marker miR-423–5p in pericardial fluid samples. [score:1]
Both miR-423–5p and its counter miRNA, miR-423–3p, were detected in pericardial fluid of the HF patients. [score:1]
One of the most frequently identified circulating miRNAs in HF is miR-423–5p [37– 41]. [score:1]
When comparing the groups using ANOVA, 12 miRNAs (miR-106b-3p, let-7c, miR-21–5p, miR-378a-3p, miR-92a-3p, miR-146b-5p, let-7a-3p, miR-92b-3p, miR-342–5p, let-7f-1–3p, miR-185–5p and miR-423–5p) were found to be differentially detected (p<0.05) (Figs. 3A and 3C). [score:1]
MiR-423–3p was detected in all samples and miR-423–5p was detected in 50 out of 51 samples. [score:1]
[1 to 20 of 9 sentences]
9
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
It is possible that bta-miR-423-5p may be upregulated in dairy cattle affected with mastitis, whereas circulating bta-miR-423-5p may be down-regulated in beef cattle when exposed to a pathogen that produces respiratory disease. [score:9]
Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies. [score:6]
Jin et al. [22], using bovine mammary gland epithelial cells challenged with E. coli, found an upregulation of bta-miR-423-5p. [score:4]
Punga et al [31], in a study using lung samples affected with myasthenia gravis (a chronic autoimmune disorder caused by an antibody -mediated attack against neuromuscular junctions) in humans, indicate that hsa-miR-423-5p is over-expressed. [score:3]
Serum antibody to M. bovis microRNA Negative Positive SE P-value bta-let-7b 11,691 15,421 1,200 0.0336 bta-miR-24-3p 15,908 24,390 1,495 0.0002 bta-miR-92a 83,405 64,330 4,156 0.0023 bta-miR-423-5p 124,920 101,818 6,315 0.0133 A total of 21 microRNAs were associated with season (Table 3). [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 17
Furthermore, we tested two more inhibitors of miRNAs expressed in HaCaT cells that are predicted to target TGFBR2: miR-93 and miR-423 (miR-20a and miR-93 have the same seed sequence). [score:7]
We therefore went beyond the siRNA screen and looked for evidence for repression of TGFBR2 by expressed miRNAs (in HaCaT cells), such as miR-20a, miR-93, miR-34a and miR-423, and non-expressed miRNAs, such as miR-373. [score:5]
The result for miR-423 was not consistent with target prediction. [score:3]
The result of the miR-423 assay was not consistent with expectation, but transfection of the miR-93 inhibitor resulted in increased TGFBR2 mRNA levels relative to a LacZ siRNA control (Figure 10B). [score:2]
[1 to 20 of 4 sentences]
11
[+] score: 14
Therefore, the decreased expression (about 50%) of miR-423-5p observed in these transfected cells is therefore in line with published findings and may have contributed to inhibition of proliferation. [score:5]
Only miR-423-5p was shared between the 30–50 differentially expressed miRNAs in cells transfected with mimic for miR-19a, miR-20b, or miR-363-5p. [score:3]
However, high levels of expression of miR-423-5p has been found in breast—(Van Der Auwera et al., 2010) and hepatocellular tumors (Murakami et al., 2013). [score:3]
One single mirNA, miR-423-5p, was found differentially expressed (decreased by about 50%) in transfectants for either miR-19a -, miR-20b -, or miR-363-5p mimic. [score:3]
[1 to 20 of 4 sentences]
12
[+] score: 14
Our results show that continuous E6/E7 expression is linked to an upregulation of let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and a downregulation of miR-21–5p, in exosomes secreted from HeLa cells. [score:9]
These findings indicate that continuous HPV E6/E7 oncogene expression determines a signature of seven miRNAs in exosomes secreted from HeLa cells in that it leads to significantly increased let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and decreased miR-21–5p levels. [score:3]
miR-423–3p has been shown to promote G [1]/S transition and cell growth. [score:1]
A statistically significant and > 1.5-fold decrease upon E6/E7 silencing was detected for exosomal let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p, whereas miR-21–5p exhibited a statistically significant and > 1.5-fold increase upon E6/E7 silencing (illustrated in bold in S4 Table). [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 14
Farazi et al. reported that these two the mature forms of miR-423 were highly expressed in ductal infiltrating BC that subsequently give metastasis, underlying the prognostic independent role of the disease [33]. [score:5]
SAMBA biclustering showed an association with only miR-423-5p and some distinct groups of samples: an over -expression was associated to Her2+/IDC samples, and a down -expression was found with ER+/PR+/mucinous A samples (supplementary material, Additional file 1 bicluster 6). [score:5]
Our biclustering analysis evidenced a distinct group of IDC patients where miR-423 was over-expressed. [score:3]
miR-423-3p and miR-423-5p are the mature transcripts of miR-423. [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 13
miR-29b and miR-423 remained almost unchanged but the other miRNAs were slightly downregulated. [score:4]
Levels of miR-423 were the same in healthy and diseased dogs. [score:3]
Moreover, levels of miR-423, which were elevated during left ventricular heart failure in humans [21, 26], were equal in the healthy and diseased groups of dogs in our study. [score:3]
1: The expression of miR-21, miR-29, miR-30b, miR-133b, miR-126, miR-423 and miR-125 in dogs with heart failure divided into groups based on age (fold changes relative to youngest group; mean ± SEM). [score:3]
