sort by

129 publications mentioning hsa-mir-449a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-449a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 405
Other miRNAs from this paper: hsa-mir-31, hsa-mir-34a, hsa-mir-182, hsa-mir-143
miR-449a overexpression in CRC cell line DLD1 cells does not inhibit pRb phosphorylation and E2F1 expression, despite a reduction in CDK6 and CDC25A protein expression, suggesting that other targets of miR-449a may contribute to its function [13]. [score:11]
To determine whether miR-449a mediates its growth-suppressive effects primarily by downregulating SATB2, we overexpressed SATB2 in tumor cells overexpressing miR-449a. [score:10]
In addition, we identified that SATB2 can bind to DNMT3A and upregulate its protein expression, thereby indirectly affecting tumor growth and miR-449a and miR-34a expression via DNA methylation. [score:9]
miR-449a induces cell cycle arrest at G1 phase by directly targeting CDK6 and CDC25A, which leads to the inhibition of pRb-E2F1 activity in prostate cancer cells and breast cancer cells [11– 14], and directly targets Bcl-2, HDAC1 and Sirt1 to promote cell death. [score:9]
These data indicate that miR-34a targets identical downstream genes including SATB2, Sirt1, HDAC1 and DNMT3a, which subsequently upregulate the expression of miR-449a and 34a. [score:8]
For instance, miR-449a has been reported to act as a tumor suppressor, and its expression is downregulated in several cancers including ovarian, lung, bladder, prostate and gastric cancers [8– 10]. [score:8]
Given to that miR-449a could repress SATB2 expression, we hypothesized that miR-449a regulated its host gene CDC20B indirectly by downregulating SATB2. [score:8]
miR-449a has been shown to suppress cell proliferation, reduce cell survival and/or inhibit migration and invasion by targeting various genes in many cancer types [8– 10, 39– 41]. [score:7]
In addition, miR-449a elevated the expression of the cell cycle inhibitory protein p27 and reduced the expression of cyclin D1 and Bcl-2 in CRC cells (Figure 2F and Supplementary Figure S1). [score:7]
Here, we report the existence of a negative feedback loop that maintains reduced levels of miR-449a and miR-34a and that directly promotes CRC cell growth and survival through upregulating a novel target: SATB2. [score:7]
We found that miR-449a can also be induced by AZA and TSA in CRC cells and further identified that that knockdown of miR-449a targets, namely, Sirt1, HDAC1, and particularly SATB2, upregulates miR-449a levels. [score:7]
Indeed, the tumor cell growth-repressing effects of miR-449a are in part facilitated via the downregulation of SATB2, indicating the existence of other targets that impact tumor growth and that are regulated by miR-449a. [score:7]
Meanwhile, we discovered that SATB2 knockdown could upregulate CDC20B expression, the host gene of miR-449a. [score:7]
miR-449a overexpression suppresses CRC cell growth and promotes apoptosis in vitro and in vivoTo address the physiological effect of miR-449a on CRC cell growth, we constructed HCT116 cells stably expressing miR-449a (Figure 2A). [score:7]
Thirdly, SATB2 overexpression partially rescued the growth suppression and apoptosis induced by miR-449a overexpression. [score:7]
We then tested whether miR-449a regulates the expression of DNA methyltransferase 3A (DNMT3A), histone deacetylase 1 (HDAC1), NAD+ -dependent protein deacetylase Sirt1 and SATB2, which are wi dely studied as epigenetic regulators, and some of which are miR-449a targets (Figure 5B and 5C) [11, 30– 32]. [score:7]
miR-449a expression was positively correlated with miR-34a expression in these patients, while miR-449a and miR-34a were negatively correlated with SATB2 expression (Figure 7D). [score:7]
Taken together, these results indicate that miR-449a is epigenetically repressed and activated by epigenetic drugs and its targets, forming a negative feedback loop to regulate its expression. [score:6]
However, the mechanism underlying the regulation of decreased miR-449a expression and tumor suppression in CRC remains largely unknown. [score:6]
In total, 2 × 10 [6] HCT116 cancer cells expressing pLVX-miR-449a (miR-449a overexpression) or pLVX-shSATB2 (SATB2 knockdown) were injected subcutaneously into the nude mice. [score:6]
SATB2 inhibited tumor growth indirectly via DNMT3A and miR-449a/34a expression. [score:6]
SATB2 knockdown or miR-449a overexpression inhibits CRC cell growth in vitro and in xenograft mouse mo del. [score:6]
Immunohistochemical analysis and western blotting showed that miR-449a overexpression dramatically inhibited SATB2 in xenografted tumors (Figure 3G). [score:5]
Figure 2Introduction of miR-449a suppresses CRC cell growth and promotes apoptosis in vitro and in vivo(A) The mRNA level of miR-449a in HCT116 cells stably expressing the negative control or miR-449a. [score:5]
Co-transfection with miR-449a mimics, but not the nonspecific control miRNA (NC), specifically decreased luciferase activity, whereas both point mutations (SATB2-3′UTR-1-MUT, SATB2-3′UTR-2-MUT) rescued the miR-449a -mediated repression of luciferase levels, indicating that miR-449a can directly target SATB2, particularly by site 1 (Figure 3B). [score:5]
Consistently, increased SATB2 expression was negatively correlated with reduced miR-449a or miR-34a expression in CRC. [score:5]
miR-449a has been reported to suppress tumor cell proliferation/growth and survival by targeting CDK6, CDC25A, Sirt1, HDAC1, cyclinD1, WISP2, and c-Met [11– 14]. [score:5]
miR-449a overexpression suppresses CRC cell growth and promotes apoptosis in vitro and in vivo. [score:5]
To investigate the clinical relevance of the expression of miR-449a, miR-34a and their target gene SATB2, we detected their expression levels by qPCR in 50 paired human colorectal normal and cancer tissues which included 10 stage I, 15 stage II, 10 stage III and 15 stage IV samples, respectively (Supplementary Table S2). [score:5]
Secondly, we found that miR-449a overexpression suppressed tumor growth and induced apoptosis in vitro and in vivo in CRC cells. [score:5]
miR-449a overexpression significantly suppressed cell growth and induced apoptosis in vitro (Figure 2B–2C). [score:5]
Kaplan-Meier analysis showed a significant impairment of overall survival with decreasing miR-449a/34a expression or increasing SATB2 expression (Figure 7E). [score:5]
To evaluate potential targets of miR-449a in CRC, we used online search tools (Target Scan, miRanda) to identify putative targets. [score:5]
miR-34a, a putative tumor suppressor miRNA that has been shown to repress tumor growth and metastasis, shares identical seed sequences and target genes with miR-449a, such as SATB2, Sirt1 and HDAC1 [33– 38]. [score:5]
Simultaneously, SATB2 knockdown induced the expression of CDC20B, which is probably regulated by miR-449a (Figure 5E–5F and Supplementary Figure S4B). [score:5]
miR-449a has been reported to induce apoptosis potently and upregulate p53 activity, followed by miR-34a induction [31]. [score:4]
These findings provide new clues for the downregulation of miR-449a and miR-34a in CRC. [score:4]
Among these miRNAs, miR-449a was found to exhibit much lower expression, even compared with miR-143/145, two putative tumor suppressive microRNAs (Figure 1A) [23, 24]. [score:4]
Therefore, we hypothesized that the downregulation of miR-449a might be attributable to the aberrant epigenetic events that occur in CRC. [score:4]
In this study, we report that miR-449a directly targets SATB2. [score:4]
Taken together, our data indicate that this miR-449a-SATB2 -mediated feedback loop plays critical roles in human CRC development and that the components of this feedback loop may serve as potential targets for the diagnosis and treatment of human CRC. [score:4]
However, the regulation of miR-449a expression and its roles in CRC are largely unknown. [score:4]
Although miR-449a expression was reported to increase in 24 patients with CRC, our data revealed reduced expression of miR-449a and miR-34a in 50 CRC tissue samples compared with paired colorectal normal tissues [42]. [score:4]
miR-449a level is decreased, leading to increased SATB2, which subsequently downregulates miR-449a in human CRC. [score:4]
The above evidence indicates that the growth-repressing effects of miR-449a are in part facilitated by SATB2 downregulation (Figure 4E–4F). [score:4]
SATB2 is a direct target of miR-449a. [score:4]
SATB2-specific knockdown and miR-449a overexpression elicit similar phenotypes in vitro and in vivo. [score:4]
Firstly, we verified that SATB2 is a direct target gene of miR-449a. [score:4]
Indeed, miR-449a has been shown to be downregulated in several cancers, although the mechanism underlying its reduction remains largely unknown. [score:4]
Similar to miR-449a, miR-34a reduced the DNMT3a protein level possibly because miR-34a downregulated SATB2 (Figure 6B). [score:4]
We found that miR-449a increased miR-34a expression (Figure 6E). [score:3]
To test for direct targeting of SATB2, Sirt1, and HDAC1 by miR-449a and miR-34a, we separately cloned their 3′UTRs into psi-CHECK [TM]2 (Promega); the primer sequences are listed in Supplementary Table S1. [score:3]
Consistently, miR-449a overexpression in CRC cells led to reduced tumor volume and weight, fewer Ki67 -positive cells and more TUNEL -positive cells in tumors (Figure 2D–2F). [score:3]
miR-34a shares similar targets with miR-449a, and they can induce each other mutually. [score:3]
Thus, SATB2 functions as a critical mediator in both the negative feedback loop that maintains low levels of miR-449a and miR-34a and the suppression of tumor growth and survival. [score:3]
We noted that SATB2 overexpression partially rescued the effects of miR-449a on cell growth and apoptosis induced by TNF. [score:3]
We hypothesized that miR-449a could induce miR-34a expression. [score:3]
Taken together, these results suggest that decreased miR-449a expression may correlate with the progression of CRC. [score:3]
Figure 6(A) Schematic depiction of miR-34a and miR-449a and matching targets, namely, SATB2, HDAC1, and Sirt1. [score:3]
Here, we identify the suppressive effects of miR-449a on CRC cell growth and survival, which occur at least partially if not completely through SATB2. [score:3]
The 3′UTR of the SATB2 mRNA has 2 predictive target sites with high complementarity to miR-449a (Figure 3A). [score:3]
miR-449a expression is reduced in human CRC. [score:3]
We examined the expression of SATB2 mRNA and miR-449a/34a in 50 paired CRC and normal tissues. [score:3]
To address the physiological effect of miR-449a on CRC cell growth, we constructed HCT116 cells stably expressing miR-449a (Figure 2A). [score:3]
This miR-449a -mediated decrease in DNMT3A protein levels suggests that miR-449a indirectly regulates DNMT3A through SATB2 (Figure 5C). [score:3]
Our findings also reveal that miR-449a can serve as a promising novel target for the diagnosis and treatment of human CRC. [score:3]
Introduction of miR-449a suppresses CRC cell growth and promotes apoptosis in vitro and in vivo. [score:3]
miR-34a is a putative tumor suppressor miRNA and shares identical seed sequences with miR-449a. [score:3]
miR-449a overexpression was achieved using the pLVX-puro plasmid, which was also obtained from Clontech. [score:3]
We found that the two miRNAs respond to each other: miR-34a overexpression induces miR-449a and vice versa. [score:3]
We also detected that miR-34a induced miR-449a expression, which further supplemented the mo del raised by Lize (Figure 6F) [31]. [score:3]
We also determined the relevance of the expression of miR-449a/34a and SATB2 on the overall survival of patients with CRC. [score:3]
Thus, DNA methylation via DNMT3a, stabilized by SATB2, integrates with histone acetylation mediated by HDAC1 and Sirt1 to contribute to the decreased expression of miR-449a and miR-34a, forming a negative feedback loop. [score:3]
In accordance with their similarity, miR-34a shares the same targets as miR-449a, such as SATB2, HDAC1 and Sirt1. [score:3]
Thus, decreased miR-34a expression contributes to a miR-449a -mediated negative feedback loop to maintain low levels of miR-449a/34a and high levels of SATB2, Sirt1, HDAC1 and DNMT3a in colorectal cancer cells. [score:3]
In addition, the SATB2 mRNA level was elevated and the miR-449a mRNA level decreased in different CRC cell lines, revealing a negative correlation between miR-449a and SATB2 (Figure 3C, the expression of miR-449a has shown in Figure 1B). [score:3]
miR-449a is epigenetically repressed and activated by epigenetic drugs and SATB2 knockdown. [score:2]
miR-449a is activated by epigenetic drugs and SATB2 knockdown. [score:2]
A similar tendency that high levels of miR-449a and miR-34a are associated with prolonged overall survival in CRC was also demonstrated, indicating the importance of this negative feedback loop in CRC development. [score:2]
We found that miR-449a and miR-34a levels were decreased in cancer tissues compared with normal tissues, although their expressions were comparable among different stages of CRC according to the TNM grading score (Figure 7A and 7C). [score:2]
SATB2 knockdown increased miR-449a dramatically, whereas siSirt1, siHDAC1 or siDNMT3A exhibited only slight effects (Figure 5D). [score:2]
Furthermore, the identical seed sequences and the association between miR-449a and miR-34a ensure that the miR-449a/34a-SATB2 -mediated negative feedback loop plays a critical role in CRC development (see mo del in Figure 7F). [score:2]
Mutation of the SATB2 3′UTR binding site for miR-449a was accomplished with a KOD-Plus-Mutagenesis Kit according to the manufacturer's instructions (Toyobo, SMK-101). [score:2]
TUNEL assays of tumors derived from HCT116 cells stably expressing miR-449a or the negative control. [score:2]
Furthermore, reduced tumor volumes and weights, fewer Ki67 -positive cells and more TUNEL -positive cells were also observed in the xenografted tumors of SATB2-knockdown cells, suggesting that the growth arrest induced by miR-449a is similar with SATB2 (Figure 4C–4D). [score:2]
miR-449a expression is lower in CRC compared to other miRNAs. [score:2]
In summary, our results indicate the existence of a negative feedback loop that maintains low levels of miR-449a and miR-34a as well as high level of SATB2 to promote colorectal tumor development. [score:2]
Relevance of the miR-34a/miR-449a-SATB2 pathway in human CRC development and progression. [score:2]
Mutual regulation between miR-449a and miR-34a in CRC. [score:2]
SATB2-specific knockdown and miR-449a overexpression elicit similar phenotypes in vitro and in vivoTo investigate the roles of SATB2 in tumor cell growth and survival, we treated HCT116 cells with 2 different shRNAs specific for SATB2 (shSATB2-1, shSATB2-2). [score:2]
Correlations between miR-449a and miR-34a were analyzed using SPSS (Statistical Product and Service Solutions). [score:1]
We examined whether these molecules would influence miR-449a levels by transiently transfecting HCT116 cells with specific siRNAs against Sirt1, HDAC1, DNMT3A or SATB2. [score:1]
Figure 3(A) The predicted binding sites of miR-449a in the SATB2 3′UTR. [score:1]
In contrast, miR-34a was not induced by this treatment, although CDC20B, the host gene of miR-449a, was induced by combined AZA and TSA treatment. [score:1]
We also found that miR-449a mimics markedly decreased the protein level of SATB2 in a time- and dose -dependent manner (Figure 3D–3F). [score:1]
Figure 7(A) Assessment of the miR-449a, miR-34a, and SATB2 levels via real-time PCR analysis of total RNA from 50 paired normal and CRC colon tissues. [score:1]
Furthermore, reduced miR-449a level is attributable to DNA hypomethylation and histone hypoacetylation in human CRC. [score:1]
Figure 5(A) miR-449a and miR-34a mRNA levels after AZA and TSA treatment (left). [score:1]
Reduction of miR-449a during tumorigenesis is associated with survival. [score:1]
Indeed, the combination of AZA and TSA dramatically induced apoptosis and significantly increased miR-449a mRNA levels, whereas AZA or TSA treatment alone only slightly increased the miR-449a level (Figure 5A and Supplementary Figure S4A). [score:1]
Importantly, our clinical data indicated that low levels of miR-449a/34a and high level of SATB2 were significantly correlated with impaired overall survival in CRC patients. [score:1]
[1 to 20 of 101 sentences]
2
[+] score: 319
To establish a causal relationship between miR-449 deregulation and cancer-relevant parameters, such as cell cycle regulation, apoptosis and senescence, we over-expressed miR-449 in gastric cancer cell lines and observed a significant down-regulation of proliferation coupled with up-regulation of the acidic beta-gal senescence marker and induction of apoptosis. [score:11]
However, in agreement with previous findings for miR-34a, we find that miR-449 regulates the expression of p53 [31, 32] as over -expression of miR-449 resulted in a potent up-regulation of p53 subsequently resulting in activation of p21 and induction of apoptosis markers, such as cleaved CASP3 and PARP as previously reported [60]. [score:9]
Having demonstrated down-regulation of miR-449 expression in gastric cancers we wanted to examine the effect of re -expressing miR-449 in gastric cancer cell lines. [score:8]
qPCR analysis of miR-449 expression in Gastrin knock out gastric tissues compared to relative expression in wild type gastric tissues, miR-449 is significantly down-regulated (p = 0.04) in Gastrin knock out tissues compared to wild types. [score:8]
TB performed cell cycle and senescence studies, targets validation and direct targets detection studies, p53 activation studies and miR-449 expression studies, conducted data analyses, contributed in designing the study and in writing the manuscript. [score:8]
"ns" not significant p value > 0.05, "*" or "#" significant 0.01 < p value < 0.05, "**" or "##" very significant 0.01 < p value < 0.001, "***" or "###" extremely significant p value < 0.001 Hence, miR-449 directly targets cell cycle regulator genes consistent with a tumour suppressor function and with the cell cycle arrest observed upon miR-449 re-introduction into cancer cell lines. [score:7]
"ns" not significant p value > 0.05, "*" or "#" significant 0.01 < p value < 0.05, "**" or "##" very significant 0.01 < p value < 0.001, "***" or "###" extremely significant p value < 0.001 Hence, miR-449 directly targets cell cycle regulator genes consistent with a tumour suppressor function and with the cell cycle arrest observed upon miR-449 re-introduction into cancer cell lines. [score:7]
Hence, aside from the pro-oncogenic effects of up-regulation of MYC, MET, CCNE2 and other direct targets, loss of miR-449 may result in increased E2F1 activity. [score:7]
While miR-449 was clearly down-regulated or lost in the analyzed mouse tumour samples no clear tendency for loss or down-regulation of miR-34a was observed (data not shown). [score:7]
Vinculin (VCL) and tubulin beta (TUBB) were used as loading controls D - verification of direct and functional target binding using luciferase constructs holding wild type 3'UTRs and mutated 3'UTRs (two mutations in miR-449 binding site), * indicates statistical significance in luciferase expression between wild type 3'UTRs transfected with miR449a/b compared to RNA scrambled control, # indicates statistical difference in luciferase expression between wild type 3'UTRs compared to mutant 3'UTRs transfected with miR-449a and miR-449b. [score:7]
qPCR analysis (upper panel) showing down-regulation of miR-449 expression in 8 gastric cancer tissues compared to miR-449 expression in sample-matched controls (dotted line). [score:7]
Beside gastric cancer, the expression of miR-449 has also been found to be reduced in several cell lines [55] and in prostate cancer, where it was found to target HDAC1 and induce growth arrest following over -expression in prostate cancer cells [56]. [score:7]
A series of the putative miR-449 targets were subsequently validated at endogenous level using western blotting and quantitative PCR and their direct regulation by miR-449 was established using heterologous reporter constructs and binding site-specific mutation studies. [score:6]
Many of the direct mRNA targets for miR-449 identified in this study are also targets of miR-34a and miR-449 and miR-34a belong to the same family of miRNAs as they share the same seed sequence. [score:6]
Focusing on a set of putative target genes with well-established roles in tumourigenesis, we confirmed down-regulation by miR-449 of met proto oncogene (MET), cyclin dependent kinase 6 (CDK6), geminin (GMNN), myelocytomatosis viral oncogenes homolog (MYC), sirtuin 1 (SIRT1) and histone deacetylase 1 (HDAC1) at the transcript level (figure 3b). [score:6]
Analyses of the genomic DNA from the tumours found no evidence for loss or hyper-methylation of the miR-449 loci using methylation-specific melting curve analysis (MS-MCA) indicating transcriptional down-regulation of expression (data not shown). [score:6]
For a subset of target genes including MET, GMNN, CCNE2, SIRT1 and HDAC1, we confirmed direct interaction of miR-449 with the target gene 3' UTR using luciferase assay (figure 3d). [score:5]
To further confirm miR-449 deregulation during gastric cancer development, we examined its expression in wild type mouse antrum tissues infected with H. Pylori. [score:5]
During the search for miR-449 targets we also identified several growth factors (AREG, and KITLG) and growth factor receptors, such as MET, as targets. [score:5]
Interestingly no noticeable expression of the miR-449 family was detected across a panel of gastric cell lines including SNU638, SNU5, SNU216, SNU601 and MKN74 sustaining the notion of miR-449 having tumour-suppressive functions (data not shown). [score:5]
We also show that miR-449 over -expression activated p53 and its downstream target p21 as well as the apoptosis markers cleaved CASP3 and PARP. [score:5]
Hence, the cancer-specific loss or down-regulation of miR-449 in gastric cancer can likely be explained by the connection to key cell cycle regulators. [score:5]
miR-449 induces p53 expression but is not regulated by p53. [score:4]
We identify miR-449 as significantly down-regulated or lost in mouse mo dels of gastric cancer as well as in primary human gastric tumours. [score:4]
The present study represents the first report demonstrating cancer-related down-regulation of miR-449 in both mouse mo dels for gastric cancer and in primary human gastric tumours. [score:4]
Importantly, we found both miR-449a and b to be significantly down-regulated or absent in 8 out of 10 primary gastric cancers. [score:4]
Furthermore, the expression of miR-449a and b seem to be co-regulated (figure 5a). [score:4]
To characterize the transcripts controlled by miR-449 and to see if miR-449 regulates different transcripts than miR-34a, SNU638 cells expression profiles were examined 24 hours post transfection of miR-449b or miR-34a and differentially expressed transcripts identified. [score:4]
Importantly, analyses of primary gastric tumours from patients clearly documented a tumour-specific down-regulation of miR-449 also in humans. [score:4]
Click here for file Figure S1 - miR-449 is down-regulated in Gastrin knock out mice compared to wild type. [score:4]
Affymetrix top down-regulated genes upon miR-449 re-introduction into SNU638 cells. [score:4]
Growth rate of gastric cell lines over -expressing miR-449 was inhibited by 60% compared to controls. [score:4]
Western blot analyses confirmed the ability of miR-449 to down-regulate MET, GMNN, MYC, SIRT1, cyclin E2 (CCNE2) and HDAC1 at the protein level to an extent similar to that achieved by re-introduction of miR-34a (figure 3c). [score:4]
miR-449 is down-regulated in human gastric cancers. [score:4]
Figure S1 - miR-449 is down-regulated in Gastrin knock out mice compared to wild type. [score:4]
To unveil molecular links between the loss of miR-449 and cancer progression or initiation we experimentally identified a number of direct mRNA targets using transcriptional profiling and extensive bioinformatics analysis. [score:4]
FACS cell cycle analysis of miR-449 over -expressing cells showed a significant increase in the sub-G [1 ]fraction indicative of apoptosis. [score:3]
In the present study, transcriptional profiling demonstrated that over -expression of miR-449 or miR-34a results in identical transcriptome changes. [score:3]
In conclusion, we found no evidence that miR-449 is a transcriptional target of p53. [score:3]
Figure S5 - miR-449 expression is p53 independent. [score:3]
B - qPCR validation of Affymetrix arrays showing down-regulation of MET, CDK6, GMNN, MYC and HDAC1 upon miR-449 re-introduction compared to scrambled RNA controls. [score:3]
Affymetrix 133v2 arrays identified GMNN, MET, CCNE2, SIRT1 and CDK6 as miR-449 targets. [score:3]
Figure S2 - miR-449 inhibits cell proliferation in human gastric cancer cell line MKN74. [score:3]
miR-449 inhibits cell cycle progression and induces senescence. [score:3]
This suggests that deregulation of miR-449 not only leads to deregulated control of cell cycle proteins but also of growth factors and their receptors. [score:3]
Thus, re-introduction of miR-449 negatively affects proliferation of gastric cancer cell lines concomitant with the induction of senescence and apoptosis in concordance with miR-449 having tumour suppressive functions. [score:3]
Finally, we examined the relationship between the p53 tumour suppressor and miR-449. [score:3]
However, no significant change in miR-449 expression was detected after p53 pathway activation (Additional file 1, figure S5b). [score:3]
C - Western blot validation of down-regulated genes upon miR-449 re-introduction into SNU638 cells compared to scrambled RNA controls. [score:3]
This is highly interesting as it places miR-449 at a key node in a feed-back loop in which E2F1 activates the transcription of miR-449 that in turn targets CDC25A and CDK6. [score:3]
In contrast, the expression of miR-449 has been reported to be increased in endometrioid adenocarcinoma [57] and melanoma in young adult patients [58]. [score:3]
The expression of miR-449 was also increased in skeletal muscle damage and regeneration [59]. [score:3]
Figure 3 miR-449 targets cell cycle controller genes. [score:3]
In this study, we document a diminished expression of miR-449 in Gastrin KO mice and further confirmed its loss in human gastric tumours. [score:3]
miR-449 expression studies, conducted data analyses and contributed in writing the manuscript. [score:3]
Figure 2 miR-449 is part of the miR-34 family and inhibits cell proliferation. [score:3]
Hence, we speculate that miR-449 induces apoptosis by inhibiting the histone deacetylase HDAC1 and SIRT1 leading to the p53 pathway activation thus the induction of apoptosis markers cleaved CASP3 and PARP. [score:3]
In summary, we have found that miR-449 may act as a tumour suppressor and is lost in gastric cancer. [score:3]
