sort by

72 publications mentioning mmu-mir-449a

Open access articles that are associated with the species Mus musculus and mention the gene name mir-449a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 319
Therefore, given the upregulation of miR-449a by Notch, Notch -mediated miR-449a expression in the colon may function as a self-guarding signal to suppress Notch -induced expression of tumorigenesis genes in the same cells. [score:10]
One recent paper reported that miR-449a was downregulated, while STAB2 expression was upregulated in patients with colorectal cancer [29]. [score:9]
With the goal of developing novel therapeutic strategies, stimulators of miR-449a may have beneficial effects on suppressing colon cancer and identification of target genes for miR-449a may yield novel target molecules to suppress colon cancer. [score:9]
These data suggested that miR-449a functioned to suppress colon tumorigenesis, at least partly through regulating MLH1 expression, and highlighted miR-449a as a therapeutic target and prognostic marker in the treatment of colon cancer. [score:8]
The expression of MLH1 was positively correlated with miR-449a expression in 72 patients with colon cancer (Fig.   6b), suggesting that miR-449a played a role in susceptibility to colon cancer through controlling MLH1 expression. [score:7]
Notably, miR-449a [−/−] mice showed higher susceptibility to AOM/DSS -induced colon tumorigenesis than wild-type mice, and the expression level of miR-449a was inversely correlated with disease severity, including disease-free survival, in patients with colon cancer. [score:7]
Overall survival was not affected by miR-449a expression; however, disease-free survival was much longer in patients with higher miR-449a expression (Fig.   5c). [score:7]
Thus, although it was unclear how miR-449a affected Mlh1 expression, our data suggested that miR-449a -mediated upregulation of MLH1 regulated the initiation or progression of colon cancer. [score:7]
However, our results demonstrated that stimulation of T cell hybridomas with overexpression of the intracellular domain of Notch1 upregulated miR-449a. [score:6]
In this study, we searched for miRNAs that were regulated by Notch signaling and found that miR-449a was indirectly upregulated by Notch signaling. [score:6]
T cells from miR-449a [+/+] or miR-449a [−/−] mice showed approximately 50% expression or no expression of miR-449a, respectively, compared with those of wild-type cells (Fig.   2c), indicating that complete deficiency of miR-449a expression was achieved in miR-449a [−/−] mice. [score:6]
The associations of miR-449a and MLH1 in terms of tumorigenesis should be analyzed by overexpressing Mlh1 in miR-449a -deficient mice, and it is also essential to assess how miR-449a regulates MLH1 expression. [score:6]
Deficiency of miR-449a in the colon resulted in downregulation of Mlh1, and expression of miR-449a was positively correlated with that of Mlh1 in patients with colon cancer. [score:6]
Furthermore, miR-449a reduces cancer cell survival by directly downregulating Notch1 [42]. [score:5]
Sun, X. et al. miR-449a inhibits colorectal cancer progression by targeting SATB2. [score:5]
In summary, our results revealed that the expression of miR-449a was inversely correlated with disease-free survival in colon cancer, and deficiency of miR-449a in mice increased susceptibility to AOM/DSS -induced colon cancer. [score:5]
Our results showed that miR-449a was highly expressed in the thymus and lung, but was expressed at low levels in the brain and colon (Fig.   2d). [score:5]
Disease-free survival in colon cancer was much longer in patients with higher miR-449a expression. [score:5]
Furthermore, the expression of miR-449a was inversely correlated with histological scores and disease-free survival in patients with colon cancer. [score:5]
Moreover, miR-449a -deficient cells expressed lower levels of Mlh1 than control mice, and the expression of miR-449a was positively correlated with MLH1 in cancerous tissues from patients with colon cancer. [score:5]
These data highlighted the role of miR-449a as a tumor suppressor in colon cancer and suggested that miR-449a may be a therapeutic target in the treatment of colon cancer. [score:5]
Rbpj -deficient T cells from Rbpj [flox/ flox] crossed with CD4-Cre transgenic mice showed substantially reduced expression of miR-449a compared with that in wild-type cells (Fig.   1c), although miR-449a expression was still detected in Rbpj -deficient cells. [score:4]
Notch regulated miR-449a expression. [score:4]
Although Notch signaling is involved in the development or differentiation of various immune cells [9], miR-449a [−/−] mice do not show any defects in immune cell development 27, 28, a process regulated by Notch signaling. [score:4]
Therefore, the miR-449 cluster, including miR-449a, may undergo similar regulatory processes, contributing to the suppression of colon tumorigenesis by miR-449a. [score:4]
Next, we compared the mRNA expression in the upper and lower colons of wild-type and miR-449a [−/−] mice to identify miR-449a target genes relevant to colon tumorigenesis (Fig.   6a). [score:4]
Only miR-449a was upregulated by more than 3 fold in DO. [score:4]
Our results showed that miR-449a was upregulated by Notch signaling. [score:4]
The relative increase in PCR products in two regions by anti-Rbpj antibody compared with that of the control antibody was similar to that of the Cnot3 region (Fig.   1d), suggesting the indirect regulation of miR-449a expression by Notch signaling. [score:4]
In a previous study, miR-449a expression in carcinoma tissues was found to be inversely correlated with the levels of serum carcinoembryonic antigen [18], supporting our present findings. [score:3]
Among 16 known genes associated with colon cancer, Mlh1 was downregulated in both the upper and lower colons in miR-449a [−/−] mice compared with those from wild-type mice. [score:3]
Previous papers have reported that overexpression of miR-449a reduced Notch signaling [40] and that blocking of miR-449 -binding sites of endogenous human Notch1 or frog Dll1 strongly repressed multiciliogenesis [41]. [score:3]
In these mice, increased the incidence of colon cancer and the rate of Ki-67 -positive intestinal epithelial cells compared with those in control mice, directly demonstrating that miR-449a suppressed colon tumorigenesis and intestinal epithelial cell proliferation. [score:3]
Furthermore, previous papers have demonstrated that the expression of miR-449a is associated with progression of lung, gastric, and bladder cancers; thus, our miR-449a -deficient mouse mo del may be a useful tool to address the contribution of miR-449a to tumorigenesis in these cancers. [score:3]
We next assessed the association of pathological findings and expression level of miR-449a in colon cancer tissue. [score:3]
Additionally, our microarray analysis showed that Mlh1 expression was lower in miR-449a [−/−] mice than in wild-type mice. [score:3]
Because previous reports have shown that miR-449a is involved in tumorigenesis in prostate, breast, lung, and gastric cancers 23– 26 and because miR-449a is expressed in the colon, we next sought to assess the roles of miR-449a in the tumorigenesis of colon cancer. [score:3]
Our present data also highlighted miR-449a not only as a therapeutic target of colon cancer but also as a prognosis marker. [score:3]
Taken together, these results strongly suggested that there was a negative correlation between miR-449a expression and the severity of human colon cancer. [score:3]
These data indicated that miR-449a could suppress Notch signaling. [score:3]
Figure 1Notch controlled miR-449a expression. [score:3]
We assessed the expression of miR-449a in various organs by real-time PCR. [score:3]
The patients were ordered based on miR-449a expression levels, and miR-449a low and high groups were designated based on the median value for all patients. [score:3]
Ki67 was mainly expressed in the basal region of the colon in wild-type and miR-449a [−/−] mice (Fig.   4e). [score:3]
The number of intestinal epithelial cells expressing Ki67 was much larger in miR-449a [−/−] mice than in wild-type mice (Fig.   4e), demonstrating the increased proliferation of intestinal epithelial cells in miR-449a [−/−] mice after. [score:3]
However, we did not detect any defects in the development of T cells, marginal zone B cells, or splenic CD8α [−] dendritic cells, all of which are regulated by Notch signaling, in miR-449a [−/−] mice. [score:3]
Figure 6Expression of miR-449a was correlated with MLH1 in patients with colon cancer. [score:3]
Unexpectedly, miR-449a -deficient mice did not show any defects in the development of T cells, marginal zone B cells, and CD8α [−] splenic dendritic cells, all of which are regulated by Notch signaling. [score:3]
These data suggested that miR-449a deficiency did not affect immune cell development or differentiation, which are regulated by Notch signaling. [score:3]
Single-cell suspensions derived from the spleens of wild-type and miR-449a [−/−] mice were stained with (a) anti-CD4, anti-CD8, anti-TCRβ, anti-TCRγ, anti-B220, anti-CD44, and anti-CD62L antibodies or (b) anti-CD11b, anti-F4/80, anti-Gr1, anti-CD11c, anti-B220, anti-CD21, and anti-CD23 antibodies, and the expression levels of the targets were evaluated by flow cytometry. [score:3]
These data were supported by low miR-449a expression in Rbpj -deficient T cells. [score:3]
The results obtained in miR-449a [−/−] mice led us to look for a link between miR-449a expression and pathology or prognosis in patients with colon cancer. [score:3]
Notably, miR-449a expression was positively correlated with MLH1 in patients with colon cancer in our present study. [score:3]
In these cancers, miR-449a may inhibit cell growth or induce senescence and apoptosis by activating the p53 pathway. [score:3]
The expression of miR-449a is decreased in several cancers, including gastric and bladder cancer 17, 18. [score:3]
The expression of miR-449a is frequently decreased in malignant tumors, including gastric and bladder cancer 17, 18. [score:3]
Taken together, these data suggested that miR-449a acted as a tumor suppressor in colon cancer. [score:3]
Promotion of colon cancer after in miR-449a [−/−] miceBecause previous reports have shown that miR-449a is involved in tumorigenesis in prostate, breast, lung, and gastric cancers 23– 26 and because miR-449a is expressed in the colon, we next sought to assess the roles of miR-449a in the tumorigenesis of colon cancer. [score:3]
Expression of Mlh1 was positively correlated with miR-449a. [score:3]
The expression level of miR-449a was similar in colon cancer tissue and normal colon tissue (Fig.   5a). [score:3]
In addition, the miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family, which was found to be a p53-responsive gene cluster 35, 36. miR-34 targets the histone deacetylase SIRT1 [37], leading to the accumulation of acetylated and therefore highly active p53. [score:3]
Higher expression of miR-449a was correlated positively with depth, differentiation, and size of colon cancer, but was not correlated with lymphatic invasion, venous invasion, or lymph node metastasis (Fig.   5b). [score:3]
The ratios of CD4 to CD8 T cells in the thymus, TCRβ [+] to TCRγ [+] T cells in the spleen and lymph nodes, TCRβ to B220 cells in the spleen and lymph nodes, and CD44 to CD62L expression in CD4 or CD8 T cells in the spleen were also comparable between wild-type and miR-449a [−/−] mice (Fig.   3a). [score:3]
Therefore, miR-449a was not involved in Notch -mediated immune cell development. [score:2]
Because Rbpj is essential for Notch signaling, we compared the expression of miR-449a in Rbpj -deficient and wild-type T cells. [score:2]
We compared the expression of miR-449a in the intact colon and colon cancer in 76 patients with colon cancer. [score:2]
We next sought to evaluate whether Notch signaling directly controlled miR-449a expression. [score:2]
Shi, W. et al. MiR-449a promotes breast cancer progression by targeting CRIP2. [score:2]
These data demonstrated that Notch was an upstream regulator of miR-449a. [score:2]
However, it is still unclear whether miR-449a is directly associated with tumorigenesis of various types of cancer because of a lack of data from in vivo mo dels; accordingly, we have established miR-449a -deficient mice. [score:2]
Furthermore, miR-449a regulated several genes associated with tumorigenesis, including the gene encoding histone deacetylase (HDAC) [19] and CDC25A [20], suggesting that miR-449a may have oncogenic effects. [score:2]
Germline transmission of the miR-449a mutation was confirmed by Southern blot analysis. [score:2]
Figure 3Unimpaired development of immune cells in miR-449a [−/−] mice. [score:2]