[1 to 20 of 4 sentences]
15
[+] score: 13
As expected, miR-423 mimics transfection suppressed that the cell vitality of A549 and H1299 cells in contrast to the mimics control. [score:3]
Likewise, in the presence of Cisplatin, overexpressing AXL (Figure 5E) or E2F3 (Figure 5F) could also block the supression of cell vitality induced by miR-423 mimics transfection. [score:3]
However, miR-423 also function as an oncogene in melanoma to promote metastasis through its targeted gene, ADAR1, further surporting the existence of a tumor type-specific manner of miR-432 during functions. [score:3]
Furthermore, a dose -dependent analysis demonstrated that the expression levels of AXL and E2F3 were progressviely depressed in A549 (Figure 4I) and H1299 (Figure 4J) in respopnse to the transfection of miR-423 mimics. [score:3]
Effect of miR-423 on the sensitivity of A549 and H1299 cells to cisplatin. [score:1]
[1 to 20 of 5 sentences]
16
[+] score: 12
The boxplots show significant downregulation of miR-130a-3p a, miR-149-5p b, miR-423-5p c, miR-487b-3p d and miR-193b-3p e in the FET placentae. [score:4]
Of these miRNAs, four (miR-130a-3p, miR-149-5p, miR-423-5p, and miR-487b-3p) were significantly downregulated in FET placentae compared with those from SP and ET. [score:3]
We identified four miRNAs, miR-130a-3p, miR-149-5p, miR-423-5p, and miR-487b-3p, that were significantly downregulated in FET placentae compared with those from SP and ET. [score:3]
We found that expression of miR-130a-3p, miR-149-5p, miR-423-5p, and miR-487b-3p was decreased in the term placentae derived from FET compared with those derived from ET or SP. [score:2]
[1 to 20 of 4 sentences]
17
[+] score: 12
In particular, ssc-miR-139-5p and its putative target SLA-DQB1 were co-expressed in the three tissues, and ssc-miR-423-5p and its putative target RNF5 were co-expressed in Abdominal Fat and Longissimus Dorsi muscle. [score:9]
Finally, the miR-423-5p target site in the 3′-UTR of human RNF5 was conserved in one porcine variant (i. e. one ‘created’ poly-miRTS) (Table S4). [score:3]
[1 to 20 of 2 sentences]
18
[+] score: 12
The miR-26 family is also involved in hematopoiesis [9], and miR-423-5p and miR-103a have previously been shown to be downregulated in MDS and to have tumor suppressor properties [30, 31]. [score:6]
Host Gene Transcribed direction LFC Tumor Suppressor P-value let-7c-5p Canonical 21 MIR99AHG Same −2.13 Yes 0.001 let-7b-5p Canonical 22 MIRLET7BHG Same −2.49 Yes 0.002 let-7f-5p let-7f-1 let-7f-2 −1.4 Yes 0.004 Canonical 9 JB153432 Same Canonical x HUWE1 Same let-7a-5p let-7a-1 let-7a-2 let-7a-3 −1.67 Yes 0.005 Canonical 9 JB153432 Same Canonical 11 MIRLET100 Same Canonical 22 MIRLET7BHG Same hsa-miR-423-5p Canonical 17 NSRP1 Same −1.66 Yes 0.007 hsa-miR-103a-3p hsa-miR-103a-1 hsa-miR-103a-2 −0.87 Yes 0.009 Canonical 5 PANK3 Same Canonical 20 PANK2 Same hsa-miR-26b-5p Canonical 2 CTDSP1 Same −2.24 Yes 0.011 let-7i-5p Canonical 12 No host gene N/A −1.09 Yes 0.011 hsa-miR-15a-5p Canonical 13 DLEU2 Same −1.18 Unknown 0.011 hsa-miR-3605-5p Mirtron 1 PHC2 Same −1.23 Unknown 0.030 hsa-miR-192-5p Canonical 11 AB429224 Same −0.84 Yes 0.047 Abbreviations, Chr: Chromosome, LFC: log2 fold change. [score:4]
When considering all mutated samples together, eight miRNAs (let-7c-5p, let-7a-5p, let-7b-5p, miR-423-5p, let-7f-5p, miR-26b-5p, miR-15a-5p, and miR-3605-5p) were differentially expressed compared to wild-type samples. [score:2]
[1 to 20 of 3 sentences]
19
[+] score: 11
Incidentally, the miR-423-3p upregulation is known to promote proliferation of tumor cells [124, 125], while it’s inhibition has an opposite effect [126]. [score:6]
miR-3184-3p is on the opposite strand relatively to the intron in the enclosing protein coding gene, and its antisense, miR-423-3p, is notably downregulated (Supplementary Table S4), indicating that BORIS mediated control is exerted differentially dependent on the direction of the gene. [score:5]
[1 to 20 of 2 sentences]
20
[+] score: 11
As shown in Figure 1A, miR-16, miR-223, miR-30a, miR-320b, let-7b, miR-92a, miR-423-5p and miR-21 were confirmed by qRT-PCR to have high expression levels in human plasma. [score:3]
A) Upper panel, Ago2 expression level in HeLa cells induced by serum starvation and TNFα is detected by western bolting; Lower panel, relative levels of total miR-16, miR-30a, miR-223, miR-320b and miR-423-5p, as well as Ago2 complex -associated miR-16, miR-30a, miR-223, miR-320b and miR-423-5p in the HeLa cells with or without apoptotic reagent treatment. [score:3]
A) Relative levels of total miR-423-5p, as well as Ago2 complex -associated miR-423-5p in the HeLa cell-derived MVs. [score:1]
B) The resistance of miR-423-5p in HeLa cell-derived MVs to degradation by RNaseA. [score:1]
C) The relative levels of miR-16, miR-223, miR-30a, miR-320b, let-7b, miR-92a, miR-423-5p and miR-21 in the MV vs. [score:1]
In agreement with many previous studies [11], [16], [17], [37], [38], we found that the majority of the circulating miRNAs in human peripheral blood, such as miR-16, miR-223, miR-30a, miR-320, let-7b, miR-92a, miR-423-5p and miR-21 were located in the MV fraction. [score:1]
Figure S4 Enhancement of the association of miR-423-5p with Ago2 complexes in HeLa MVs by TNFα treatment. [score:1]
[1 to 20 of 7 sentences]
21
[+] score: 11