A - Chart showing significant down-regulation (p < 1.2e-70) of mRNAs with predicted miR-449 seed match in their 3'UTR (red line) compared to mRNAs lacking the seed match (black line). [score:3]
A pathway activation analysis based on the differentially regulated transcripts demonstrates that miR-449 mainly controls transcripts coding for proteins involved in cell damage responses, cell cycle control, inflammation and cancer pathways (figure 3a). [score:2]
miR-449 regulates numerous cell cycle controllers. [score:2]
We investigated the function of miR-449 by identifying its direct targets. [score:2]
In agreement with other studies [55, 60], we did not observe a p53 -dependent regulation of miR-449 in gastric cancer cells as well as in primary human and mouse fibroblasts. [score:2]
Western blot analysis showing an increase of the p53 protein upon miR-449 and positive control miR-34a re-introduction into SNU638 cells compared to RNA scrambled control as well as an activation of the p53 downstream target p21 and apoptosis markers cleaved CASP3 and PARP. [score:2]
Importantly, qPCR analyses showed a loss of miR-449 expression in human clinical gastric tumours compared to normal tissues. [score:2]
A - Ingenuity Pathway Analysis (IPA) of deregulated genes upon miR-449 re-introduction into SNU638 cells showing enrichment for the gene categories cancer, cell death and cell cycle pathways among others. [score:2]
B - miR-449 re-introduction into human gastric cell lines (SNU638) inhibits cell proliferation (red line) compared to a scrambled control (blue line) and miR-146 control (black line). [score:2]
Thus, another important property of miR-449 could be as a regulator of signals important for growth and migration/invasion. [score:2]
ß-Gal assays indicated a senescent phenotype of gastric cell lines over -expressing miR-449. [score:2]
Error bars represent S. D. C - Visual inspection of cell proliferation inhibition and senescence-like phenotype upon miR-449 re-introduction into SNU638 cells (lower panel) compared to scrambled transfection control (upper panel). [score:2]
miRNA expression profile was assessed using Taqman miRNA assays (Applied biosystems) for hsa/mmu-miR-449a and b, hsa/mmu-miR-34a, b and c and rnu44 or hsa/mmu-miR-191. [score:2]
Figure 5 miR-449 is down regulated in human gastric cancers. [score:2]
Table S2 - list of genes deregulated upon miR-449 re-introduction. [score:2]
We did not find any correlation between the reduction in miR-449 expression and clinical characteristics of the cancer (figure 5b). [score:1]
On the other hand, we found that miR-449a/b is able to induce activation of p53, activation of p53 response genes such as p21 and the induction of apoptosis as evidenced by cleavage of caspase 3 (CASP3) and poly (ADP-ribose) polymerase 1 (PARP) (figure 4). [score:1]
The miR-449 family consists of miR-449a and b in humans and miR-449a, b and c in mice. [score:1]
This was furthermore spurred by the presence of a putative p53 binding site 10 kb upstream from human miR-449 (data not shown). [score:1]
miRNA precursors were purchased from Ambion, hsa-miR-449a (PM11521), hsa-miR-449b (PM11127) and hsa-miR-34a (PM11030). [score:1]
The 3'UTRs of HDAC1, SIRT1, MET, GMNN and CCNE2 holding miR-449 binding sites were cloned downstream of the luciferase reporter in pMIR-REPORT vector system (Ambion). [score:1]
A - miR-449 is part of the miR-34 family and is evolutionarily conserved. [score:1]
Towards understanding the mechanism by which miR-449 does this we examined the effect of miR-449 on SIRT1 and HDAC1. [score:1]
Interestingly, miR-449 was recently shown to operate under the control of E2F1 [55, 60]. [score:1]
B - qPCR analyses of miR-449a and miR-449b post p53 induction. [score:1]
As miR-34a was previously found to function downstream of p53 [30- 33], we analyzed if also miR-449a/b were linked to p53. [score:1]
As miR-34a has been firmly placed downstream from p53 [30- 33] it was relevant to test if the same was the case for miR-449. [score:1]
Figure 4 miR-449 activates the p53 pathway. [score:1]
Hence, this study further underlines the importance of miRNAs in cancer and points to an important function for miR-449 in gastric cancer. [score:1]
Furthermore we show that miR-449 induces senescence and apoptosis by activating the p53 pathway. [score:1]
To evaluate the importance of miR-449 in human malignancies we next examined the expression of miR-449 in 10 gastric cancer biopsies. [score:1]
To assess the function of miR-449 in gastric cell lines we re-introduced miR-449b in SNU638 and MKN74 cells. [score:1]
To rule out cell line-specific effects, the functional consequences of miR-449 re-introduction in terms of cell cycle arrest were verified in MKN74 cells (Additional file 1, figure S3). [score:1]
We also found that re-introduction of miR-449 induces senescence and apoptosis. [score:1]
[1 to 20 of 92 sentences]
3
[+] score: 285
Considering that HDAC1 is a direct target of miR-449a, we speculate that TSA might induce miR-449a expression to exert its inhibitory effect on HDAC1 expression, thereby enhancing HBV replication and gene expression in an FXRα -dependent manner. [score:12]
Moreover, analysis of the cellular gene expression profile revealed that miR-449a overexpression results in the downregulation of a set of cell cycle-related genes and the upregulation of multiple genes related to a highly differentiated hepatocyte phenotype. [score:11]
In the present study, we found that miR-449a expression in HCC cell lines was low and could be regulated by HDAC inhibitor, consistent with the previous reports that miR-449 expression was suppressed in liver cancerous tissue 43, likely due to the epigenetic silencing of miR-449a by HDAC1-3 18. [score:10]
Therefore, modification of the HCC cell phenotype via miR-449a overexpression could also contribute to the upregulation of HBV replication and gene expression. [score:8]
Taken together, miR-449a enhances HBV replication and gene expression at least partly by upregulating FXRα expression. [score:8]
Upregulation of HBV replication and miR-449a expression by the HDAC inhibitor TSA in HCC cells. [score:8]
The results showed that the downregulation of predicted target gene set of miR-449a family and cell cycle-related gene set was enriched in miR-449a transfected HepG2.2.15 cells, while a cluster of liver-specific genes with enhanced expression was also found (Suppl. [score:8]
Furthermore, CREB5 was found to be directly targeted by miR-449a, and CREB5 knockdown increased FXRα expression. [score:7]
Fig. 2A,B), and we find that miR-449a expression is induced by TSA treatment and that its overexpression enhances HBV replication, transcription and gene expression. [score:7]
Using miRNA target prediction softwares (TargetScan, MiRanda, DIANAmT, miRWalk, and Pictar5), CREB5 was identified as a potential target of miR-449a, with two evolutionarily conserved complementary seed sequences (nt 3259–3265, nt 3317–3323) in the 3′UTR of its mRNA (Suppl. [score:7]
Interestingly, both HDAC inhibition and miR-449 overexpression in HCC cells led to reduced c-MET expression, increased apoptosis, and decreased proliferation. [score:7]
Upregulation of HBV replication, transcription, and gene expression by miR-449a. [score:6]
Regulation of HBV replication and miR-449a expression by the HDAC inhibitor TSA. [score:6]
A direct interaction between a miRNA and its target mRNA requires the presence of a complementary seed sequence in the target miRNA 7. However, bioinformatics analysis using the HBV genomic sequences available in GenBank did not identify a sequence complementary to the miR-449a seed sequence (CACUGCC) (data not shown). [score:6]
We also observed that miR-449a transfection consistently up-regulates HBeAg expression and capsid formation in a HBV cccDNA mo del cell line, HepDES19 32, leading to the enhancement of HBV transcription and replication from the cccDNA template (Suppl. [score:6]
Taken together, miR-449a targets multiple genes to inhibit cell growth and promote the differentiation of hepatoma cells, which is generally beneficial for HBV replication. [score:5]
Further, the baseline expression of miR-449a in the HepG2.215 cells and its parent cell line HepG2 were similar, and these cells including huh7, expressed less miR-449a than in primary human hepatocytes (PHH) and HL-7702 (Fig. 1D), suggesting that miR-449a may be epigenetically silenced during the malignant transformation of hepatocytes. [score:5]
MiR-449a transactivates the HBV core promoter by upregulating FXRα expression. [score:5]
CREB5 is a negative regulator of HBV replication and a direct target of miR-449a. [score:5]
These findings show that CREB5 is a direct target of miR-449a and negatively regulates HBV replication. [score:5]
of whole-cell extracts showed that expression of the previously reported targets E2F1, CDK6, and HDAC1 was reduced by miR-449a in a dose -dependent manner (Fig. 5D); sequential de-phosphorylation of Rb and ERK during cell cycle arrest was also mediated by miR-449a transfection (Fig. 5D). [score:5]
The relative luciferase expression was expressed as the ratio of miR-449a- to miR-con -transfected samples. [score:5]
demonstrated that CREB5 expression was reduced by CREB5 siRNA and miR-449a transfection, whereas FXRα expression was increased after transfection (Fig. 4B). [score:5]
According to our results, the regulatory effect of miR-449a on HBV replication might be dependent on CREB5 regulation and FXRα expression. [score:5]
Due to the relatively lower expression of miR-449a in Huh7 cells, transfected with the miR-449a inhibitor anti-miR-449a did not affect baseline HBV replication significantly, but it could partially block the enhancing effect of TSA on HBV replication (Fig. 2D). [score:5]
The upregulation of FXRα by miR-449a was further verified by real-time RT-PCR and western blot analysis (Fig. 3B). [score:4]
By dissecting the relationship between histone deacetylation and miR-449a regulation, we identified CREB5 as a target gene of miR-449a in HCC cells. [score:4]
To determine whether CREB5 is directly targeted by miR-449a, four luciferase reporter plasmids were constructed bearing the wildtype and three mutant versions of the CREB5 3′UTR. [score:4]
Moreover, the upregulation of HBV replication by miR-449a was detectable beginning on day 2 after transfection, increased with time, and was maintained at least up to day 14 (Fig. 2C). [score:4]
MiR-449a inhibits cell proliferation and arrests the cell cycle by targeting multiple genes. [score:4]
We next addressed whether miR-449a -targeted genes are involved in regulating HBV replication. [score:4]
CREB5 is directly targeted by miR-449a and is involved in the control of HBV replication. [score:4]
FXRα upregulation mediates the increased HBV core promoter activity and enhanced HBV replication caused by miR-449a. [score:4]
Interestingly, we found that miR-34a, which shares the same seed sequence as miR-449a, had an enhancing effect on HBV replication and transcription (Fig. 7A), with the concomitant upregulation of HBsAg and HBeAg (Suppl. [score:4]
To further understand the mechanism involved in HBV upregulation, we utilized GSEA analysis of expression profiles to investigate the biological effect of miR-449a. [score:4]
Considering that the miR-449a -targeted HDAC1 and ERK pathways are involved in regulating HBV replication, we tested the effect of miR-449a on HBV. [score:4]
How to cite this article: Zhang, X. et al. Epigenetically regulated miR-449a enhances hepatitis B virus replication by targeting cAMP-responsive element binding protein 5 and modulating hepatocytes phenotype. [score:4]
Similar to cell lines from testicular cancer 27, we also observed an approximately 4–30-fold induction of miR-449a expression in TSA -treated HepG2.2.15 and Huh7 cells, as well as in HL-7702 cells, respectively (Fig. 1C). [score:3]
Additionally, neutralizing endogenous miR-449a by anti-miR-449a in HL-7702 cells was able to reduce HBV replication and HBsAg expression (Suppl. [score:3]
Thus, to elucidate the molecular mechanisms of the effect of miR-449a on HBV replication, the global gene expression profile of HepG2.2.15 cells after miR-449a transfection was determined by microarray analysis. [score:3]
However, the enhancement of HBV replication by miR-449 was partially blocked by the natural FXRα antagonist guggulsterone (GGS) or a validated siRNA targeting FXRα (Fig. 3D). [score:3]
Dose -dependent enhancement of HBV replication, transcription and gene expression by miR-449a. [score:3]
A cell cycle distribution analysis showed that miR-449a led to cell cycle arrest at the G1 phase and increased the cell population in this phase, even after the inhibitors were removed (Fig. 5C). [score:3]
Interestingly, miR-449a transfection also resulted in an increase in FXRα promoter activity and mRNA and protein expression. [score:3]
Consistently, co-transfection with miR-449a and pSM2 in Huh7 cells resulted in enhanced HBV replication and HBsAg and HBeAg expression (Suppl. [score:3]
Furthermore, FXRα promoter activity was found to be enhanced after miR-449a transfection (Fig. 3C); both FXRα promoter activity and expression were also induced by TSA treatment in HCC cells (Suppl. [score:3]
Eight miRNA mimics in addition to miR-1 and miR-449a were selected according to a previous report 30 about altered expression levels in HCC tissues and transfected into HepG2.215 cells. [score:3]
miR-449a inhibits cell cycle transition and proliferation in hepatoma cells and promotes differentiation. [score:3]
A heatmap showed that similar to miR-1, miR-449a transfection increased farnesoid X receptor α (FXRα) expression (Suppl. [score:3]
HepG2.2.15 cells were transfected with a miR-449a mimic at concentrations ranging from 5 to 40 nM, and HBV replication and gene expression were analyzed after 4 days. [score:3]
The effects of aphidicolin and nocodazole, two cell cycle inhibitors that synchronize cells at the G1 and G2/M phase, respectively, were then examined in miR-449a transfected HepG2.2.15 cells. [score:3]
Moreover, the dual function of miR-449a on HBV replication and cell proliferation could partially explain the lower levels of HBV replication and gene expression in the cancerous tissue than adjacent normal liver tissue 44 45. [score:3]
miR-449a promotes liver-specific gene expression in HepG2.2.15 cells. [score:3]
identified 14 genes with expression levels that decreased by more than 2-fold after miR-449a transfection (Suppl. [score:3]
In the current study, we identified and explored the role of miR-449a in the regulation of HBV replication. [score:2]
Compared with control miRNA, miR-449a increased HBV replicative intermediates and HBV 3.5-kb RNA transcripts, intracellular HBcAg expression, and HBV capsid formation (Fig. 2A), as well as the number of HBV progeny and HBsAg and HBeAg concentrations in culture supernatants (Fig. 2B) in a dose -dependent manner. [score:2]
Co-transfection with miR-449a reduced the luciferase activity of the wildtype CREB5 3′UTR reporter, whereas the 3′UTR mutant construct containing two mutation sites was fully protected from miR-449a -mediated repression (Fig. 4C). [score:2]
The expression of miR-449a and different cellular genes was determined by quantification of specific targets using commercial Quantitect Primer Assays (Qiagen, primer sequences not available). [score:2]
Consistently, miR-449a increased transcription of the HBV core promoter to approximately 1.8-fold but had no significant effect on HBV SP1, SP2, and X promoter activity (Fig. 3A). [score:1]
Concerning the similar mechanisms of miR-1 and miR-449a in HBV replication, epi-miRNAs might have a general effect on HBV infection. [score:1]
Based on the above findings, a question was raised with regard to whether other HCC-related epi-miRNAs exert an effect on HBV replication that is similar to miR-449a. [score:1]
Total RNA was isolated from HepG2.2.15 cells transfected with miR-449a and miR-con and subjected to microarray analysis using Affymetrix Human Genome U133A Plus 2.0 Array according to the manufacturer’s instructions. [score:1]
Thus, there is a possibility that miR-449a enhances HBV replication through a blockade of the MAPK-ERK pathway. [score:1]
Consistently, cell growth (Fig. 5A) and DNA synthesis (Fig. 5B) of HepG2.2.15 cells were decreased by miR-449a transfection. [score:1]
In addition, the mRNA levels of six representative genes for hepatocyte differentiation, albumin (ALB), apolipoprotein A1 (APOA-I), fibrogen β (FGB), GM2 ganglioside activator (GM2A), phosphoenolpyruvate carboxykinase 2 (PCK2), and sulfotransferase 2A (Sult2A1), were increased significantly at day 4 after miR-449a transfection (Fig. 6A). [score:1]
HepG2.2.15 cells were transfected with 20 nM miR-449a. [score:1]
Our results demonstrated that epi-miRNA miR-449a acts as a novel linker between histone deacetylation and HBV replication, creating a favorable environment for HBV replication in hepatocytes. [score:1]
Moreover, miR-449a arrested the cell cycle at G1 phase and induced HCC differentiation. [score:1]
ERK 1/2, two downstream effectors of c-MET, consistently display reduced phosphorylation and activation 18, and we also confirmed that miR-449a is able to reduce ERK1/2 phosphorylation. [score:1]
[1 to 20 of 69 sentences]
4
[+] score: 274
NOTCH1 Expression is Upregulated in HCVTo determine whether downregulation of miRNA-449a in HCV infection is accompanied by upregulation of its target NOTCH1, biopsies were obtained from 10 chronic HCV patients, 10 alcoholic hepatitis patients, 10 NASH patients and 10 control normal donor livers at the time of liver transplant. [score:14]
miRNA-449a Regulates YKL40 Expression by Modulating NOTCH1 ExpressionGenomewide microarray analysis in our laboratory followed by miRNA gene expression analysis showed that miRNA-449a is downregulated more than two fold in HCV patients compared to non-HCV liver diseases and normals (Figure 1A). [score:12]
Since, computational target analysis did not identify YKL40 to be a direct target for miRNA-449a; results obtained from promoter based reporter analysis suggest that miRNA-449a regulates the expression of YKL40 by silencing components of upstream transcriptional regulatory complexes such as NOTCH1/NFKB. [score:10]
It is likely that downregulation of miRNA-449a in HCV infected patients (Figure 1A) results in activation of NOTCH1/NFKB signaling that leads to upregulation of YKL40 expression. [score:9]
To determine whether downregulation of miRNA-449a in HCV infection is accompanied by upregulation of its target NOTCH1, biopsies were obtained from 10 chronic HCV patients, 10 alcoholic hepatitis patients, 10 NASH patients and 10 control normal donor livers at the time of liver transplant. [score:9]
Thus, results obtained from patient samples and our in vitro analysis using hepatocytes indicate that upregulation of NOTCH1 resulting from downregulation of miRNA-449a stabilizes nuclear P65 to activate YKL40 expression in patients with HCV mediated hepatic fibrosis (Figure 1). [score:9]
Expression analysis demonstrated that miRNA-449a is downregulated more than two fold in livers obtained from HCV patients whereas no significant differences in the expression was observed in alcoholic hepatitis patients, NASH patients and normal livers (Figure 1A). [score:8]
miRNA-449a is downregulated in HCV patients and YKL40 is upregulated in patients with hepatic fibrosis. [score:7]
In consistence with our in vitro results, in the same HCV patients downregulation of miRNA-449a was accompanied by significant upregulation of NOTCH1 (Figure 7). [score:7]
Genomewide microarray analysis in our laboratory followed by miRNA gene expression analysis showed that miRNA-449a is downregulated more than two fold in HCV patients compared to non-HCV liver diseases and normals (Figure 1A). [score:7]
Computational target prediction of miRNA-449a using Targetscan (Targetscan. [score:7]
Western blot analysis using anti-YKL40 showed downregulation of YKL40 by expression of miRNA-449a or siRNA mediated knockdown of NOTCH1 or P65 in hepatocytes (Figure 6C, lower panels). [score:7]
Based on our in-vitro results obtained with hepatocytes, upregulation of NOTCH1 and YKL40 (Figure 1) in HCV patients can be attributed to downregulation of miRNA-449a. [score:7]
HCV infection results in downregulation of miRNA-449a that leads to upregulation of NOTCH1 eventually results in nuclear stabilization of P65. [score:7]
qPCR analysis also showed downregulation of YKL40 by increased expression of miRNA-449a (Figure S3). [score:6]
miRNA-449a Regulates YKL40 Expression by Modulating NOTCH1 Expression. [score:6]
To test whether miRNA-449a regulates YKL40 expression, hepatocytes were transfected with either a control vector or vector expressing miRNA-449a along with an YKL40 promoter -driven luciferase reporter construct. [score:6]
To demonstrate that downregulation of YKL40 expression by miRNA-449a is mediated by silencing NOTCH1, hepatocytes were transfected with either scrambled siRNA or siRNA specific for NOTCH1 along with an YKL40 -driven luciferase reporter construct and cells were treated with TNFα. [score:6]
In HCV infected patients expression of miRNA-449a was significantly downregulated (Figure 1A). [score:6]
Increased expression of miRNA-449a resulted in more than two fold downregulation of NOTCH1 (Figure 6A and B). [score:6]
Immunoblot analysis using anti-NOTCH1 demonstrated that expression of miRNA-449a resulted in downregulation of NOTCH1. [score:6]
In our current study using promoter analyses techniques we provide direct evidence for the role of miRNA-449a, which is down regulated in HCV infection (Figure 1), in the upregulation pro-inflammatory YKL40 fibrotic cascade. [score:6]
Hepatocytes were transfected with an empty vector (-) or vector expressing miRNA-449a (+) and expression of YKL40 was determined by Q-PCR. [score:5]
We have shown for the first time in human hepatocytes that miRNA-449a targets NOTCH1 for translational silencing. [score:5]
A & B. Hepatocytes were transfected with an empty vector (−) or vector expressing miRNA-449a (+) and expression of NOTCH1 (6A) and miRNA-449a (6B) were determined by Q-PCR. [score:5]
miRNA-449a is Downregulated in HCV A genomewide miRNA analysis in liver biopsies obtained from chronic HCV infected patients demonstrated a distinct expression profile when compared to the normal liver. [score:5]
To test this, hepatocytes were transfected with either empty vector of vector expressing miRNA-449a and expression of both miRNA-449a and NOTCH1 were determined by qPCR. [score:5]
Thus, HCV induced down regulation of miRNA-449a in human livers can upregulate transcriptional factors leading to increased inflammatory response; promoting cell proliferation that can result in HCC. [score:5]
Particularly, a significant downregulation of microRNA-449a was observed in the HCV infected livers. [score:4]
miRNA-449a is Downregulated in HCV Patients. [score:4]
Figure S3 miRNA-449a regulates YKL40 expression. [score:4]
miRNA-449a has been implicated transcriptional dysregulation affecting cell proliferation in several human diseases including cancers [45], [46]. [score:4]
We have also demonstrated by in vitro analysis that miRNA-449a regulates TNFα mediated induction of YKL40 by targeting components of the NOTCH signaling pathway (NOTCH1) (Figure 6). [score:4]
However, in presence of miRNA-449a this TNFα mediated upregulation of YKL40 was impaired. [score:4]
This suggests that miRNA-449a regulates expression of YKL40 by modulating the NOTCH1 signaling pathway. [score:4]
qPCR analysis also confirmed downregulation of YKL40 by miRNA-449a (Figure S3). [score:4]
To further determine if TNFα mediated activation of YKL40 is regulated by miRNA-449a, hepatocytes were transfected with either a control vector or vector expressing miRNA-449a along with an YKL40 -driven luciferase reporter construct (−3000 bp) and cells were treated with or without TNFα. [score:4]
Total RNA was isolated from the liver biopsies and expression level of miRNA-449a was determined by qPCR using specific primers and the results were normalized to GAPDH expression. [score:4]
For miRNA regulation studies the reporter construct was transfected in combination with 1 µg of either control vector or vector expressing miRNA-449 precursor. [score:4]
The ΔΔCt value was calculated by normalizing the threshold (CT) values with GAPDH expression and miRNA-449a (1A) or YKL40 (1B) expression respectively in controls. [score:3]
0050826.g008 Figure 8Schematic representation of HCV mediated role of miRNA-449a in YKL40 expression. [score:3]
This suggests that miRNA-449a is specifically downreguated in patients with liver diseases following HCV infection. [score:3]
In TNFα treated cells expression of YKL40 is reduced by more than two fold in the presence of miRNA-449a (Figure 6C, upper panel). [score:3]
Schematic representation of HCV mediated role of miRNA-449a in YKL40 expression. [score:3]
C. (Upper panel) hepatocytes were transfected with a luciferase construct driven by the YKL40 promoter in addition to the control vector or vector expressing miRNA-449a or non-specific siRNA or siRNA specific for NOTCH1 or siRNA specific for P65 in the presence of TNFα. [score:3]
D. Hepatocytes were transfected with a luciferase construct driven by the YKL40 promoter in addition to the control vector or vector expressing miRNA-449a construct with (+) or without (−) TNFα. [score:3]
Expression of miRNA-449a (1A) and YKL40 (1B) were determined by Q-PCR. [score:3]
Further, we have shown that miRNA-449a regulates HCV induced inflammatory responses (YKL40) implicated in allograft liver fibrosis. [score:2]
Expression level of miRNA-449a was determined using the TaqMan® MicroRNA assays and TaqMan® Universal Master Mix II (Life technologies, NY) using predesigned primers. [score:1]
To analyze the specific role of miRNA-449a following HCV infection, biopsies were obtained from 10 chronic HCV patients, 10 alcoholic hepatitis patients, 10 non-alcoholic Steatohepatitis (NASH) patients and 10 control normal donor livers at the time of liver transplant. [score:1]
In this study we identified a novel miRNA (miRNA-449a) that is modulated in HCV infection. [score:1]
The ΔΔCT value was calculated by normalizing the threshold (CT) values with GAPDH and expression of NOTCH1 and miRNA-449a respectively in controls. [score:1]
In vitro studies have also shown that miRNA-449a can arrest cell proliferation and induce apoptosis [46], [47]. [score:1]
Hsa-miRNA-449a (SC400399) and control constructs were purchased from Origene, MD. [score:1]
[1 to 20 of 54 sentences]
5
[+] score: 235
Other miRNAs from this paper: hsa-mir-34a
In addition, miR-449a may also directly target and suppress the expression of antiapoptotic genes. [score:8]
It has been shown that miR-449a is depleted in human prostate tumor tissue relative to patient-matched controls and possesses tumor suppressor-like function, in part, through targeting HDAC1 and activating p27 expression [16]. [score:7]
In support, we define Cyclin D1 as another direct target suppressed by miR-449a in prostate cancer cells. [score:6]