We also compared the expression level of miR-449a and the prognosis of patients with colon cancer. [score:2]
The miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family and has therefore been classified as a single family of miRNAs. [score:1]
A 377b genomic miR-449a (restriction enzyme: NotI, EcoRV) fragment was replaced with a neo resistance gene cassette. [score:1]
The sizes of tumors were also larger in miR-449a [−/−] mice at 18 weeks after AOM treatment, with approximately 50% of miR-449a [−/−] mice developing tumors larger than 12 mm in diameter (Fig.   4d). [score:1]
MicroRNA-449a (miR-449a) is a member of the miR-449 family (miR-449a, miR-449b, and miR-449c). [score:1]
Additionally, miR-449a -deficient mice showed increased susceptibility to azoxymethane (AOM) and dextran sodium sulfate (DSS) -induced colon cancer with increased proliferation of intestinal epithelial cells. [score:1]
Establishment of miR-449a -deficient mice. [score:1]
Therefore, we evaluated whether there was an association between MLH1 and miR-449a expression in patients with colon cancer. [score:1]
MiR-449a deficiency did not affect immune cell developmen t. Promotion of colon cancer after in miR-449a [−/−] mice. [score:1]
K. N. and J. N. generated the miR-449a -deficient mice. [score:1]
We first treated wild-type or miR-449a [−/−] mice with 2% DSS and monitored body weight loss. [score:1]
MiR-449a deficiency did not affect immune cell developmen tBecause Notch signaling regulates early T-cell development and effector T-cell differentiation 9, 22, we evaluated changes in immune cell numbers in miR-449a [−/−] mice. [score:1]
Murine genomic DNA of miR-449a was cloned by PCR. [score:1]
Figure 4Increased colon tumor formation after in miR-449a [−/−] mice. [score:1]
Notably, the frequencies of CD8α [−] dendritic cells and marginal zone B cells (CD21 [+]CD23 [+]) in miR-449a [−/−] mice were equivalent to those of wild-type mice (Fig.   3b). [score:1]
Because Notch signaling regulates early T-cell development and effector T-cell differentiation 9, 22, we evaluated changes in immune cell numbers in miR-449a [−/−] mice. [score:1]
Establishment of miR-449a [−/−] mice. [score:1]
miR-449a [−/−] mice were born according to Men delian inheritance rules and did not show any gross body changes. [score:1]
There were no significant differences in body weight between the two groups, although body weight loss in miR-449a [−/−] mice tended to be more abundant than that in wild-type mice (Fig.   4a). [score:1]
The total cell numbers in the thymus, lymph nodes, and spleen were comparable between wild-type and miR-449a [−/−] mice (Fig.   3a). [score:1]
The expression of Mlh1 in upper and lower colons from wild-type and miR-449a [−/−] mice was evaluated by real-time PCR. [score:1]
The miR-449a locus was replaced with a neo-cassette (Fig.   2a), and homologous recombination was confirmed by Southern blotting and PCR (Fig.   2b and Supplementary Figure  2). [score:1]
Another 15 genes were not significantly altered by deleting miR-449a. [score:1]
Establishment of miR-449a [−/−] miceMurine genomic DNA of miR-449a was cloned by PCR. [score:1]
However, the roles of miR-449a in tumorigenesis in vivo have not yet been determined. [score:1]
Figure 2Establishment of miR-449a -deficient mice. [score:1]
miR-449a [−/−] mice were viable for up to at least 60 weeks of age (data not shown). [score:1]
There were two putative Rbpj binding regions upstream of the miR-449a locus in homologous regions shared between mice and humans (depicted as 11k and 450) (Fig.   1d). [score:1]
Tumors were found in both wild-type and miR-449a [−/−] mice at 6 weeks after AOM treatment, and miR-449a [−/−] mice had significantly more tumors than wild-type mice at 12 and 18 weeks after AOM treatment (Fig.   4c). [score:1]
Th1, Th2, and Th17 cell differentiation in miR-449a [−/−] mice was equivalent to that in control mice (Supplementary Figure  1). [score:1]
[1 to 20 of 103 sentences]
2
[+] score: 319
To establish a causal relationship between miR-449 deregulation and cancer-relevant parameters, such as cell cycle regulation, apoptosis and senescence, we over-expressed miR-449 in gastric cancer cell lines and observed a significant down-regulation of proliferation coupled with up-regulation of the acidic beta-gal senescence marker and induction of apoptosis. [score:11]
However, in agreement with previous findings for miR-34a, we find that miR-449 regulates the expression of p53 [31, 32] as over -expression of miR-449 resulted in a potent up-regulation of p53 subsequently resulting in activation of p21 and induction of apoptosis markers, such as cleaved CASP3 and PARP as previously reported [60]. [score:9]
Having demonstrated down-regulation of miR-449 expression in gastric cancers we wanted to examine the effect of re -expressing miR-449 in gastric cancer cell lines. [score:8]
qPCR analysis of miR-449 expression in Gastrin knock out gastric tissues compared to relative expression in wild type gastric tissues, miR-449 is significantly down-regulated (p = 0.04) in Gastrin knock out tissues compared to wild types. [score:8]
TB performed cell cycle and senescence studies, targets validation and direct targets detection studies, p53 activation studies and miR-449 expression studies, conducted data analyses, contributed in designing the study and in writing the manuscript. [score:8]
"ns" not significant p value > 0.05, "*" or "#" significant 0.01 < p value < 0.05, "**" or "##" very significant 0.01 < p value < 0.001, "***" or "###" extremely significant p value < 0.001 Hence, miR-449 directly targets cell cycle regulator genes consistent with a tumour suppressor function and with the cell cycle arrest observed upon miR-449 re-introduction into cancer cell lines. [score:7]
"ns" not significant p value > 0.05, "*" or "#" significant 0.01 < p value < 0.05, "**" or "##" very significant 0.01 < p value < 0.001, "***" or "###" extremely significant p value < 0.001 Hence, miR-449 directly targets cell cycle regulator genes consistent with a tumour suppressor function and with the cell cycle arrest observed upon miR-449 re-introduction into cancer cell lines. [score:7]
Hence, aside from the pro-oncogenic effects of up-regulation of MYC, MET, CCNE2 and other direct targets, loss of miR-449 may result in increased E2F1 activity. [score:7]
While miR-449 was clearly down-regulated or lost in the analyzed mouse tumour samples no clear tendency for loss or down-regulation of miR-34a was observed (data not shown). [score:7]
Vinculin (VCL) and tubulin beta (TUBB) were used as loading controls D - verification of direct and functional target binding using luciferase constructs holding wild type 3'UTRs and mutated 3'UTRs (two mutations in miR-449 binding site), * indicates statistical significance in luciferase expression between wild type 3'UTRs transfected with miR449a/b compared to RNA scrambled control, # indicates statistical difference in luciferase expression between wild type 3'UTRs compared to mutant 3'UTRs transfected with miR-449a and miR-449b. [score:7]
qPCR analysis (upper panel) showing down-regulation of miR-449 expression in 8 gastric cancer tissues compared to miR-449 expression in sample-matched controls (dotted line). [score:7]
Beside gastric cancer, the expression of miR-449 has also been found to be reduced in several cell lines [55] and in prostate cancer, where it was found to target HDAC1 and induce growth arrest following over -expression in prostate cancer cells [56]. [score:7]
A series of the putative miR-449 targets were subsequently validated at endogenous level using western blotting and quantitative PCR and their direct regulation by miR-449 was established using heterologous reporter constructs and binding site-specific mutation studies. [score:6]
Many of the direct mRNA targets for miR-449 identified in this study are also targets of miR-34a and miR-449 and miR-34a belong to the same family of miRNAs as they share the same seed sequence. [score:6]
Focusing on a set of putative target genes with well-established roles in tumourigenesis, we confirmed down-regulation by miR-449 of met proto oncogene (MET), cyclin dependent kinase 6 (CDK6), geminin (GMNN), myelocytomatosis viral oncogenes homolog (MYC), sirtuin 1 (SIRT1) and histone deacetylase 1 (HDAC1) at the transcript level (figure 3b). [score:6]
Analyses of the genomic DNA from the tumours found no evidence for loss or hyper-methylation of the miR-449 loci using methylation-specific melting curve analysis (MS-MCA) indicating transcriptional down-regulation of expression (data not shown). [score:6]
For a subset of target genes including MET, GMNN, CCNE2, SIRT1 and HDAC1, we confirmed direct interaction of miR-449 with the target gene 3' UTR using luciferase assay (figure 3d). [score:5]
To further confirm miR-449 deregulation during gastric cancer development, we examined its expression in wild type mouse antrum tissues infected with H. Pylori. [score:5]
During the search for miR-449 targets we also identified several growth factors (AREG, and KITLG) and growth factor receptors, such as MET, as targets. [score:5]
Interestingly no noticeable expression of the miR-449 family was detected across a panel of gastric cell lines including SNU638, SNU5, SNU216, SNU601 and MKN74 sustaining the notion of miR-449 having tumour-suppressive functions (data not shown). [score:5]
We also show that miR-449 over -expression activated p53 and its downstream target p21 as well as the apoptosis markers cleaved CASP3 and PARP. [score:5]
Hence, the cancer-specific loss or down-regulation of miR-449 in gastric cancer can likely be explained by the connection to key cell cycle regulators. [score:5]
miR-449 induces p53 expression but is not regulated by p53. [score:4]
We identify miR-449 as significantly down-regulated or lost in mouse mo dels of gastric cancer as well as in primary human gastric tumours. [score:4]
The present study represents the first report demonstrating cancer-related down-regulation of miR-449 in both mouse mo dels for gastric cancer and in primary human gastric tumours. [score:4]
Importantly, we found both miR-449a and b to be significantly down-regulated or absent in 8 out of 10 primary gastric cancers. [score:4]
Furthermore, the expression of miR-449a and b seem to be co-regulated (figure 5a). [score:4]
To characterize the transcripts controlled by miR-449 and to see if miR-449 regulates different transcripts than miR-34a, SNU638 cells expression profiles were examined 24 hours post transfection of miR-449b or miR-34a and differentially expressed transcripts identified. [score:4]
Importantly, analyses of primary gastric tumours from patients clearly documented a tumour-specific down-regulation of miR-449 also in humans. [score:4]
Click here for file Figure S1 - miR-449 is down-regulated in Gastrin knock out mice compared to wild type. [score:4]
Affymetrix top down-regulated genes upon miR-449 re-introduction into SNU638 cells. [score:4]
Growth rate of gastric cell lines over -expressing miR-449 was inhibited by 60% compared to controls. [score:4]
Western blot analyses confirmed the ability of miR-449 to down-regulate MET, GMNN, MYC, SIRT1, cyclin E2 (CCNE2) and HDAC1 at the protein level to an extent similar to that achieved by re-introduction of miR-34a (figure 3c). [score:4]
miR-449 is down-regulated in human gastric cancers. [score:4]
Figure S1 - miR-449 is down-regulated in Gastrin knock out mice compared to wild type. [score:4]
To unveil molecular links between the loss of miR-449 and cancer progression or initiation we experimentally identified a number of direct mRNA targets using transcriptional profiling and extensive bioinformatics analysis. [score:4]
FACS cell cycle analysis of miR-449 over -expressing cells showed a significant increase in the sub-G [1 ]fraction indicative of apoptosis. [score:3]
In the present study, transcriptional profiling demonstrated that over -expression of miR-449 or miR-34a results in identical transcriptome changes. [score:3]
In conclusion, we found no evidence that miR-449 is a transcriptional target of p53. [score:3]
Figure S5 - miR-449 expression is p53 independent. [score:3]
B - qPCR validation of Affymetrix arrays showing down-regulation of MET, CDK6, GMNN, MYC and HDAC1 upon miR-449 re-introduction compared to scrambled RNA controls. [score:3]
Affymetrix 133v2 arrays identified GMNN, MET, CCNE2, SIRT1 and CDK6 as miR-449 targets. [score:3]
Figure S2 - miR-449 inhibits cell proliferation in human gastric cancer cell line MKN74. [score:3]
miR-449 inhibits cell cycle progression and induces senescence. [score:3]
This suggests that deregulation of miR-449 not only leads to deregulated control of cell cycle proteins but also of growth factors and their receptors. [score:3]