The modulation of miRNA expression following E6/E7 siRNA treatment was further confirmed by real-time quantitative PCR (RT-qPCR) for approximately three-quarters of the targets and among them, let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423-3p, miR-7-5p, miR-92a-3p were downregulated and miR-21-5p was upregulated. [score:11]
[1 to 20 of 1 sentences]
22
[+] score: 10
Of the 31 PD-miRNAs, 7 miRNAs (hsa-mir-202, hsa-mir-196a-2, hsa-mir-423, hsa-mir-943, hsa-mir-520h, hsa-mir-1908 and hsa-mir-647) were identified in prior studies as being differentially expressed in human diseases representing a significant increase above expectation (1.1 out of 31) for disease -associated miRNAs (95% C. I. = 1.08 – 1.11; p = 2.2 × 10 [−16]) (Figure  5B). [score:7]
First, the hsa-mir-423 SNP rs6505162 has been shown to confer reduced risk for breast cancer in women of European decent in GWAS [57]. [score:1]
Similarly, the other 6 PD-miRNAs identified (hsa-mir-423, hsa-mir-196a-2, hsa-mir-520h, hsa-mir-1908, hsa-mir-647 and hsa-mir-943) have also been implicated in cancer susceptibility in human populations [56]. [score:1]
Overall, we identify 7 PD-miRNAs that are currently implicated as cancer biomarkers or diagnostics: hsa-mir-202, hsa-mir-423, hsa-mir-196a-2, hsa-mir-520h, hsa-mir-647, hsa-mir-943, and hsa-mir-1908. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 10
Among the 11 differentially expressed miRNAs (significant in ANOVA), eight differed significantly between HNF1B-MODY and at least one of the other groups (miR-32, miR-223, miR-23a, miR-199a, miR-27b, miR-24, miR-145 and miR-423; ESM Table 3). [score:3]
Adjusted expression of miR-423 did not differ significantly between the four groups of patients with diabetes (p = 0.3899), which excluded this miRNA from further analyses. [score:3]
Expression levels of: (c) miR-24 ΔC [t]; (d) miR-223 ΔC [t]; (e) miR-27b ΔC [t]; (f) miR-199a ΔC [t]; (g) miR-32 ΔC [t]; (h) miR-23a ΔC [t]; (i) miR-423 ΔC [t]; (j) miR-145 ΔC [t]. [score:3]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 10
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
[1 to 20 of 2 sentences]
25
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
Let-7a, let-7c, miR-181b, miR-185, miR-378 and miR-423-5p were predicted to target the inducible co-stimulatory molecule (ICOS), which plays a key role in regulating T-cell differentiation, T-cell proliferation, and secretion of lymphokines, providing effective help for antibody secretion by B cells [86]. [score:4]
The let7 family and miR-423-5p were predicted to target CCL25, a potent and selective chemoattractant for IgA antibody-secreting cells [83]. [score:3]
Conversely, miR-423-5p had 22,588 counts, while its complementary strand, miR-423-3p, had only 654 reads, and which was shared by miR-22, miR-30a, miR-339, miR-17, miR-24, miR-331, miR-27b and let-7d (detail in Additional file 3: Table S3). [score:1]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 4 sentences]
26
[+] score: 9
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
[1 to 20 of 1 sentences]
27
[+] score: 8
Despite tissue- and pathology-specificity of miRNAs expression, we failed to identify miRNAs, such as miR-133a and miR-423-5p, as circulating prognostic biomarkers of cardiac remo delling post-MI [14]. [score:3]
Data were normalized to miR-423-3p for LV and graph shows mean ± SEM values expressed as fold change (2−ΔΔCt). [score:3]
Bauters C Circulating miR-133a and miR-423-5p fail as biomarkers for left ventricular remo deling after myocardial infarctionInt. [score:1]
Up to now, we failed to identify miRNAs, such as miR-133a and miR-423-5p, as circulating prognostic biomarkers of cardiac remo delling post-MI [14]. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Stimulation of HCC proliferationBudhu et al., 2008; Gramantieri et al., 2008; Huang et al., 2009, 2011 miR-373 Invasion and metastasisMeng et al., 2007; Bartels and Tsongalis, 2009; Wu et al., 2011 miR-374 DevelopmentWang et al., 2008; Wong et al., 2008, 2010; Koh et al., 2013 miR-375 Stimulation of HCC proliferationLiu et al., 2010; He et al., 2012 miR-376a Proliferation and apoptosisMeng et al., 2007; Zheng et al., 2012b miR-423 Enhanced CDK2 activityLin et al., 2011 miR-491-5p Inhibition of TNF-α-related apoptosisYoon et al., 2010 miR-500 Elevated in HCC, returned to physiologic level after surgical interventionYamamoto et al., 2009 miR-637 Active STAT3Zhang et al., 2011 let-7a/a-1/a-2/b/c/d/e/f/f-2/g Development. [score:5]
MicroRNA-423 promotes cell growth and regulates G(1)/S transition by targeting p21Cip1/Waf1 in hepatocellular carcinoma. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 8
SOX4 knockdown (Figure  5A) using shRNA led to significant upregulation of miR-31 in TE8 and FLO1 cells, while miR-191 and miR-423-5p, used as controls, did not show any significant change (Figure  5B and C). [score:5]
miR-31, miR-191, miR-423-5p expression was normalized to RNU6. [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 7
Besides the identification of differential expression of miRNAs, our initial studies identified three reference endogenous miRNAs (miR-103, miR-191, and miR-423-3p). [score:3]
Through pilot large-scale comprehensive profiling studies, we identified three reference miRNAs, miR-109, miR-191, and miR-423-3p with GeNorm and Normfinder that were invariant in the mouse samples and were used as reference miRNAs for those studies. [score:1]
Three reference miRNAs, in addition to the spiked in UniSp2 were used for normalization in the validation experiments (ΔCq = NF − Cq [miRNA]) were NF is the normalization factor and NF = (Cq [miR-103] + Cq [miR-191] + Cq [miR-423-3p] + Cq [UniSp2])/4. [score:1]