To confirm Cyclin D1 is a direct target of miR-449a, we cloned the putative target sequence into the 3'UTR of a luciferase reporter vector (CCND1-WT). [score:6]
Because Rb is required, in part, for the tumor suppressor-like function of miR-449a in prostate cancer cells, miR-449a likely targets genes responsible for regulating Rb activity. [score:6]
It has previously been shown that miR-449a activates p27 expression by targeted knockdown of HDAC1 in prostate cancer cells [16]. [score:6]
It has also been reported that miR-449a directly targets and represses the expression of CDK6 and CDC25A; two more key factors involved in promoting Rb phosphorylation [29]. [score:6]
Our data supports the tumor suppressor-like function of miR-449a by highlighting its relationship with Rb and describing its inhibitory effects on cell growth. [score:5]
Co-treatment of histone methylation and HDAC inhibitors has been shown to re-activate miR-449a expression in breast cancer cells [29]. [score:5]
This data indicates that miR-449a regulates Rb phosphorylation, in part, through targeted knockdown of Cyclin D1. [score:5]
We show that miR-449a can regulate Rb phosphorylation by directly targeting Cyclin D1 and HDAC1. [score:5]
Because E2F family members function as downstream mediators of Rb, miR-449a functions in an auto-regulatory loop to control Rb activity by targeting multiple upstream regulatory factors (i. e. Cyclin D1, HDAC1, CDK6, and CDC25B). [score:5]
MicroRNA-449a is depleted in human prostate tumors and functions as a potential tumor suppressor miRNA by inhibiting proliferation and promoting apoptosis [16]. [score:5]
Mutant Rb renders DU-145 cells generally resistant to the growth inhibitory effects of miR-449a, while DU-145 sublines expressing wild-type Rb retain sensitivity to miR-449a. [score:5]
Taken together, this data indicates that the Cyclin D1 transcript is a direct target of miR-449a. [score:4]
Direct downstream targets of miR-449a are shown in red, while miR-449a is colored blue. [score:4]
We further indicate that miR-449a suppresses Rb phosphorylation through specific knockdown of both Cyclin D1 and HDAC1. [score:4]
The dependency on Rb is likely facilitated through miR-449a targeting genes involved in regulating Rb activity. [score:4]
miR-449a regulates Rb phosphorylation by targeting Cyclin D1 and HDAC1. [score:4]
Figure 7: Direct downstream targets of miR-449a are shown in red, while miR-449a is colored blue. [score:4]
To determine if wild-type Rb can sensitize DU-145 cells to miR-449a, we obtained two DU-145 sublines that stably overexpress wild-type Rb from either a plasmid vector (DU-1.1) or retroviral construct (B5). [score:3]
This highlights an evolutionary significance for the target site and corroborates the functional interaction between the Cyclin D1 transcript and miR-449a. [score:3]
We transfected PC-3 cells with miR-449a or a specific siRNA designed to target only Cyclin D1 (siCCND1). [score:3]
Indicated is complementary base-pairing, including G:U wobbles, between the mature miR-449a guide sequence and the Cyclin D1 target site. [score:3]
Constructs were co -transfected with a β-galactosidase expression vector and treated with miR-449a for 24 hrs. [score:3]
Figure 5: A. The 3'UTR of the Cyclin D1 transcript contains a putative miR-449a target site. [score:3]
We propose that the loss of miR-449a expression can promote Rb inactivation and prostate cancer progression. [score:3]
To determine if miR-449a can also modulate Rb activity through HDAC1, we transfected PC-3 cells with miR-449a or a specific siRNA targeting HDAC1 (siHDAC1) and detected Rb phosphorylation by immunoblot analysis. [score:3]
Treatment with miR-449a anti-miR inhibitory oligonucleotide (anti-miR-449a) or anti-miR negative control (anti-miR-Con) from Applied Biosystems was also utilized to sequester miR-449a activity and validate sequence specificity. [score:3]
miR-449a targets Cyclin D1. [score:3]
We provide evidence that the putative tumor suppressor function of miR-449a is, in part, dependent on Rb in prostate cancer cells. [score:3]
Regardless, loss of miR-449a would disrupt its auto-regulatory control over Rb and promote unregulated growth, which may, in part, contribute to transformation during prostate cancer tumorigenesis. [score:3]
Only upon restoration of Rb did miR-449a regain its growth inhibitory effects in the DU-145 sublines. [score:3]
Although sensitive to the apoptotic effects of miR-449a, DU-145 cells are resistant to the inhibitory function of miR-449a on cell cycle progression. [score:3]
Cells were also co -treated with a miR-449a inhibitory oligonucleotide (anti-miR-449a) or a non-specific control (anti-miR-Con) to confirm reduction in luciferase activity was dependent on miR-449a sequence. [score:3]
A. The 3'UTR of the Cyclin D1 transcript contains a putative miR-449a target site. [score:3]
We performed an additional in silico analysis on the Cyclin D1 3'UTR and identified the miR-449a target site as a highly-conserved sequence found in many vertebrates (i. e. human, horse, lizard, etc. ) [score:3]
C. Putative miR-449a target sequence from Cyclin D1 (CCND1-WT) was cloned into the 3'UTR of a luciferase reporter vector. [score:3]
This data indicates that miR-449a also regulates Rb phosphorylation though knockdown of HDAC1. [score:3]
In the present study, we indicate that the growth inhibitory function of miR-449a is largely dependent on Rb status in prostate cancer cells. [score:3]
Complementary oligonucleotides containing the putative miR-449a target site from Cyclin D1 (CCND1-WT) was cloned into the 3'UTR of the pMIR-Report luciferase reporter vector (Applied Biosystems, Foster City, CA). [score:3]
As shown in Figure 6A, knockdown of Cyclin D1 by miR-449a or siCCND1 drastically reduced phophorylated Rb (P-Rb) levels. [score:2]
Our data implicates miR-449a as a key miRNA component of the Rb pathway that functions to regulate prostate cancer cell growth, in part, by controlling Rb activity. [score:2]
Previous research has indicated that the specific knockdown of HDAC1 contributes to the apoptotic effects of miR-449a [16]. [score:2]
As shown in Figure 6B, knockdown of HDAC1 by miR-449a or siHDAC1 elevated p27 protein and reduced P-Rb levels. [score:2]
By this mechanism, miR-449a has a dual approach for regulating Cyclin D1 activity and Rb phosphorylation. [score:2]
Further evidence has indicated that miR-449a is also transcriptionally regulated by E2F transcription factors [29- 31]. [score:2]
Figure 2: PC-3 and DU-145 cells were transfected with 50 nM concentrations of miR-Con or miR-449a for 72 hours. [score:1]
In a pattern similar to cell cycle analysis, PC-3 cells stained positive for SA-β-gal activity following miR-449a transfection, while staining in DU-145 cells was nearly undetectable in all treatments (Figure 2). [score:1]
B. DU-1.1 and B5 cells were transfected with mock, miR-Con, or miR-449a for 72 hours as indicated. [score:1]
However, we reveal that miR-449a promotes apoptosis in prostate cancer cells regardless of Rb status; both PC-3 and DU-145 cells are susceptible to the apoptotic effects of miR-449a. [score:1]
Co-transfection with miR-449a reduced the luciferase activity of CCND1-WT, whereas the Cyclin D1 mutant construct (CCND1-MUT) was protected from miR-449a -mediated repression (Figure 5C). [score:1]
Furthermore, miR-449a is located in a chromosomal region previously identified as a susceptibility locus in a variety of malignancies including prostate cancer [35, 36]. [score:1]
DU-145 cells are resistant to miR-449a -induced growth arrest and senescence. [score:1]
Further analysis of DNA fragmentation/apoptosis revealed a substantial increase in cells with sub-diploid DNA content; miR-449a caused ~11% and ~13% boost in PC-3 and DU-145 apoptotic cell populations, respectively (Figure 1C). [score:1]
Transfection of miR-449a promoted cell cycle arrest at G1/G0, increased sub-diploid/apoptotic populations, and caused SA-β-gal staining to indicate that DuPro cells are also sensitive to miR-449a (Supplementary Figure 2A-D). [score:1]
Phenotypically, miR-449a is a multifaceted miRNA in that it induces apoptosis in association to cell cycle arrest [16, 30]. [score:1]
A. PC-3 cells were transfected at 50 nM concentrations of miR-Con, miR-449a, or siCCND1 for 72 hours. [score:1]
The mature hsa-miR-449a mimic (miR-449a), non-specific control (miR-Con), Cyclin D1 (siCCND1) and HDAC1 (siHDAC1) siRNAs were synthesized by Invitrogen. [score:1]
Based on our data, a simple mo del can be created linking miR-449a to Rb activation and growth arrest in prostate cancer cells (Figure 7). [score:1]
Transfection of miR-449a at 10 or 25 nM concentrations improved cell density for analysis. [score:1]
All oligonucleotide sequences used to create the 3'UTR constructs are listed in Supplementary Table 1. PC-3 cells were transfected with 0.6 μg CCND1-WT or CCND1-MUT construct, 0.4 μg pMIR-Report Beta-gal, and 30 nM miR-449a for 24 hours. [score:1]
To determine if DU-1.1 and B5 cells have also become sensitive to miR-449a -induced senescence, we transfected DU-145 sublines with miR-449a and stained for SA-β-gal activity. [score:1]
To determine if miR-449a regulates Rb activity, we evaluated Rb phosphorylation by immunoblot analysis following knockdown of Cyclin D1. [score:1]
miR-449a -mediated depletion of Cyclin D1 and/or HDAC1 reduces Rb phosphorylation leading to growth arrest (denoted in red type). [score:1]
Wild-type Rb sensitizes DU-1.1 and B5 cells to miR-449a-mediate cell cycle arrest. [score:1]
Interestingly, miR-449a has already been established as an evolutionary conserved miRNA [16]. [score:1]
B. PC-3 cells were transfected with mock, miR-Con, miR-449a, or siHDAC1 for 72 hours as indicated. [score:1]
Figure 6: A. PC-3 cells were transfected at 50 nM concentrations of miR-Con, miR-449a, or siCCND1 for 72 hours. [score:1]
Although miR-449a -mediated cell cycle arrest is largely Rb -dependent, re-activation or replacement of miR-449a may have therapeutic benefit in prostate cancer that retains functional Rb status. [score:1]
These results further suggest that DU-145 cells are generally resistant to the growth arrest effects of miR-449a. [score:1]
PC-3 and DU-145 cells were transfected with 50 nM concentrations of miR-Con or miR-449a for 72 hours. [score:1]
DU-145 cells devoid of wild-type Rb are resistant to cell cycle arrest and senescence induced by miR-449a. [score:1]
This data further supports that miR-449a induces growth arrest via an Rb -dependent mechanism in prostate cancer cells. [score:1]
In PC-3 cells, miR-449a caused G0/G1 arrest as indicated by the increase in G0/G1 cell number and corresponding reductions in S and G2/M populations (Figure 1A-B). [score:1]
Figure 4: DU-1.1 and B5 cells were transfected with mock, miR-Con, or miR-449a for 72 hours. [score:1]
This data indicates that miR-449a triggered a senescent-like phenotype in both DU-145 sublines. [score:1]
In contrast, cell cycle distribution in DU-145 cells was not significantly altered by miR-449a (Figure 1A-B). [score:1]
Note improvement in cell quantity within the cell cycle fraction at lower concentrations of miR-449a in the FLA2 histograms (Supplementary Figure 1). [score:1]
Rb sensitizes DU-145 sublines to growth arrest by miR-449a. [score:1]
A. PC-3 and DU-145 cells were transfected with 50 nM concentrations of miR-Con or miR-449a for 72 hours. [score:1]
We also reveal that wild-type Rb enhanced the apoptotic response in DU-145 sublines to suggest that miR-449a may facilitate apoptosis through Rb -dependent mechanisms, as well. [score:1]
B. PC-3 cells were transfected with mock, miR-Con, or miR-449a for 72 hours as indicated. [score:1]
The mechanism by which miR-449a is depleted in prostate cancer may result from genomic deletion or epigenetic silencing. [score:1]
Differential effects of miR-449a on cell cycle distribution in PC-3 and DU-145 cells. [score:1]
Rb also enhanced the apoptotic effects of miR-449a; sub-diploid/apoptotic populations increased to as much as ~45% and ~30% in DU-1.1 and B5, respectively (Figure 3C). [score:1]
We subsequently transfected both DU-1.1 and B5 cells with miR-449a and examined cell cycle distribution by flow cytometry. [score:1]
DU-1.1 and B5 cells were transfected with mock, miR-Con, or miR-449a for 72 hours. [score:1]
PC-3, DU-145, DuPro, DU-1.1, and B5 cell lines were transfected with miR-449a for 72 hours and stained for SA-β-gal activity as previously described [21]. [score:1]
As shown in Figure 3B, miR-449a caused G0/G1 arrest in DU-1.1 and B5 cells as indicated by the increase in G0/G1 cell number and concurrent declines in S and G2/M populations. [score:1]
In vivo analysis has shown that miR-449a is depleted in human prostate tumor tissue relative to patient-matched controls [16]. [score:1]
Although transfection of a non-specific control oligonucleotide (anti-miR-Con) did not interfere with the miR-449a -mediated repression of CCND1-WT, anti-miR-449a blocked miR-449a function causing a rebound in CCND1-WT luciferase activity (Figure 5C). [score:1]
DU-145 cells are resistant to miR-449a -induced cellular senescence. [score:1]
Figure 1: A. PC-3 and DU-145 cells were transfected with 50 nM concentrations of miR-Con or miR-449a for 72 hours. [score:1]
A mo del linking miR-449a to Rb activation and growth arrest in prostate cancer cells. [score:1]
Collectively, these results indicate that wild-type Rb sensitizes DU-145 sublines to miR-449a -induced growth arrest, as well as further enhances the apoptotic effects of miR-449a. [score:1]
We also co -treated cells with a complementary oligonucleotide (anti-miR-449a) designed to specifically bind and sequester miR-449a activity. [score:1]
), miR-449a may promote apoptosis in an Rb-independent manner through depletion of HDAC1 [32, 33]. [score:1]
Because standard miR-449a transfection concentrations (50 nM) resulted in robust levels of cell death, DU-1.1 and B5 cells were also transfected at lower concentrations (10 and 25 nM) of miR-449a to increase viable cell number. [score:1]
Collectively, these reports, in combination with our data, define miR-449a as an integral miRNA component of the Rb pathway. [score:1]
As shown in Figure 5B, miR-449a significantly reduced Cyclin D1 protein levels in PC-3 cells. [score:1]
Lower concentrations of miR-449a improved cell cycle analysis by increasing viable cell number. [score:1]
miR-449a triggers cellular senescence in DU-1.1 and B5 cells. [score:1]
[1 to 20 of 103 sentences]
6
[+] score: 231
To determine whether the PI3K-C2β -mediated regulation of miR-449a was associated with modulation of cyclin B1 protein expression, we then analyzed the effect of miR-449a downregulation on cyclin B1 expression. [score:9]
These data indicate that downregulation of PI3K-C2β reduces cyclin B1 levels through upregulation of miR-449a and that miR-449a is involved in the regulation of cell cycle progression. [score:8]
On the other hand, our data indicate that downregulation of β catenin was not able to increase the percentage of MCF7 cells in G1 phase of the cell cycle, as observed upon downregulation of PI3K-C2β or transfection with the mimic miR-449a. [score:7]
Data showed that downregulation of miR-449a (performed in parallel with experiments presented in Figure 3G) was indeed able to counteract the effect of PI3K-C2β downregulation on SIRT1 levels and to increase SIRT1 protein levels (Supplementary Figure S5D). [score:7]
Specifically, we observed that downregulation of PI3K-C2β was associated with reduced activation of β catenin in MDA-MB-231 cells and that downregulation of β catenin resulted in increased miR-449a levels. [score:7]
Consistent with this, our data demonstrate that counteracting the upregulation of miR-449a induced by PI3K-C2β downregulation, using specific anti miR-449a increases cyclin B1 protein levels. [score:7]
These data indicated that miR-449 is a potential tumor suppressor that regulates cell cycle, invasion and metastasis by targeting multiple oncogenes. [score:6]
Consistent with this, we observed that downregulation of PI3K-C2β, as well as transfection of cells with mimic miR-449a, inhibited invasion of MDA-MB-231 cells. [score:6]
More specifically, previous analysis of miRNA expression in 101 tumor samples from breast cancer patients indicated that miR-449a was downregulated in highly proliferative samples, with negative correlation with the cell cycle genes [38]. [score:6]
It has been further shown that miR-449a is able to inhibit migration and invasion and indeed a recent study reported that low expression of miR-449a was correlated with lymph-node metastasis [45]. [score:5]
Data are expressed as fold change over miR-449a/RNU48 values in cells transfected with non targeting siRNA and are means ± s. e. m. of n = 4 (si scrambled, si β catenin) and n = 3 (si PI3K-C2β) independent experiments. [score:5]
While we cannot completely rule out the possibility that downregulation of either β catenin or STAT3 could possibly modulate miR-449a levels in MCF7 cells in different experimental conditions, overall these data suggest that PI3K-C2β modulates miR-449a levels in MCF7 cells through additional mechanisms of regulation. [score:5]
However, the observation that downregulation of STAT3 did not affect cell cycle progression supports the conclusion that STAT3 is not involved in the regulation of miR-449a in MCF7 cells. [score:5]
As shown in Supplementary Table S1, with reference to the E-GEOD-19783 dataset, we observed that the expression of miR-449a was significantly downregulated in basal compared to LUM A and normal-like samples (logFC −0.9 and −0.4, respectively, p-value < 0.01), and in TP53 mutated samples versus TP53 wild-type ones (logFC −0.5, p-value < 0.01). [score:5]
The specific targets of miR-449 have only been partially identified and cyclin B1 is indeed among the validated miR-449 targets [25]. [score:5]
miR-449a levels are downregulated in primary human breast cancer samples. [score:4]
However, the fact that downregulation of PI3K-C2β did not strongly affect cell number in the same experimental conditions (Figure 6C) possibly suggests additional roles for miR-449a in MDA-MB-231 cells. [score:4]
Specifically, we demonstrate that downregulation of PI3K-C2β increases miR-449a levels. [score:4]
Since we observed that PI3K-C2β regulates activation of the transcription factor STAT3, which in turn can also be involved in miR-34 family regulation [44], we then tested whether STAT3 could be involved in PI3K-C2β -dependent regulation of miR-449a in MCF7 cells. [score:4]
Transient downregulation of both β catenin and PI3K-C2β in MDA-MB-231 (Figure 5C) significantly increased the levels of miR-449a (Figure 5D). [score:4]
Downregulation of miR-449a in breast cancer was also confirmed by our analysis of publicly available databases. [score:4]
PI3K-C2β regulates cyclin B1 expression through modulation of miR-449a. [score:4]
Taken together these data indicate that miR-449a is downregulated in human breast cancer tissues and negatively associated to aggressiveness/progression. [score:4]
Consistent with these data, we observed that transfection of MCF7 cells with mimic miR-449a was able to induce G1 arrest, similarly to the effect observed upon downregulation of PI3K-C2β. [score:4]
To determine whether this PI3K-C2β -mediated regulation of cellular senescence was dependent on miR-449a regulation, we next investigated the effect of miR-449a downregulation on SIRT1 levels. [score:4]
A similar down-regulation, although not statistically significant, was observed for miR-449a in T3-T4 samples versus T1 ones (Supplementary Table S1). [score:4]
In addition, transfection of sh scrambled MCF7 cells with miR-449a increased the percentage of cells in G1 phase of the cell cycle assessed upon starvation in phenol red-free/serum-free media and incubation in growing media for 24h (Figure 3H), consistent with data obtained upon PI3K-C2β downregulation (Figure 2E-2H). [score:4]
There is evidence that indicates an involvement of β catenin in miRNA repression [40, 41], even though the mechanism by which β catenin downregulates miR-449a in breast cancer is currently unknown. [score:4]
This analysis revealed a selective upregulation of 16 miRs in T47D cells lacking PI3K-C2β compared to control cells, including 5 miRs belonging to the same family: miR-449a, miR-449b, miR-34b, miR-34b*, miR-34c-5p (Figure 3D). [score:3]
E. - G. The indicated cell lines were transfected with a specific anti miR-449a or a non targeting anti miR (anti miR-ctr). [score:3]
More importantly, transfection with the specific anti-miR-449a resulted in increased cyclin B1 protein expression, in particular in cells lacking PI3K-C2β (Figure 3E-3G). [score:3]
To determine whether the PI3K-C2β -dependent regulation of β catenin was involved in the regulation of miR-449a and cyclin B1, TRANSFAC was used to identify transcription factors with putative binding sites within 10K bases upstream the miR-449a TSS. [score:3]
PI3K-C2β regulates senescence via miR-449 regulation. [score:3]
PI3K-C2β regulates cyclin B1 via miR-449 regulationWe next sought to assess the mechanism by which. [score:3]
Figure 3 through modulation of miR-449a A., B. Protein expression levels of cyclin D1, cyclin D2 and cyclin B1 in the indicated stable MCF7 and T47D cell lines assessed by Western blotting analysis. [score:3]
miR-449a belongs to the miR-34 family, which is expressed at a low level in several cancer cell lines and solid tumors including breast cancer [38]. [score:3]
Reduced proliferation [36] and inhibition of the BrdU proliferation index [39] was observed in MCF7 transfected with miR-449a. [score:3]
Upregulation of miR-34b (Supplementary Figure S3D), miR-34c (Supplementary Figure S3E) and miR-449b (Supplementary Figure S3F) was also confirmed in T47D lacking PI3K-C2β compared to control cells, although the levels of these miRs were much lower compared to the levels of miR449-a. Taken together these data indicated that PI3K-C2β regulates miR levels, in particular it down modulates miR-449a levels. [score:3]
PI3K-C2β regulates cyclin B1 via miR-449 regulation. [score:3]
Analysis of the E-GEOD-12848 dataset confirmed the downregulation of miR-449a (Supplementary Table S1) in basal-like samples compared to LUM A ones, and in TP53 mutated versus TP53 wild-type cancers. [score:3]
PI3K-C2β regulates senescence via miR-449 regulationIt has been recently shown that miR-449 induces cell senescence in prostate and gastric cancer cells [25, 26]. [score:3]
Data are expressed as fold change over control cells and are means ± s. e. m. from n = 5 independent experiments (except for miR-449a, n = 4). [score:3]
To determine whether modulation of miR-449a levels occurs in human breast cancer specimens, we analyzed two independent datasets of primary human breast cancers, publicly available on Array Express. [score:3]
Additional information on tumor grade revealed that the expression of miR-449a was significantly repressed in grade 3 tumors when compared to grade 1-2 tumors. [score:2]
β catenin is involved in miR-449a regulation in MDA-MB-231 cells. [score:2]
Transfection of sh scrambled MDA-MB-231 cells with mimic miR-449a significantly reduced cell invasion whereas a control miR had no effect (Figure 6D), indicating a role for the PI3K-C2β -dependent regulation of miR-449a in invasion of MDA-MB-231 cells. [score:2]
We further show that PI3K-C2β -dependent regulation of cyclin B1 occurs through modulation of the specific microRNA miR-449a. [score:2]
To investigate this hypothesis, we next determined the effect of β catenin downregulation on miR-449a levels. [score:2]
These data suggest that PI3K-C2β may regulate miR-449a in a mechanism involving β catenin activation in MDA-MB-231 cells. [score:2]
In addition, we showed that this novel PI3K-C2β/miR-449a pathway can also play a key role in the regulation of cell invasion. [score:2]
To gain further insight into the signaling pathways involved in the PI3K-C2β -dependent regulation of miR-449a and cyclin B1, we then performed a phosphokinase array, monitoring phosphorylation and activation of ~50 proteins in the stable MDA-MB-231 cell lines (Figure 4A-4C). [score:2]
Taken together these data indicate that β catenin is involved in the PI3K-C2β -dependent regulation of miR-449a and cyclin B1 levels in MDA-MB-231 cells. [score:2]
This analysis not only confirmed a very significant increase in the levels of miR-449a upon PI3K-C2β downregulation, but it also indicated that the levels of this specific miR were much higher than the levels of the other miRs investigated (Supplementary Figure S3C). [score:2]
Our data further identified one of the mechanisms by which PI3K-C2β can potentially regulate the levels of miR-449a. [score:2]
PI3K-C2β regulates miR449a/cyclinB1 through modulation of LEF1/β catenin pathway in MDA-MB-231 cells. [score:2]
Furthermore, MCF7 ChIP-seq data from the ENCODE project revealed the presence of a H3K27me3 peak upstream miR-449a, whereas no activating histone modifications were detected (data not shown). [score:1]
These data showed that transfection of mimic miR-449a reduced the number of cells (Figure 6E, 6F). [score:1]
Nevertheless, data indicate that both PI3K-C2β and miR-449a are involved in MDA-MB-231 cell invasion. [score:1]
D. sh scrambled MDA-MB-231 cells were transfected with mimic miR-449a, negative control miR (miR-ctr) or transfection reagent alone (control, ctr). [score:1]
It has been recently shown that miR-449 induces cell senescence in prostate and gastric cancer cells [25, 26]. [score:1]
Transfection of T47D (Figure 3E), MDA-MB-231 (Figure 3F) and MCF7 (Figure 3G) with a specific anti miR-449a successfully reduced the levels of miR-449a in all cell lines (graphs in Figure 3E-3G). [score:1]
Match tool from TRANSFAC [50] was used for identification of transcription factors with putative binding sites within 10K bases upstream the miR-449a TSS. [score:1]
On the other hand, we cannot exclude the possibility that the difference may be due to different amounts of miR-449a present in sh PI3K-C2β cells and in sh scrambled transiently transfected with the mimic miR-449a. [score:1]
These results suggest the existence of additional, β catenin-independent mechanisms by which PI3K-C2β modulates miR-449a levels in MCF7 cells. [score:1]
Data further indicated that through modulation of miR-449a. [score:1]
In this respect, it has been reported that miR-449a levels can be epigenetically repressed by histone H3 Lys27 trimethylation in MCF7 cells [39]. [score:1]
In these experiments the average number of invaded cells/field was 445±48 (control), 207±80 (miR-449a) and 429±80 (miR-ctr). [score:1]
Graphs show levels of miR-449a in the corresponding stable cells at 72h following transfection with the indicated anti miRs. [score:1]
90 putative binding sites were found with core match and matrix match equal 1, 35 of which had negative orientation (as miR-449a). [score:1]
Anti miR control and anti-miR-449a were from Life Technologies. [score:1]
Graph shows the effect of transient transfection with the indicated siRNAs on miR-449a levels. [score:1]