Thus, re-introduction of miR-449 negatively affects proliferation of gastric cancer cell lines concomitant with the induction of senescence and apoptosis in concordance with miR-449 having tumour suppressive functions. [score:3]
Finally, we examined the relationship between the p53 tumour suppressor and miR-449. [score:3]
However, no significant change in miR-449 expression was detected after p53 pathway activation (Additional file 1, figure S5b). [score:3]
C - Western blot validation of down-regulated genes upon miR-449 re-introduction into SNU638 cells compared to scrambled RNA controls. [score:3]
This is highly interesting as it places miR-449 at a key node in a feed-back loop in which E2F1 activates the transcription of miR-449 that in turn targets CDC25A and CDK6. [score:3]
In contrast, the expression of miR-449 has been reported to be increased in endometrioid adenocarcinoma [57] and melanoma in young adult patients [58]. [score:3]
The expression of miR-449 was also increased in skeletal muscle damage and regeneration [59]. [score:3]
Figure 3 miR-449 targets cell cycle controller genes. [score:3]
In this study, we document a diminished expression of miR-449 in Gastrin KO mice and further confirmed its loss in human gastric tumours. [score:3]
miR-449 expression studies, conducted data analyses and contributed in writing the manuscript. [score:3]
Figure 2 miR-449 is part of the miR-34 family and inhibits cell proliferation. [score:3]
Hence, we speculate that miR-449 induces apoptosis by inhibiting the histone deacetylase HDAC1 and SIRT1 leading to the p53 pathway activation thus the induction of apoptosis markers cleaved CASP3 and PARP. [score:3]
In summary, we have found that miR-449 may act as a tumour suppressor and is lost in gastric cancer. [score:3]
A - Chart showing significant down-regulation (p < 1.2e-70) of mRNAs with predicted miR-449 seed match in their 3'UTR (red line) compared to mRNAs lacking the seed match (black line). [score:3]
A pathway activation analysis based on the differentially regulated transcripts demonstrates that miR-449 mainly controls transcripts coding for proteins involved in cell damage responses, cell cycle control, inflammation and cancer pathways (figure 3a). [score:2]
miR-449 regulates numerous cell cycle controllers. [score:2]
We investigated the function of miR-449 by identifying its direct targets. [score:2]
In agreement with other studies [55, 60], we did not observe a p53 -dependent regulation of miR-449 in gastric cancer cells as well as in primary human and mouse fibroblasts. [score:2]
Western blot analysis showing an increase of the p53 protein upon miR-449 and positive control miR-34a re-introduction into SNU638 cells compared to RNA scrambled control as well as an activation of the p53 downstream target p21 and apoptosis markers cleaved CASP3 and PARP. [score:2]
Importantly, qPCR analyses showed a loss of miR-449 expression in human clinical gastric tumours compared to normal tissues. [score:2]
A - Ingenuity Pathway Analysis (IPA) of deregulated genes upon miR-449 re-introduction into SNU638 cells showing enrichment for the gene categories cancer, cell death and cell cycle pathways among others. [score:2]
B - miR-449 re-introduction into human gastric cell lines (SNU638) inhibits cell proliferation (red line) compared to a scrambled control (blue line) and miR-146 control (black line). [score:2]
Thus, another important property of miR-449 could be as a regulator of signals important for growth and migration/invasion. [score:2]
ß-Gal assays indicated a senescent phenotype of gastric cell lines over -expressing miR-449. [score:2]
Error bars represent S. D. C - Visual inspection of cell proliferation inhibition and senescence-like phenotype upon miR-449 re-introduction into SNU638 cells (lower panel) compared to scrambled transfection control (upper panel). [score:2]
miRNA expression profile was assessed using Taqman miRNA assays (Applied biosystems) for hsa/mmu-miR-449a and b, hsa/mmu-miR-34a, b and c and rnu44 or hsa/mmu-miR-191. [score:2]
Figure 5 miR-449 is down regulated in human gastric cancers. [score:2]
Table S2 - list of genes deregulated upon miR-449 re-introduction. [score:2]
We did not find any correlation between the reduction in miR-449 expression and clinical characteristics of the cancer (figure 5b). [score:1]
On the other hand, we found that miR-449a/b is able to induce activation of p53, activation of p53 response genes such as p21 and the induction of apoptosis as evidenced by cleavage of caspase 3 (CASP3) and poly (ADP-ribose) polymerase 1 (PARP) (figure 4). [score:1]
The miR-449 family consists of miR-449a and b in humans and miR-449a, b and c in mice. [score:1]
This was furthermore spurred by the presence of a putative p53 binding site 10 kb upstream from human miR-449 (data not shown). [score:1]
miRNA precursors were purchased from Ambion, hsa-miR-449a (PM11521), hsa-miR-449b (PM11127) and hsa-miR-34a (PM11030). [score:1]
The 3'UTRs of HDAC1, SIRT1, MET, GMNN and CCNE2 holding miR-449 binding sites were cloned downstream of the luciferase reporter in pMIR-REPORT vector system (Ambion). [score:1]
A - miR-449 is part of the miR-34 family and is evolutionarily conserved. [score:1]
Towards understanding the mechanism by which miR-449 does this we examined the effect of miR-449 on SIRT1 and HDAC1. [score:1]
Interestingly, miR-449 was recently shown to operate under the control of E2F1 [55, 60]. [score:1]
B - qPCR analyses of miR-449a and miR-449b post p53 induction. [score:1]
As miR-34a was previously found to function downstream of p53 [30- 33], we analyzed if also miR-449a/b were linked to p53. [score:1]
As miR-34a has been firmly placed downstream from p53 [30- 33] it was relevant to test if the same was the case for miR-449. [score:1]
Figure 4 miR-449 activates the p53 pathway. [score:1]
Hence, this study further underlines the importance of miRNAs in cancer and points to an important function for miR-449 in gastric cancer. [score:1]
Furthermore we show that miR-449 induces senescence and apoptosis by activating the p53 pathway. [score:1]
To evaluate the importance of miR-449 in human malignancies we next examined the expression of miR-449 in 10 gastric cancer biopsies. [score:1]
To assess the function of miR-449 in gastric cell lines we re-introduced miR-449b in SNU638 and MKN74 cells. [score:1]
To rule out cell line-specific effects, the functional consequences of miR-449 re-introduction in terms of cell cycle arrest were verified in MKN74 cells (Additional file 1, figure S3). [score:1]
We also found that re-introduction of miR-449 induces senescence and apoptosis. [score:1]
[1 to 20 of 92 sentences]
3
[+] score: 276
q-PCR analysis of mRNA expression for aire, spt1, Insulin and CRP in 2-DG FTOC (Control, 2-DG FTOC; miR-449a, 2-DG FTOC infected with lentivirus expressing miR-449a for 4 days; miR-449a/miR-449/34 sponge, 2-DG FTOC infected with lentivirus expressing miR-449a and miR-449/34 sponge for 4 days). [score:7]
Among the candidate targets with target score >85, most of the targets of miR-34a overlapped that of miR-449a (Fig.   6C and Table  1). [score:7]
In addition, overexpression of RelA/p50 or RelB/p52 in TSC cells induced miR-449a expression (Fig.   1C), indicating that RANKL and downstream canonical or non-canonical NF-κB activation could induce miR-449a expression. [score:7]
Sun X miR-449a inhibits colorectal cancer progression by targeting SATB2Oncotarget 2016 44. [score:7]
Interestingly, DNMT3a and SATB2 (2 epigenetic regulators and SATB2 as a miR-449a target in our previous study [43]) were significantly decreased in TSC cells after miR-449a overexpression (Fig.   3F). [score:6]
More importantly, expression of miR-34a was significantly up-regulated in miR-449a-mutant thymus, which in another way may indicate its compensation role. [score:6]
Here, analysis of miRNA expression in 2-DG FTOC identified that miR-449a was up-regulated by RANK ligand. [score:6]
In contrast, RelB -deficient thymic epithelial cells showed decreased miR-449a expression as well as Aire and PTAs expression, which were consistent with previous report (Fig.   1D) [28]. [score:5]
Furthermore, ectopic overexpression of miR-449a in 2-DG FTOC via lentiviral transduction induced expression of Aire and Aire -dependent PTAs (Fig.   4). [score:5]
To see if miR-449a could induce mTEC maturation and Aire expression, we further stably overexpressed miR-449a in TSC cells (labeled as TSC miR-449a cells). [score:5]
To delicately trace miR-449a expression, we analyzed its expression in thymic lobes at E13.5, E14.5, E15.5, E16.5, E17.5 and E18.5 days. [score:5]
Thymic in situ injection Virus expressing Control-GFP or miR-449/34 sponge-GFP were packaged according to Lenti-X™ shRNA Expression Systems User Manual (Clontech). [score:5]
Interestingly, by searching for the 3′UTR of mRNA sequence, miR-449a was predicted to target SATB2, a transcription factor that was highly expressed in embryonic stem cells [56]. [score:5]
MiR-449a was highly expressed during thymus development and positively correlated with Aire expression. [score:5]
Statistic analysis of the K14 [+] and K8 [+] zone in GFP -expressing area revealed that K14 [+] GFP [+] mTEC was significantly reduced, while K8 [+] GFP [+] cTEC was increased after expression of miR-449/34 sponge (Fig.   7B). [score:5]
Immunofluonrescence staining of TSCs revealed both K5 and K8 expression in control cells while loss of K8 expression in TSC miR-449a cells, thus resulting in K5 [+]K8 [−]cells reminiscent of K5 [+] mTEC in thymus (Fig.   3B). [score:5]
Clues from the expression profiling of miR-449/34 cluster during thymus development, miR-34 may function at early stage before E15.5 while miR-449 may regulate late differentiation of mTECs. [score:5]
To stably overexpress miR-449a in TSC cells, TSC cells were infected with empty control lentivirus or lentivirus expressing miR-449a and selected with 1ug/ml puromycin for 4 days. [score:5]
Immunofluonrescence staining (Fig.   3A, white arrow: Aire [+]; blue arrow: Aire [−]) and flow cytometry (Fig.   3C) identified about 50% of Aire -expressing TSCs 4 days after miR-449a overexpression. [score:5]
Overexpression of miR-449a induced TEPC differentiation into mature mTEC in vitroAire, a core transcription factor, interacts with a large set of proteins to regulate PTAs expression and is considered as a biomarker of functional mature medullary thymic epithelial cells 19, 41. [score:5]
Although the expression levels of miR-449b, miR-449c, miR-34b and miR-34c were much lower than that of miR-449a, the expression abundance of miR-34a was comparable to that of miR-449a in developing thymus (data not shown). [score:5]
Expression of miR-449/34 sponge resulted in reduced GFP [+] medulla (K14 [+]GFP [+]) and augmented GFP [+] cortex (K8 [+]GFP [+]) in GFP -expression area (Fig.   7A 1 [st] and 2 [nd] panel). [score:5]
Virus expressing Control-GFP or miR-449/34 sponge-GFP were packaged according to Lenti-X™ shRNA Expression Systems User Manual (Clontech). [score:5]
The transcripts of miR-449a host gene CDC20b was unaffected indicating that the mutation of miR-449a had no side-effect on host gene expression (Fig.   S4C). [score:4]
The generation of miR-449/34 sponge transgenic mice or miR-449/34 knock out mice may help to reveal the molecular mechanisms of miR-449/34 in regulation of thymus development. [score:4]
Intriguingly, miR-449a and Aire showed very similar temporal expression profiling during thymus development (Fig.   2D), indicating that miR-449a may function to promote mTEC maturation. [score:4]
Thus, these results indicated that expression of miR-449/34 sponge to interfere with miR-449a and other cluster members blocked normal maturation of mTECs. [score:3]
Unlike miR-449a, expression of miR-34a, miR-34b and miR-34c remained unchanged or undetectable (Fig.   1B). [score:3]
We wondered if this functional redundancy was responsible for the lack of effects of miR-449a mutation on thymus development. [score:3]
MiR-34a and miR-449a possessed similar seed sequence and had overlapped candidate targets as predicted. [score:3]
Expression of miR-34a was increased in miR-449a [Ins/Ins] thymusThe functional redundancy of miR-449/34 family has been previously reported 38– 40. [score:3]
Overexpression of miR-449a induced TEPC differentiation into mature mTEC in vitro. [score:3]
These results demonstrated that RANKL and downstream canonical or non-canonical NF-κB activation were sufficient to induce miR-449a expression in TECs. [score:3]
Expression of miR-449a was dramatically increased at E18.5 and peaked at postnatal 10-day (Fig.   2A). [score:3]