Additionally, GeNorm and NormFinder algorithms were run and identified miR-103, miR-191, and miR-423-3p as appropriate reference miRNAs 11. [score:1]
M values and stability factors for GeNorm and NormFinder identify miR-423-3p, miR-191, and miR-103 as endogenous reference miRNAs for mouse experiments. [score:1]
[1 to 20 of 5 sentences]
31
[+] score: 7
Mir-519 and -519E were also upregulated in cKit+ ILCs; these microRNAs have been shown to inhibit cell growth and thus promote cell survival [25]whereas mir-423 promotes cell growth by regulating the G(1)/S transition in the cell cycle in hepatocellular carcinoma cell lines [26]. [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1
The downregulation of miR-423-5p enhances apigenin -induced cell apoptosis in glioma stem cells with a shift in the Bax/Bcl-2 ratio, an increased cytochrome c level, Apaf-1 induction and caspase-3 activation [126]. [score:4]
miR-423-5p is overexpressed in glioblastomas and contributes to glioma stem cells. [score:3]
[1 to 20 of 2 sentences]
33
[+] score: 7
In table 2, it could be found that people both carrying risk genotypes of miRNA SNPs and exposure to risk factor (cooking oil fumes) were in a higher risk of lung cancer than persons with only one of the two risk factors (ORs were 1.91, 1.05 and 1.41 for miR-146a rs2910164, ORs were 1.94, 1.23 and 1.34 for miR-196a2 rs11614913, ORs were 2.06, 1.41 and 1.68 for miR-608 rs4919510, ORs were 1.76, 0.82 and 1.07 for miR-27a rs895819, and ORs were 2.13, 1.15 and 1.02 for miR-423 rs6505162, respectively), which suggested that there may be interaction between these SNPs and cooking oil fume exposure, so we further explored the interaction on an additive scale and a multiplicative scale by quantitative and statistically significant analyses. [score:1]
The combination of the risk genotypes of five miRNA SNPs (miR-146a rs2910164, miR-196a2 rs11614913, miR-608 rs4919510, miR-27a rs895819 and miR-423 rs6505162) with risk factor (cooking oil fume exposure) contributed to a significantly higher risk of lung cancer, and the corresponding ORs (95% confidence intervals) were 1.91(1.04-3.52), 1.94 (1.16-3.25), 2.06 (1.22-3.49), 1.76 (1.03-2.98) and 2.13 (1.29-3.51). [score:1]
The similar statistically significant results were also found in miR-196a2 rs11614913, miR-608 rs4919510, miR-27a rs895819 and miR-423 rs6505162 polymorphisms, that was the combination of the risk genotypes of these miRNA SNPs with risk factor of cooking oil fume exposure contributed to a significantly higher risk of lung cancer, and the corresponding ORs (95%CIs) were 1.94 (1.16–3.25), 2.06 (1.22–3.49), 1.76 (1.03–2.98) and 2.13 (1.29–3.51). [score:1]
The individuals with both risk genotypes of miRNA SNPs and exposure to risk factor (cooking oil fumes) were in a higher risk of lung cancer than persons with only one of the two risk factors (ORs were 1.91, 1.05 and 1.41 for miR-146a rs2910164, ORs were 1.94, 1.23 and 1.34 for miR-196a2 rs11614913, ORs were 2.06, 1.41 and 1.68 for miR-608 rs4919510, ORs were 1.76, 0.82 and 1.07 for miR-27a rs895819, and ORs were 2.13, 1.15 and 1.02 for miR-423 rs6505162, respectively). [score:1]
We have studied the effect of the common SNPs in selected six miRNAs on the susceptibility of lung cancer in non-smoking females (miR-146a rs2910164, miR-196a2 rs11614913, miR-30c-1 rs928508, miR-608 rs4919510, miR-27a rs895819, and miR-423 rs6505162) and found the significantly associated miRNA SNPs (the manuscript has been submitted). [score:1]
For miR-146a rs2910164, miR-196a2 rs11614913, miR-608 rs4919510, miR-27a rs895819 and miR-423 rs6505162 polymorphisms, the risk genotypes combining with the risk factor (cooking oil fume exposure) were significantly associated with lung adenocarcinoma risks, and the corresponding ORs (95%CIs) were 2.13 (1.12–4.04), 2.18 (1.25–3.81), 2.18(1.24–3.83), 2.19 (1.24–3.88) and 2.06 (1.20–3.55). [score:1]
The combination of two risk factors contributed to a higher risk of lung adenocarcinoma than those with only one of them (ORs were 2.13, 1.07 and 1.37 for miR-146a rs2910164, ORs were 2.18, 1.31 and 1.20 for miR-196a2 rs11614913, ORs were 2.18, 1.04 and 1.13 for miR-608 rs4919510, ORs were 2.19, 1.04 and 1.13 for miR-27a rs895819, and ORs were 2.06, 1.13 and 1.13 for miR-423 rs6505162, respectively). [score:1]
[1 to 20 of 7 sentences]
34
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
The major plasma/serum -based, GC-related circulating miRNAs that have been suggested as useful GC biomarkers are listed in Table 3 and Table 4. Liu et al. [111] used systematic analysis of miRNA profiling, miRNA profiling to identify a signature of five circulating oncomiRs—miR-1, miR-20a, miR-27a, miR-34 and miR-423-5p—and correlated it with tumor stage. [score:1]
The major plasma/serum -based, GC-related circulating miRNAs that have been suggested as useful GC biomarkers are listed in Table 3 and Table 4. Liu et al. [111] used systematic analysis of miRNA profiling, miRNA profiling to identify a signature of five circulating oncomiRs—miR-1, miR-20a, miR-27a, miR-34 and miR-423-5p—and correlated it with tumor stage. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 7