H. sh scrambled MCF7 cells were transfected with mimic miR449a (100nM), negative control miR (miR-ctr) or transfection reagent alone (control). [score:1]
[1 to 20 of 72 sentences]
7
[+] score: 208
CRIP2, MYB and PRKAG1 were consistently under-expressed in both T47D and MDA-MB-231 cells (both of which have high endogenous expression of miR-449a), and overexpressed in MDA-MB-468 cells (which have low endogenous expression of miR-449a) relative to MCF-10A normal mammary gland epithelial cells (Figure 3B). [score:9]
Concordantly, in MDA-MB-468 cells (which endogenously under-express miR-449a; Figure 2A), CRIP2 3′-UTR luciferase expression was downregulated in the presence of pre-miR-449a (Supplementary Figure S1C). [score:8]
Suppressing miR-449a in T47D and MDA-MB-231 cells resulted in up-regulated expression of CRIP2, MYB and PRKAG1 mRNA transcript levels at 48 hours post-transfection (Figure 3C). [score:8]
In this early-stage study, miR-449a was observed to be significantly up-regulated in a cohort of 71 primary LNN breast tumors, and its overexpression was associated with higher risk of recurrence and lower overall survival. [score:6]
In MDA-MB-231 cells (which endogenously express high levels of miR-449a; Figure 2A), CRIP2 3′-UTR luciferase (pmiR-CRIP2) expression was significantly higher in the presence of anti-miR-449a (Figure 4B). [score:5]
Although the cell line correlation between endogenous miR-449a (Figure 2A), CRIP2 (Supplementary Figure S2A), and VEGF (Figure 6) expression did not correlate precisely, differences would be expected due to the concentrations of alternate endogenous miRNA targets and competing endogenous RNA cross-talking [42]. [score:5]
C. T47D and MDA-MB-231 cells were transfected with anti-miR-449a (40 nM) or scrambled control (SC), and candidate miR-449a target gene expression was assessed using qRT-PCR 48 hours after transfection. [score:5]
In summary, our findings support the mo del wherein overexpression of miR-449a in breast cancer suppresses CRIP2 activity, leading in turn to increased tumor growth, migration, invasion, as well as angiogenic signaling (Figure 6D). [score:5]
Both miR-449a and miR-449b were first described as tumor suppressors in osteosarcoma cells, targeting CDK6 and CDC25A [31]. [score:5]
The 3′-untranslated regions (3′-UTRs) of potential RNAs targeted by miR-449a were amplified by PCR and placed in the pmiR-Report vector (Ambion), downstream of the Firefly luciferase gene. [score:5]
MiR-449a directly targeted the 3′-untranslated region (3′-UTR) of CRIP2. [score:5]
In order to investigate the association between miR-449a expression and patient survival, the patient cohort was first segregated using the median miR-449a expression value (19.31 fold-change relative to the median expression of normal tissue samples) into high (n=36) vs. [score:5]
As expected, quantitative real-time PCR (qRT-PCR) revealed that CDC20B was concordantly overexpressed in the three miR-449a overexpressing cancer lines (Figure 2B). [score:5]
MiR-449a suppresses CRIP2 expression, which then leads to increased tumor formation (as well as migration and invasion), along with the activation of proangiogenic cytokines such as VEGF, possibly via the NF-κB/p65 complex. [score:4]
Furthermore, miR-449a downregulation in non-small cell lung cancer correlated with the presence of lymph node metastasis, poor survival, and c-MET repression [33]. [score:4]
In TCGA data, the expression values for miR-449a were significantly higher in LNN breast cancer samples (n=266) compared to adjacent normal tissue samples (n=87) (Wilcoxon rank-sum test, p=0.00027; Figure 1D), validating our own observation of significant miR-449a overexpression in malignant LNN breast cancer tissue. [score:4]
MiR-449a targeted the 3′-untranslated region (3′-UTR) of CRIP2. [score:4]
Together, the luciferase and data support the specific and direct inhibition of CRIP2 by miR-449a. [score:4]
Downregulation of miR-449a reduced cell proliferation, clonogenicity, migration, and invasion in breast cancer cells. [score:4]
In order to determine whether miR-449a directly targets the 3′-UTRs of CRIP2, MYB, and/or PRKAG1, the 3′-UTR for each gene was cloned into separate pmiR-Report luciferase reporter vectors (Figure 4A). [score:4]
low (n=35) miR-449a expression groups. [score:3]
Figure 2 A. Quantitative real-time PCR (qRT-PCR) for miR-449a expression in human normal mammary gland epithelial (MCF-10A) and breast cancer (MCF-10A, MDA-MB-231, T47D, and MDA-MB-453) cell lines. [score:3]
Overexpression of miR-449a was associated with higher risk of recurrence in lymph node -negative (LNN) breast cancer patients. [score:3]
Herein, we report that further analyses of these data identified miR-449a to be highly overexpressed and significantly associated with increased incidence of patient relapse. [score:3]
High-throughput small RNA sequencing in peritoneal endometriotic lesions with matched healthy surrounding tissue indicated that miR-449a was one of five miRNAs expressed at significantly higher levels in the epithelial cells of endometriotic lesions [36]. [score:3]
miR-449a was implicated functionally in breast cancer pathogenesis, suppressing Cysteine-Rich Protein 2 (CRIP2) and altering cell viability, migration, invasion, in vivo tumor growth, and angiogenesis, thereby driving malignant phenotypes in these aggressive tumors. [score:3]
Given the strong correlation of miR-449a overexpression with patient relapse, we investigated changes in cell migration and invasion after suppressing miR-449a. [score:3]
A. Quantitative real-time PCR (qRT-PCR) for miR-449a expression in human normal mammary gland epithelial (MCF-10A) and breast cancer (MCF-10A, MDA-MB-231, T47D, and MDA-MB-453) cell lines. [score:3]
Growth arrest induced by miR-449a may also be dependent on Rb inhibition [34]. [score:3]
Strikingly, the miR-449a high expression group experienced significantly poorer outcome in both OS and DFS (OS p=0.00092; DFS p=0.0022; Figure 1B, 1C). [score:3]
Taqman Low Density Array (TLDA) miRNA profiling demonstrated that miR-449a expression was significantly increased in pre-treatment primary LNN invasive ductal breast cancer samples (n=71) relative to normal mammary epithelial tissues (n=5) (p=0.042; Figure 1A). [score:3]
low miR-449a expression groups (p=0.10) (Supplementary Figure S1A, S1B). [score:3]
In this manuscript, a novel prognostic microRNA, miR-449a, was identified to be overexpressed in lymph node -negative invasive ductal breast cancer using global miRNA profiling of 71 primary tumors and 5 normal mammary epithelial tissues. [score:3]
Together, these data indicated that breast cancer patients with higher miR-449a expression levels experienced higher recurrence rates and poorer clinical outcomes. [score:3]
Figure 3 A. Venn diagram illustrating the approach used to identify potential targets of miR-449a. [score:3]
Overexpression of miR-449a was associated with tumor recurrence in LNN breast cancer. [score:3]
A three-pronged approach was undertaken to identify potential miR-449a targets as previously described [19]; miRWalk, experimental (GeneChip Human Genome U133 Plus 2.0 mRNA array of T47D cells transfected with anti-miR-449a), and publically available data [20] were all utilized (Figure 3A). [score:3]
A. Venn diagram illustrating the approach used to identify potential targets of miR-449a. [score:3]
Suppression of miR-449a significantly reduced in vitro cell survival, clonogenicity, migration, and invasion. [score:3]
Our study identified a novel target for miR-449a: Cysteine-Rich Protein 2 (CRIP2). [score:3]
Importantly, when paired with comprehensive patient follow-up data, expression of miR-449a was significantly correlated with higher risk of patient relapse, and decreased overall and disease-free survival rates, thus highlighting the possible applications for this newly characterized potential biomarker. [score:3]
Further, miR-449a is located within intron 2 of Cell Division Cycle 20B (CDC20B; Chromosome 5 - NC_000005.10), a cell cycle regulatory protein involved in anaphase nuclear movement and chromosome separation. [score:2]
Additionally, miR-449a expression was significantly higher in the primary tumors of patients who eventually relapsed, when compared to the primary tumors of non-relapsed patients (p=0.019; Figure 1A). [score:2]
C. Anti-miR-449a (40 nM) was transfected into T47D cells and significantly reduced miR-449a expression compared with scrambled control (SC; 40 nM) or transfection reagent alone (Lipo). [score:2]
MiR-449a overexpression was significantly increased in colorectal carcinoma and inversely correlated with the levels of serum carcinoembryonic antigen (CEA) [35]. [score:2]
MiR-449a putative gene target identification. [score:2]
D. miRNA-Seq and clinical data from The Cancer Genome Atlas (TCGA) validated that miR-449a expression was significantly higher in LNN breast cancer samples (n=266) compared to adjacent normal tissue (n=87). [score:2]
MiR-449a overexpression promoted tumor cell proliferation and colony formation in two cell lines, also increasing migration and invasion. [score:2]
The precise mechanism by which miR-449a is dysregulated remains unclear. [score:2]
MiR-449a inhibits CRIP2, allowing the NF-kB/p65 complex to transcriptionally activate angiogenic factors such as VEGF. [score:2]
Figure 4 A. Schema depicting the luciferase reporter vectors carrying the predicted miR-449a binding sites downstream of the Firefly luciferase gene (pmiR-Report vector). [score:1]
Moreover, we revealed the role of miR-449a in increasing tumor progression via CRIP2 repression, highlighting the potential importance of this new pathway in driving aggressive cancer behavior both in vitro and in vivo. [score:1]
MiR-449a was significantly overexpressed in three (MDA-MB-231, T47D and MDA-MB-453) of the four cancer lines examined, when compared to normal mammary epithelial cells (MCF-10A; Figure 2A). [score:1]
Figure 1 A. Taqman Low Density Array (TLDA) was used to identify that miR-449a was significantly increased in primary LNN breast cancer samples and strongly associated with tumor relapse. [score:1]
Anti-miR-449a significantly reduced migration in MDA-MB-231 cells (19% vs. [score:1]
Anti-miR-449a or pre-miR-449a mimic (Ambion) were reverse transfected into cells using Lipofectamine 2000 (Invitrogen) at a final concentration of 40 nM (unless otherwise indicated), according to the manufacturer's instructions. [score:1]
Through an iterative statistical evaluation of all possible cut-off points, a segregation value of 40 fold-change relative to the median expression of normal tissue samples was chosen to dichotomize the 71 breast cancer patients into miR-449a high (n=28) vs. [score:1]
A. Schema depicting the luciferase reporter vectors carrying the predicted miR-449a binding sites downstream of the Firefly luciferase gene (pmiR-Report vector). [score:1]
D. Schema for the miR-449a-CRIP2 pathway. [score:1]
In summary, we have identified the potential clinical relevance of miR-449a in LNN breast cancer, wherein it promotes a variety of oncogenic functions such as increased cell viability, colony formation, migration, and invasion. [score:1]
Suppression of miR-449a significantly reduced in vitro cell survival, clonogenicity, migration, and invasionThe biological significance of miR-449a was evaluated in various human breast cancer cell lines. [score:1]
A proposed mo del for the miR-449a-CRIP2 pathway. [score:1]
Vector and anti-miR-449a co -transfected luciferase activity was normalized to vector and SC co -transfected luciferase activity, with Renilla luciferase activity for transfection efficiency normalization. [score:1]
The role of miR-449a and miR-449b (another member of the miR-449 family cluster and also located in the second intron of CDC20b) in other human malignancies appears to be controversial, and varies largely depending on the biological context. [score:1]
F. Representative images (left) and quantification (right) for the migration and invasion of MDA-MB-231 cells after transfection with anti-miR-449a or SC (40 nM). [score:1]
Anti-miR-449a or SC transfected cells were collected and lysed at 72 hours. [score:1]
These vectors (pmiR) were co -transfected with pre-miR-449a, anti-miR-449a, or SC into various cell lines. [score:1]
B. qRT-PCR for CDC20B, the miR-449a host gene, in corresponding cell lines. [score:1]
In silico (miRWalk) data was combined with experimental (GeneChip Human Genome U133 Plus 2.0 mRNA array of T47D cells transfected with anti-miR-449a) and publically available data (lymph node negative (LNN) cancer gene profiling). [score:1]
However, we speculate that the function of miR-449a is fundamentally linked with cytogenetic location and is dependent on cancer type or tissue of origin. [score:1]
A. Taqman Low Density Array (TLDA) was used to identify that miR-449a was significantly increased in primary LNN breast cancer samples and strongly associated with tumor relapse. [score:1]
To evaluate the effects of miR-449a suppression, cells were transfected with either SC (negative control) or anti-miR-449a (Figure 2C). [score:1]
In contrast, several studies supported the oncogenic phenotype of miR-449a and miR-449b. [score:1]
[1 to 20 of 73 sentences]
8
[+] score: 204
In conclusion, although several candidates have emerged from this unbiased microarray screen between the pseudoglandular and canalicular phases of lung development, miR-449a stood out as the most significantly upregulated, with N-myc as a likely target in the epithelium at this time in development according to prediction algorithms, the MGI database of mouse phenotypes, and luciferase assays. [score:7]
During chick (G. gallus) lung development, CDC20B expression was highest at E18 by RT-qPCR of whole-lung extracts (Fig 1B), suggesting that the developmental control of miR-449a expression follows the same pattern in mammals and avians. [score:7]
In addition, N-MYC expression in CDH lungs was increased and more wi dely expressed thorough the distal tips of growing airways in diseased lungs (Fig 5F and 5G) This phenotype is consistent with reduced miR-449a levels, possibly correlated with lung immaturity. [score:7]
Mycn transcripts are regulated by miRNA-449aSeveral transcripts were predicted as putative hsa-miR-449a targets by TargetScanHuman Release 6.2 (N = 655; 730 conserved binding sites in the miRNA family) (www. [score:6]
A prioritized list of likely miRNA-449a targets was obtained through a compilation of the online tools TargetScanHuman Release 6.2 and miRDB. [score:5]
MiRNA-449a exhibited the greatest increase in expression among differentially expressed genes, confirmed by real-time qPCR (Fig 1A) and replicated in C57BL/6 mouse embryonic lungs at comparable developmental stages (Fig 1B). [score:5]
Similarly, the pool of Sox9 expressing progenitors is expanded when miR-449a is antagonized, or reduced when it is overexpressed. [score:5]
Several transcripts were predicted as putative hsa-miR-449a targets by TargetScanHuman Release 6.2 (N = 655; 730 conserved binding sites in the miRNA family) (www. [score:5]
D. N-myc is the only predicted target of miR-449a associated with lung hypoplasia and expressed in the lung epithelium. [score:5]
N-myc, a transcription factor belonging to the myc basic Helix-Loop-Helix DNA binding domain family, was the only predicted miR-449a target in the MGI database to be associated to both abnormal branching morphogenesis and pulmonary hypoplasia in mouse mo dels, and also expressed in lung epithelial cells like miR-449a. [score:5]
In the present study, quantitative PCR revealed a time specific increase in expression of miR-449a at E15.5-E18.5, which corresponds to the end of branching morphogenesis in the late pseudoglandular phase, and throughout the canalicular phase; its expression decreased dramatically at birth. [score:5]
F-G. N-MYC expression is increased and more wi dely distributed in distal epithelium of A. hsa-miR-449a expression increases from 16 to 20 wk in human lungs (left) (n = 2 and n = 1, respectively), but not in patients with CDH (right) (n = 1 and n = 1, respectively). [score:5]
Therefore, we developed and injected in ovo an RCAS(A)-449a virus, expressing the murine miR-449a, or the negative control RCAS(A)-GFP along with sham injections at the beginning of lung development of chick embryos (E2). [score:4]
In the lung, upregulation of the miRNA-449a had been correlated with the differentiation of ciliated cells in proximal pulmonary epithelia through the Delta/Notch pathway [30, 33]. [score:4]
The most highly upregulated miRNA was miR-449a, confirming published microarray data in mice [31]. [score:4]
E. N-myc expression during mouse and chick lung development is anticorrelated with that of miR-449a. [score:4]
Interestingly, miRNA-449a reached its peak level of expression at 18 weeks (H. sapiens), or E18.5 (M. musculus), corresponding to the final stages of canalicular development. [score:4]
Although we do not presently know whether decreased miR-449a expression is sufficient to cause the full human phenotype or how it affects the diaphragm, the present study suggests that miR-449a dysregulation plays a role in the pathophysiology of CDH -associated lung hypoplasia. [score:4]
Inhibition of MiR-449a increases SOX9 expression. [score:4]
Furthermore, miR-449a murine ex vivo functional knockdown and avian in ovo overexpression documented morphological changes consistent with impaired lung differentiation and proliferation. [score:4]
MiR-449a overexpression reduces PCNA, NKX2.1, and SOX9 expression. [score:4]
In ovo viral transductionA replication-competent avian specific retrovirus (RCAS; A coat) was engineered to express the RCAS(A)-449a construct composed of the miR-449a murine premiR sequence flanked by 200 nucleotides, using established techniques, and grown and harvested in DF1 cells [27, 28]. [score:3]
The negative correlation (anticorrelation) between N-Myc and miR-449a expression was confirmed by RT-qPCR in human and mouse lung samples (Fig 1E). [score:3]
Lungs were harvested from E16.5 embryos, corresponding to the end of the pseudoglandular phase, at the onset of miR-449a expression. [score:3]
miR-449a is expressed during midgestation in human, murine, and avian lungs. [score:3]
Next, we studied the effect of miR-449 overexpression on lung epithelial proliferation. [score:3]
A. Hsa-miR-449a is highly expressed at 18–20 weeks (canalicular) relative to 9 weeks (pseudoglandular) and newborn human human lungs. [score:3]
Additionally, we detected abnormal miR-449a expression in the necessarily limited human CDH samples available for research purposes. [score:3]
In fact, miR-449a expression is normally controlled by the transcription factor E2F1, a potent stimulator of cell cycle progression [31, 32]. [score:3]
0149425.g005 Fig 5 A. hsa-miR-449a expression increases from 16 to 20 wk in human lungs (left) (n = 2 and n = 1, respectively), but not in patients with CDH (right) (n = 1 and n = 1, respectively). [score:3]
Site directed mutagenesis experiments with a series of 7 nucleotide deletions of the miR-449a:N-myc binding site, confirmed a direct interaction. [score:3]
As pulmonary hypoplasia is associated with diaphragmatic defects in humans and in animal mo dels, we assessed miR-449a expression levels in lung paraffin embedded specimens from available CDH fetuses by RT-qPCR. [score:3]
Given the observed increased epithelial proliferation in antagomir treated mouse lung explants, we hypothesized that miR-449a overexpression would disrupt lung growth, resulting in lung hypoplasia. [score:3]
The luciferase vector, a renilla vector for transcription control, and either pre-miR-449a or a negative control scrambled pre-miRNA were co -transfected into HEK cells, chosen from a panel of cell lines because they exhibited the lowest endogenous miR-449a expression in order to maximize signal-to-noise. [score:3]
The miR-449a target N-myc belongs to the group of genes that maintain the proliferation of undifferentiated progenitors [39]. [score:3]
Hsa-miR-449a expression in hypoplastic CDH lungs. [score:3]
Distal populations of epithelial progenitors start to express miR-449a as they leave the tip of the airways. [score:3]
A replication-competent avian specific retrovirus (RCAS; A coat) was engineered to express the RCAS(A)-449a construct composed of the miR-449a murine premiR sequence flanked by 200 nucleotides, using established techniques, and grown and harvested in DF1 cells [27, 28]. [score:3]
0149425.g001 Fig 1 A. Hsa-miR-449a is highly expressed at 18–20 weeks (canalicular) relative to 9 weeks (pseudoglandular) and newborn human human lungs. [score:3]
QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to delete either one or both predicted miR-449a binding sites within the N-myc 3’ UTR in the previously described luciferase vector. [score:2]
Therefore, we speculate that the N-myc regulation operated by miR-449a may be one of several cellular mechanisms used by epithelial progenitors to escape their undifferentiated proliferative state and thus coordinate the critical process of epithelial differentiation. [score:2]
MiR-449a expressing cells then engage two separate pathways, the first to reduce their proliferative rate, the second to initiate proximal epithelial mucociliary differentiation [30]. [score:2]
MiR-449a is expressed al low levels in the distal lung epithelium, and not in the mesenchyme, of mouse and chick lung explants (Fig 1C). [score:2]
C. MiR-449a expression in mouse (E15.5) and chick (E12) distal lung epithelium by LNA ISH. [score:2]
Mycn transcripts are regulated by miRNA-449a. [score:2]
MiR-449a, and its paralogs miR-449b and miR-449c, are co-regulated with their host gene CDC20B [30]. [score:2]
Mir449a expression. [score:2]
Thus, N-myc plays an important role in embryonic lung development and the data presented herein point to a role for miR-449a as a regulator of N-myc, as confirmed by luciferase assays. [score:2]
Pre-miR-449a transfection caused a significant reduction in luciferase activity compared to scrambled pre-miRNA treated cells (p < 0.0001), indicating direct regulation of the N-myc 3’UTR by miR-449a (Fig 2C). [score:2]
MiR-449a expression differences were not detectable at the onset of the canalicular phase between a 17 week CDH specimen (N = 1) and 16 week reference samples (N = 2) (Fig 5A). [score:2]
Mucociliary differentiation largely occurs late in lung development; our data, however, support the hypothesis that miR-449a may additionally influence distal epithelial progenitor proliferation. [score:2]
miR-449a regulates epithelial proliferation and differentiation ex vivo and in ovo. [score:2]
This pattern suggests a specific role for miR-449a in the mid stages of lung development. [score:2]
Luciferase assays based on a vector with a basal promoter and the luc2P gene upstream of the N-myc 3’UTR were used to confirm regulation by the miR-449a (Fig 2A). [score:1]
miR-449a regulates epithelial proliferation and differentiation ex vivo and in ovoBy competitive binding of PNA antagomirs, we investigated whether functional knockdown of miR-449a affected lung epithelial progenitors in ex vivo organ cultures. [score:1]
It is worth noting that human hsa-miR-449a and its murine ortholog mmu-miR-449a-5p share identical mature sequences in miRBase (www. [score:1]
0149425.g004 Fig 4E15 chick lungs after RCAS(A)-Gfp (A,C,E) or RCAS(A)-mir449a (B,D,F) in ovo infection, stained with anti-PCNA (A,B), anti-NKX2.1 (C,D), and anti-SOX9 (E,F) antibodies. [score:1]
Hsa-miR-449a binds to the MYCN 3’-UTR. [score:1]
MiR-449a was found to be highly expressed at the canalicular stage compared to the pseudoglandular stage. [score:1]
E15 chick lungs after RCAS(A)-Gfp (A,C,E) or RCAS(A)-mir449a (B,D,F) in ovo infection, stained with anti-PCNA (A,B), anti-NKX2.1 (C,D), and anti-SOX9 (E,F) antibodies. [score:1]
MiR-449a is a critical regulator of genes involved in cellular proliferation, differentiation, and apoptosis [30, 31]. [score:1]
In the mid-late canalicular phase, at 20 weeks gestation, miR-449a appeared to be reduced in a CDH fetus (N = 1) relative to a reference sample of the same gestational age (N = 1) (Fig 5A). [score:1]
B. Mmu-miR-449a, and CDC20B as a proxy for chick gga-miR-449a, in mouse and chick lungs. [score:1]
Specific deletion of the 5’ S1 predicted binding region alone was sufficient to result in significant loss of the miR-449a effect, indicating that S1 is the functionally active binding site. [score:1]
These data, necessarily based on the limited samples available for research purposes, suggest a role for hsa-miR-449a in the pulmonary phenotype of CDH patients prenatally, which should be further explored. [score:1]
E-F. Expression of the 3C2 viral marker was measured in RCAS-mir449 infected chick samples (*, lung airways or parabronchi). [score:1]
Furthermore, we found that miR-449a controlled epithelial proliferation in the developing lung. [score:1]
Anti-miRNA-449a and scrambled (control) Peptide Nucleic Acids (PNA) (Panagene, Daejeon, Korea) were transfected using Effectene Transfection Reagent (Qiagen, Venlo, The Netherlands). [score:1]
By the time miR-449a can be first detected by our methodology, proximal cells arising from a pool of epithelial progenitors, have already begun to abandon their undifferentiated state [41]. [score:1]
Their co-transfection with pre-miR-449a resulted in abrogation of the miR-449a effect when either S1 or S1+S2 were deleted, whereas deletion of S2 alone had only a modest effect on luciferase activity, indicating that S1 in the N-Myc 3’ UTR is the critical binding site for miR-449a (Fig 2C). [score:1]
Hsa-miR-449a binds to the MYCN 3’-UTRLuciferase assays based on a vector with a basal promoter and the luc2P gene upstream of the N-myc 3’UTR were used to confirm regulation by the miR-449a (Fig 2A). [score:1]
B. Site S1 and S2 sequence aligned with miR-449a. [score:1]
[1 to 20 of 72 sentences]
9
[+] score: 197
In this study, we found that Overexpression of miR-449a significantly inhibited the luciferase activity of the Wt Flot2 3′-UTR reporter gene but not the Mut reporter gene and overexpression of miR-449a markedly reduced the expression of Flot2, but silenced Flot2 did not affect miR-449a expression, indicating that Flot2 is a direct target of miR-449a in GC cells. [score:14]
In this study, miR-449a expression was downregulated and Flot2 was upregulated in all GC cell lines as compared with that in GES-1. luciferase reporter assay identified Flot2 as a novel direct target of miR-449a. [score:10]
Our data indicate that overexpressed miR-449a and loss of Flot2 in GC cells results in an more epithelial morphology with upregulation of E-cadherin and downregulation of vimentin and N-cadherin. [score:9]
Consistent with the effects induced by miR-449a mimics, knockdown of Flot2 significantly suppressed the cell invasion (Fig.   3), indicating that miR-449a suppress GC cell invasion by repressing Flot2 expression. [score:8]
Consistent with previous study [19], the miR-449a expression was downregulated in all GC cell lines as compared with that in GES-1 (Fig.   1a), indicating that miR-449a may function as a tumor suppressor in GC cells. [score:7]