However, the other two members of miR-449 family, miR-449b and miR-449c, showed very low background expression and only miR-449c showed a slight increase in new-born thymi (Fig.   2A). [score:3]
Q-PCR revealed continuous increase of miR-449a expression and a sharp jump at E15.5 (Fig.   2C). [score:3]
Figure 6Expression of miR-34a was increased in miR-449a [Ins/Ins] thymus. [score:3]
Thymic in situ expression of miR-449/34 sponge reduced mature mTECs. [score:3]
Figure 5Mutation of miR-449a alone did not affect thymus development in mouse mo del. [score:3]
Expression of miR-34a was increased in miR-449a [Ins/Ins] thymus. [score:3]
Expression of miR-449a was induced by RANK ligand. [score:3]
Consistently, the expression of Aire and PTAs displayed no significant difference between miR-449a mutant mice and wild type littermates (Fig. S4A). [score:3]
In addition, we analyzed the candidate targets of miR-34a and miR-449a by an online database miRDB [45]. [score:3]
Figure 1Expression of miR-449a was induced by RANKL. [score:3]
Overexpression of miR-449a (>300 fold) was then confirmed by q-PCR. [score:3]
Consistently, expression of SATB2 was decreased in in vitro differentiation of TEPC into mature thymic epithelial cells by miR-449a from our data. [score:3]
Figure 4Overexpression of miR-449a induced differentiation of mTEC in 2-DG FTOC. [score:3]
Mutation of miR-449a alone does not affect thymus development in mouse mo del. [score:3]
Unlike miR-449 cluster, expression of miR-34 cluster was consistently decreased from the detecting point E14.5 (Fig.   2B). [score:3]
To see if expression of miR-449a could be induced by RANKL, TSC cells were treated with 100ng/ml RANKL for 2 days. [score:3]
Thus, these results supported the notion that the increased expression of miR-34a compensated for the absence of miR-449a in miR-449a-mutant mice. [score:3]
Despite the fact that mice with miR-449a mutation showed no discernible phenotype, the role of miR-449a in thymus development could not be entirely excluded because our data suggested that miR-34a compensated for the dysfunction of miR-449a. [score:3]
in fetal thymus and overexpression of miR-449a could induce TEPC differentiation in vitro. [score:3]
The GFP protein acted as a reporter gene of miR-449/34 sponge expression. [score:3]
Fetal thymic lobes (2-DG FTOC) were cultured in RPMI1640-10%FBS medium and infected with lentivirus carrying miR-449a or miR-449/34 sponge expressing vectors. [score:3]
Injection of miR-449/34 sponge virus resulted in reduced GFP [+] medulla and augmented GFP [+] cortex, reflected on the extensive miR-449/34 sponge-GFP expression in cortex. [score:3]
Upon RANKL stimulation, expression of miR-449a was significantly increased while other members of miR-449 cluster were undetectable (Fig.   1B). [score:3]
Figure 7Thymic in situ expression of miR-449/34 sponge reduced mature mTECs. [score:3]
Figure 3Overexpression of miR-449a induced TEPC differentiation into mature mTEC in vitro. [score:3]
To further confirm if miR-449a was mutated in thymic epithelial cells, we analyzed the mature miR-449a expression in TECs. [score:3]
MiR-449a expression profiling during thymus development. [score:3]
F2 and R primer pair for miR-449a [Del/Del] genotyping, a 314 bp band indicates wild type or heterozygous mutation, homozygous mutation results in no amplification. [score:2]
To further confirm the impact of miR-449a on mTEC development, we introduced miR-449/34 sponge through thymic in situ injection of lentivirus in 3-week old mice. [score:2]
Taken together, these results indicated that interference of miR-449a and miR-449/34 cluster blocked normal differentiation of mTEC and may also have impact on cTEC development. [score:2]
Collectively, these results suggested that the lack of miR-449a had no overall significant effects on thymus development. [score:2]
Our results revealed a new function of miR-449a in regulation of mTEC differentiation. [score:2]
Furthermore, we demonstrated that miR-449a induced thymic epithelial progenitor cells differentiation into mature thymic epithelial cells in vitro. [score:1]
The insert mutant strain (miR-449a [Ins/Ins]) bore a 20 bp insertion in miR-449a seed sequence following TGGCAGTGTATTGT while the deletion mutant strain (miR-449a [Del/Del]) bore a 30-bp deletion just after TGGCAGTGTATTGTTA (Fig.   5A). [score:1]
We identified miR-449a in 2-DG FTOC (2-DG FTOC, 2′-deoxyguanosine (2-DG) treated Fetal Thymus Organ Culture) treated with recombinant human RANK ligand. [score:1]
Further RT-PCR analysis confirmed the thymic identity of TSC miR-449a cells (Fig.   3G). [score:1]
Neutralization of miR-449a and other miR-449/34 family members reduced the number of mature MHCII [hi] mTECs in thymus. [score:1]
By RANKL stimulation, miR-449a was dramatically induced in 2-DG FTOC (Fig.   1A). [score:1]
The miR-449a mutant mice (miR-449a [Ins/Ins] and miR-449a [Del/Del]) were generated by Shanghai Bioray Biotech Co. [score:1]
The stable cell lines were thereafter named as TSC Control or TSC miR-449a. [score:1]
Counting the Aire [+] TSC cells in 5 randomly selected view fields from immunofluonrescence images showed about 50% Aire [+] TSCs in TSC miR-449a cultures while none in TSC control cultures (Fig.   3A and D). [score:1]
MiR-449 cluster members (miR-449c/449b/449a) share similar seed sequence with miR-34 cluster members (miR-34a, miR-34b/34c) and constitute a conserved miRNA family 38– 40. [score:1]
Control-GFP virus and miR-449/34 sponge-GFP virus were concentrated by ultracentrifugation and stored at −80 °C. [score:1]
The functional redundancy of miR-449/34 family has been previously reported 38– 40. [score:1]
Q-PCR analysis revealed that mature miR-449a was nearly depleted in miR-449a [Ins/Ins] (Fig.   S4B) and miR-449a [Del/Del] mice (data not shown). [score:1]
of miR-449/34 sponge that was used to silence miR-449a was sufficient to neutralize the function of miR-449a in 2-DG FTOC (Fig.   4). [score:1]
To investigate the function of miR-449a in vivo, we generated mouse mutants carrying an insert mutation or a deletion mutation in the miR-449a locus through CRISPR/Cas9 mediated gene editing (Fig.   5A) [44]. [score:1]
PCR analysis and further DNA sequencing demonstrated that both alleles of miR-449a were mutated in miR-449a [Ins/Ins] and miR-449a [Del/Del] mice (Fig.   S1A, B). [score:1]
To our surprise, miR-34a exhibited a marked increase in miR-449a deficient thymus (Fig.   6A). [score:1]
There were about 20% K5 [+]K8 [−]TSCs in TSC control cultures, and this proportion increased to about 55% in TSC miR-449a cultures (Fig.   3B and E). [score:1]
Primers used for genotyping: F1: CACAATTCTATCTCTAGGCC F2: GCTGGTTGAGTATGTGAG R: GGGCAAATACACAAGGC F1 and R primer pair for miR-449a [Ins/Ins] genotyping, a 336 bp band indicates insert mutation, and further sequencing is needed to distinguish heterozygous and homozygous mutation. [score:1]
To clone miR-449/34 sponge, forward sequence: 5'-gatccACCAGCTAACTATCACTGCC ACGATACCAGCTAACTATCACTGCCAACGCGACCAGCTAACTATCACTGCCACGATACCAGCTAACTATCACTGCCAACG CGACCAGCTAACTATCACTGCCACGATACCAGCTAACTATCACTGCCAttttttg-3' and reverse sequence: 5'-aattcAAAAAATGGCAGTGATAGTTAGCTGGTATCGTGGCAGTGATAGTTAGCTGGTCGCGTTGGCA GTGATAGTTAGCTGGTATCGTGGCAGTGATAGTTAGCTGGTCGCGTTGGCAGTGATAGTTAGCTGGTATCGTGGCAGTGA TAGTTAGCTGGT g-3' were synthesized, annealed and cloned into plvx-shRNA2 (Clontech). [score:1]
Primers used for genotyping: F1: CACAATTCTATCTCTAGGCC F2: GCTGGTTGAGTATGTGAG R: GGGCAAATACACAAGGCF1 and R primer pair for miR-449a [Ins/Ins] genotyping, a 336 bp band indicates insert mutation, and further sequencing is needed to distinguish heterozygous and homozygous mutation. [score:1]
Taken together, these data demonstrated that in in vitro studies using TSC cells or 2-DG FTOC, miR-449a was able to induce mTEC differentiation. [score:1]
In silico analysis identified that members of the miR-449 cluster and miR-34 cluster possess similar mature sequences and seed regions (Fig.   6B). [score:1]
[1 to 20 of 89 sentences]
4
[+] score: 269
These findings will contribute to our understanding of the molecular mechanism by which miR-34b-3 and miR-449a play tumor suppressor roles in the development of NPC and these miRNAs may be potential therapeutic targets to suppress the metabolic reprogramming of NPC cells. [score:8]
In conclusion, we verified that miR-34b/c and miR-449a inhibit glycolysis through targeting LDHA in NPC, thereby suppressing the tumor proliferation and progression. [score:7]
These results indicated that miR-34b-3 and miR-449a over -expression inhibited the endogenous LDHA expression both at mRNA and protein levels. [score:7]
The expression levels of miR-34b/c cluster and miR-449a were significantly and gradually reduced with advancing stages of NPC, with the lowest expression at the latest stage IV (Figure 1, Upper line; * P < 0.05, ** P < 0.01; *** P < 0.001), indicating gradual loss of miR-34b/c cluster and miR-449a expression with the progression of NPC. [score:7]
Our results suggest that miR-34b-3 and miR-449a suppress the development of NPC by regulating glycolysis via targeting LDHA. [score:7]
The results demonstrated that miR-34b-3 or miR-449a significantly decreased LD content and suppressed LDH activity when compared with negative control, whereas LDHA over -expression rescued the suppressive effect of miR-34b-3 and miR-449a (Figure 6D; * P < 0.05; ** P < 0.01; *** P < 0.001, data from three independent experiments). [score:6]
In our study, we showed that miR-34b-3 and miR-449a directly targeted LDHA and LDHA overexpression significantly recovered cell proliferation, LD content and LDH activity in NPC cells following transfection of miR-34b-3 and miR-449a. [score:6]
MiR-34b-3 and miR-449a inhibit tumor progression in NPC by targeting LDHA to regulate glycolysis. [score:6]
In addition, we found that LDHA was a direct target of miR-34b/c cluster and miR-449a and was overexpressed in NPC. [score:6]
Further tandem mass tags isotope labeling and LC-MS/MS analysis revealed that miR-34b/c and miR-449a regulated the expression of 15 potential targeted genes, mainly clustered in key enzymes of glycolysis metabolism, including LDHA. [score:6]
These results suggest that miR-34b-3 and miR-449a execute tumor suppressor gene function in NPC partly due to inhibition of glycolysis by down -regulating LDHA. [score:6]
Furthermore, ectopic overexpression of LDHA significantly abolished the suppression of the proliferation, invasion and migration of CNE2 cells by miR-34b-3 or miR-449a. [score:5]
Consequently, overexpression of miR-34b-3 and miR-449a suppressed the growth of NPC cells in culture and mouse tumor xenografts. [score:5]
Collectively, these results demonstrated that LDHA overexpression rescued the suppressive effect of miR-34b-3 and miR-449a in CNE2 cells. [score:5]
Importantly, miR-34b-3 or miR-449a significantly decreased LD content and suppressed LDH activity, which was restored by ectopic overexpression of LDHA. [score:5]
The showed that ectopic overexpression of LDHA significantly enhanced the proliferation of CNE2 cells and abolished the suppression of cell proliferation by either miR-34b-3 or miR-449a (Figure 6A; * P < 0.05; ** P < 0.001). [score:5]
In this study, we showed that the expression levels of miR-34b/c cluster and miR-449a were significantly and gradually reduced with advancing stages of NPC, with the lowest expression at stage IV. [score:5]
To clarify the mechanisms of miR-34b/c and miR-449a in the suppression function of NPC, we used tandem mass tags (TMT) isotope labeling technology and LC-MS/MS analysis to explore miR-34b-3 potential target genes. [score:5]
We then explored whether the tumor suppressor function of miR-34b-3 and miR-449a depends on LDHA expression. [score:5]
Our findings suggest that miR-34b-3 and miR-449a suppress NPC progression and metastasis partly through inhibition of LDHA. [score:5]
We next asked whether miR-34b-3 or miR-449a overexpression could suppress tumor growth in vivo. [score:5]
Overexpression of miR-34b-3 and miR-449a suppresses the growth of NPC cells in culture and mouse tumor xenografts. [score:5]
In this study, we found that loss of miR-34b/c and miR-449a was related with the progression of NPC, and overexpression of miR-34b/c and miR-449a inhibited the proliferation, migration and invasion of NPC cells in vitro and tumor size in vivo. [score:5]
Collectively, these results clearly indicate that LDHA is a direct target of miR-34b/c cluster and miR-449a. [score:4]
MiR-34b/c cluster and miR-449a are down-regulated in NPC samples and NPC cell lines. [score:4]
LDHA is a direct target of miR-34b/c and miR-449a. [score:4]
MiR-34b-3 and miR-449a inhibit tumor progression and regulate glycolysis through LDHA in NPC. [score:4]