The 50 miRNAs that showed highest total reads (most abundant) in the exosomes of the 36 patient samples were then subjected to unsupervised hierarchal clustering with the expression heat maps of the individual patient samples shown in Figure 1. The twenty most variable miRNAs among all samples were then further validated by qPCR analysis to examine their differential expression within the four patient cohorts described in Table 1. These miRNAs included let-7b, let-7g, miR-17, miR-19a, miR-19b, miR-20b, miR-21, miR-23a, miR-29a, miR-92a, miR-125b, miR-126, miR-128, miR-137, miR-148a, miR-149, miR-199a, miR-221, miR-222 and miR-423 (Table 2). [score:5]
hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT hsa-let-7g-5p TGAGGTAGTAGTTTGTACAGTT hsa-miR-125b TCCCTGAGACCCTAACTTGTGA hsa-miR-126 TCGTACCGTGAGTAATAATGCG hsa-miR-128 TCACAGTGAACCGGTCTCTTT hsa-miR-137 TTATTGCTTAAGAATACGCGTAG hsa-miR-148a AAAGTTCTGAGACACTCCGACT hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-199a-5p CCCAGTGTTCAGACTACCTGTTC hsa-miR-19a TGTGCAAATCTATGCAAAACTGA hsa-miR-19b TGTGCAAATCCATGCAAAACTGA hsa-miR-20b TAAAGTGCTTATAGTGCAGGTAG hsa-miR-21 TAGCTTATCAGACTGATGTTGA hsa-miR-221 AGCTACATTGTCTGCTGGGTTTC hsa-miR-222 AGCTACATCTGGCTACTGGGT hsa-miR-23a ATCACATTGCCAGGGATTTCC hsa-miR-29a TAGCACCATCTGAAATCGGTTA hsa-miR-423-5p TGAGGGGCAGAGAGCGAGACTTT hsa-miR-92a TATTGCACTTGTCCCGGCCTGT Since there are no known control or house-keeping microRNAs in exosomes, we adopted the strategy of using spiked-in C. elegans miRNAs directly into Qiazol prior to RNA extraction as normalizing controls [20]. [score:2]
[1 to 20 of 2 sentences]
36
[+] score: 7
Other miRNAs from this paper: mmu-mir-423, hsa-mir-3184
Eighty five of them were upregulated, and two microRNAs (mir-423 and mir-3184) were downregulated (Fig. 4a and Supplementary File S1). [score:7]
[1 to 20 of 1 sentences]
37
[+] score: 7
The upregulated miRNAs included miR-132-3p, miR-604, miR-186-5p, miR-29b-3p, miR-125b-5p, miR-376c-3p, and miR-30b-5p, where the only downregulated miRNA was miR-423-3p (Table 1). [score:7]
[1 to 20 of 1 sentences]
38
[+] score: 7
Of note, upregulation of miR-106b, miR-423, miR-20a, and miR-16 as well as downregulation of miR-10a were newly observed. [score:7]
[1 to 20 of 1 sentences]
39
[+] score: 7
Previous research has shown that in cancer several of the miR genes such as miR-200b/200a/429, miR-21, miR-30b, miR-30d, miR-31, and miR-423 are upregulated, while other miR genes such as miR-143 and miR-145 are downregulated [1- 3]. [score:7]
[1 to 20 of 1 sentences]
40
[+] score: 7
Expression of miRNAs was normalized using geometric means of the expression of three stable endogenous control genes, SNORD49A, SNORD38B and hsa-miR-423-5p, which were shown in our previous study to be stably expressed in endometrial tissue [11]. [score:7]
[1 to 20 of 1 sentences]
41
[+] score: 6
Circulating miR-1, miR-208a and miR-133a are overexpressed in the following 2 h after an acute myocardial infarction [106], and circulating miR-423-5p is upregulated in heart failure [107, 108]. [score:6]
[1 to 20 of 1 sentences]
42
[+] score: 6
Besides miR-423, all above mentioned miRNAs were down-regulated in blood cells of lung cancer patients compared to blood cells of healthy subjects indicating an overall decreased miRNA repertoire. [score:3]
The miRNAs that were most significantly deregulated included hsa-miR-126 with a p-value of 0.00003, hsa-let-7d with a p-value of 0.003, hsa-let-7i with a p-value of 0.003, and hsa-miR-423 with a p-value of 0.001 (Figure 1 and Figure 2). [score:2]
The most significant miRNA, hsa-miR-423, showed an adjusted significance level of 0.78. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 6
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 6
Together with the fact that the viral miRNA downregulates LTAg, this would then imply that hsa-miR-423-5p negatively regulates this antigenic protein, thereby reducing immune response against the virus and limiting the viral replication rate [64]. [score:5]
For SV40 it was shown that hsa-miR-423-5p may act as a functional ortholog of SV40-miR-S1-5p, which shares identical seed sequence [85]. [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 6
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
Other miRNAs like miR-138, miR-375, miR-593, miR-133a were down-regulated in esophageal cancer tissue, serving as tumor suppressors, while miR-34b, miR-16, miR-208, miR-423, miR-21, miR-31, miR-223 and miR-373 could have oncogenic actions [18– 23] (Figure 1). [score:6]
[1 to 20 of 1 sentences]
47
[+] score: 6
The relatively high expression of miR-1 and mir-423-5p that we detected in foetal and adult hearth, respectively, is of interest. [score:3]
Also, it seems that the miR-423-5p can act as a circulating biomarker for heart failure [25]. [score:1]
In the foetal heart, miR-1 showed a highest level, however, the highest level is for miR-423-5p in the adult heart. [score:1]
Hence both miR-1 and miR-423-5p are linked to establishment of structure and function of heart. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 6
The study reported six up-regulated miRNAs in the cells cultivated on ZO [2] ceramics compared to the one cultivated on Ti layer (miR-214, miR-337, miR-423, miR-339, miR-377, and miR-193b), and four down-regulated miRNAs (miR-143, miR-17-5p, miR-24, and miR-22) [29]. [score:6]
[1 to 20 of 1 sentences]
49
[+] score: 6
Additionally, 3 miRNAs (miR-103, miR-191 and miR-423-5p) with stable expression in human testis tissue were included to serve as reference miRNAs in the expression analysis. [score:5]
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 5