In addition, overexpression of miR-449a markedly reduced the expression of Flot2 (Fig.   2c), but silenced Flot2 did not affect miR-449a expression (Fig.   2b). [score:7]
Expression analysis of a set of epithelial-mesenchymal transition (EMT) markers showed that miR-449a reduced the expression of mesenchymal markers (vimentin and N-cadherin) and induced the expression of epithelial marker (E-cadherin), which was consistent with silenced Flot2. [score:7]
This indicated miR-449a-repressed Flot2 expression reduced epithelial–mesenchymal transition (EMT) with elevated expression of E-cadherin and reduced expression of Vimentin and N-cadherin in MGC-803 cells. [score:7]
To determine the role and potential mechanism of Flot2 in cell invasiveness, we analyzed the effects of overexpressed miR-449a and silenced Flot2 on the expression of epithelial marker (E-cadherin) and induced expression of mesenchymal markers (Vimentin and N-cadherin) in GC cells. [score:7]
miR-449a was downregulated in gastric cancer cell lines and gastric cancer tissues [19, 20], and inhibits proliferation and induces apoptosis by directly repressing E2F3 [19]. [score:7]
Moreover, transwell invasion assay showed that miR-449a inhibited GC cell invasion by suppressing Flot2 expression. [score:6]
miR-449a regulated GC cell invasion by suppressing Flot2 expression. [score:6]
To elucidate whether Flot2 is a potential downstream target gene of miR-449a in GC cells, we constructed luciferase reporter vectors containing the wild-type (Wt) or mutant (Mut) miR-449a target sequences of the Flot2 3′-UTR (Fig.   2a). [score:5]
In summary, we demonstrated the important role of miR-449a mediated Flot2 suppression that subsequently disarranged TGF-β induced epithelial mesenchymal transition within gastric cancers, thus providing a potential therapeutic target in gastric cancer therapy. [score:5]
Overexpression of miR-449a significantly inhibited the luciferase activity of the Wt Flot2 3′-UTR reporter gene but not the Mut reporter gene (Fig.   2a). [score:5]
MiR-449a reduces EMT of GC cells by suppressing Flot2 expression. [score:4]
miR-449a directly targeted Flot2. [score:4]
Our results demonstrated that miR-449a suppressed Flot2 expression results in decreased cell invasion through repressing TGF-β -mediated-EMT, and provides a new theoretical basis to further investigate miR-449a-regulated Flot2 as a potential biomarker and a promising approach for GC treatment. [score:4]
N-cadherin and Vimentin was downregulated significantly in miR-449a group. [score:4]
These results demonstrated that Flot2 is a direct target of miR-449a in GC cells. [score:4]
a MiR-449a induces EMT of GC cells by suppressing Flot2 expression. [score:4]
miR-449a mimics, negative controls (NC), and siRNA targeting human Flot2 mRNA were designed and synthesized by Shanghai GenePharma Company (Shanghai, China). [score:3]
c analysis revealed the effects of Flot2 siRNA-810 and miR-449a mimics on the expression level of Flot2. [score:3]
a Representative diagram of the predicted wild-type (WT) or mutant (Mut) binding site of miR-449a in the 3'- untranslated region (UTR) of Flot2 mRNA. [score:3]
Here, we demonstrated the mechanism of miR-449a and its novel specific target Flot2 on GC invasiveness. [score:3]
The relative expression of miR-449a was shown as fold difference relative to U6. [score:3]
a analysis revealed the miR-449a expression in normal human gastric epithelial cells GES-1 and gastric cancer cell lines (SGC-7901, NCI-N87 and MGC-803). [score:3]
Moreover, N-cadherin and Vimentin expression in Flot2 siRNA group were higher than that in control group and similar with that in miR-449a group. [score:3]
b analysis revealed the effects of Flot2 siRNA and miR-449a mimics on the expression level of miR-449a. [score:3]
Western bolt analysis revealed the effects of miR-449a and Flot2 on EMT-relative protein expression. [score:3]
The expression of miR-449a and Flot2 in GC cell lines. [score:3]
miR-449a mediated Flot2 suppression resulted in reduced GC cell invasion via repressing TGF-β -induced EMT. [score:3]
and western blot was performed to detect miR-449a and Flot2 expression in GC cell lines and Normal human gastric epithelial cells. [score:3]
Fig. 1The expression of miR-449a and Flot2 in NPC cell lines. [score:3]
Moreover, E-cadherin expression in siRNA group was higher than that in control and similar with that in miR-449a group. [score:3]
In this study, luciferase reporter assay identified Flot2 as a novel direct target of miR-449a. [score:3]
Flot2 involves in miR-449a-regulated GC cell invasion. [score:2]
Fig. 3Flot2 involves in miR-449a-regulated BC cell invasion. [score:2]
indicated the expression of E-cadherin was increased in miR-449a mimics group compared with control groups (Fig.   4a). [score:2]
Here, to explore protein regulated by miR-449a in the EMT process, we investigated the expression of three EMT related proteins, E-cadherin, N-cadherin and Vimentin by. [score:2]
Then, luciferase reporter assay was used to elucidate whether Flot2 is a target gene of miR-449a. [score:2]
miR-449a FLOT2 Gastric cancer TGF-β -mediated-EMT Gastric cancer (GC) is the second leading cause of cancer-related deaths worldwide with 934,000 new cases occurring each year [1]. [score:1]
MGC-803 cells (3.5 × 10 [4]) were seeded in triplicate in 24-well plates and cotransfected with wild-type (WT) or mutant (Mut) 3′-UTR vectors and miR-449a mimics using Lipofectamine 2000. [score:1]
In miR-449a mimics group, MGC-803 cells were transfected with miR-449a mimic or miR-Ctrl (50 nM; GenePharma, Suzhou, China) using Lipofectamine 2000 reagent (Invitrogen). [score:1]
We first employed to detect miR-449a levels in normal human gastric epithelial cells GES-1 and gastric cancer cell lines (SGC-7901, NCI-N87 and MGC-803). [score:1]
To determine the role of Flot2 and miR-449a in the GC cell invasion, MGC-803 cells were transiently transfected with Flot2 siRNA (siRNA group) or miR-449a mimic (miR-449a group). [score:1]
MGC-803 cells were transfected with NC, miR-449a mimics and Flot2 siRNA. [score:1]
However, the effects and mechanism of miR-449a on GC cell invasion remains unclear. [score:1]
The luciferase reporter plasmid containing the WT or Mut Flot2 3′-UTR was cotransfected into HEK293T cells with miR-449a mimics. [score:1]
[1 to 20 of 49 sentences]
10
[+] score: 195
Figure 5 ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in Trans(A) qRT-PCR was performed to detect miRNAs expression after ANRIL knockdown. [score:9]
The released E2F1 activates ANRIL expression, thus forming a positive feedback loop, continuing to promote gastric cancer cell proliferationOur results indicated that higher expression of ANRIL could release E2F1 expression by silencing of miR-449a expression. [score:9]
Interestingly, silencing of miR-449a by ANRIL releases E2F1 expression, and, meantime, up-regulated E2F1 promotes ANRIL expression, thus forming a positive feedback loop, continuing to promote gastric cancer cell proliferation. [score:8]
Then our results showed that ANRIL knockdown could significantly upregulate the expression of miR-99a/miR-449a both in SGC-7901 and BGC-823 cell lines in PRC2 -dependent manner (Figure 5A and 5C). [score:7]
Figure 6 ANRIL could control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferation(A) The level of miR-99a and miR-449a was downregulated in 30 pairs GC tissues. [score:7]
Importantly, overexpression of miR-449a could suppress the expression of ANRIL in both SGC-7901 and BGC-823 cell lines (Figure 7D). [score:7]
Our results indicated that higher expression of ANRIL could release E2F1 expression by silencing of miR-449a expression. [score:7]
ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in TransTo further study the mechanism of its regulation of gastric cancer cell proliferation, firstly, according to previous studies [19, 22], we validated that ANRIL whether can bind PRC2 in gastric cancer cells. [score:7]
Importantly, overexpression of miR-449a could significantly inhibit E2F1 expression (Figure 7D). [score:7]
As shown in Figure 5A, knockdown of ANRIL could significantly upregulate the expression of miR-99a/miR-449a both in SGC-7901 and BGC-823 cell lines. [score:7]
Importantly, knockdown of ANRIL and EZH2 could control the well described target genes of miR-99a and miR-449a, mTOR [27- 29] and CDK6 [30- 32], also including the important target gene of CDK6 kinases, E2F1, a pivotal role in controlling cell cycle progression(Figure 6C and 6D)[35]. [score:6]
ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in Trans. [score:6]
ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in Trans. [score:6]
In addition, miR-99a and miR-449a were both down-regulated in GC and further analysis revealed that expression of ANRIL is inversely correlated with miR-99a/miR-449a level in GC tissues (Figure 6A and 6B). [score:6]
Co-transfection (miR-99a/miR-449a inhibitors and si- ANRIL) could partially abrogate miR-99a/miR-449a inhibitors caused mTOR/CDK6/E2F1 stimulation (Figure 6F). [score:5]
In an attempt to understand the biological role of miR-99a/miR-449a in GC, we enforce miR-99a/miR-449a expression by using mimics and found apparent cell proliferation inhibition through inducing obvious G1–G0 phases arrest and apoptosis (Figure 6E). [score:5]
Further analysis revealed that ANRIL expression was inversely correlated with miR-99a/miR-449a expression in 30 pairs of gastric cancer tissues (Figure 6B). [score:5]
To validate whether miR-99a/miR-449a could also inhibit gastric cancer cell proliferation, we enforced their expression in SGC-7901 cells with respective miRNAs mimics. [score:5]
Furthermore, western blot analysis showed that the expression of mTOR and CDK6 in SGC-7901 cells transfected with miR-99a/miR-449a mimics were indeed downregulated compared with cells transfected with negative control (Figure S2B). [score:5]
Together, in addition through the regulation of p15 [INK4B] and p16 [INK4A] in Cis, ANRIL could also regulate the expression of miR-99a/miR-449a in Trans, thus controlling mTOR and CDK6/E2F1 pathway, which may in part account for ANRIL -mediated cell growth promotion. [score:5]
Ren XS Yin MH Zhang X Wang Z Feng SP Wang GX Luo YJ Liang PZ Yang XQ He JX Zhang BL Tumor-suppressive microRNA-449a induces growth arrest and senescence by targeting E2F3 in human lung cancer cellsCancer letters 2013 48. [score:5]
ANRIL could indeed control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferation. [score:4]
ANRIL could control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferation. [score:4]
ANRIL could indeed control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferationTo investigate the roles of miR-99a/miR-449a in gastric cancer, we performed qRT-PCR analysis and found that miR-99a/miR-449a expression was significantly decreased in 30 pairs of gastric cancer tissues (Figure 6A). [score:4]
These data indicate that ANRIL could epigenetically modulate the expression of miR-99a/miR-449a by binding to PRC2, thus regulating mTOR and CDK6 pathway, thereby controlling gastric cancer cell proliferation. [score:4]
MiR-99a and miR-449a are both downregulated in a variety of tumors and indicate a poor prognosis [46, 47]. [score:4]
qRT-PCR was performed to detect the average expression of ANRIL/miR-99a/miR-449a in xenograft tumors (n=7). [score:3]
Collectively, higher ANRIL could silence the expression of p15 [INK4B], p16 [INK4A] and miR-449a. [score:3]
Higher ANRIL could silence the expression of miR-449a. [score:3]
As shown in Figure S2A, SGC-7901 cells were effectively transfected with miR-99a/miR-449a mimics/ inhibitors. [score:3]
In addition, we demonstrated that ANRIL could epigenetically silence miR-99a/miR-449a by binding to PRC2, thus regulating mTOR and CDK6/E2F1 pathway, which could in part account for ANRIL -mediated cell growth regulation. [score:3]
Then we examined the well-described target genes of miR-99a/miR-449a, mTOR [27- 29] and CDK6 [30- 32]. [score:3]
These results suggested that ANRIL could epigenetically modulate the expression of miR-99a/miR-449a by binding to PRC2. [score:3]
Lower expression of miR-449a releases CDK6 kinases. [score:3]
Next, we determined the PRC2 complex was bound to the promoter region of miR-99a/miR-449a, and whether ANRIL was required for targeting PRC2 occupancy and activity of promoters of miR-99a/miR-449a. [score:3]
In addition, flow cytometric analysis indicated that the overexpression of miR-99a/miR-449a in SGC-7901 cells could induce obvious G1–G0 phases arrest compared with cells transfected with miR-NC and could also induce apoptosis (Figure 6E). [score:2]
To further confirm the regulation between ANRIL and miR-99a/miR-449a, we performed rescue experiments. [score:2]
In addition, knockdown ANRIL could also lead to the loss of SUZ12 binding of miR-99a/miR-449a promoters (Figure S1D). [score:2]
Especially, miR-449a plays an important role in regulation of cell cycle and cell proliferation [48, 49]. [score:2]
Knockdown ANRIL resulted in the loss of EZH2 binding and H3K27 trimethylation occupancy of miR-99a/miR-449a locus. [score:2]
Importantly, the average level of miR-99a/miR-449a was higher in sh ANRIL group (Figure 8C). [score:1]
To investigate the roles of miR-99a/miR-449a in gastric cancer, we performed qRT-PCR analysis and found that miR-99a/miR-449a expression was significantly decreased in 30 pairs of gastric cancer tissues (Figure 6A). [score:1]
In our study, higher ANRIL could continuously activate CDK6 through repressing miR-449a and inactivate the p15 [INK4B]/p16 [INK4A. ] [score:1]
Next, MTT and trypan blue assay revealed that the cells transfected with miR-99a or miR-449a had a significant growth inhibition when compared with cells transfected with miR-NC (Figure 6E). [score:1]
[1 to 20 of 44 sentences]
11
[+] score: 172
Furthermore, a western blot confirmed that the protein level of one of miR-449a's targets, histone deacetylase 1 (HDAC1) [27], was strongly down-regulated upon miR-449a overexpression (Fig. 3B). [score:8]
It has been reported that miR-449a is a direct target of E2F1 and prevents tumor cells from entering S phase by down -regulating E2Fs directly and by inhibiting the activity of E2F transcription factors through the reduction of CDKs [25], [26]. [score:8]
0062383.g003 Figure 3(A) Expression profiling of miR-449a over-expressed in CL1-0. Relative expression levels of miR-449a in CL1-0 cells were measured at indicated time points by real-time PCR after transiently transfected with miR-449a expression plasmid. [score:7]
To generate a construct expressing miR-449a, miRNA expressing plasmids were created using the BLOCK-iT pol II miR RNAi Expression Vector Kit with EmGFP (Invitrogen). [score:7]
Although miR-449a in CL1-0 cells did not significantly down-regulated at 24 h post irradiation using qRT-PCR, we observed significant (P<0.05) down-regulation of miR-449a in CL1-0 cells at 24 h post-irradiation (Fig. 2C). [score:7]
We speculated that part of reasons was the effect of over -expressing miR-449a was transient, or those un -transfected cells might dilute the suppressive effect of miR-449a in clonogenic survival. [score:5]
However, differences still existed between the cell cycle of miR-449a -overexpressed CL1-0 and that of CL1-5. For example, over -expression of miR-449a did not show any effect in S phase (Fig. 4D). [score:5]
Moreover, when cells exposed to radiation, although more apoptotic cells were found both in miR-449a -overexpressing and control cells, the amount of apoptosis induced by irradiation in miR-449a -overexpressing cells was significantly greater than that in control cells (Fig. 4C). [score:5]
Over -expression of miR-449a efficiently suppresses cell viability post-irradiation. [score:5]
As expected, over -expression of miR-449a alone increased the cleaved form of caspase 3. Furthermore, activation of caspase 3 by cleavage occurred earlier in miR-449a -overexpressing CL1-0 cells treated with irradiation (24 h) than in control cells (48 h) (Fig. 4B). [score:5]
Over -expression of miR-449a in CL1-0 increased radiosensitivity. [score:3]
However, in the current experiment setting, the transient effect of miR-449a overexpression deterred us from doing the synchronization of cell cycle. [score:3]
Moreover, miR-449a was found to be strongly expressed in lung tissue [29], but lower amounts in lung cancer tissues [30]. [score:3]
Furthermore, the decreasing G0/G1 population was observed in CL1-0 over-expressed with miR-449a, which was probably caused by the G2/M arrest (Fig. 4D). [score:3]
MiR-449a, sharing the same seed sequence with tumor suppressors miR-34 family [24], was reported to provoke cell cycle arrest [25], [26] as well as induce apoptosis in prostate and gastric cancers [25], [27], [28]. [score:3]
Flow cytometry analysis of cell cycle progression was performed in miR-449a -overexpressing cells 24 h after treated with 10 Gy. [score:3]
Therefore, we further demonstrated that, after irradiation exposure, overexpression of miR-449a further enhanced irradiation -induced DNA damage and apoptosis, altered the cell cycle distribution, and consequently sensitized the radioresistant CL1-0 cells to irradiation. [score:3]
In Fig. 4B&C, we have shown that, without irradiation, overexpression of miR-449a alone caused increase in apoptosis. [score:3]
The primary miRNA sequence of miR-449a with flanking regions was obtained by PCR, and was inserted into the Block-iT Pol II miR RNAi Expression Vector, pcDNA6.2-GW/EmGFP-miR. [score:3]
Successful over -expression of miR-449a in CL1-0.. [score:3]
First, the results of both microarray and quantitative RT-PCR showed that expression levels of miR-449a in CL1-5 cells did not respond to irradiation (Fig. 2C & D). [score:3]
As expected, over -expression of miR-449a elevated the cleavage of caspase 3 without irradiation in CL1-0 cells (0 h in Fig. 4B). [score:3]
In order to investigate the role of miR-449a in modulating the radiosensitivity of CL1-0, miR-449a was overexpressed in CL1-0 cells using a miRNA expression plasmid containing a primary miR-449a sequence. [score:3]
Furthermore, the pro-apoptotic activity of miR-449a in tumor cells makes it difficult to develop a stable clone to constitutively overexpress miR-449a. [score:3]
In addition, irradiation induced cleaved caspase 3 occurred earlier in miR-449a -overexpressing CL1-0 cells (Fig. 4B). [score:3]
0062383.g004 Figure 4(A) Immunoblotting of γH2AX in miR-449a -overexpressing cells. [score:3]
Since we showed that the difference in radiosensitivity between CL1-0 and CL1-5 was attributed to different mechanisms of apoptosis and cell cycle progression post-irradiation, we hypothesized that miR-449a, known for regulating apoptosis and cell cycle arrest, might be a regulator of radiosensitivity. [score:3]
After irradiation, a significant increase in the level of γH2AX was observed in CL1-0 cells overexpressing miR-449a (Fig. 4A). [score:3]
We observed that over -expression of miR-449a caused a subtle increase in the phosphorylation of H2AX even in the un-irradiated cells (Fig. 4A), suggesting DNA repair mechanism should increase. [score:3]
This selective proapoptotic activity is compatible with the idea that miR-449 may be involved in tumor-suppressive activities. [score:3]
Moreover, miR-449a was found to be strongly expressed in lung tissue, especially in differentiated bronchial epithelium, without any sign of cell death [29]; while tumor cells contained far lower amounts of miR-449a [30]. [score:3]
The irradiation-evoked caspase 3 activation continued to increase up to 48 h and attenuated at 72 h in miR-449a -expressing cells. [score:3]
In addition, we observed that, following irradiation in the presence of ectopic miR-449a, cell viability was further suppressed at 48 h as compared with un-irradiated cells in the (Fig. 5A), while there was no significant difference in clonogenic survival (Fig. 5B). [score:2]
In this study, we demonstrated that two lung adenocarcinoma cell lines with an isogenic background, CL1-0 and CL1-5, displayed different radioresponses, and identified miR-449a as a regulator of their radiosensitivity. [score:2]
Ectopic expression of miR-449a increased the proportion of CL1-0 cells in the G2/M phase and decreased the proportion of cells in G0/G1 phase compared with that of control cells (Fig. 4D). [score:2]
Overall, we know the second mechanism of miR-449a modulating radiosensitivities is through regulation of apoptosis. [score:2]
Next, miR-449a -overexpressing CL1-0 cells were treated with 10 Gy and subjected to annexin V binding assay at 48 h post-irradiation. [score:2]
Previously, miR-449a was reported to induce apoptosis in prostate and gastric cancers through the activation of p53 by down -regulating the histone deacetylase HDAC1 [27]. [score:2]
Also, it has been reported that miR-449a plays important roles in regulating cell cycle progression, cell proliferation, and apoptosis in many types of cancer [25]. [score:2]
Also, miR-449a induces apoptosis in prostate and gastric cancers through the activation of p53 by down -regulating the histone deacetylase HDAC1 [27] and SIRT1 [25], [28]. [score:2]
Furthermore, since DNA damage activates checkpoint pathways that regulate specific DNA repair mechanisms in the different phases of the cell cycle [55], miR-449a might be only involved in DNA repair for a specific phase of cell cycle. [score:2]
However, we did not observe any effect of miR-449a expression on radioresponse using unsynchronized clonogenic assays (Fig. 5B). [score:2]
Without radiation, cells overexpressing miR-449a exhibited more apoptosis as compared to control cells. [score:2]
Irradiation -induced apoptosis is enhanced by miR-449a. [score:1]
We used miRNA microarrays to screen the radiation-responding miRNAs in two isogenic lung adenocarcinoma cells with different radiosensitivity and found that miR-449a enhanced radiosensitivity by increasing irradiation -induced DNA damage and apoptosis and altering cell cycle distribution. [score:1]
Moreover, miR-449a sensitized the radio-resistant CL1-0 to irradiation, resulting in enhancement of irradiation -induced apoptosis by counting the proportion of Annexin V -positive cells (Fig. 4C). [score:1]
We used immunoblotting of γH2AX to examine the effect of miR-449a on irradiation -induced DNA damage. [score:1]
Hence, it could eliminate the problem of transfection efficiency, and will be a powerful tool for further examining the effect of miR-449a on radioresponse in lung adenocarcinoma cell lines. [score:1]
After transfection, the relative expression level of miR-449a was significantly increased, as measured by real-time PCR (Fig. 3A). [score:1]
These results suggest that miR-449a is involved in sensitization of CL1-0 to irradiation via augmenting irradiation -induced DSBs. [score:1]
0062383.g005 Figure 5 miR-449a reduced cell viability post-irradiation ins. [score:1]
Based on the results of miRNA microarrays and literature surveys, we focused on miR-449a. [score:1]
At 48 h post-irradiation, miR-449a -overexpressing cells were stained with annexin V and propidium iodide, and the percentage of apoptotic cells was calculated. [score:1]
Since it has been demonstrated that miR-449a induced more severe DNA damage and more apoptosis after irradiation, we hypothesized that the survival capability of cells post-irradiation might be altered upon miR-449a transfection. [score:1]
Thus, we focused on miR-449a for further experiments. [score:1]
The alteration of cell cycle progression post-irradiation correlated closely with radiosensitivity, which prompted us to further examine the effect of miR-449a on cell cycle progression post-irradiation. [score:1]
These results implied that miR-449a caused CL1-0 cells to accumulate in G2/M phase post-irradiation. [score:1]
Also, further studies on the role of miR-449a in radiosensitivity in other resistant and radiosensitive cancer cell lines are another avenue to pursue. [score:1]
Reintroduction of miR-449 in tumor cells efficiently drives them into cell cycle arrest and apoptosis [25], [29], [31]. [score:1]
These results suggested that miR-449a sensitizes CL1-0 cells to irradiation by enhancing irradiation -induced apoptosis. [score:1]
This impeded the establishment of a clear-cut mechanism of miR-449a in response to radiation. [score:1]
In cells depleted of p53, miR-449a also induces apoptosis, though the underlying mechanisms are not fully understood [25]. [score:1]
After miR-449a transfection following irradiation treatment, the altered cell cycle pattern of CL1-0 (Fig. 4D) was shifted to be similar to that of CL1-5 (Fig. 1D), which was identified as a radiosensitive cell line in this lung adenocarcinoma mo del and also displayed G2/M arrest pattern post irradiation. [score:1]
Within the miRNA candidates identified at 24 h in CL1-0, miR-449a drew our attention. [score:1]
Reintroduction of miR-449 in tumor cells efficiently drives them into cell cycle arrest and apoptosis [25], [29]. [score:1]
[1 to 20 of 65 sentences]
12
[+] score: 171
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34b, hsa-mir-34c, hsa-mir-449b, hsa-mir-449c
Previously, we knocked down miR-449 in Xenopus MCCs by injecting a cocktail of morpholino antisense oligonucleotides against miR-449a/b/c (449-MOs) into the prospective epidermis at the eight-cell stage 9. In Xenopus, miR-34b was detected in MCCs (Supplementary Fig. 2d–f), and in situ hybridization (ISH) experiments also revealed that 449-MOs not only blocked the expression of miR-449 but also blocked the expression of miR-34b (Supplementary Fig. 2f), suggesting that 449-MOs collectively inhibit miR-34/449 miRNAs (Supplementary Fig. 2e,f). [score:8]
As expected, both ectopic expression of miR-449 in proliferating HAECs and DAPT repressed the expression of the Notch target gene HES1 (Fig. 1g). [score:7]
At later time points of differentiation, this regulatory loop drives the accumulation of miR-449 at sufficient levels to downregulate additional targets implicated in more downstream events, such as CP110, involved in basal body maturation 48, and R-Ras, shown here to be important for actin network assembly. [score:7]
We hypothesize that once this loop is locked in a state of high miR-449 expression, interactions of miR-449 with additional targets expressed at subsequent steps of multiciliogenesis remain possible (see Fig. 8d). [score:7]
Conversely, DAPT caused a significant increase in RhoA activity in differentiating HAECs (Fig. 3a), consistent with the concomitant upregulation of miR-449 expression (Fig. 1f) 9. RhoA activation was also examined in Xenopus MCCs by injecting embryos with an RNA encoding the Rhotekin rGBD-GFP, a sensor of activated RhoA 56. [score:6]
RRAS2 expression remained at a very low level during MCC differentiation and in response to miR-449 overexpression, and was not altered by miR-34/449 knockdown or PO- RRAS protection (HAECs, see GEO GSE22147; Xenopus, Supplementary Fig. 4c). [score:6]