These data provided strong evidence that miR-34b/c cluster and miR-449a were downregulated in NPC. [score:4]
To explore the molecular mechanisms of miR-34b/c and miR-449a as anti-oncogene in NPC, we used quantitative proteomics to find the direct targets of miR-34b/c and miR-449a. [score:4]
In the regulation of spermatogenesis, miR-34b/c and miR-449a have redundant function through targeting of the E2F-Rb pathway [27– 28]. [score:4]
To validate that LDHA is a direct target gene of miR-34b-3 and miR-449a, CNE2 cells were transfected with same amount of miR-34b-3 or miR-449a mimics. [score:4]
LDHA is a direct target of miR-34b-3 and miR-449a. [score:4]
miR-34b/c cluster and miR-449a are down-regulated in NPC. [score:4]
The nude mice receiving cells overexpressing miR-34b-3 or miR-449a formed significantly smaller subcutaneous tumors than mice receiving cells transfected with control miRNA. [score:3]
These data suggest an important role for miR-34b/c and miR-449a in the suppression of the tumorigenesis of NPC. [score:3]
showed that miR-34b-3 and miR-449a mediated decrease of LDHA expression was restored by pENTER-LDHA in CNE2 cells (Supplementary Figure S4). [score:3]
Figure 1(Upper line) The real time RT-PCR determination of miR-34 cluster and miR-449a expression in different development stages of NPC (n = 45) compared with the non-tumor nasopharyngeal epithelial (normal, n = 10). [score:3]
To examine the function of miR-34b-3 or miR-449a, NPC cell lines CNE2 and 5–8F were transfected with miR-34b-3 or miR-449a mimics to restore their expression levels. [score:3]
MiR-449a is located at 5q11.2 and shares a very similar “seed” sequence and a cohort of targets genes with miR-34b/c [23– 26]. [score:3]
Using a stem-loop RT-PCR or miRNA microarray assay respectively, our previous study and other four independent labs revealed that miR-34b/c and miR-449a are down-regulated in NPC tissues [14– 18]. [score:3]
MiR-34b-3 and miR-449a play tumor suppressor roles in NPC. [score:3]
Similarly, colony formation assay revealed that miR-34b-3 and miR-449a significantly suppressed colony formation compared with negative control, which was significantly prevented by LDHA overexpression (Figure 6B; * P < 0.05; ** P < 0.001). [score:3]
These results clearly demonstrated that overexpression of miR-34b-3 or miR-449a repressed cell proliferation, invasion and migration of NPC cells in vitro. [score:3]
For the convenience of gene annotation, corresponding Entrez gene IDs of the proteins were used for further bioinformatics analysis and these genes were predicted whether have matching sequence with miR-34b/c and miR-449a by 3 common databases such as Targetscan, Pictar, and miRanda. [score:3]
showed that miR-34b-3 and miR-449a overexpression significantly reduced the proliferation of CNE2 cells (Figure 2A, * P < 0.05). [score:3]
Here, we further verified the expression levels of miR-34 cluster and miR-449a by RT-PCR in another cohort of NPC samples including 45 NPC tissues of different stages and 10 non-tumor nasopharyngeal epithelial. [score:3]
Two sets of NPC samples were collected for this study: Set 1, including tissue biopsies of 45 NPC and 10 non-tumor nasopharynx epithelial tissue samples to verify miR-34 and miR-449a expression with qRT-PCR; Set 2, including 20 paraffin-embedded NPC and 4 non-tumor nasopharynx epithelial tissue samples for LDHA detection with IHC. [score:3]
Compared with the immortalized normal nasopharynx epithelial NP69 cells, miR-34b/c cluster and miR-449a were also significantly down-regulated in NPC cell lines (Figure 1, Bottom line). [score:3]
To confirm the role of miR-34b-3 and miR-449 in the inhibition of cancer cell proliferation in vivo, we performed subcutaneous tumor mouse mo dels. [score:3]
Our previous miRNA array analysis showed that miR-34b/c cluster and miR-449a have low expression in NPC [14]. [score:3]
Figure 5(A) miR-34b-3 and miR-449a overexpression reduced LDHA mRNA level. [score:3]
RT-PCR analysis showed that miR-34b-3 and miR-449a overexpression significantly reduced LDHA mRNA level (Figure 5A; * P < 0.05; *** P < 0.001). [score:3]
showed that the endogenous expression of LDHA protein substantially decreased after miR-34b-3 or miR-449a transfection (Figure 5B). [score:3]
Figure 2(A) miR-34b-3 and miR-449a suppressed tumor cell growth. [score:3]
Among these 15 genes, LDHA, LDHB, PGK1 and PHGDH were predicted to have complementary sequences in their 3′UTR with miR-34b/c or miR-449a by one or more Targetscan, Pictar, and miRanda databases. [score:3]
The double knock out mice of miR-34b/c and miR-449 show basal forebrain structures, absence of motile cilia in trachea and oviducts, and severe disruption of spermatogenesis, but no spontaneous tumor formation [49]. [score:2]
In this study we firstly examined the roles of miR-34b/c and miR-449a in the dynamic development of NPC. [score:2]
Additionally, transwell migration assays showed that cells transfected with miR-34b-3 or miR-449a mimics demonstrated significantly fewer migrated cells than the negative control, which was significantly recovered by LDHA overexpression (Figure 6C, * P < 0.05, ** P < 0.01, *** P < 0.001). [score:2]
Given LDHA promotes L-lactate and NAD to pyruvate and NADH in the last step of glycolysis pathway, we next assessed whether miR-34b-3 and miR-449a regulated glycolysis in NPC cells through LDHA. [score:2]
Similarly, the colony formation assays verified that miR-34b-3 and miR-449a overexpression resulted in a significantly lower number of colonies than control miRNA (Figure 2B, *** P < 0.001). [score:2]
MiR-34b-3 mimics (MSY0004676, 5′-CAAUCACUAACUCCACUGCCAU-3′), miR-449a mimics (MSY0001541, 5′-UGGCAGUGUAUUGUU AGCUGGU-3′) and scrambled miRNA (a synthesized RNA showing no homology to any human mRNA sequence) were obtained from Qiagen (Valencia, CA, USA). [score:1]
RT-PCR and Western blot analyses of LDHA were performed 48 h after transfection of the same amount of miR-34b-3, miR-449a mimics or scrambled miRNA (NC). [score:1]
The results showed significant decrease of luciferase activity in wild-type vector but not in mutant vector after transfection of either miR-34b-3 or miR-449a (Figure 5C; * P < 0.05; ** P < 0.001). [score:1]
To this end, CNE2 cells transfected with miR-34b-3 or miR-449a mimics for 48 h were subcutaneously injected into nude mice and tumor formation and volume were monitored. [score:1]
NPC cells CNE2 was transfected with miR-34b-3 mimics, miR-449a mimics or scrambled miRNA (NC) and then subjected to. [score:1]
Cells were transfected with miR-34b-3, miR-449a mimics or scrambled miRNA (NC) for 24 h, and then seeded in a 6-well plate in triplicate. [score:1]
Cells were transfected with miR-34b-3, miR-449a mimics or scrambled miRNA (NC) for 24 h, and then seeded in a 96-well plate at a density of 2 × 10 [3] cells/well. [score:1]
Cells transfected with either miR-34b-3 or miR-449a showed significantly reduced cell invasion (Figure 2C; *** P < 0.001). [score:1]
CNE2 cells were transfected with miR-34b-3 or miR-449a mimics, and respectively cotransfected with pENTER-LDHA. [score:1]
A total of 1000 cells (CNE2) transfected with miR-34b-3 or miR-449a mimic or scrambled miRNA (NC) were seeded in six-well plates and allowed to grow for 10 days. [score:1]
Furthermore, we cloned the 3′UTR of LDHA downstream of the luciferase open reading frame including wild type or mutant type of miR-34b-3 and miR-449a binding sites. [score:1]
Sequence alignment of miR-34b-3 and miR-449a and LDHA 3′UTR was shown. [score:1]
Cells cotransfected miR-449a mimics with pENTER-LDHA (miR-449a/LDHA) or pENTER-3C (miR-449a/ve). [score:1]
Mice were divided into three groups: miR-34b-3, miR-449a and scrambled miRNA(NC). [score:1]
CNE2 cells were cotransfected with miR-34b-3 or miR-449a mimics and the pENTER-LDHA or control plasmid pENTER-3C (ve). [score:1]
Since miR-34b-3 and miR-34c-3, miR-34c-5 and miR-449a have the same seed sequences, respectively (Supplementary Table S2), we selected miR-34b-3 and miR-449a as representatives to study the functions and molecular mechanisms at the following study. [score:1]
MiR-34b-3, miR-449a mimics or scrambled miRNA were cotransfected with the luciferase constructs. [score:1]
MiR-449 cluster have very similar sequences and secondary structures belonging to the miR-34 family. [score:1]
However, the precise function and molecular mechanisms of miR-34b/c and miR-449a in the initiation and progression of NPC remain unclear. [score:1]
Indeed, miR-449a has the same tissue distribution as miR-34b/c and they form a functionally related miRNA family. [score:1]
The results demonstrated that both miR-34b-3 and miR-449a repressed cell motility. [score:1]
[1 to 20 of 81 sentences]
5
[+] score: 208
CRIP2, MYB and PRKAG1 were consistently under-expressed in both T47D and MDA-MB-231 cells (both of which have high endogenous expression of miR-449a), and overexpressed in MDA-MB-468 cells (which have low endogenous expression of miR-449a) relative to MCF-10A normal mammary gland epithelial cells (Figure 3B). [score:9]
Concordantly, in MDA-MB-468 cells (which endogenously under-express miR-449a; Figure 2A), CRIP2 3′-UTR luciferase expression was downregulated in the presence of pre-miR-449a (Supplementary Figure S1C). [score:8]
Suppressing miR-449a in T47D and MDA-MB-231 cells resulted in up-regulated expression of CRIP2, MYB and PRKAG1 mRNA transcript levels at 48 hours post-transfection (Figure 3C). [score:8]
In this early-stage study, miR-449a was observed to be significantly up-regulated in a cohort of 71 primary LNN breast tumors, and its overexpression was associated with higher risk of recurrence and lower overall survival. [score:6]
In MDA-MB-231 cells (which endogenously express high levels of miR-449a; Figure 2A), CRIP2 3′-UTR luciferase (pmiR-CRIP2) expression was significantly higher in the presence of anti-miR-449a (Figure 4B). [score:5]
Although the cell line correlation between endogenous miR-449a (Figure 2A), CRIP2 (Supplementary Figure S2A), and VEGF (Figure 6) expression did not correlate precisely, differences would be expected due to the concentrations of alternate endogenous miRNA targets and competing endogenous RNA cross-talking [42]. [score:5]
C. T47D and MDA-MB-231 cells were transfected with anti-miR-449a (40 nM) or scrambled control (SC), and candidate miR-449a target gene expression was assessed using qRT-PCR 48 hours after transfection. [score:5]
In summary, our findings support the mo del wherein overexpression of miR-449a in breast cancer suppresses CRIP2 activity, leading in turn to increased tumor growth, migration, invasion, as well as angiogenic signaling (Figure 6D). [score:5]
Both miR-449a and miR-449b were first described as tumor suppressors in osteosarcoma cells, targeting CDK6 and CDC25A [31]. [score:5]
The 3′-untranslated regions (3′-UTRs) of potential RNAs targeted by miR-449a were amplified by PCR and placed in the pmiR-Report vector (Ambion), downstream of the Firefly luciferase gene. [score:5]
MiR-449a directly targeted the 3′-untranslated region (3′-UTR) of CRIP2. [score:5]
In order to investigate the association between miR-449a expression and patient survival, the patient cohort was first segregated using the median miR-449a expression value (19.31 fold-change relative to the median expression of normal tissue samples) into high (n=36) vs. [score:5]
As expected, quantitative real-time PCR (qRT-PCR) revealed that CDC20B was concordantly overexpressed in the three miR-449a overexpressing cancer lines (Figure 2B). [score:5]
MiR-449a suppresses CRIP2 expression, which then leads to increased tumor formation (as well as migration and invasion), along with the activation of proangiogenic cytokines such as VEGF, possibly via the NF-κB/p65 complex. [score:4]
Furthermore, miR-449a downregulation in non-small cell lung cancer correlated with the presence of lymph node metastasis, poor survival, and c-MET repression [33]. [score:4]
In TCGA data, the expression values for miR-449a were significantly higher in LNN breast cancer samples (n=266) compared to adjacent normal tissue samples (n=87) (Wilcoxon rank-sum test, p=0.00027; Figure 1D), validating our own observation of significant miR-449a overexpression in malignant LNN breast cancer tissue. [score:4]
MiR-449a targeted the 3′-untranslated region (3′-UTR) of CRIP2. [score:4]
Together, the luciferase and data support the specific and direct inhibition of CRIP2 by miR-449a. [score:4]
Downregulation of miR-449a reduced cell proliferation, clonogenicity, migration, and invasion in breast cancer cells. [score:4]
In order to determine whether miR-449a directly targets the 3′-UTRs of CRIP2, MYB, and/or PRKAG1, the 3′-UTR for each gene was cloned into separate pmiR-Report luciferase reporter vectors (Figure 4A). [score:4]