Although most of the newly detected miRNAs in T-ALL were expressed at very low levels, we also identified a selection of novel T-ALL miRNAs with very high expression levels in T-ALL patient samples, including hsa-miR-181b-5p, hsa-miR-423-3p, hsa-miR-486-5p and hsa-miR-92b-3p (Fig.   1b). [score:5]
[1 to 20 of 1 sentences]
51
[+] score: 5
Within hsa-mir-136, hsa-mir-423, hsa-mir-376b and hsa-mir-1307, their 5p arm miRNAs have higher expression level in the normal tissue; while their 3p arm miRNAs dominated in the tumor tissue. [score:3]
As shown in Table 3, the 5p and 3p miRNA of hsa-mir-423 individually have read counts of 20,920 (N5p) and 8,945 (N3p) in G1245N library, leading to the Ratio_N53p value of 2.3387. [score:1]
In another interesting case of hsa-mir-423, the major arm and minor arm in normal tissue are individually 5p arm and 3p arm, obeying the annotation of miRBase. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 5
In man, high expression of miR-423, miR-199a-3p, miR-93*, and miR-377 in plasma[17] and low expression of miR-146a-5p and miR-155in whole blood can predict acute GvHD[18]. [score:5]
[1 to 20 of 1 sentences]
53
[+] score: 5
Of these, the top 20 expressed miRNA and their read counts in the duplicated samples are shown in Table 2. These include known disease associated miRNA species such as miR-451a [20, 21], miR-1246 [22], miR-423 [23], and miR-148a [24, 25] (Table 3). [score:5]
[1 to 20 of 1 sentences]
54
[+] score: 5
MiRNA expression data was normalized to the geometric mean of the expression of the miR-423-3p, SNORD48 and U6snRNA housekeeper genes. [score:5]
[1 to 20 of 1 sentences]
55
[+] score: 4
044hsa-miR-18b2.20.014hsa-miR-423-5p1.70.048hsa-miR-932.10.014hsa-miR-1911.50.049hsa-miR-548b-5p2.30.015Downregulated miRNAs  hsa-miR-252.10.015hsa-miR-885-5p-4.20.00011hsa-miR-324-3p2.30.017hsa-miR-874-5.80.00018hsa-miR-3262.60.017hsa-miR-486-3p-4.60.00040hsa-miR-18a3.10.017hsa-miR-299-5p-4.20.0020hsa-miR-20b2.00.017hsa-miR-488-3.90.0063hsa-miR-1942.80. [score:4]
[1 to 20 of 1 sentences]
56
[+] score: 4
114) identified a profile of five serum miRNAs (miR-1, miR-20a, miR-27a, miR-34 and miR-423-5p) as biomarkers for gastric cancer detection, and their expression level correlated well with the tumour stage. [score:3]
Several miRNAs circulating in blood of gastric cancer patients can be applied as diagnosis biomarkers, including let-7a, miR-1, miR-17-5p, miR-21, miR-20a, miR-27a, miR-34, miR-106a/b, miR-196a, miR-199a-3p, miR-218, miR-221, miR-223, miR-370, miR-376c, miR-378, miR-421, miR-423-5p, miR-451 and miR-486 (Refs 64, 76, 111, 112, 113, 114, 115, 116, 117). [score:1]
[1 to 20 of 2 sentences]
57
[+] score: 4
Of the total counts 86% were contributed by the top five most highly expressed miRNAs (eca-miR-486-5p, eca-miR-92a, eca-miR-191a, eca-miR-423-5p, eca-miR-148a). [score:3]
The analysis with the tool edgeR showed following differenced in contrast to the analysis with DESeq2: four miRNAs were not significantly affected by the level of hemolysis (eca-miR-744, eca-miR-128, eca-miR-28-3p and eca-miR-125a-5p) and additionally five significantly affected miRNAs were reported: eca-miR-423-5p, eca-let-7g, eca-miR-19b, eca-miR-425, eca-miR-7177b (Table S6). [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 4
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-129-2, hsa-mir-18b, hsa-mir-452, hsa-mir-622
Aliquots of sera were pooled from patients with Ross scores <3, 3–5, and >5 for expression analysis of miR129-5p, miR18b, miR423-5p, miR622, and miR452. [score:3]
Following linear pre-amplification of miRNA sequences using the Applied Biosystems Preamplification system, relative expression was determined using singleplex TaqMan Assays (ABI) with primer sets for miR-129 (ABI; 000590), miR-18b (ABI; 002310), miR-423-5p (ABI; 002340), miR-622 (ABI; 001553), and miR-452 (ABI; 002330). [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 4
There were however seven microRNAs (miR-335-3p, miR-128, miR-224-5p, miR-28-5p, miR-191-5p, miR-423-3p, and miR-181a-5p) with a statistically significant upregulation in the controls. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 4
Other miRNAs from this paper: hsa-mir-663a, hsa-mir-663b
Meanwhile, the expression of p21 in human tumors could be post-transcriptionally regulated by a lot of microRNAs including miR-663 and miR-423 [43, 44]. [score:4]
[1 to 20 of 1 sentences]
61
[+] score: 4
Normalisation of raw Ct data was performed with interplate calibrators followed by miR-423-5p, as a housekeeping gene expressed at relatively constant levels in our analysed samples. [score:3]
Raw Ct data were substracted from the maximal qPCR cycle number (45) and data were normalised with interplate calibrators and also with miR-423-5p Ct values. [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 4
Mmu-miR-423-5p, -455, -466f-3p, -466g, -467a* and -467b* were consistently upregulated at IT and LT. [score:4]
[1 to 20 of 1 sentences]
63
[+] score: 3
Other housekeeping genes frequently used are the miRNAs: let-7, miR-16, miR-423 and miR-374, among others, but the use of a single miRNA to normalize data may induce a systematic error [78]. [score:1]
For this reason, our data were normalized by the geometric mean of 6 miRNAs (RNU6B, RNU5G, miR-423-5p, miR191-5p, miR-16-5p and let-7a). [score:1]
Data were normalized by the geometric mean of: RNU6B, RNU5G, miR-423-5p, miR191-5p, miR-16-5p and let-7a. [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 3