In proliferating HAECs, miR-449 overexpression strongly reduced the transcript levels of ARHGDIB, ARHGAP1 and RRAS, whereas the expression of DAAM1 and NDRG1 transcripts was slightly decreased (Fig. 4b). [score:5]
Finally, miR-449 favour basal body maturation and anchoring by downregulating CP110. [score:4]
In proliferating primary HAECs, miR-449 overexpression caused a 50% increase in the level of active RhoA-GTP, similar to the effect of the Rho activator calpeptin (Fig. 3a), while it decreased by 35±14% Rac1,2,3 activity (Supplementary Fig. 3a), as previously observed in another cellular context with miR-34a (ref. [score:3]
MiR-449 knockdown suppressed multiciliogenesis and apical actin web formation in both HAECs (Fig. 1a,b) and Xenopus embryonic epidermis (Fig. 2a,b). [score:3]
The RRAS protector is a complementary antisense oligonucleotide targeting the conserved miR-449 binding site of the human RRAS 3′-UTR. [score:3]
We found that in proliferating A549 cells, a human lung cell line devoid of miR-449 and miR-34b/c, miR-449 overexpression increased actin stress fibres and focal adhesion formation (Fig. 1c,d, see also Supplementary Fig. 3d,e). [score:3]
MiR-449a and miR-449b reduced the relative luciferase activity of chimeric constructs containing the wild-type 3′-untranslated regions (3′-UTRs) of ARHGAP1, ARHGDIB, NDRG1 and RRAS, but not of DAAM1 3′-UTR (Fig. 4c). [score:3]
The huge induction of miR-449 expression at early ciliogenesis (stage EC) suggests that early effects were mainly mediated through miR-449, without excluding a later role for miR-34 (Supplementary Fig. 2a). [score:3]
Transcript levels of rras were normalized against Odc transcript as an internal control and miR-449 expression was normalized with U2 as an internal control. [score:3]
The miR-449 antagomiR targets Homo sapiens miR-449a (full match) and miR-449b with one mismatch. [score:3]
Then, miR-449 miRNAs repress the Notch pathway inducing a double -negative feedback loop increasing miR-449 expression. [score:3]
ARHGAP1, ARHGDIB and RRAS are targeted by miR-449 in HAECs. [score:3]
Following miR-449 overexpression, R-Ras disappeared from the membrane fraction, while FLNA was redistributed from the membrane to the cytoskeletal fraction (Fig. 8b). [score:3]
This effect remained however smaller than the one induced by miR-449 expression (Supplementary Fig. 3f). [score:3]
Protecting the RRAS mRNA from interaction with miR-449 leads to defects in apical actin reorganization together with a decrease in MCC differentiation similar to that observed after inhibition of miR-449 activity. [score:3]
We treated proliferating HAECs or human lung A549 cells (which both are devoid of endogenous miR-449) either with miR-449 or with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT), a γ-secretase inhibitor that blocks Notch activation. [score:3]
The expression of Multicilin (MCIDAS), CCNO and miR-449 is controlled by the Notch pathway activity. [score:3]
Expression levels of miR-449a (c) and of ARHGAP1, ARHGDIB and R-Ras proteins (d) during HAEC differentiation. [score:3]
Rac1,2,3 activity was slightly reduced by miR-449 expression, whereas it was not affected by a silencing of RRAS (Supplementary Fig. 3a). [score:3]
Conversely, miR-449 expression was increased after treatment of differentiated HAECs with DAPT (Fig. 1f). [score:3]
In differentiating HAECs, both R-Ras and ARHGAP1 protein level strongly and continuously decreased from Po to LC, concomitantly with the increase in miR-449 expression (Fig. 5c,d). [score:3]
In Xenopus epidermis, miR-449a and miR-34b were both specifically expressed in MCCs, and their levels in the developing epidermis showed a similar evolution (Supplementary Fig. 2d, see also ref. [score:3]
In proliferating human A549 cells, the silencing of RRAS or ARHGAP1 but not ARHGDIB increased actin stress fibres and focal adhesion formation (Supplementary Fig. 3d,e), and mimicked the effects observed after miR-449 overexpression (Fig. 1c,d and Supplementary Fig. 3d,e). [score:3]
We finally noticed a miR-449 -dependent subcellular redistribution of FLNA, after quantifying R-Ras and FLNA protein levels in different cellular fractions of proliferating HAECs that overexpress or not miR-449. [score:3]
Notch repression is associated with the increase in MCIDAS, CCNO and miR-449 expression. [score:3]
As miR-34 and miR-449 miRNAs share the same targets, we only used miR-449 in the rest of this study. [score:3]
MiR-449 inhibit cell cycle-related genes to stop proliferation and promote entry in differentiation. [score:2]
The direct repression of RRAS by miR-449 affects multiciliogenesis and apical actin cytoskeleton reorganization in HAECs. [score:2]
In addition, western blot analysis revealed increased ERM phosphorylation following miR-449 transfection in proliferating HAECs (Fig. 1e), consistent with the regulatory role of phospho-ERM during actin cytoskeleton dynamics 50 54. [score:2]
Protector MO directed against miR-449 -binding sites in rras 3′-UTR (PO- rras): 5′- gttggcaatgtaggtgcaattcgtt -3′. [score:2]
To invalidate miR-449 or miR-34b/c activity in human, we transfected HAECs with a cholesterol-conjugated antagomiR directed against miR-449 (Antago-449) or against miR-34 (Antago-34) and assessed MCC differentiation. [score:2]
The direct repression of RRAS by miR-449 affects multiciliogenesis and apical actin cap formation in Xenopus. [score:2]
In contrast, Notch pathway inhibition by DAPT had no impact on RhoA activity in proliferating HAECs (Fig. 3a), indicating that exogenous miR-449 modulated the RhoA pathway in a Notch-independent manner in this assay. [score:2]
Interestingly, miR-449 appears to be negatively regulated by Notch activity, supporting the existence of a double -negative feedback loop. [score:2]
The protector MOs directed against miR-449 -binding sites in Dll1 3′-UTR have the following sequences: P1 MO: 5′- cggcagtgcaacagtttatgtctgg -3′; P2 MO: 5′- aggcagtgactgtctgtagtttagc -3′. [score:2]
MiR-449 silencing and target protection experiments. [score:2]
Our data suggest that the induction of RhoA activity by miR-449 may at least in part involve the silencing of RRAS, notwithstanding possible contributions by additional regulators. [score:2]
We therefore focused on the functional impact of miR-449 -mediated repression of RRAS on apical actin reorganization in MCCs. [score:1]
This suggests that miR-449 cause a rise of levels of phosphorylated ERM independently of Notch repression. [score:1]
Supplementary Figures 1-5 and Supplementary Table 1 Supplementary Figures 1-5 and Supplementary Table 1 (a– c) Effect of a treatment by control antagomiR (CTR-Neg), anti-miR-449a/b (Antago-449) and miR-449:: Notch1 protector (PO- Notch1) on differentiating HAECs. [score:1]
Antago-449 as well as antago-34 strongly blocked miR-449a/b, whereas antago-34 blocked miR-34a/b/c more efficiently than antago-449 (Supplementary Fig. 2b). [score:1]
In the absence of miR-449, R-Ras and FLNA were enriched in the membrane fraction (Fig. 8b). [score:1]
3′-UTR -binding sites for miR-449. [score:1]
Cells were then transfected with synthetic negative control miRNA (miR-Neg, Ambion) or synthetic miR-449a/b miRNAs (Ambion) (10 nM final concentration). [score:1]
HAECs): RhoA activity in proliferating HAECs transfected for 72 h with miR-Neg, miR-449a and/or incubated with DAPT (10 μM) or a Rho activator (calpeptin, 1 U ml [−1], 2 h). [score:1]
miR-449 controls small GTPase pathways during MCC differentiation. [score:1]
In parallel, miR-449 also control apical actin network remo delling by repressing R-Ras, promoting FLNA redistribution and modulating RhoA activity. [score:1]
3′-Cholesterol linked 2′- O-methyl miR-449a/b or miR-34b/c antisense oligonucleotide (antagomiR, antago-449: 5′- c [s] u [s] c [s] uucaacacugccacau [s] u [s] u -Chol-3′, antago-34: 5′- g [s] c [s] a [s] aucagcuaacuacacugc [s] c [s] u -Chol-3′), Notch1 protector oligonucleotide 5′- a [s]a [s]a [s]aaggcaguguuucugug [s]u [s]a -Chol-3′ and RRAS protector oligonucleotide (PO- RRAS: 5′- c [s] g [s] u [s] uggcagugacauuuauu [s] u [s] u -Chol-3′) were purchased from Eurogentec (Seraing, Belgique). [score:1]
The protein levels of ARHGAP1, ARHGDIB and R-Ras proteins were also dramatically decreased after transfection of proliferating HAECs with miR-449 (Fig. 4d). [score:1]
Mutual repression between miR-449 and the Notch pathway. [score:1]
Ten nanograms of mixture of each miR-449 MO (449-MOs) was injected in one animal-ventral blastomere at the eight-cell stage. [score:1]
MiR-449 -mediated silencing of either ARHGAP1, ARHGDIB or RRAS was respectively abolished when miR-34/449-predicted binding sites were mutated (Fig. 4c). [score:1]
We also noticed a reduction of miR-449 levels when preventing miR-34/449 binding on Notch1 in differentiating HAECs (Fig. 1f) and on Dll1 in frog epidermis (Fig. 2f). [score:1]
We assessed the functional impact of miR-449 on the activity of RhoA and Rac1,2,3 by transfecting proliferating HAECs with miR-449 and differentiated HAECs with antago-449. [score:1]
Morpholino antisense oligonucleotides were as follows: MOs against miR-449 (GeneTools, LLC): miR-449a MO, 5′- accagctaacattacactgcct -3′; miR-449b MO, 5′- gccagctaaaactacactgcct -3′; miR-449c MO, 5′- acagccagctagcaagtgcactgcc -3′; control MO (MO-Neg), 5′- tgcacgtttcaatacagaccgt -3′. [score:1]
Altogether, these data reveal the existence of a double -negative feedback loop between miR-449 and the Notch pathway. [score:1]
in magenta) in miR-449 morphants (449-MOs, n=68) relative to negative control (n=110). [score:1]
A locked nucleic acid antisense probe against the mature form of miR-449a was described previously 9. For fluorescent ISH (FISH) on sections, embryos were fixed in MEMFA for 2 h at room temperature or overnight at 4 °C, stored in methanol at least 24 h at −20 °C, rehydrated and washed in triethanolamine (0.1 M)/acetic anhydrid. [score:1]
Interestingly, rras transcript levels were anti-correlated with miR-449a levels during the course of MCC differentiation (Fig. 5g). [score:1]
Cells were either untreated (CTR-Neg, b1,2,5,6), injected with miR-449 morpholinos (449-MOs, b7,8) or with Notch intracellular domain NICD (b3–4). [score:1]
Protecting the rras mRNA from interaction with miR-449 results in defects in actin cap formation (F-Actin, a5 and b3,4) together with a loss of MCCs (Ac. [score:1]
As observed for miR-449 morphants with rhotekin staining in Xenopus epidermis (Fig. 3b), PO- rras -injected MCCs displayed reduced actin cap and motile cilia staining, but maintained RhoA activation at the apical surface (Fig. 7c,e). [score:1]
Among the four miR-449 -binding sites in the 3′-UTR of RRAS, the strongest effect was observed for the most 3′-site, which also corresponds to the unique conserved site between human and Xenopus (Fig. 4c and Supplementary Fig. 4a). [score:1]
In HAECs, miR-449 silencing caused a decrease of 51%±3.5 in the number of acetylated tubulin -positive cells and of 33%±7 in the number of ezrin -positive cells (Fig. 1b). [score:1]
[1 to 20 of 70 sentences]
13
[+] score: 163
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3
The enforced expression of miR-449a suppresses gastric cancer cell proliferation and induces apoptosis through directly targeting Bcl-2. These findings indicate that the frequently downregulated miR-449a in gastric adenocarcinoma contributes to gastric cancer proliferation, and that miR-449a may have a therapeutic potential in the suppression of gastric adenocarcinoma, therefore providing us with an improved understanding of the molecular mechanism of gastric adenocarcinoma initiation and progression. [score:13]
As shown in Fig. 4B, compared with control group, the Bcl-2 protein was downregulated in the cells transfected with miR-449a, and upregulated in the ASO-449a transfected cells, with an average 0.55-fold decrease and 2.6-fold increase separately, indicating that miR-449a is capable of inhibiting Bcl-2 expression through directly targeting Bcl-2 3′UTR, when taking into account the results in the previous section. [score:13]
Therefore, we speculate that another pathway may exist by which p53 regulates miR-449a, which then targets Bcl-2 and downregulates its expression. [score:9]
Numerous putative miR-449a targets are predicted by various computer-aided algorithms known as PicTar, TargetScan and miR-Base Targets. [score:7]
In order for miR-449a to downregulate Bcl-2 expression, we hypothesize that miR-449a may induce gastric adenocarcinoma cell apoptosis. [score:6]
miR-449a downregulates Bcl-2 mRNA and protein expression in gastric adenocarcinoma cells. [score:6]
Taking into account the above results, the present study assessed whether miR-449a had a functional role in the downregulation of endogenous Bcl-2 expression. [score:6]
miR-449a also induced MGC-803 and SGC-7901 cell inhibition, which could be aborted by the overexpression of Bcl-2 (Fig. 5C and D). [score:5]
As shown in Fig. 5B, in the MGC-803 cells, the overexpression of miR-449a induced the luminescent signals of caspase 3 and 7, while the signal induced could be rescued in the cells by Bcl-2 expression. [score:5]
To unveil the molecular mechanism of miR-449a in the regulation of cancer progression, Bcl-2 was experimentally identified as the direct target of miR-449a. [score:5]
Given that miR-449a has a lower expression level in cancer cells, we conjectured that miR-449a may be a growth inhibitor in gastric adenocarcinoma. [score:5]
Luciferase reporter assay-validated miR-449a targets the 3′UTR of Bcl-2, subsequently downregulating the endogenous level of Bcl-2, as observed using western blotting and qPCR analysis. [score:5]
Previous studies have confirmed that sequence-specific ASOs are able to inhibit miRNA activation (19), therefore, miR-449a ASO (ASO-449a), which was the exact antisense copy of the mature miR-449a sequence, was synthesized to inhibit the miR-449a function. [score:5]
miR-449a is downregulated in human gastric adenocarcinoma tissues. [score:4]
In conclusion, the present results show that miR-449a, an important anti-oncogenic miRNA associated with apoptosis, is downregulated in gastric adenocarcinoma. [score:4]
The mitochondrial pathway includes the activation of pro-apoptotic factors, such as Bax, forming heterodimers and antagonizing the antiapoptotic effect of Bcl-2 (28), subsequently resulting in the activation of caspase 3 and 7. Therefore, the protein level of caspase 3 and 7 were detected in the present study and it was found that they were upregulated when cells were transfected with miR-449a. [score:4]
In the MGC-803 cells, ASO-449a showed a significant antiproliferative effect compared with the control group (Fig. 2A), while overexpression of miR-449a inhibited cell proliferation in the gastric adenocarcinoma cells. [score:4]
Recently a study identified that p53 is able to transcriptionally regulate Dicer, which is the miRNA processing complex, subsequently affecting the miR-449a expression level (30). [score:4]
Bcl-2 gene is negatively regulated by miR-449a by targeting putative binding sites in the 3′-UTR. [score:4]
These data confirm the prediction that Bcl-2 is a direct target for miR-449a. [score:4]
These results indicated that miR-449a may be a tumor suppressor in gastric adenocarcinoma cells. [score:3]
Further investigation into the circumstances under which p53 regulates Bcl-2 directly or through the miR-449a -targeting pathway may also be conducted. [score:3]
The results indicated that miR-449a is able to bind to the 3′UTR of Bcl-2 mRNA and repress gene expression. [score:3]
To confirm that miR-449a binds to this region and causes translational repression, the luciferase reporter pMIR-Bcl-2-3′UTR was constructed. [score:3]
As a result, when miR-449a was overexpressed, Bcl-2 mRNA was subsequently decreased by 0.6-fold compared with the control group, while the Bcl-2 cells transfected with ASO-449a showed a 2.8-fold increase (Fig. 4A), indicating that miR-449a regulates endogenous Bcl-2 mRNA levels via a mechanism of mRNA degradation. [score:3]
The results showed that the miR-449a expression levels were generally lower in the gastric adenocarcinoma tissues than in the matched normal gastric tissues, with the exception of three paired samples (Fig. 1). [score:3]
To test miR-449a functions on gastric adenocarcinoma cell lines, the effects of altered miR-449a expression on MGC-803 and SGC-7901 cells were examined. [score:3]
miR-449a inhibits gastric adenocarcinoma cell growth in vitro. [score:3]
These results showed that miR-449a is able to repress cell proliferation and induce cell apoptosis, and that this effect may be rescued by Bcl-2 overexpression. [score:3]
We predicted that the overexpression of miR-449a function may result in the arrest of growth. [score:3]
In the CCK-8 and colony formation assays, it was shown that miR-449a inhibited MGC803 and SGC-7901 cell proliferation. [score:2]
Similarly, another luciferase reporter vector was constructed containing the mutational Bcl-2 3′UTR, and this showed that neither miR-449a nor ASO-449a was able to affect the luciferase intensity in this 3′UTR mutant vector. [score:2]
The MGC-803 cells were transfected with the reporter vector and miR-449a or ASO-449a. [score:1]
ASOs for miR-449a were used to enhance miR-449a function. [score:1]
The cells were transfected with miR-449a, ASO-449a or control oligonucleotides and then were lysed with RIPA lysis buffer 72 h later and the proteins harvested. [score:1]
miR-449a-repressed MGC-803 cell function is mediated by Bcl-2. Discussion. [score:1]
The cells were plated in 96-well plates in 100 μl cell culture medium and incubated at 37ºC for 24 h. The cells were then transfected with miR-449a, ASO-449a or control oligonucleotides. [score:1]
The clarification of this should allow us to further understand the role of miR-449a in gastric adenocarcinoma. [score:1]
In the present study, we aim to explore the role of miR-449a in the adenocarcinoma cell lines, MGC803 and SGC-7901. [score:1]
In order to construct the Bcl-2 3′UTR plasmid, a wild-type 3′-UTR fragment of human Bcl-2 mRNA containing the putative miR-449a binding sequence was amplified by PCR and cloned downstream of the firefly luciferase gene in the pMIR-REPORT vector (Ambion, Life Technologies, Carlsbad, CA, USA) between the HindIII and SpeI sites. [score:1]
The MGC803 cells were transfected with miR-449a to enhance its function, and the expression of Bcl-2 mRNA was measured by qPCR. [score:1]
For the mutant reporter vector, seed sequences of miR-449a -binding sites in the Bcl-2 3′UTR fragment were mutated using the QuikChange Mutagenesis kit (Stratagene, La Jolla, CA, USA). [score:1]
As shown in Fig. 2B, the colony number of the MGC-803 and SGC-7901 cells transfected with miR-449a ASO was significantly higher than those transfected with control oligonucleotides, while the cells transfected with miR-449a decreased significantly. [score:1]
[1 to 20 of 43 sentences]
14
[+] score: 129
In this pathway, T-2 toxin suppresses miR-449a expression; the downregulation of miR-449a upregulates SIRT1 expression; the overexpression of SIRT1 leads to the increased accumulation of deacetylated PGC-1α; and the high accumulation of deacetylated PGC-1α activates mitochondrial biogenesis and ROS production in HepG2 and HEK293T cells. [score:15]
The overexpression of miR-449a has been shown to decrease the protein level of SIRT1, and we observed that T-2 toxin can suppress the level of miR-449a and, thus, plays a role in the upregulation of SIRT1 expression in response to T-2 toxin exposure. [score:10]
In addition to remarkable changes in miR-449a expression, SIRT1 protein expression was significantly downregulated in the cells transfected with miR-449a mimics (Figure 6B), but no effect of miR-181d mimics transfection on SIRT1 protein expression was observed (Figure 6C). [score:10]
The overexpression of miR-449a mimics suppresses the expression of its target, SIRT1, counteracts the induction effect of T-2 toxin in these cells, and subsequently blocks the increase in mitochondrial DNA content mediated by T-2 toxin. [score:9]
Based on this mechanism, we hypothesize that the downregulated miR-449a and miR-181d might release the tight suppression of SIRT1 expression in T-2 toxin treated cells. [score:8]
To further confirm this role, we overexpressed miR-449a in the T-2 toxin -treated cells to validate whether it plays a key role in the upregulation of mitochondrial biogenesis via controlling the expression of SIRT1. [score:8]
These data suggested that miR-449a targets the 3′UTR of SIRT1 mRNA to regulate its expression. [score:6]
In T-2 toxin treatment, two miRNAs, miR-449a and miR-181d, have been found to be significantly downregulated via the screening of predicted miRNAs that potentially target the SIRT1 3′UTR. [score:6]
These data suggest that miR-449a potentially suppressed SIRT1 expression. [score:5]
Plasmids containing the predicted miR-449a target sequence in the 3′UTR of SIRT1 and the mutant miR-449a target sequence were cloned into the pmirGLO vector. [score:5]
The overexpression of miR-449a reversed the heightened expression of SIRT1 induced by T-2 toxin and led to no apparent increase in mtDNA copy number (Figures 6E,F). [score:5]
T-2 toxin suppresses miR-449a expression, which leads to elevated of SIRT1. [score:5]
To further validate whether SIRT1 is a direct target of miR-449a in HepG2 and HEK293T cells, we transfected a luciferase fusion construct containing either the wild-type SIRT1 3′UTR or a mutant to which miR-449a cannot bind into both cell lines. [score:4]
Two putative miRNAs, miR-449a and miR-181d, were selected for further analysis because they were significantly downregulated by T-2 toxin, showing 0.6- and 0.7-fold changes in HepG2 cells relative to the untreated control and 0.6- and 0.3-fold changes in HEK293T cells (Figure 6A). [score:4]
The elevated level of SIRT1 induced by T-2 toxin in both cell types is mainly mediated by downregulation of the level of miR-449a. [score:4]
The results showed that miR-449a mimics significantly suppressed the luciferase activity of the wild-type reporter, but no repression was observed in the reporter with the mutated SIRT1 3′UTR (Figure 6D). [score:3]
Further functional analysis confirmed that miR-449a plays the key role in SIRT1 expression. [score:3]
Next, we determined whether overexpression of miR-449a attenuated T-2 toxin -induced deacetylation of PGC-1α. [score:3]
Transfection of miR-449a mimics significantly inhibited the deacetylation of PGC-1α in HepG2 and HEK293T cells under T-2 toxin treatment (Figure S6). [score:3]
We also examined whether overexpression of miR-449a could affect cell viability in both cell lines under T-2 toxin treatment. [score:3]
However, the exact mechanism of the suppression of miR-449a expression remains to be further investigated. [score:3]
We conclude that the stepwise regulation of miR449a/SIRT1/deacetylated PGC-1α probably plays a self-defense role by inducing mitochondrial biogenesis to balance the ROS overproduction in the early-stage response to T-2 toxin exposure. [score:2]
The plasmids and miR-449a were transfected into HepG2 and HEK293T cells using Opti-MEM Reduced Serum Media with Lipofectamine 3000 (Invitrogen). [score:1]
The protein level of SIRT1 in HepG2 and HEK293T cells transfected with miR-449a mimics was analyzed. [score:1]
Figure 6T-2 toxin enhances protein level of SIRT1 through miR-449a. [score:1]
T-2 toxin increases mitochondrial biogenesis through the miR-449a-SIRT1 axis. [score:1]
To evaluate the potential roles of miR-449a and miR-181d in SIRT1 expression, we transfected miR-449a and miR-181d mimics into HepG2 and HEK293T cells, respectively. [score:1]
[1 to 20 of 27 sentences]
15
[+] score: 99
Two sets of miRNAs (one down-regulated and one up-regulated compared to controls) show similar expression levels in active and GFD CD patients, being miR-449a the highest expressed miRNA. [score:10]
qRT-PCR confirmed the expression levels both of miR-449a (active CD: 2.8±0.9 mean RQ±SEM) and of 2 other tested miRNAs, the down-regulated miR-124a (active CD:0.6±0.1 mean RQ±SEM) and the similar to control expressed miR-564 (active CD:1.4±0.3 mean RQ±SEM vs 1.2±0.1 at array). [score:8]
Six of the 11 programs [Target Scan 5.1, PicTar, Miranda 1.9, MirTarget2 (v2.0), PITA (Catalog version 3) and RNAhybrid (v2.2)], which we used to predict putative target genes of miR-449a, identified several proteins that are present in relevant biological pathways. [score:7]
The levels of a group of deregulated miRNAs (up-regulated miR-449a, down-regulated miR-124a, and similar to controls expressed miR-564) were also evaluated with TaqMan miRNA assays (Applied Biosystems) to validate the array results. [score:7]
Among the up-regulated miRNAs the miR-449a was expressed at very high levels in all active CD (55.18±16.45 mean RQ±SEM) and GFD children (15.43±7.69 mean RQ±SEM). [score:6]
Globally, these data indicate that the NOTCH1 pathway is deregulated in intestinal epithelium of CD children, irrespective of whether the disease is active or not, and that this alteration could be related to the very high miR-449a expression. [score:6]
No inhibition of the Renilla luciferase expression was observed in mutant 3′UTR of KLF4-mRNA with miR-449a, so confirming the miR-449a/3′UTR KLF4-mRNA direct interaction (panel B). [score:6]
The direct interaction between miR-449a and the 3′UTRs of both NOTCH1 and KLF4 was further confirmed after mutating the putative target sites in 3′UTR of the two genes (See S1). [score:4]
Figure S2 The luciferase assay confirms that miR-449a inhibits the expression of NOTCH1 and KLF4. [score:4]
MiR-449a binds to the 3′ UTR of NOTCH1 and KLF4 and inhibits their expression. [score:4]
Figure S1 Bioinformatics analysis of miR-449a putative target genes. [score:3]
The bioinformatics search for putative target genes of miR-449a revealed about one hundred proteins, among these several belonged to the Notch pathway, i. e., NOTCH1, KLF4 (a NOTCH1 transcription factor) [21], DLL1, LEF1 and NUMBL. [score:3]
Bioinformatic prediction of the target genes of miR-449a. [score:3]
php?species=Homosapiens&mirna_acc=hsa-miR449a&targetgene_type=refseq_acc&targetgene_info=&v=yes&search_int=Search (http://www. [score:3]
Particularly, the miR-449a showed the highest expression level in CD patients than in controls. [score:3]
miR-449a putative target genes with most favorable context score, selected by bioinformatics, were sorted into pathways using GOTM (http://bioinfo. [score:3]
php?species=Homosapiens&mirna_acc=hsa-miR-449a&targetgene_type=refseq_acc&targetgene_info=&v=yes&search_int=Search) (http://www. [score:3]
We also investigated the protein expression of KLF4, another selected target gene of miR449a, in small intestinal villi from GFD patients and controls, lacking the villous architecture in active CD patients. [score:3]
The biological pathways predicted to be deregulated by miR-449a and sorted in functional groups are reported in Figure S1 (http://mirecords. [score:2]
MiR-449a seems to be regulated through activation of its host gene, CDC20B, and both were induced by the cell cycle regulator E2F1 [19]. [score:2]