low (n=35) miR-449a expression groups. [score:3]
Figure 2 A. Quantitative real-time PCR (qRT-PCR) for miR-449a expression in human normal mammary gland epithelial (MCF-10A) and breast cancer (MCF-10A, MDA-MB-231, T47D, and MDA-MB-453) cell lines. [score:3]
Overexpression of miR-449a was associated with higher risk of recurrence in lymph node -negative (LNN) breast cancer patients. [score:3]
Herein, we report that further analyses of these data identified miR-449a to be highly overexpressed and significantly associated with increased incidence of patient relapse. [score:3]
High-throughput small RNA sequencing in peritoneal endometriotic lesions with matched healthy surrounding tissue indicated that miR-449a was one of five miRNAs expressed at significantly higher levels in the epithelial cells of endometriotic lesions [36]. [score:3]
miR-449a was implicated functionally in breast cancer pathogenesis, suppressing Cysteine-Rich Protein 2 (CRIP2) and altering cell viability, migration, invasion, in vivo tumor growth, and angiogenesis, thereby driving malignant phenotypes in these aggressive tumors. [score:3]
Given the strong correlation of miR-449a overexpression with patient relapse, we investigated changes in cell migration and invasion after suppressing miR-449a. [score:3]
A. Quantitative real-time PCR (qRT-PCR) for miR-449a expression in human normal mammary gland epithelial (MCF-10A) and breast cancer (MCF-10A, MDA-MB-231, T47D, and MDA-MB-453) cell lines. [score:3]
Growth arrest induced by miR-449a may also be dependent on Rb inhibition [34]. [score:3]
Strikingly, the miR-449a high expression group experienced significantly poorer outcome in both OS and DFS (OS p=0.00092; DFS p=0.0022; Figure 1B, 1C). [score:3]
Taqman Low Density Array (TLDA) miRNA profiling demonstrated that miR-449a expression was significantly increased in pre-treatment primary LNN invasive ductal breast cancer samples (n=71) relative to normal mammary epithelial tissues (n=5) (p=0.042; Figure 1A). [score:3]
low miR-449a expression groups (p=0.10) (Supplementary Figure S1A, S1B). [score:3]
In this manuscript, a novel prognostic microRNA, miR-449a, was identified to be overexpressed in lymph node -negative invasive ductal breast cancer using global miRNA profiling of 71 primary tumors and 5 normal mammary epithelial tissues. [score:3]
Together, these data indicated that breast cancer patients with higher miR-449a expression levels experienced higher recurrence rates and poorer clinical outcomes. [score:3]
Figure 3 A. Venn diagram illustrating the approach used to identify potential targets of miR-449a. [score:3]
Overexpression of miR-449a was associated with tumor recurrence in LNN breast cancer. [score:3]
A three-pronged approach was undertaken to identify potential miR-449a targets as previously described [19]; miRWalk, experimental (GeneChip Human Genome U133 Plus 2.0 mRNA array of T47D cells transfected with anti-miR-449a), and publically available data [20] were all utilized (Figure 3A). [score:3]
A. Venn diagram illustrating the approach used to identify potential targets of miR-449a. [score:3]
Suppression of miR-449a significantly reduced in vitro cell survival, clonogenicity, migration, and invasion. [score:3]
Our study identified a novel target for miR-449a: Cysteine-Rich Protein 2 (CRIP2). [score:3]
Importantly, when paired with comprehensive patient follow-up data, expression of miR-449a was significantly correlated with higher risk of patient relapse, and decreased overall and disease-free survival rates, thus highlighting the possible applications for this newly characterized potential biomarker. [score:3]
Further, miR-449a is located within intron 2 of Cell Division Cycle 20B (CDC20B; Chromosome 5 - NC_000005.10), a cell cycle regulatory protein involved in anaphase nuclear movement and chromosome separation. [score:2]
Additionally, miR-449a expression was significantly higher in the primary tumors of patients who eventually relapsed, when compared to the primary tumors of non-relapsed patients (p=0.019; Figure 1A). [score:2]
C. Anti-miR-449a (40 nM) was transfected into T47D cells and significantly reduced miR-449a expression compared with scrambled control (SC; 40 nM) or transfection reagent alone (Lipo). [score:2]
MiR-449a overexpression was significantly increased in colorectal carcinoma and inversely correlated with the levels of serum carcinoembryonic antigen (CEA) [35]. [score:2]
MiR-449a putative gene target identification. [score:2]
D. miRNA-Seq and clinical data from The Cancer Genome Atlas (TCGA) validated that miR-449a expression was significantly higher in LNN breast cancer samples (n=266) compared to adjacent normal tissue (n=87). [score:2]
MiR-449a overexpression promoted tumor cell proliferation and colony formation in two cell lines, also increasing migration and invasion. [score:2]
The precise mechanism by which miR-449a is dysregulated remains unclear. [score:2]
MiR-449a inhibits CRIP2, allowing the NF-kB/p65 complex to transcriptionally activate angiogenic factors such as VEGF. [score:2]
Figure 4 A. Schema depicting the luciferase reporter vectors carrying the predicted miR-449a binding sites downstream of the Firefly luciferase gene (pmiR-Report vector). [score:1]
Moreover, we revealed the role of miR-449a in increasing tumor progression via CRIP2 repression, highlighting the potential importance of this new pathway in driving aggressive cancer behavior both in vitro and in vivo. [score:1]
MiR-449a was significantly overexpressed in three (MDA-MB-231, T47D and MDA-MB-453) of the four cancer lines examined, when compared to normal mammary epithelial cells (MCF-10A; Figure 2A). [score:1]
Figure 1 A. Taqman Low Density Array (TLDA) was used to identify that miR-449a was significantly increased in primary LNN breast cancer samples and strongly associated with tumor relapse. [score:1]
Anti-miR-449a significantly reduced migration in MDA-MB-231 cells (19% vs. [score:1]
Anti-miR-449a or pre-miR-449a mimic (Ambion) were reverse transfected into cells using Lipofectamine 2000 (Invitrogen) at a final concentration of 40 nM (unless otherwise indicated), according to the manufacturer's instructions. [score:1]
Through an iterative statistical evaluation of all possible cut-off points, a segregation value of 40 fold-change relative to the median expression of normal tissue samples was chosen to dichotomize the 71 breast cancer patients into miR-449a high (n=28) vs. [score:1]
A. Schema depicting the luciferase reporter vectors carrying the predicted miR-449a binding sites downstream of the Firefly luciferase gene (pmiR-Report vector). [score:1]
D. Schema for the miR-449a-CRIP2 pathway. [score:1]
In summary, we have identified the potential clinical relevance of miR-449a in LNN breast cancer, wherein it promotes a variety of oncogenic functions such as increased cell viability, colony formation, migration, and invasion. [score:1]
Suppression of miR-449a significantly reduced in vitro cell survival, clonogenicity, migration, and invasionThe biological significance of miR-449a was evaluated in various human breast cancer cell lines. [score:1]
A proposed mo del for the miR-449a-CRIP2 pathway. [score:1]
Vector and anti-miR-449a co -transfected luciferase activity was normalized to vector and SC co -transfected luciferase activity, with Renilla luciferase activity for transfection efficiency normalization. [score:1]
The role of miR-449a and miR-449b (another member of the miR-449 family cluster and also located in the second intron of CDC20b) in other human malignancies appears to be controversial, and varies largely depending on the biological context. [score:1]
F. Representative images (left) and quantification (right) for the migration and invasion of MDA-MB-231 cells after transfection with anti-miR-449a or SC (40 nM). [score:1]
Anti-miR-449a or SC transfected cells were collected and lysed at 72 hours. [score:1]
These vectors (pmiR) were co -transfected with pre-miR-449a, anti-miR-449a, or SC into various cell lines. [score:1]
B. qRT-PCR for CDC20B, the miR-449a host gene, in corresponding cell lines. [score:1]
In silico (miRWalk) data was combined with experimental (GeneChip Human Genome U133 Plus 2.0 mRNA array of T47D cells transfected with anti-miR-449a) and publically available data (lymph node negative (LNN) cancer gene profiling). [score:1]
However, we speculate that the function of miR-449a is fundamentally linked with cytogenetic location and is dependent on cancer type or tissue of origin. [score:1]
A. Taqman Low Density Array (TLDA) was used to identify that miR-449a was significantly increased in primary LNN breast cancer samples and strongly associated with tumor relapse. [score:1]
To evaluate the effects of miR-449a suppression, cells were transfected with either SC (negative control) or anti-miR-449a (Figure 2C). [score:1]
In contrast, several studies supported the oncogenic phenotype of miR-449a and miR-449b. [score:1]
[1 to 20 of 73 sentences]
6
[+] score: 204
In conclusion, although several candidates have emerged from this unbiased microarray screen between the pseudoglandular and canalicular phases of lung development, miR-449a stood out as the most significantly upregulated, with N-myc as a likely target in the epithelium at this time in development according to prediction algorithms, the MGI database of mouse phenotypes, and luciferase assays. [score:7]
During chick (G. gallus) lung development, CDC20B expression was highest at E18 by RT-qPCR of whole-lung extracts (Fig 1B), suggesting that the developmental control of miR-449a expression follows the same pattern in mammals and avians. [score:7]
In addition, N-MYC expression in CDH lungs was increased and more wi dely expressed thorough the distal tips of growing airways in diseased lungs (Fig 5F and 5G) This phenotype is consistent with reduced miR-449a levels, possibly correlated with lung immaturity. [score:7]
Mycn transcripts are regulated by miRNA-449aSeveral transcripts were predicted as putative hsa-miR-449a targets by TargetScanHuman Release 6.2 (N = 655; 730 conserved binding sites in the miRNA family) (www. [score:6]
A prioritized list of likely miRNA-449a targets was obtained through a compilation of the online tools TargetScanHuman Release 6.2 and miRDB. [score:5]
MiRNA-449a exhibited the greatest increase in expression among differentially expressed genes, confirmed by real-time qPCR (Fig 1A) and replicated in C57BL/6 mouse embryonic lungs at comparable developmental stages (Fig 1B). [score:5]
Similarly, the pool of Sox9 expressing progenitors is expanded when miR-449a is antagonized, or reduced when it is overexpressed. [score:5]
Several transcripts were predicted as putative hsa-miR-449a targets by TargetScanHuman Release 6.2 (N = 655; 730 conserved binding sites in the miRNA family) (www. [score:5]
D. N-myc is the only predicted target of miR-449a associated with lung hypoplasia and expressed in the lung epithelium. [score:5]
N-myc, a transcription factor belonging to the myc basic Helix-Loop-Helix DNA binding domain family, was the only predicted miR-449a target in the MGI database to be associated to both abnormal branching morphogenesis and pulmonary hypoplasia in mouse mo dels, and also expressed in lung epithelial cells like miR-449a. [score:5]
In the present study, quantitative PCR revealed a time specific increase in expression of miR-449a at E15.5-E18.5, which corresponds to the end of branching morphogenesis in the late pseudoglandular phase, and throughout the canalicular phase; its expression decreased dramatically at birth. [score:5]
F-G. N-MYC expression is increased and more wi dely distributed in distal epithelium of A. hsa-miR-449a expression increases from 16 to 20 wk in human lungs (left) (n = 2 and n = 1, respectively), but not in patients with CDH (right) (n = 1 and n = 1, respectively). [score:5]
Therefore, we developed and injected in ovo an RCAS(A)-449a virus, expressing the murine miR-449a, or the negative control RCAS(A)-GFP along with sham injections at the beginning of lung development of chick embryos (E2). [score:4]
In the lung, upregulation of the miRNA-449a had been correlated with the differentiation of ciliated cells in proximal pulmonary epithelia through the Delta/Notch pathway [30, 33]. [score:4]
The most highly upregulated miRNA was miR-449a, confirming published microarray data in mice [31]. [score:4]
E. N-myc expression during mouse and chick lung development is anticorrelated with that of miR-449a. [score:4]
Interestingly, miRNA-449a reached its peak level of expression at 18 weeks (H. sapiens), or E18.5 (M. musculus), corresponding to the final stages of canalicular development. [score:4]