Next-generation Solexa sequencing results demonstrated that 19 serum miRNAs were markedly up-regulated in GC patients compared to the controls, and a profile of five serum miRNAs (miR-1, miR-20a, miR-27a, miR-34 and miR-423-5p) was identified as a biomarker for GC detection. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
Among miRNAs expressed in nTreg five times or more than in naïve CD4 [+] T-cells (as determined by miR-seq), Takahashi et al. identified: miR-10a-5p, miR-21-5p, miR-31-5p, miR-21-3p, miR-146a-5p, miR-423-3p and miR-23a-3p [33]. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
Simulated microgravity revealed altered expression of microRNA in human lymphoblastoid TK6 cells including miR-150, miR-34a, miR-423-5p, miR-22, miR-141, miR-618, and miR-222 [25]. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
[20] Simulated microgravity revealed altered expression of microRNA in human lymphoblastoid TK6 cells as well, including miR-150, miR-34a, miR-423-5p, miR-22, miR-141, miR-618, and miR-222, while beta-actin and GAPDH were assumed to be unchanged and therefore used for normalization. [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
In accordance with short duration of fever and lymphopenia, the expression levels of two circulating miRNAs (Bta-miR-423-5p and Bta-miR-151-3p) were different between BVDV challenged group and control group across time examined. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
Among these, only a few cellular miRNAs including miR-423, miR-301a, and miR-155 bound viral transcripts and reduced their expression. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
miR-411 - ND miR-423-5p + +miR-423-5p was involved in muscle development and growth and showed greatest in the neonate development stage [57]. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-197, hsa-mir-150
In previous studies, miRNAs abnormal expression was frequently reported in psoriasis [19], including miR-99a, miR-150, miR-423 and miR-197 [20]. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
The scatter-plots show RT-PCR quantification cycle (C [q]) values and log [2]-transformed microarray signal values for microRNAs let-7e, miR-22, miR-30a-5p, miR-185, miR-210, and miR-423-5p (n = 11). [score:1]
Six of the eight microRNAs, let-7e, miR-22, miR-30a-5p, miR-185, miR-210, and miR-423-5p, were detectable in more than half of the samples, and demonstrated significantly good Pearson correlation (|r| >0.6) between log [2]-transformed microarray signal and RT-PCR C [q] values, indicating validity of the microarray -based microRNA quantification (figure 1). [score:1]
0046045.g001 Figure 1The scatter-plots show RT-PCR quantification cycle (C [q]) values and log [2]-transformed microarray signal values for microRNAs let-7e, miR-22, miR-30a-5p, miR-185, miR-210, and miR-423-5p (n = 11). [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 3
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125b-2, hsa-mir-661, hsa-mir-3934
Individual analysis of four miRNAs (miR-125b-5p, miR-423-5p, miR-661 and miR-3934-5p), chosen alleatorily, performed by qRT-PCR in a subset of CRCs and corresponding PBTs (cases 2, 3, 5 and 6), showed no statistical difference of their expression levels among the pairs (P<0.05) (Fig 6). [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
Other miRNAs from this paper: hsa-mir-21, hsa-mir-208a, hsa-mir-27b
Among the number of miRNAs identified to be differentially regulated, the miRNAs significantly changed were miR21, miR208a, miR423 and miR27b that have been shown to regulate endothelial and myogenic differentiation. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
It has also been reported that the over -expression of miR-1, miR-20a, miR-27a, miR-34a and miR-423-5p can be used as diagnostic criteria of gastric cancer [14]. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 2
While some miRNAs were significant in many scenarios (including hsa-miR-106a (130 comparisons), hsa-miR-361-5p (130 comparisons), hsa-miR-17 (125 comparisons), hsa-miR-423-5p (125 comparisons), hsa-miR-320d (122 comparisons), and hsa-miR-20a (120 comparisons)), others were significantly dysregulated in just a few comparisons (including hsa-miR-506 (3 comparisons), hsa-miR-202* (5 comparisons), hsa-miR-361-3p (6 comparisons), hsa-miR-429 (7 comparisons), hsa-miR-548a-3p (9 comparisons), or hsa-miR-518e (9 comparisons)). [score:2]
[1 to 20 of 1 sentences]
77
[+] score: 2
MiR-423-5p causes transcriptional silencing of progesterone receptor (PR) by targeting a highly conserved region in the promoter [8]. [score:2]
[1 to 20 of 1 sentences]
78
[+] score: 2
007−3.33 (0.30)Let-7d0.001−7.09 (0.14)miR-30a0.006−3.67 (0.27)miR-26b0.013−4.26 (0.24)let-7i0.036−9.51 (0.17)miR-30b0.029−2.72 (0.37)miR-170.023−4.06 (0.25)miR-106b0.04−7.22 (0.14)miR-423–3p0.04−6.15 (0.16)miR-15b0.037−7.94 (0.13)let-7g0.005−7.23 (0. 14)let-7i0.027−5.91 (0.17)miR-302a0.019−4.06 (0.25)miR-28–5p0.011−12.99 (0.08)miR-106b0.034−9.15 (0.11)miR-30c0.014−3.46 (0.29)miR-374a0.044−9.93 (0.10)miR-170.04−2.84 (0.35)miR-90.007−4.13 (0.24)miR-1000.007−10.4 (0.10)miR-15b0.034−10.18 (0.10)miR-196b0.032−3. [score:1]
05 (0.33)miR-1030.02−6.27 (0.16)miR-302a0.017−3.30 (0.30)miR-125a-5p0.003−6.16 (0.16)miR-1280.012−15.4 (0.06)miR-29c0.021−6.95 (0.14)miR-1950.002−4.26 (0.24)miR-1500.031−9.29 (0.11)miR-1860.016−4.51 (0.22)miR-423–3p0.027−11.23(0.09)miR-7c0.024−5.52 (0.18)miR-210. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 2