This finding confirms the interaction between miR-449a and the 3′ UTR of both NOTCH1 and KLF4. [score:1]
In HEK293 cells co -transfected or with pRL-NOTCH1 vector (panel A) or with pRL-KLF4 vector (panel B), a pre-miR-449a concentration of 100 nmol/L was sufficient to significantly reduce (respectively, p = 0.001 and p = 0.002) Renilla luciferase activity versus control values. [score:1]
The miR-449 (a and b) cluster is embedded into an intronic sequence of the mRNA-encoding gene CDC20B on Chr 5q11.2 [17]. [score:1]
cgi?species=Human&gid=&mir_sc=&mir_c=&mir_nc=&mirg=hsa-miR-449a). [score:1]
The mature miR-449a sequence is evolutionarily conserved across a variety of species (monkey, horse, rodents, and dogs) and therefore it probably exerts an important function [20]. [score:1]
We didn't verify the interaction miR-449a/3′UTR NOTCH1 being this latter recently validated by Marcet B et al [32]. [score:1]
As this pathway plays a relevant role in the control of intestinal cell fate in animal mo dels we further examined the interaction of miR-449a with Notch pathway [18]. [score:1]
Accordingly, in a very recent report miR449 by repressing the Delta/Notch pathway was elegantly shown to control the human airway epithelium and vertebrate multilciliogenesis [32]. [score:1]
In cells co -transfected with pRL-NOTCH1 vector and pre-miR-449a or with pRL-KLF4 vector, a pre-miR-449a concentration of 100 nmol/L was sufficient to significantly reduce (respectively, p = 0.001 and p = 0.002) Renilla luciferase activity versus control values after 48 h (Figure S2A and S2B). [score:1]
[1 to 20 of 29 sentences]
16
[+] score: 64
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-106a, hsa-mir-34a
Our data on SA-miRNAs expression showed upregulation of miR-24 and miR-34a and downregulation of miR-20a and miR-449a in senescent cells. [score:9]
TRF treatment increased miR-20a expression in young HDFs, reduced miR-34a expression in senescent HDFs, and increased miR-449a expression in both young and senescent HDFs (P < 0.05). [score:7]
Similarly, genome-wide analysis of miRNA expression revealed miR-449a was downregulated with age [18]. [score:6]
However, miR-449a expression was found to be negatively associated with CCND1 expression [47]. [score:5]
Increase of miR-34a expression with higher relative expression value (REV) suggested miR-34a may have a more important role than miR-449a during replicative senescence of HDFs. [score:5]
TRF treatment was found to have increased miR-449a expression in both young and senescent HDFs, indicating that TRF modulated miR-449a expression but not specifically for senescent cells. [score:5]
Increased CCND1 observed in senescent HDFs may contribute to the downregulation of miR-449a in senescent HDFs observed in this study. [score:4]
Increased miR-449a expression in young and senescent cells may be accompanied with the elevated level of miR-449a transcription regulator, E2F1, to promote cell cycle progression [50]. [score:4]
This study also observed the downregulation of miR-449a in senescent HDFs. [score:4]
The expression of miR-20a and miR-449a was decreased while the expression of miR-24 and miR-34a was increased significantly in senescent HDFs as compared to young HDFs (P < 0.05) (Figure 2). [score:4]
Furthermore, the seed sequences of miR-449a are similar to that of miR-34a (UGGCAGUGU) [48], indicating similar target genes including CCND1 [46], CCNE2 [47], and CDK6 [49]. [score:3]
In contrary, increased miR-449a expression was reported in deep sequencing analysis [17]. [score:3]
Several miRNAs (including miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) that funnel proliferating cells to senescence regulate cellular senescence via either or both p53/p21 and p16/pRb pathways [14]. [score:2]
PCR reactions were then performed according to manufacturer's instructions to quantitate the expression levels of miRNAs (miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) using Taqman Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, USA), and Taqman microRNA assay (Applied Biosystems, USA) for the miRNAs of interest. [score:2]
The PCR amplification was performed in iQ5 Multicolor Real Time PCR (Bio Rad, USA) at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. The PCR incubation profile was extended to 45 cycles for miR-20a and miR-449a. [score:1]
[1 to 20 of 15 sentences]
17
[+] score: 51
In contrast, miR-449a displayed the binary expression as miR-34b/c during spermatogenesis but had an overall lower expression (Fig. 2A–B). [score:5]
Mice heterozygous for the miR-34bc [Fl], targeted Dcr and miR-449 targeted alleles were crossed to Deleter Cre [43] to generate the miR-34b [−], Dcr [FH] and miR-449 [−] alleles, respectively. [score:5]
The targeting vector used for introduction of loxP flanked Neomycin (Neo) cassette into the miR-449 locus and the schematic map of the targeted miR-449 before and after Cre -mediated-recombination are shown. [score:5]
Our analysis identifies miR-34b/c and miR-449 loci as specifically and abundantly expressed in post-mitotic germ cells. [score:3]
miR-34b/c and miR-449 are selectively expressed in post-mitotic spermatogenesis. [score:3]
Northern blotting of testicular RNA revealed the robust expression of miR-34b/c and miR-449a at postnatal day 14, a time when the appearance of pachytene spermatocytes is observed. [score:3]
With the similarity of expression of miR-34b/c and miR-449 loci and their potential to be functionally redundant with respect to spermatogenesis, we generated miR-34bc [−/−];449 [−/−] mice (Fig. 3A) that were born in Men delian ratios. [score:3]
A 8 kb DNA fragment corresponds to the wild-type miR-449 locus, integration of loxP flanked neo cassette of introduces an additional BamHI site, thus decreasing the size of the BamHI DNA fragment recognized to 6.6 kb in the miR-449 targeted allele. [score:3]
A targeting construct was generated that contains the 5′ 4.9 kb and 3′ 4.7 kb homology arms, an loxP flanked neo cassette that replaces the sequences the encoding miR-449a, b and c. Southern blotting of the individual ES cell clones-derived genomic BamHI-digested DNA with an external 3′ probe was used to identify homologous recombinants. [score:3]
The Dcr [FH], miR-34bc and miR-449 targeting constructs were electroporated into A9 ES cells (ESCs) and manipulated to generate mice fully derived from ESCs [41]. [score:3]
Both the miR-34b/c and miR-449 showed highly restricted expression profiles across an assortment of mouse tissues (Fig. 2C) [32]. [score:3]
Next we wanted to determine the precise onset of miR-34b/c and miR-449a during spermatogenesis and we decided to take advantage of the first wave of spermatogenesis, as it proceeds in a near synchronous manner with the appearance of successive spermatogenic populations across juvenile mouse development (Fig. S1A). [score:2]
Our study identifies the miR-34b/c and miR-449 as the first miRNA loci required for mammalian spermatogenesis. [score:1]
This strategy is designed to remove the miR-449 without affecting the Cdc20B gene. [score:1]
The miR-449a, miR-449b and miR-449c miRNAs are encoded in 1.6 kb of sequence within an intron of 20 Kb of the coding Cdc20B gene. [score:1]
For the miR-34bc [−/−];449 [−/−] experiments, miR-34bc [+/−];449 [+/−] or miR-34bc [+/−] or miR-449 [+/−] were used as control mice. [score:1]
Position of the DNA encoding the pre-miR-449a, pre-miR-449b and pre-miR-449c are indicated within the intron of Cdc20B. [score:1]
Representative images from one of three independent experiments are shown for panel E and F. (A) qRT-PCR of miR-34a, miR-34b, miR-34c and miR-449a from control (Ctl) and miR-34bc [−/−];449 [−/−] adult testis. [score:1]
The miR-34b/c miRNAs are part of a miR-34 family encompassing six miRNAs (miR-34a, b, c and 449a, b, c) encoded by three distinct loci (miR-34a, miR-34b/c and miR-449) (Fig. 2B). [score:1]
Having established that loss of both miR-34b/c and miR-449 loci results in oligoasthenoteratozoospermia, we next wanted to define the etiology of this disorder. [score:1]
Deletion of miR-34bc and miR-449 leads to sterility due to the production of abnormal spermatozoa with reduced motility. [score:1]
To generate mice lacking all miR-449 miRNAs, we replaced the hairpins that encode all miR-449s with loxP flanked neo cassette. [score:1]
[1 to 20 of 22 sentences]
18
[+] score: 33
It was also reported that miR-449a and miR-145 played tumor suppressive roles by targeting E2F3 in gastric cancer [46, 47]. [score:5]
Also, downregulation of miR-449a was observed to be highly associated with tumor recurrence and lung cancer patients' survival, suggesting that miR-449a/E2F3 played a critical role in development of lung cancer [45]. [score:5]
Also, re -expression of miR-449a significantly increased apoptosis of gastric cancer cells by targeting E2F3 [46]. [score:5]
In gastric cancer cells, significant G0/G1 arrest was also observed after transfection of miR-449a mimics, which were stimulated by directly targeting of E2F3 [46]. [score:4]
The 3′-UTRs of E2F3 contained miR-449b binding sites, while E2F3 was also reported to be a direct target of miR-449a [44, 45]. [score:4]
Meanwhile, enforced miR-449a could lead to cell cycle arrest and cell senescence via regulation of E2F3 expression in lung cancer cells [45]. [score:4]
The introduction of miR-449a was found to be result in cell cycle arrest and cell senescence in A549 and 95D cells by targeting E2F3 [45]. [score:3]
Meanwhile, miR-449a/b and miR-34 was reported to induce inhibition of E2F1 and E2F3 in a negative feedback loopy, respectively [80]. [score:3]
[1 to 20 of 8 sentences]
19
[+] score: 29
The results revealed that there were 128 miRNA-target genes shared between hsa-miR-34a and hsa-miR-449a, 1 target gene shared between hsa-miR-34a and hsa-miR-432, and 1 target gene shared between hsa-miR-432 and hsa-miR-449a (see Table S5 for the complete list). [score:7]
For the analyses of the predicted miRNA-target genes, 621 genes for three miRNAs (hsa-miR-34a, hsa-miR-449a, and has-miR-432) were obtained using MAMI [39] and 684 genes for two miRNAs (hsa-miR-34a and hsa-miR-449a) were obtained using TargetCombo [40] (see Table S4 for the setting in each method and the results for each miRNA). [score:5]
Consistent with this, 70% of the 60 subjects of the learning set in this study had higher expression levels of the miR-449a than miRNA-449b in mononuclear leukocytes, which might explain the lack of association of miR-449b expression level with schizophrenia in this study. [score:5]
Three other miRNAs have also been implicated in neuropsychiatric disorders or neurodevelopment, e. g., miR-432 with autism in human cerebella cortex [48], miR-449 with Alzheimer's disease in cerebrospinal fluid [49], and miR-652 with embryogenesis in the mouse brain and spinal cord [31]. [score:4]
Previous studies indicated that the expression levels of miR-449a exceed those of miR-449b in all the systems analyzed [56]. [score:3]
It is intriguing to note that two of the seven miRNAs, miR-34a and miR-449a, share the same seed sequence and the direction and magnitude of their fold change were similar in our study. [score:2]
Another intriguing finding is that despite the close alignment of miR-449b to miR-449a, the former was not selected as a predictive biomarker in this study. [score:1]
From these a seven-miRNA signature (miR-34a, miR-449a, miR-564, miR-432, miR-548d, miR-572 and miR-652) was identified using stepwise logistic regression analysis, with a fold-change ranging from −1.4 to 2.5 (Table 1 ). [score:1]
It is worthwhile to note that miR-449a significantly correlated with most features of the WCST, implying that miR-449a might be sensitive to the executive function activity in the brain. [score:1]
[1 to 20 of 9 sentences]
20
[+] score: 26
For instance, miR-449-5p exerts anti-IAV activities by inhibiting histone deacetylase and, therefore, inducing IFNβ expression (18), and inhibition of miR-223-3p (which was more highly expressed in the DBA/2J strain in our study) reduced mortality and delayed death of H5N2-infected mice (64). [score:9]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
Many miRNAs whose expression differed between DBA/2J and C57BL/6J mice during infection belong to the miR-467, miR-449, and miR-34 families. [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
The miR-34 and miR-449 families control epithelial barrier repair (65) and regulate multiciliogenesis via the Delta/Notch pathway (66, 67), which might help transport virions out of the respiratory tract (68) and reduce end-organ damage. [score:2]
Using the ViTa Database, the human homologs of miR-135b-5p, miR-147-3p, miR-31-5p, miR-379-5p, miR-7a-5p, as well as the miR-449 (-5p) and miR-34 (-5p) families, were predicted to bind to viral RNA segments of influenza A/Puerto Rico/8/34/Mount Sinai (H1N1). [score:1]
An at least twofold greater induction in C57BL6/J mice was detected in eight miRNAs (miR-190a-3p, miR-449a-5p, miR-449a-3p, miR-449c-5p, miR-3096a-5p, miR-3096b-5p, miR-3096b-3p, and miR-669c-5p). [score:1]
Of note, miR-31-5p, miR-379-5p, miR-7a-5p, as well as some members of the miR-449 (-5p) and miR-34 (-5p) families were moderately to highly abundant (>10 CPM), making it more likely that they would bind to a biologically relevant number of viral RNAs. [score:1]
Of these two, the miR-449 family is of considerable interest with respect to the higher resistance of C57BL/6J mice, because—in addition to their different abundance in the two strains—these miRNAs were more strongly induced in C57BL/6J mice, suggesting that their higher abundance is less due to mere leukocyte infiltration. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Cui et al. [166] reported that the tumor suppressors miR-449 and miR-29a both target p42.3 (suppressor APC domain containing 2) in GC, promoting increased G2/M cell cycle progression and proliferation. [score:7]
Bou Kheir T. Futoma-Kazmierczak E. Jacobsen A. Krogh A. Bardram L. Hother C. Gronbaek K. Federspiel B. Lund A. H. Friis-Hansen L. miR-449 inhibits cell proliferation and is down-regulated in gastric cancer Mol. [score:6]
miR-449, which targets cyclin E2 and geminin, among others, and normally promotes senescence and apoptosis, is down-regulated in GC. [score:6]
Consistent with these biological functions, down-regulation of miR-449 in GC promotes G1/S and M/G1 cell cycle progression and cell proliferation [178]. [score:4]
Li L. P. Wu W. J. Sun D. Y. Xie Z. Y. Ma Y. C. Zhao Y. G. miR-449a and CDK6 in gastric carcinoma Oncol. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 23
In prostate cancer cell lines miR-449a was shown to have growth suppressing activity partly through inhibition of HDAC-1 expression [50]. [score:7]
In the cases of miR-130b and miR-19a, up regulated in HP (with positive correlation with the cell-cycle genes), and miR-449a, miR-299, miR-154 and miR-145, downregulated in HP (with negative correlation with the cell-cycle genes), the effect of miRNA over -expression on proliferation was confirmed in cell lines. [score:7]
Among the miRNAs that were down-regulated in HP samples we found the strongest matching effect for miR-449a (MCF-7), miR-154 (BT-474) and miR-34c-5p (MCF-7 and BT-474) (Figure 5A and B). [score:4]
The expression patterns of miR-449a and of HDAC-1, in our cohort, are anti-correlated (Pearson's r = −0.26) and it might be that the mechanism is similar in breast cancer. [score:3]
The strongest effect was seen for miR-449a. [score:1]
The miRNAs selected for this validation were miR-17-5p, miR-18a, miR-18b, miR-19a, miR-29c, miR-34c-5p, miR-142-3p, miR-150 and miR-449a, and the endogenous control used was RNU6B. [score:1]
[1 to 20 of 6 sentences]
23
[+] score: 22
[36– 38] miR-125b TLR signaling Abolish the cytokine production[39] miR-19a Enhance IFNα and interleukin-6[42] miR-192Upregulate TGF-β1 expressionMediate HCV infection -associated fibrogenesis[44] miR-152Target the WNT1 3′-UTRRegulate proliferation, G1-S transition, and colony formation in HepG2 cells[45] miR-491 Enhance HCV replication[46] miR-449a NOTCH signaling Inhibit TNFa -mediated activation of YKL40[49] HCV hepatitis C virus IFN interferon miRNA microRNAs DUSP dual specific phosphatases TLR toll-like receptor JAK/STAT Janus kinase/signal transducer and activator of transcriptions SOCS suppressors of cytokine signaling TGF-β transforming-growth factor-β PI3K/Akt phosphatidylinositol 3-kinase and Akt/protein kinase B NS5A non-structural protein 5A HZ made contributions to conception and design of the work, and was a major contributor in writing the manuscript. [score:13]
Moreover, miRNA-449a in liver biopsies is downregulated in chronic HCV infected patients, but not in patients with alcoholic or non-alcoholic liver disease, and the downregulation of miRNA-449a promotes TNFa -mediated activation of YKL40 through NOTCH signaling pathway [49]. [score:9]
[1 to 20 of 2 sentences]
24
[+] score: 20
In addition, miR-449 expression is not substantially increased in miR-34 -null mice, and activation of the p53 pathway does not lead to significant upregulation of miR-449 (Figure S8). [score:6]
Figure S8Expression of miR-449a, miR-449b and miR-449c. [score:3]
Although our observation that single KO and miR-34 [T KO/T KO] mice produce viable offspring argues against an essential role for miR-34 in these processes, members of the related miR-449 family, that are particularly highly expressed in the testis (Figure S8), could partially compensate for miR-34 loss in this context. [score:3]
A notable exception is represented by the testis, in which expression of miR-449a is particularly elevated (Figure S8). [score:3]
First, in the tissues and cells used in our experiments, the expression of miR-449 members is much lower compared to miR-34a and miR-34c, as judged by multiple independent methods including qPCR, Northern blotting and high throughput sequencing (Figure S8 and data not shown). [score:2]
In particular, members of the miR-449 family (miR-449a, b and c) have the same “seed” sequence as miR-34, and miR-34 antagonists could in principle impair their function as well. [score:1]
For each tissue, the same membrane was serially probed first for the three members of the miR-449 family and lastly for miR-34a. [score:1]
A conclusive test for this hypothesis will require the generation of compound miR-34 and miR-449 mutant animals, but several lines of evidence suggest that this explanation is not particularly likely. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 19
Hsa-miR-449a shows a striking expression pattern during human pre-natal development, [23] which may be related to ciliogenesis in the ventricular system, [24] and hsa-miR-548d is involved in regulating the expression of erb-b2 receptor tyrosine kinase 2 (ERBB2), one of the receptors in NRG1–ErbB signaling pathways. [score:7]
[17] Although the relative expression of only two miRNAs (hsa-miR-34a and hsa-miR-449a) reached statistical significance in the peripheral sample, the remaining four, except hsa-miR-432, tended to be upregulated. [score:6]
Intriguingly, the finding of another peripheral study using a cohort of preterm infants and adults [35] showed that six (hsa-miR-34a, hsa-miR-449a, hsa-miR-564, hsa-miR-432, hsa-miR-548d and hsa-miR-572) of the seven schizophrenia -associated miRNAs were consistently expressed from infancy to adulthood. [score:3]
Among the seven miRNAs, hsa-miR-449a and hsa-miR-548d have been shown to be relevant to brain development or function. [score:2]
We previously identified a seven-miRNA (hsa-miR-34a, miR-449a, miR-564, miR-432, miR-548d, miR-572 and miR-652) signature as a potential biomarker for schizophrenia. [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
MiR-1a, miR-140 and miR-449 were significantly up-regulated in both tissues, while miR-455, miR-34b and miR-34c were only up-regulated with AIV infection in tracheae. [score:7]
Of particular interest, miR-1a, miR-140, and miR-449, which were highly expressed in infected tracheas than the non-infected ones, and also were differentially expressed between infected tissues (higher expression levels in infected tracheae than infected lungs). [score:7]
When tissues in the state of virus infection were compared, 28 and 23 miRNAs were specifically and highly expressed in lungs, respectively, and only 6 miRNAs (miR-1a-1 and 2, miR-1b, miR-34b, 34c and miR-449) were highly expressed in tracheae (Table 5). [score:4]
[1 to 20 of 3 sentences]
27
[+] score: 18
To demonstrate the biological consequences of miRNA regulation, a target for the miR-449 family, HDAC1, was analyzed in detail. [score:4]
In addition to the role for miR-449 family members in antiviral responses, a previous report has also implicated miR-449a in targeting HDAC1 in prostate cancer cells. [score:3]
MiR-449b shares this conserved seed region with other members of the miR-449 family, miR-449a and miR-449c (Figure 4B), all of which are expressed as a result of influenza A virus infection (Figure 2). [score:3]
MicroRNAs miR-187 (previously identified to be induced by influenza A virus [26]), miR-147b, miR-190b, miR-874, and the miR-449 family (miR-449a, miR-449b, and miR-449c) were all validated as highly regulated by influenza A virus infection (Figure 2). [score:2]
The miR-449 family (miR-449a, miR-449b, and miR-449c) are all encoded within an intronic region of the CDC20b gene on human chromosome 5, and this miRNA cluster was previously reported to be coordinately regulated during airway differentiation and following E2F activation [56, 57]. [score:2]
In this context, miR-449a regulation of HDAC1 causes cell cycle arrest and apoptosis [57- 59]. [score:2]
Influenza A Virus Infection Induces Cellular MicroRNAs, Including the miR-449 Family. [score:1]
Follow-up experiments focused on a biologically relevant miRNA-mRNA pair identified between the miR-449 family and HDAC1. [score:1]
[1 to 20 of 8 sentences]
28
[+] score: 18
In contrast, the overexpression of miR-449a suppressed AKT activation in hepatocellular carcinoma (Chen et al., 2015). [score:5]
Further studies are required in order to identify the miRNAs, including miR-9, miR-17-5p, miR-135a, and miR-449a, that contribute to K [Ca]1.1 translational repression via mRNA degradation in AR -overexpressing breast cancer tissues. [score:5]
MiR-449a suppresses the epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by multiple targets. [score:4]
We identified miR-9, miR-17-5p, miR-135a, and miR-449a as androgen-regulated, K [Ca]1.1-down -regulating miRNAs in prostate cancer. [score:3]
Mus musculus-microRNA-449a ameliorates neuropathic pain by decreasing the level of KCNMA1 and TRPA1, and increasing the level of TPTE. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 17
Ren X. S. Yin M. H. Zhang X. Wang Z. Feng S. P. Wang G. X. Luo Y. J. Liang P. Z. Yang X. Q. He J. X. Tumor-suppressive microRNA-449a induces growth arrest and senescence by targeting E2F3 in human lung cancer cells Cancer Lett. [score:5]
Ye W. W. Xue J. S. Zhang Q. Li F. Y. Zhang W. Chen H. J. Huang Y. B. Zheng F. Y. MiR-449a functions as a tumor suppressor in endometrial cancer by targeting CDC25A Oncol. [score:4]
Zhou Y. Q. Chen Q. Y. Qin R. Zhang K. F. Li H. MicroRNA-449a reduces cell survival and enhances cisplatin -induced cytotoxicity via downregulation of NOTCH1 in ovarian cancer cells Tumor Biol. [score:3]
First, mmu-mir-449a has been shown as a tumor suppressor in endometrial cancer [16, 19], gastric carcinoma [15], lung cancer [17, 32], ovarian cancer [33], prostate cancer [18], etc. [score:3]
In the current study, we showed that three of the fifteen microRNAs, mmu-mir-449a, mmu-mir-1935 and mmu-mir-1894, had significant effects on lung metastasis of cancer cells. [score:1]
Of these microRNAs, fifteen constructs, including mmu-miR-487b [11, 12], mmu-miR-467e [13], mmu-miR-466d [14], mmu-miR-449a [15, 17, 18, 32, 33], mmu-miR-148a [20], mmu-miR-133a-1 [21], mmu-miR-1-2-as [22], mmu-miR24-2 [23], mmu-miR-1940, mmu-miR-1935, mmu-miR-1931 [24], mmu-miR-1902, mmu-miR-1895, mmu-miR-1894 [24], and mmu-miR-1193, were examined in this study. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 17
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
[1 to 20 of 4 sentences]
31
[+] score: 16
Yang X. Feng M. Jiang X. Wu Z. Li Z. Aau M. Yu Q. miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A Genes Dev. [score:7]
Expression of miR-449 slows growth of HCC xenograft tumors in mice, suggesting that this miR might function as a tumor suppressor [53]. [score:5]
In HCC cells, Buurman reported that miR-449 directly targets c-Met, leading to an increase of apoptosis and growth arrest of liver cancer cell lines. [score:4]
[1 to 20 of 3 sentences]
32
[+] score: 16
C-F. Four differentially expressed miRNAs with fold change of over 2 among all time points, including the up-regulated hsa-miR-184 (C), hsa-miR-449a (D), hsa-miR-449b-5p (E), and the down-regulated hsa-miR-302d-3p (F), were selected for validation of the microarray results in hiPSC-RPE at 0, 30, 60, and 90 dpd. [score:9]
Agreed with the microarray data, hsa-miR-184, hsa-miR-449a and hsa-miR-449b-5p were consistently up-regulated along with the differentiation, while hsa-miR-302d-3p was down-regulated (Figures 1C-1F). [score:7]
[1 to 20 of 2 sentences]
33
[+] score: 15
However miR-449 expression was shown to be significantly downregulated in the antrum of gastrin knockout mice relative to wild-type counterparts [25]. [score:7]
Dysregulation of the miR-449/pRB-E2F1 regulatory loop therefore increases E2F1 activity and promotes cell cycle progression and inhibits apoptosis in gastric cancer. [score:5]
The transcription factor E2F1 promotes miR-449 transcription which inhibits the oncogenic genes CDC25A and CDK6. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 15
mRNA, messenger RNA Table 1circRNA-miRNA-mRNA network elements for those circRNA-miRNA interactions predicted by both miRanda and RNAHybrid, with a miRanda match score > = 180 and mRNA targets that are differentially expressed (uncorrected P < 0.05) with log2(fold change) >= 2 or =< − 2 (high stringency network) Circular RNA microRNA target Number of binding sites predicted Target genes (differentially expressed) X:47,431,299–48,327,824 hsa-miR-139-5p 6 NOTCH1, STAMBP, TPD52 8:144,989,320–145,838,888 hsa-miR-320a 2 METTL7A, PBX3, PLS1, SEC14L1, VCL, VIM, VOPP1, YPEL2 8:144,989,320–145,838,888 hsa-miR-320b 2 RTKN, VCL, VOPP1 X:47,431,299–48,327,824 hsa-miR-449a 1 BAZ2A, MFSD8, NOTCH1, TSN, ZNF551 8:144,989,320–145,838,888 hsa-miR-125a-3p 1 ANKRD62, C15orf40, COL18A1, MFSD11, MPEG1, MUL1, TTC31, WDR12, ZNF641 X:47,431,299–48,327,824 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 8:144,989,320–145,838,888 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 X:47,431,299–48,327,824 hsa-miR-324-5p 1 FOXO1, MEMO1, PSMD4, SMARCD2 14:23,815,526–24,037,279 hsa-miR-142-3p 1 BTBD7, CLDN12, CPEB2, CSRP2, DAG1, KIF5B, PTPN23, WHAMM 4:88,394,487–89,061,166 hsa-miR-133b 1 FAM160B1 4:88,394,487–89,061,166 hsa-miR-448 1 DDIT4, PURG 4:88,394,487–89,061,166 hsa-miR-339-5p 1 AXL, HLA-E, METTL7A, ZNF285, ZNRF3 MetaCore pathway analysis on the 255 filtered differentially expressed target genes from the previous analysis revealed 112 perturbed pathways (corrected P < 0.01; Table  2, Additional file  8: Table S5). [score:15]