Although we do not presently know whether decreased miR-449a expression is sufficient to cause the full human phenotype or how it affects the diaphragm, the present study suggests that miR-449a dysregulation plays a role in the pathophysiology of CDH -associated lung hypoplasia. [score:4]
Inhibition of MiR-449a increases SOX9 expression. [score:4]
Furthermore, miR-449a murine ex vivo functional knockdown and avian in ovo overexpression documented morphological changes consistent with impaired lung differentiation and proliferation. [score:4]
MiR-449a overexpression reduces PCNA, NKX2.1, and SOX9 expression. [score:4]
In ovo viral transductionA replication-competent avian specific retrovirus (RCAS; A coat) was engineered to express the RCAS(A)-449a construct composed of the miR-449a murine premiR sequence flanked by 200 nucleotides, using established techniques, and grown and harvested in DF1 cells [27, 28]. [score:3]
The negative correlation (anticorrelation) between N-Myc and miR-449a expression was confirmed by RT-qPCR in human and mouse lung samples (Fig 1E). [score:3]
Lungs were harvested from E16.5 embryos, corresponding to the end of the pseudoglandular phase, at the onset of miR-449a expression. [score:3]
miR-449a is expressed during midgestation in human, murine, and avian lungs. [score:3]
Next, we studied the effect of miR-449 overexpression on lung epithelial proliferation. [score:3]
A. Hsa-miR-449a is highly expressed at 18–20 weeks (canalicular) relative to 9 weeks (pseudoglandular) and newborn human human lungs. [score:3]
Additionally, we detected abnormal miR-449a expression in the necessarily limited human CDH samples available for research purposes. [score:3]
In fact, miR-449a expression is normally controlled by the transcription factor E2F1, a potent stimulator of cell cycle progression [31, 32]. [score:3]
0149425.g005 Fig 5 A. hsa-miR-449a expression increases from 16 to 20 wk in human lungs (left) (n = 2 and n = 1, respectively), but not in patients with CDH (right) (n = 1 and n = 1, respectively). [score:3]
Site directed mutagenesis experiments with a series of 7 nucleotide deletions of the miR-449a:N-myc binding site, confirmed a direct interaction. [score:3]
As pulmonary hypoplasia is associated with diaphragmatic defects in humans and in animal mo dels, we assessed miR-449a expression levels in lung paraffin embedded specimens from available CDH fetuses by RT-qPCR. [score:3]
Given the observed increased epithelial proliferation in antagomir treated mouse lung explants, we hypothesized that miR-449a overexpression would disrupt lung growth, resulting in lung hypoplasia. [score:3]
The luciferase vector, a renilla vector for transcription control, and either pre-miR-449a or a negative control scrambled pre-miRNA were co -transfected into HEK cells, chosen from a panel of cell lines because they exhibited the lowest endogenous miR-449a expression in order to maximize signal-to-noise. [score:3]
The miR-449a target N-myc belongs to the group of genes that maintain the proliferation of undifferentiated progenitors [39]. [score:3]
Hsa-miR-449a expression in hypoplastic CDH lungs. [score:3]
Distal populations of epithelial progenitors start to express miR-449a as they leave the tip of the airways. [score:3]
A replication-competent avian specific retrovirus (RCAS; A coat) was engineered to express the RCAS(A)-449a construct composed of the miR-449a murine premiR sequence flanked by 200 nucleotides, using established techniques, and grown and harvested in DF1 cells [27, 28]. [score:3]
0149425.g001 Fig 1 A. Hsa-miR-449a is highly expressed at 18–20 weeks (canalicular) relative to 9 weeks (pseudoglandular) and newborn human human lungs. [score:3]
QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to delete either one or both predicted miR-449a binding sites within the N-myc 3’ UTR in the previously described luciferase vector. [score:2]
Therefore, we speculate that the N-myc regulation operated by miR-449a may be one of several cellular mechanisms used by epithelial progenitors to escape their undifferentiated proliferative state and thus coordinate the critical process of epithelial differentiation. [score:2]
MiR-449a expressing cells then engage two separate pathways, the first to reduce their proliferative rate, the second to initiate proximal epithelial mucociliary differentiation [30]. [score:2]
MiR-449a is expressed al low levels in the distal lung epithelium, and not in the mesenchyme, of mouse and chick lung explants (Fig 1C). [score:2]
C. MiR-449a expression in mouse (E15.5) and chick (E12) distal lung epithelium by LNA ISH. [score:2]
Mycn transcripts are regulated by miRNA-449a. [score:2]
MiR-449a, and its paralogs miR-449b and miR-449c, are co-regulated with their host gene CDC20B [30]. [score:2]
Mir449a expression. [score:2]
Thus, N-myc plays an important role in embryonic lung development and the data presented herein point to a role for miR-449a as a regulator of N-myc, as confirmed by luciferase assays. [score:2]
Pre-miR-449a transfection caused a significant reduction in luciferase activity compared to scrambled pre-miRNA treated cells (p < 0.0001), indicating direct regulation of the N-myc 3’UTR by miR-449a (Fig 2C). [score:2]
MiR-449a expression differences were not detectable at the onset of the canalicular phase between a 17 week CDH specimen (N = 1) and 16 week reference samples (N = 2) (Fig 5A). [score:2]
Mucociliary differentiation largely occurs late in lung development; our data, however, support the hypothesis that miR-449a may additionally influence distal epithelial progenitor proliferation. [score:2]
miR-449a regulates epithelial proliferation and differentiation ex vivo and in ovo. [score:2]
This pattern suggests a specific role for miR-449a in the mid stages of lung development. [score:2]
Luciferase assays based on a vector with a basal promoter and the luc2P gene upstream of the N-myc 3’UTR were used to confirm regulation by the miR-449a (Fig 2A). [score:1]
miR-449a regulates epithelial proliferation and differentiation ex vivo and in ovoBy competitive binding of PNA antagomirs, we investigated whether functional knockdown of miR-449a affected lung epithelial progenitors in ex vivo organ cultures. [score:1]
It is worth noting that human hsa-miR-449a and its murine ortholog mmu-miR-449a-5p share identical mature sequences in miRBase (www. [score:1]
0149425.g004 Fig 4E15 chick lungs after RCAS(A)-Gfp (A,C,E) or RCAS(A)-mir449a (B,D,F) in ovo infection, stained with anti-PCNA (A,B), anti-NKX2.1 (C,D), and anti-SOX9 (E,F) antibodies. [score:1]
Hsa-miR-449a binds to the MYCN 3’-UTR. [score:1]
MiR-449a was found to be highly expressed at the canalicular stage compared to the pseudoglandular stage. [score:1]
E15 chick lungs after RCAS(A)-Gfp (A,C,E) or RCAS(A)-mir449a (B,D,F) in ovo infection, stained with anti-PCNA (A,B), anti-NKX2.1 (C,D), and anti-SOX9 (E,F) antibodies. [score:1]
MiR-449a is a critical regulator of genes involved in cellular proliferation, differentiation, and apoptosis [30, 31]. [score:1]
In the mid-late canalicular phase, at 20 weeks gestation, miR-449a appeared to be reduced in a CDH fetus (N = 1) relative to a reference sample of the same gestational age (N = 1) (Fig 5A). [score:1]
B. Mmu-miR-449a, and CDC20B as a proxy for chick gga-miR-449a, in mouse and chick lungs. [score:1]
Specific deletion of the 5’ S1 predicted binding region alone was sufficient to result in significant loss of the miR-449a effect, indicating that S1 is the functionally active binding site. [score:1]
These data, necessarily based on the limited samples available for research purposes, suggest a role for hsa-miR-449a in the pulmonary phenotype of CDH patients prenatally, which should be further explored. [score:1]
E-F. Expression of the 3C2 viral marker was measured in RCAS-mir449 infected chick samples (*, lung airways or parabronchi). [score:1]
Furthermore, we found that miR-449a controlled epithelial proliferation in the developing lung. [score:1]
Anti-miRNA-449a and scrambled (control) Peptide Nucleic Acids (PNA) (Panagene, Daejeon, Korea) were transfected using Effectene Transfection Reagent (Qiagen, Venlo, The Netherlands). [score:1]
By the time miR-449a can be first detected by our methodology, proximal cells arising from a pool of epithelial progenitors, have already begun to abandon their undifferentiated state [41]. [score:1]
Their co-transfection with pre-miR-449a resulted in abrogation of the miR-449a effect when either S1 or S1+S2 were deleted, whereas deletion of S2 alone had only a modest effect on luciferase activity, indicating that S1 in the N-Myc 3’ UTR is the critical binding site for miR-449a (Fig 2C). [score:1]
Hsa-miR-449a binds to the MYCN 3’-UTRLuciferase assays based on a vector with a basal promoter and the luc2P gene upstream of the N-myc 3’UTR were used to confirm regulation by the miR-449a (Fig 2A). [score:1]
B. Site S1 and S2 sequence aligned with miR-449a. [score:1]
[1 to 20 of 72 sentences]
7
[+] score: 99
Two sets of miRNAs (one down-regulated and one up-regulated compared to controls) show similar expression levels in active and GFD CD patients, being miR-449a the highest expressed miRNA. [score:10]
qRT-PCR confirmed the expression levels both of miR-449a (active CD: 2.8±0.9 mean RQ±SEM) and of 2 other tested miRNAs, the down-regulated miR-124a (active CD:0.6±0.1 mean RQ±SEM) and the similar to control expressed miR-564 (active CD:1.4±0.3 mean RQ±SEM vs 1.2±0.1 at array). [score:8]
Six of the 11 programs [Target Scan 5.1, PicTar, Miranda 1.9, MirTarget2 (v2.0), PITA (Catalog version 3) and RNAhybrid (v2.2)], which we used to predict putative target genes of miR-449a, identified several proteins that are present in relevant biological pathways. [score:7]
The levels of a group of deregulated miRNAs (up-regulated miR-449a, down-regulated miR-124a, and similar to controls expressed miR-564) were also evaluated with TaqMan miRNA assays (Applied Biosystems) to validate the array results. [score:7]
Among the up-regulated miRNAs the miR-449a was expressed at very high levels in all active CD (55.18±16.45 mean RQ±SEM) and GFD children (15.43±7.69 mean RQ±SEM). [score:6]
Globally, these data indicate that the NOTCH1 pathway is deregulated in intestinal epithelium of CD children, irrespective of whether the disease is active or not, and that this alteration could be related to the very high miR-449a expression. [score:6]
No inhibition of the Renilla luciferase expression was observed in mutant 3′UTR of KLF4-mRNA with miR-449a, so confirming the miR-449a/3′UTR KLF4-mRNA direct interaction (panel B). [score:6]
The direct interaction between miR-449a and the 3′UTRs of both NOTCH1 and KLF4 was further confirmed after mutating the putative target sites in 3′UTR of the two genes (See S1). [score:4]
Figure S2 The luciferase assay confirms that miR-449a inhibits the expression of NOTCH1 and KLF4. [score:4]
MiR-449a binds to the 3′ UTR of NOTCH1 and KLF4 and inhibits their expression. [score:4]
Figure S1 Bioinformatics analysis of miR-449a putative target genes. [score:3]
The bioinformatics search for putative target genes of miR-449a revealed about one hundred proteins, among these several belonged to the Notch pathway, i. e., NOTCH1, KLF4 (a NOTCH1 transcription factor) [21], DLL1, LEF1 and NUMBL. [score:3]
Bioinformatic prediction of the target genes of miR-449a. [score:3]
php?species=Homosapiens&mirna_acc=hsa-miR449a&targetgene_type=refseq_acc&targetgene_info=&v=yes&search_int=Search (http://www. [score:3]
Particularly, the miR-449a showed the highest expression level in CD patients than in controls. [score:3]
miR-449a putative target genes with most favorable context score, selected by bioinformatics, were sorted into pathways using GOTM (http://bioinfo. [score:3]
php?species=Homosapiens&mirna_acc=hsa-miR-449a&targetgene_type=refseq_acc&targetgene_info=&v=yes&search_int=Search) (http://www. [score:3]
We also investigated the protein expression of KLF4, another selected target gene of miR449a, in small intestinal villi from GFD patients and controls, lacking the villous architecture in active CD patients. [score:3]
The biological pathways predicted to be deregulated by miR-449a and sorted in functional groups are reported in Figure S1 (http://mirecords. [score:2]
MiR-449a seems to be regulated through activation of its host gene, CDC20B, and both were induced by the cell cycle regulator E2F1 [19]. [score:2]
This finding confirms the interaction between miR-449a and the 3′ UTR of both NOTCH1 and KLF4. [score:1]
In HEK293 cells co -transfected or with pRL-NOTCH1 vector (panel A) or with pRL-KLF4 vector (panel B), a pre-miR-449a concentration of 100 nmol/L was sufficient to significantly reduce (respectively, p = 0.001 and p = 0.002) Renilla luciferase activity versus control values. [score:1]