hsa-miR-10a, hsa-miR-128, hsa-miR-1307, hsa-miR-140-3p, hsa-miR-185, hsa-miR-196a, hsa-miR-25, hsa-miR-320a, hsa-miR-330-3p, hsa-miR-340, hsa-miR-423-5p, hsa-miR-629 and hsa-miR-744 significantly associated with the mitochondria of HEK293. [score:1]
The most abundant miRNAs associated with mitochondria of HEK293 and HeLa were hsa-miR-423-5p, hsa-miR-320a and let-7 family members (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7h and let-7i) followed by hsa-miR-103b, hsa-miR-140-3p, hsa-miR-744, hsa-miR-107 (Figure 4C, Figure 4D, Table S3). [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 2
MiRNAs like miR-503-5p (MIMAT0002874) and miR-423-3p (MIMAT0001340) were stable contributors to prediction accuracy in both mid- and late pregnancy, whereas miR-337-3p (MIMAT0000754) contributed to prediction accuracy in late pregnancy. [score:1]
However, miRNAs, including hsa-miR-503-5p (MIMAT0002874) and hsa-miR-423-3p (MIMAT0001340) which were predictors at mid-pregnancy as well as in late pregnancy, constituted 7 out of the top 10 predictors of class membership. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 2
In general, the rank order of the expression levels of the measured miRNAs was comparable in mice and rats, with the highest miRNA levels of miR-16-5p and miR-223-3p and the lowest levels of miR-199a-3p, miR-652-3p, miR-423-3p and miR-26b-5p (S1– S3 Figs). [score:1]
In rats we found one significant correlation between the normalized -Ct values of miR-423-3p and the dP/dt [max] values (R = -0.53, P-value = 0.036). [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 2
Based on the total number of sequencing reads the miRNAs miR-486-5p, miR-92a-3p, miR-22-3p, miR-451a, miR-423-5p, miR-16-5p, miR-142-5p, miR-191-5p, miR-10b-5p and miR-25-3p were the most abundant miRNAs in the serum of HC subjects. [score:1]
By contrast, miR-22-3p, miR-423-5p and miR-10b-5p have not been found in red blood cells. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
Other miRNAs have also been reported as potential biomarkers for HBV-infected patients: miR-375, miR-10a, miR-223, and miR-423 distinguished HBV-infected patients from HC, and the combination of miR-920 and miR-423 was able to differentiate between HBV- and hepatitis C virus (HCV)-infected individuals (190). [score:1]
[1 to 20 of 1 sentences]
85
[+] score: 1
A: Graph bar of the quantification of Hsa-miR-423-5p. [score:1]
[1 to 20 of 1 sentences]
86
[+] score: 1
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
[1 to 20 of 1 sentences]
87
[+] score: 1
MiR-423-3p and miR-423-5p were ranked number 3 and 4 and were as well not present in the human top 10. [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
Accordingly, let‐7a‐5p, miR‐103a‐3p and miR423‐3p were identified as the most stable sncRNAs in our panel of 75 HGS‐OvCa and 30 normal tissues, followed by miR‐191‐5p and SNORD48. [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
MiR-122 was the most abundant miRNA in the FBS, followed by miR-1246, miR-423-5p, miR-148a-3p, and let-7 family (Fig. 1f). [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
Li S miR-423-5p contributes to a malignant phenotype and temozolomide chemoresistance in glioblastomasNeuro. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
The tissue preferences of miRNAs determined using NGS are consistent with those identified using PCR with only one exception: hsa-miR-423-3p. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
In adult patients with dyspnea, circulating miR-423-5p has been identified as a potential biomarker that can distinguish patients with left-sided heart failure from those with other causes of dyspnea [19]. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
Four human miRNAs (miR-30e, miR-92, miR-92N, and miR-423) that were least variable among the 40 normal tissues in this study were identified, and the average quantity of these four in each tissue was used to normalize the RNA input. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
For the main study the data was normalized based on the geomean Cp of the reference miRNAs miR-30a, miR-103, miR-191, miR-320a and miR-423-5p, on a well-to-well basis. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
Li S miR-423-5p contributes to a malignant phenotype and temozolomide chemoresistance in glioblastomasNeuro-oncology. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
Considering the results from global analysis, it was decided to use the reference gene with less variation (miR-423-5p) among samples for normalization of validation data. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
First, those which correlate to a larger number of miRNAs of lower significance value, indicated by dark blue in the p<0.05 column, for example miR-122 (Accession Number 406906), miR-589 (Accession Number 693174), and miR-423-5p (Accession Number 494335). [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
Let-7b, miR-125b, miR-24, miR-23b, and let-7e represented the most abundant ones, while miR-210, miR-193b and miR-423 represented the less abundant ones. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Of note, let-7a, let-7g, let-7i, miR-126, miR-130a and miR-19b have been reported to be decreased and miR-423-3p increased in the elderly by more than one author apart from the present study, supporting their role in healthy aging (Table 3). [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Hsa-miR-423-5p was used for normalization. [score:1]
[1 to 20 of 1 sentences]