[1 to 20 of 1 sentences]
35
[+] score: 15
Mir-449a/b show a striking expression pattern during pre-natal development, with a peak of expression at week 17. [score:5]
Mir-449 has been shown to control ciliogenesis in the human airway epithelium [35], and has been proposed to regulate choroid plexus development based on expression patterns in the mouse brain [36]. [score:4]
For example, hsa-mir-449a/449b show a dramatic change in expression during 14–20 week gestation, with a peak at week 17. [score:3]
The peak in mir-449 expression at week 17 may be related to ciliogenesis in the ventricular system, which if impaired, can impact ion transport and cerebrospinal fluid production and flow [37]. [score:3]
[1 to 20 of 4 sentences]
36
[+] score: 14
One study confirmed miR-449a could inhibit proliferation and induce apoptosis by directly targeting E2F3 in gastric cancer [27]. [score:6]
In this study, miR-449 family member miR-449c-5p was firstly identified to also function as a negative regulator in VICs osteogenic differentiation. [score:2]
The findings were consistent with previous studies about the function of miR-449 family on osteogenic differentiation. [score:1]
In recent years, it was reported in many studies that miR-449 family was closely related to osteogenic differentiation. [score:1]
Studies have confirmed miR-449 family members are primarily involved in tumor pathogenesis. [score:1]
This study further expands our current knowledge of the importance of the miR-449 family in osteogenic differentiation and bone formation. [score:1]
This cluster, which encodes the highly conserved miR-449, contains similar sequences and secondary structures as the miR-34 family, so they are classified as a single miRNA family [26]. [score:1]
The human miR-449 cluster is located on chromosome 5 in a highly conserved region within the second intron of the CDC20B gene. [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 13
Consequently, downregulation of miR-449, as occurs following H. pylori infection, promotes cell cycle progression and proliferation through the upregulation of cyclin E2 and geminin. [score:7]
miR-449 is downregulated in H. pylori-infected gastric mucosa and in gastric cancer and targets cyclin E2 and geminin. [score:6]
[1 to 20 of 2 sentences]
38
[+] score: 13
Physiol Genomics 45 Yang X Feng M Jiang X Wu Z Li Z 2009 miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. [score:7]
Consistent with a possible role of this miR-449 induction in cell cycle arrest during senescence, miR-449 has been shown to inhibit cell cycle progression at G1 phase by targeting CDK6 and CDC25A, which are pivotal to G1/S-phase transition [45]. [score:5]
Members of the miR-449 family were among the most highly induced miRNAs in senescent fibroblasts. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 12
As an oncogene, NEAT1 could inhibit miR-449-5p expression, resulting in upregulated c-MET expression, which promoted proliferation, migration, and invasion, and inhibited apoptosis of glioma cells [18]. [score:12]
[1 to 20 of 1 sentences]
40
[+] score: 11
It is also known that miR-449a expression was negatively correlated with NEAT1 expression [61]. [score:5]
Additionally, miR-449a overexpression affected the cell cycle by lengthening the G1/G0 phase and shortening the S and G2/M phases. [score:3]
MiR-449a was shown to function as a tumor suppressor in lung cancer by decreasing proliferation and increasing apoptosis. [score:2]
You et al. looked at the interaction between the lncRNA, nuclear enriched abundant transcript 1 (NEAT1) and miR-449a in lung cancer cells (Figure 1). [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 11
Furthermore, hsa-miR-34a, hsa-miR-34c-5p, hsa-miR-449a, hsa-miR-607 and hsa-miR-664-3p are associated with neuropsychaitric and nuerodegenrative diseases [40], Bipolar disorder and Schizophenia [41], Molecular Targets for Neurodegenerative diseases [42], Neurodegenerative diseases [43], and Psychiatric and Neurodegenerative disease [44], respectively. [score:11]
[1 to 20 of 1 sentences]
42
[+] score: 11
Other miRNAs from this paper: hsa-mir-199b, hsa-mir-206, hsa-mir-433
Importantly, inhibition of Notch1 signaling by overexpression of miR-449a could sensitize chemoresistant ovarian cancer cells to cisplatin -induced cytotoxicity. [score:5]
The study by Zhou et al. provides evidence that downregulation of miR-449a could enhance ovarian cancer cell proliferation and induce cisplatin resistance. [score:4]
It may suggest that the miR-449a/Notch1 axis plays a significant role in the development of ovarian cancer [62]. [score:2]
[1 to 20 of 3 sentences]
43
[+] score: 11
A search of miRNAs preferentially expressed in normal lung in our previously published dataset found a group of 3 miRNAs (miR-34b, miR-34c, and miR-449) that had approximately a thousand copies or less each cell in testes, fallopian tubes, lung, and trachea, while the rest of tissues examined had no or barely detectable levels of expression [9] (Figure 2A). [score:5]
Although miR-449 lacks such information as transcriptional regulation and functional roles, a web -based tool [21] that identifies potential cis-regulatory elements by comparative genomics recognizes a p53 -binding site within a region about 1.5 kb upstream to the miR-449 gene (see Additional file 2 and its Figure 1). [score:3]
Two independent datasets were used to test the hypothesis whether these miRNAs (miR-449 was not available in these two databases) had reduced expression in lung cancer. [score:3]
[1 to 20 of 3 sentences]
44
[+] score: 11
Another potential insight into the biological mechanisms related to KITLG methylation comes from our co -expression network analyses showing that KITLG is part of a gene network enriched for genes regulated by miRNAs 449 (miR449), 23A/23B (miR23A/miR23B) and 9 (miR9). [score:4]
With the webGestalt tool, we found that the 21-gene network around KITLG is a preferred target for three miRNAs: miR449 (genes COL12A1, SHKBP1 and KITLG FDR [hypergeometric] (FDR, false discovery rate)=0.0012), miR23A/miR23B (genes EYA1, HMGN2 and KITLG FDR [hypergeometric]=0.0018) and miR9 (genes COL12A1, CCDC43 and KITLG FDR [hypergeometric]=0.0019; Supplementary Table 3). [score:3]
Specifically, miR449 is involved in the regulation of corticotropin-releasing factor type 1 receptor in the anterior pituitary and HPA-axis activation 31. [score:2]
The entire red module (containing 9,494 of 19,815 genes) was enriched for genes related to these three miRNAs (miR449 Fisher's exact test, odds ratio (OR)=1.4, P=0.0015, FDR=0.009, miR23A/miR23B Fisher's exact test, OR=1.4, P=7.3 × 10 [−6], FDR=9.8 × 10 [−5] and miR9 Fisher's exact test, OR=1.3, P=9.5 × 10 [−5], FDR=0.0006). [score:1]
Several other methylation modules were also enriched for these miRNAs (10 modules enriched for miR449 Fisher's exact test FDR<0.05; 19 modules enriched for miR23A/miR23B Fisher's exact test FDR<0.05 and 20 modules enriched for miR9 Fisher's exact test FDR<0.05; Supplementary Table 4–6). [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 10
Epigenetic silencing of HDAC1 by miR-449a upregulates Runx2 and promotes osteoblast differentiation. [score:4]
For example, HDAC4 has been confirmed to be one of the important targets of miR-140 (Song et al., 2009), whereas miR-449a binds to the 3′UTR of HDAC1 (Noonan et al., 2009; Liu et al., 2015). [score:3]
miR-449a targets HDAC-1 and induces growth arrest in prostate cancer. [score:3]
[1 to 20 of 3 sentences]
46
[+] score: 10
However, circUBAP2 can control cancer by reducing Bcl-2 levels as a consequence of sequestering miR-143Studies have shown that circ_0009910 acts as a sponge for miR-449a and promotes the expression of IL6R, which is the target of miR-449a. [score:5]
However, circUBAP2 can control cancer by reducing Bcl-2 levels as a consequence of sequestering miR-143 Studies have shown that circ_0009910 acts as a sponge for miR-449a and promotes the expression of IL6R, which is the target of miR-449a. [score:5]
[1 to 20 of 2 sentences]
47
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Up-regulation of miR-276 promotes liver stenosis whereas down-regulation of miR-449a and miR-107, as well as up-regulation of miR-200c, supports hepatic fibrosis [43, 65]. [score:10]
[1 to 20 of 1 sentences]
48
[+] score: 10
miRNA target has-miR302a MECP2 hsa-miR29a TET1, TET2, TET3 has-miR29a/c DNMT3A, DNMT3B has-miR29b-1/2 DNMT1 (Indirect via SP1) hsa-miR148a DNMT3B hsa-miR148a DNMT1 hsa-miR152 DNMT1 has-miR302a DNMT1 (Indirect via AOF2) hsa-miR342 DNMT1 hsa-miR17-92 DNMT1 hsa-miR26a-1/2 EZH2 hsa-miR101-1/2 EZH2/EED hsa-miR214 EZH2 hsa-miR128-1/2 BMI-1 hsa-miR199a-1/2 BRM hsa-miR433 HDAC6 hsa-miR449a HDAC1 hsa-miR138 SIRT1In the first column we report a list of miRNAs which are known to target epigenetic regulators and in the second column the corresponding targets. [score:10]
[1 to 20 of 1 sentences]
49
[+] score: 10
mir-449a/b is downregulated and directly targets HDAC1, a histone deacetylase in lung cancer (Jeon et al., 2012). [score:7]
Combining microRNA-449a/b with a HDAC inhibitor has a synergistic effect on growth arrest in lung cancer. [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 9
In our study miR-449a was downregulated from 12 hrs to 168 hrs, suggesting that it may have a different role from that of miR-34a in regulating the recovery processes in cerebral ischemia. [score:5]
miR-449a also targeted WISP2 in Wnt signaling pathway. [score:3]
Furthermore, miR-449a was also reported to bring about cell cycle arrest and apoptosis by a partially p53-independent mechanism in cancer stem cells [59], [60]. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 9
On the other hand, miR-192 and miR-194 were highly expressed in the kidney and small intestine, and miR-449a was highly expressed in the lung (Figures 3(d) and 3(e)). [score:5]
The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure. [score:3]
In addition, we identified miR-449a as a lung-specific miRNA in rodents in the present study. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 9
MicroRNAs that function as oncogenes, including miR-17, miR-21, and miR-106a, were upregulated, whereas microRNAs that function as tumor suppressors, such as miR-101, miR-181, miR-449, miR-486, and let-7a, were downregulated in gastric cancer [42, 43]. [score:9]
[1 to 20 of 1 sentences]
53
[+] score: 8
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-148a, hsa-mir-34a, hsa-mir-1297
Given that CDK6 is a target of miR-449a that can also be inhibited by p15INK4B and p16INK4A, the positive feedback loop formed by ANRIL promotes GC cell proliferation [85] as shown in Figure 4B. [score:5]
In addition, ANRIL epigenetically silences miR-99a/miR-449a expression in GC cells by binding to PRC2 with EZH2 and SUZ12 in trans, and this complex triggers mTOR and CDK6/E2F1 pathways to promote GC cell proliferation and growth [85]. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 8
Amongst the isolated miRNAs worth noting is miR-214, clearly involved in cancer and stemness [18, 19]; miR-9, involved in neurogenesis [20] and, very interestingly, protective in neural cells of HGPS patients against the effects of progeria [21]; miR-298, involved in the regulation of beta-amyloid precursor protein converting enzyme messenger RNA translation, and thus in Alzheimer’s disease [22]; the tumour suppressor miR-34a [23]; and miR-449a involved in differentiation [24] and pRB mediated cell cycle arrest [25]. [score:8]
[1 to 20 of 1 sentences]
55
[+] score: 8
In addition, the lack of a strong effect of genetic deletion of miR-34a could also be secondary to functional redundancy provided by the other miR-34 members or other p53-regulated tumor suppressor miRNAs [45– 49] or by the p53-independent miR-449 family, which shares a seed sequence with miR-34 [50]. [score:4]
In mice, miR34b/c and the related miR-449 cluster are expressed specifically in multiciliated epithelia and their KO causes infertility and respiratory dysfunction [6, 7], supporting their distinct roles. [score:3]
Three chromosome 5q11.2 miRNAs (miR-449a/b/c) share a seed sequence with miR-34, and have a tissue distribution similar to that of miR-34b/c [6, 7]. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 8
Moreover, we also identified that the expression changes of MIR34c-5p (p-value < 0.33), and MIR449a (p-value < 0.50) contributed to the expression changes of TATA binding protein -associated factor 5 (TAF5) (p-value < 0.25) via miRNA regulations (p-value < 1☓10 [-16]). [score:6]
Dysregulation of MIR34c-5p and MIR449a contributes to the frequency of latent HIV infection. [score:2]
[1 to 20 of 2 sentences]
57
[+] score: 7
Yang X. Feng M. Jiang X. Wu Z. Li Z. Aau M. Yu Q. miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate PRB-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A Genes Dev. [score:7]
[1 to 20 of 1 sentences]
58
[+] score: 7
And in HCC, upregulation of HDACs (HDAC1–3) was associated with repression of miR-449, which led to activation of the putative miR-449 target gene c-MET (Buurman et al., 2012). [score:6]
Histone deacetylases activate hepatocyte growth factor signaling by repressing microRNA-449 in hepatocellular carcinoma cells. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 7
Upregulation of miR-449a effectively increases irradiation -induced DNA damage and apoptosis, and eventually enhances radiosensitivity of CL1-0 LAD cells [44]. [score:4]
Also, overexpression of miR-449a in lung adenocarcinoma cell line (CL1-0) effectively increased irradiation -induced DNA damage and apoptosis, altered the cell cycle distribution and eventually led to sensitization of CL1-0 to irradiation [13]. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
MiR-449, whose expression is increased during the proliferation and differentiation of airway ciliated cells, has been confirmed to target NOTCH1 mRNA. [score:4]
Marcet B. Chevalier B. Luxardi G. Coraux C. Zaragosi L. E. Cibois M. Robbe-Sermesant K. Jolly T. Cardinaud B. Moreilhon C. Control of vertebrate multiciliogenesis by miR-449 through direct repression of the delta/notch pathwayNat. [score:2]
As a result, ciliated cells are reduced in number, whereas the number of mucous cells increases, implying an miR-449 contribution to altered epithelial differentiation observed in asthma [42, 54]. [score:1]
[1 to 20 of 3 sentences]
61
[+] score: 7
Regeneration-miRNAs were up-regulated (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), while degenerative-miRNAs (miR-1, miR-29c, and miR-135a) were down-regulated in mdx mice and in DMD patients’ muscles. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 7
Furthermore, in silico analysis demonstrated that miR-23b, miR-24-2, miR-141, and miR-449 act as tumour suppressors by inhibiting translation of CTNNB1 mRNA, while miR-150 was proposed to be acting as an oncomiR by modulating adenomatous polyposis coli (APC) [134]. [score:7]
[1 to 20 of 1 sentences]
64
[+] score: 7
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In a number of single studies, miRNAs such as let-7d [26], let-7i [26] and miR-210 [23] were also found to be up-regulated in prostate cancer, in contrast to let-7g [23], miR-27b [28], miR-99a [23], miR-126 [54], miR-128 [26], miR-152 [28], miR-200a [58] and miR-449a [59] which were down-regulated in prostate cancer samples. [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 6
The “metabolism B” node includes GAPDH, PGK1, LDHA and pyruvate kinase proteins, among others; and also miR-449a, whose expression showed a negative correlation with the functional node activity (Sup. [score:3]
Moreover, miR-139-5p, miR-149, miR-449a and miR-342 were overexpressed in ER+ tumors with regard to TNBCs 10, 24, 48, 49. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 6
Two miRNAs, miR-375 and miR-449 were specific only to airway samples, indicating that these miRNAs are expressed in a cell type that is explicit the airways. [score:3]
Three miRNAs, miR-375, miR-449 and miR-200c were specifically expressed only in the airway samples. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 6
Specifically, E2F1 induces cell cycle progression but also potentiates apoptosis via upregulating pro-apoptotic miR-449a/b expression [91]. [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 6
Low expression of miR-449 in gynecologic clear cell carcinoma. [score:3]
Similarly, low miR-449 expression [23] and high miR-30a/ 30a* expression [24] were identified as characteristic of an OCCC-specific miRNA molecular profile. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 6
3'UTR lengths were derived from RefSeq gene conversion as shown in Table 7. The most significant evolutionary conserved motif in the top 1% and top 5% genes (Table 5) correspond to a potential miRNA target site; YACTGCCR and WGCCTTA have seed complementarity to miR-34/miR-449 and miR-124. [score:3]
3'UTR lengths were derived from RefSeq gene conversion as shown in Table 7. The most significant evolutionary conserved motif in the top 1% and top 5% genes (Table 5) correspond to a potential miRNA target site; YACTGCCR and WGCCTTA have seed complementarity to miR-34/miR-449 and miR-124. [score:3]
[1 to 20 of 2 sentences]
70
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
miR-34 and miR-449 are also involved in the inhibition of NSCLC cell migration and invasion by suppression of AXL and SNAIL-1, respectively a tyrosine-kinase receptor and a zinc-finger protein involved in cellular migration, proliferation and cancer cell epithelial-mesenchymal transition [123- 124]. [score:5]
The miR-449 cluster (miR-449a, miR-449b, miR-449c) belongs to the same family as miR-34 (p53- responsive microRNAs) [122]. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 5
Expression of BMI1, Ub-H2A protein in MDAMB-231cells transfected with Anti-miR- 200a, Anti-miR-200b, Anti-miR-15a, Anti-miR-449, Anti-miR-203 (C) BMI1, RING1A localization in MDAMB-231 cells having overexpressed miR-200a, miR-200b, miR-15a, miR-449, miR-203under confocal microscopy (D, E). [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
You et al. found that miR-449a inhibited cell growth in lung cancer and regulated lncRNA NEAT1 [11]. [score:4]
Zhang et al. presented that lncRNA ANRIL indicated a poor prognosis of gastric cancer and promoted tumor growth by epigenetically silencing of miR-99a/miR-449a [10]. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 5
Han R. Ji X. Rong R. Li Y. Yao W. Yuan J. Wu Q. Yang J. Yan W. Han L. Mir-449a regulates autophagy to inhibit silica -induced pulmonary fibrosis through targeting bcl2J. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
A recent report suggested that miR-449a regulates the chondrogenesis of human MSCs through direct targeting of Lymphoid Enhancer-Binding Factor-1 [29]. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
Indeed, several deregulated miRNAs including miR-221, miR-222, miR-449a, miR-21, miR-205, miR-10b, miR-143 and miR-181a have been shown to regulate cell growth, apoptosis, migration and invasion [18– 23], indicating an essential role of miRNAs in tumorigenesis of NSCLC. [score:3]
Deregulation of miRNAs such as miR-221, miR-222, miR-449a, miR-21, miR-205, miR-10b, miR-143 and miR-181a in NSCLC has been shown to be a key factor in tumorigenesis [31]. [score:2]
[1 to 20 of 2 sentences]
76
[+] score: 5
Similarly, transcriptional regulation may also be important for many of the significantly repressed miRNAs in smoker alveolar macrophages because ten downregulated miRNAs were processed from four polycistronic pri-miRNAs (miR-224/miR452, miR-200a/miR-200b/miR-429, miR-449a/miR-449b/miR-449c, and let-7e/miR-99b/miR-125a). [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
A group of 39 miRNAs was significantly down-regulated by Nkx2-1 knock-down including miR-1195 (−4.9 fold), miR-378 (−4.6 fold), miR-449a (−2.1 fold), and miR-130a (−1.9 fold) (Figure  2A and Table  1). [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
In this study, we overexpressed miRNA449a/b in gastric cancer cells, and examined the effect of miRAN449a/b overexpression on cell proliferation and apoptosis of gastric cancer cells in details. [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 5
A recent paper reported that inactivation of two miRNA clusters, miR-34b/c and miR-449 clusters, with identical seed sequences, affected brain development, and microtubule dynamics (Wu et al., 2014). [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
Of the 6 miRNAs in this miRNA seed family (miR-34a,b,c, and miR-449a,b,c) only miR-34a and miR-34c are annotated in pig, in agreement with the detected miRNAs in our profiling experiment. [score:1]
[1 to 20 of 3 sentences]
80
[+] score: 5
Several deregulated miRNAs in NSCLCs such as miR-221, miR-222, miR-449a, miR-21, miR-205, miR-10b, miR-143 and miR-181a have been shown to regulate cell growth, apoptosis, migration and invasion [11– 16]. [score:3]
Deregulation of miRNAs such as miR-221, miR-222, miR-449a, miR-21, miR-205, miR-10b, miR-143 and miR-181a in NSCLC is a key factor underlying tumorigenesis [25]. [score:2]
[1 to 20 of 2 sentences]
81
[+] score: 5
HDAC1–3 inhibition -mediated miR-449 expression promotes cell apoptosis and reduces cell proliferation in hepatocellular carcinoma [27]. [score:5]
[1 to 20 of 1 sentences]
82
[+] score: 5
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-331
Our previous studies also showed that lncRNA ANRIL could be a growth regulator, which promoted GC proliferation by epigenetically silencing of miR-99a/miR-449a [11]; lncRNA HOTAIR could function as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in GC [12]. [score:5]
[1 to 20 of 1 sentences]
83
[+] score: 4
Restoration of miR-449 in gastric cancer cells led to down-regulation of the GMNN, MET, CCNE3 and SIRT1 genes, which is accompanied by a reduction in cell proliferation (Ref. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
MiR-449a exerts tumor-suppressive functions in human glioblastoma by targeting Myc -associated zinc-finger protein. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
MiR-449a exerts tumor-suppressive functions in human glioblastoma by targeting Myc -associated zinc-finger protein. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
For example, the combined use of 3-deazaneplanocin A (DZNep) and trichostatin A (TSA), but not their single use, could dramatically induce miR-449 expression [50]. [score:3]
For instance, miR-139-5p, miR-125b, miR-101, let-7c, miR-200b were found to be epigenetically repressed by EZH2, and miR-449 was repressed by HDACs in human hepatocellular carcinoma (HCC) [30, 31]. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 4
The endogenous expression of miR-34a/b/c and miR-449a/b/c is low in MDA-MB-231 cells, with RPM values below 300 for both 5p and 3p strands for all these miRNAs based on sequencing data from control mimic transfected MDA-MB-231 cells (Fig.   3a, Supplementary data  S5, and data not shown). [score:3]
Interestingly, miRBase also annotates a seed-shifted version for one miR-449 family member (miR-449c), but also here less than 5% of the deep sequencing reads deposited in the miRBase match the annotated miR-449c. [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 4
They also showed the up-regulation of miR-1, miR-449a and a 60-fold induction of miR-135b. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
Furthermore, they experimentally validate miR-449, miR-19a/b, miR-29a/b/c, and miR-202 as direct MYCN -targeting miRNAs. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
As an important epigenetic mechanism, histone acetylation has been engaged in many types of cancers by transcriptional regulation of genes expression such as miR-200a, miR-449 and miR-15a [39]– [41]. [score:4]
[1 to 20 of 1 sentences]
91
[+] score: 4
Recent studies validated E2F3 as the direct target of various miRNAs, such miR-449a and miR-200b, to be involved in the abnormal proliferation and chemoresistance lung cancer [17, 23], supporting its multifacet roles in the pathological onset or progression in lung cancer. [score:4]
[1 to 20 of 1 sentences]
92
[+] score: 4
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Then, Abu-Halima et al. showed that hsa-miR-34b*, hsa-miR-34b, hsa-miR-34c-5p, hsa-miR-449a and hsa-miR-449b, which are structurally similar, are downregulated in testes of infertile men with different histopathologic patterns (the most common feature of male-factor infertility). [score:4]
[1 to 20 of 1 sentences]
93
[+] score: 3
Differential expression between good and poor performers (minimum of two-fold difference) was observed for hsa-miR-505, hsa-miR-34a, hsa-miR-1275, hsa-miR-125a-5p, hsa-miR-449a, hsa-miR-155, hsa-miR-101#, hsa-miR-375, hsa-miR-96, hsa-miR-217 and hsa-miR-125b. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Other miRNAs from this paper: hsa-mir-99a
LncRNA ANRIL acts as an oncogene and plays a significant role in GC progression, involving the epigenetic suppression of miR-99a/miR-449a in Trans by binding to PRC2, thus establishing a positive feedback loop to expedite GC cell proliferation [25]. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Some miRNAs are able to reverse the EMT process by targeting the Notch and Wnt-signaling pathways as has been demonstrated for miR-429 and miR-449a. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
A limited number of genes were shown to be regulated by EVI1 in a direct manner and to contribute to some of its biological effects, e. g., Gata2 [24], Pbx1 [40], Pten [41], Gpr56 [42], miR-1-2 [43], miR-9 [44], miR-124 [45, 46], and miR-449A [47]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
ICC experiments confirmed that Cx43 and cTnT were convincingly turned on upon over -expression of miRNA449 alone and even more so in combination with miRNA133 (Fig. 3B). [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Furthermore, the NOTCH signaling was identified as a target of miR-449a in CD [73]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
MiR-18a promotes the proliferation, migration and invasion of glioma cells, whereas miR-146a and miR-449a inhibit glioma growth by inducing cellular apoptosis [20– 22]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Mir-21, mir-34c and mir-221/222 control self-renewal of undifferentiated spermatogonia [19], Mirc1, Mirc3 and Mirlet7 regulate spermatogonial differentiation [9], [20], mir-15a and mir-184 mediate differentiation of spermatocytes [18], [19], miR-18, miR-34b, miR-34c, miR-184, miR-383, miR-449 and miR-469 mediate meiotic division of spermatocytes to spermatids [21], [23]– [25] and miR-469, miR-34c regulate differentiation of spermatid to form spermatozoa [24], [25]. [score:3]
[1 to 20 of 1 sentences]