The miR-449 (a and b) cluster is embedded into an intronic sequence of the mRNA-encoding gene CDC20B on Chr 5q11.2 [17]. [score:1]
cgi?species=Human&gid=&mir_sc=&mir_c=&mir_nc=&mirg=hsa-miR-449a). [score:1]
The mature miR-449a sequence is evolutionarily conserved across a variety of species (monkey, horse, rodents, and dogs) and therefore it probably exerts an important function [20]. [score:1]
We didn't verify the interaction miR-449a/3′UTR NOTCH1 being this latter recently validated by Marcet B et al [32]. [score:1]
As this pathway plays a relevant role in the control of intestinal cell fate in animal mo dels we further examined the interaction of miR-449a with Notch pathway [18]. [score:1]
Accordingly, in a very recent report miR449 by repressing the Delta/Notch pathway was elegantly shown to control the human airway epithelium and vertebrate multilciliogenesis [32]. [score:1]
In cells co -transfected with pRL-NOTCH1 vector and pre-miR-449a or with pRL-KLF4 vector, a pre-miR-449a concentration of 100 nmol/L was sufficient to significantly reduce (respectively, p = 0.001 and p = 0.002) Renilla luciferase activity versus control values after 48 h (Figure S2A and S2B). [score:1]
[1 to 20 of 29 sentences]
8
[+] score: 85
miR-449 and miR-34 have the same inhibitory seed sequence and function together in mouse development, such that knockout of either miR-449 or miR-34 paralogs alone does not yield a detectable developmental phenotypes, whereas knockout of both sets of miRNAs mice show defects in brain development and spermatogenesis caused, at least in part, by defective microtubule and associated cilia function [22]. [score:8]
Each point represents an individual sample a– b qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in all samples, normalized to the overall average expression to generate a relative expression value. [score:5]
Thus, the severe decrease in expression of both miR-449a and miR-34c we detect in early embryos from stressed male mice could alter brain development and the process of spermatogenesis in subtler ways than knockout mice. [score:5]
c Correlation plot comparing miR-449a expression to miR-34c expression in individual samples fitted with single-variable linear regression. [score:5]
Fig. 2 a– b qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in all samples, normalized to the overall average expression to generate a relative expression value. [score:5]
miR-449a and miR-34c are downregulated in sperm across generations and in early embryos derived from them in a mouse mo del of early life stress. [score:4]
The levels of the miR-449a and miR-34c are coordinately expressed in each sample (r = 0.913, P = 0.001), implying that stress regulates their levels in sperm by the same mechanism (Fig. 2c). [score:4]
Interestingly, among identified sperm miRNAs, only miR-449a/b and miR-34b/c have been shown to be expressed specifically in sperm, not eggs, and are present in zygotes, supporting a mechanism for how the small amounts of these miRNAs in sperm can impact early development. [score:4]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b Sperm miRNA content has been shown to be influenced by smoking 29, 30 and obesity 31, 32; however, in univariate regression analysis neither BMI nor smoking status were significantly associated with expression of sperm miR-449a or miR-34c (Extended Data, Table 1). [score:3]
The fact that we detect reduction in expression of paralogs of both miR-34 and miR-449 genes in sperm of men with high ACE scores, as well as in sperm of mice exposed to sociability stress and in embryos derived from them, adds to the potential functional significance of these findings. [score:3]
Consistent with these observations, we found low-sperm morphology score associated with low miR-449a expression. [score:3]
ACE score negatively correlates with expression of miR-449a and miR-34c in 28 human sperm samples. [score:3]
b– c Correlation plot comparing relative expression of miR-449a to miR-449b (b) and miR-34b to miR-34c (c) for individual samples fitted with single-variable linear regression. [score:3]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, bSperm miRNA content has been shown to be influenced by smoking 29, 30 and obesity 31, 32; however, in univariate regression analysis neither BMI nor smoking status were significantly associated with expression of sperm miR-449a or miR-34c (Extended Data, Table 1). [score:3]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Wu J Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesisProc. [score:2]
To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Consistent with this hypothesis, we discovered large decreases in the expression of both miR-449a and miR-34c in embryos isolated at the 2-cell, 4-cell, 8-cell, and morula stages (~two–tenfold) from the mating of stressed males to control females, compared to those from the mating of control males (Fig. 3b, c). [score:2]
A distinguishing feature of miR-449a/b and miR-34b/c is that they are among a small set (14) of miRNAs in mice that are not present in oocytes but delivered to them from sperm upon fertilization [34], suggesting that changes in these miRNAs observed in sperm of stressed males may influence subsequent generations via alterations in early development. [score:2]
b– c qPCR analysis of miR-449a (b), miR-34c-5p (c) in pooled F1 embryos derived from mating control females with stressed or unstressed males. [score:1]
Interestingly, both sharply reduced levels of sperm miR-449 and miR-34 family members and severe stress have been found to be associated with reduced sperm quality and fertility in men 32, 36. [score:1]
Fig. 3 a qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in pooled mature motile sperm isolated from stressed or control mice, n = 4–6 males per pool, 1 pool per group. [score:1]
Moreover, previous studies found that neither smoking nor obesity influence the levels of sperm miR-449a/b or miR-34b/c 30, 32. miRNA expression was also not associated with behavioral characteristics, such as alcohol and drug use, sperm count, or sperm motility. [score:1]
If a similar phenomenon occurs in humans, we predict that reductions in the levels of sperm miR-449a and miR-34c we detect in men with high ACE scores could be transmitted to their sons. [score:1]
One set includes two of the three paralogs of miR-449, miR-449a, and miR-449b, and the other set, two of the three paralogs of miR-34, miR-34b, and miR-34c. [score:1]
Because the relative levels of miR-449a and miR-449b, as well as miR-34b and miR-34c, were similar to each other in almost every sample (Fig. 1b, c) miR-449a and miR-34c were used as representatives of each family. [score:1]
However, a significant association was observed between sperm morphology score and levels of miR-449a, but not miR-34c. [score:1]
In mice, the effect of stress on these sperm miRNAs crosses generations, as reductions in miR-449a and miR-34c are found in both early embryos derived from stressed fathers and in sperm of males derived from these embryos. [score:1]
If so, this process could yield another explanation for why some men in our survey display low miR-449a and miR-34c levels despite reporting low ACE scores. [score:1]
Levels of miR-449a and miR-34c are decreased in sperm of male mice exposed to chronic social instability stress, early embryos derived from them, and sperm from adult mice derived from these embryos. [score:1]
We found a statistically significant inverse correlation between ACE score and levels of both miRNAs (miR-449a r = −0.4357, P = 0.0205; miR-34c-5p r = −0.397, P = 0.0376), where many of the highest ACE score samples had miR-449a and miR-34c levels as much as ~300-fold lower than many of the low ACE score samples (Fig. 2a, b). [score:1]
Fig. 1 a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
Both miR-449a and miR-34c are sharply reduced in sperm of these stressed males when they are adults (~fivefold) (Fig. 3a). [score:1]
a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
a qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in pooled mature motile sperm isolated from stressed or control mice, n = 4–6 males per pool, 1 pool per group. [score:1]
When male embryos from stressed fathers reached adulthood, levels of their sperm miR-449a and miR-34c were assayed, and found to also be severely suppressed (~tenfold) compared to those from control males (Fig. 3d), consistent with our previous finding that these mice transmit stress phenotypes to their F2 offspring [15]. [score:1]
[1 to 20 of 36 sentences]
9
[+] score: 83
Identical expression profiles between miR-34b/c and miR-449a/b/c, and the upregulation of miR-34b/c in miR-449 KO testes (Bao et al., 2012), strongly suggest that these two miRNA clusters might be functionally redundant. [score:6]
Both miR-34b/c- and miR449 -null sperm can fertilize wild type oocytes and support embryonic developmentTo test if miR-34b/c- and miR-449 -null sperm can fertilize WT oocytes and support preimplantation development, we performed ICSI using epididymal sperm isolated from these two KO males. [score:3]
The five miRNAs encoded by the two miRNA clusters, i. e., miR-34b/c and miR-449a/b/c, belong to the same miRNA family because they share the same “seed sequence” and target the same sets of mRNAs. [score:3]
MicroRNA-449 and microRNA-34b/c function redundantly in murine testes by targeting E2F transcription factor-retinoblastoma protein (E2F-pRb) pathway. [score:3]
As described above, these miRNA KO sperm lacked expression of either miR-34b/c or miR-449 (Fig.  1B). [score:3]
miR-34b/c and miR-449a/b/c are expressed in sperm, but absent in oocytes. [score:3]
Using TaqMan -based miRNA qPCR analyses, we examined expression levels of miRNA-34b/c and miR-449a/b/c in mouse sperm and oocytes (Fig.  1A). [score:3]
Fig. 3. Computer-assisted sperm analyses (CASA) of epididymal sperm collected from wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice. [score:2]
Testicular and epididymal histology and sperm morphology of wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice at the age of 10 weeks. [score:2]
Both miR-34b/c- and miR449 -null sperm can fertilize wild type oocytes and support embryonic development. [score:2]
Fertilization and development of WT oocytes injected with WT or miR-d KO (miR-34b/c [−/−];miR-449 [−] [/−]) spermatozoa. [score:2]
To test if miR-34b/c- and miR-449 -null sperm can fertilize WT oocytes and support preimplantation development, we performed ICSI using epididymal sperm isolated from these two KO males. [score:2]
Here, we show that both miR-34b/c- and miR-449 -null male mice displayed normal fertility, and that intracytoplasmic injection of either miR-34b/c- or miR-449 -null sperm led to normal fertilization, normal preimplantation development and normal birth rate. [score:2]
Despite their presence in sperm, miR-34b/c and miR-449a/b/c are not required for fertilization, first cleavage division, or subsequent development. [score:2]
miR-449 and miR-34b/c knockout mice were generated as described (Choi et al., 2011; Bao et al., 2012). [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
The fact that both miR-34b/c -null and miR-449 -null spermatozoa perform as efficiently as the WT spermatozoa in ICSI demonstrates that a lack of either of the two miRNA clusters does not affect fertilization and early development either in vitro or in vivo. [score:2]
Computer-assisted sperm analyses (CASA) of epididymal sperm collected from wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice. [score:2]
Normal fertility of miR-34c or miR-449 KO males suggests that sperm-borne miR-34c or miR-449 alone is dispensable for fertilization and early development. [score:2]
Fig. 2. Testicular and epididymal histology and sperm morphology of wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice at the age of 10 weeks. [score:2]
Thus, all five sperm-borne miRNAs, including miR-34b/c and miR-449a/b/c, are dispensable for the first cleavage division and subsequent early embryonic development. [score:2]
Our data demonstrate that miR-34b/c and miR-449a/b/c are essential for normal spermatogenesis and male fertility, but their presence in sperm is dispensable for fertilization and preimplantation development. [score:2]
Term development of mouse embryos developed from the oocytes fertilized by injection of WT and miR-d KO (miR-34b/c [−/−]; miR-449 [−/−]) round spermatids. [score:2]
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway. [score:2]
However, miR-34b/c and miR-449 double knockout (miR-d KO) males were infertile due to severe spermatogenic disruptions and oligo-astheno-teratozoospermia. [score:2]
Similar ICSI experiments were performed using miR-449 -null sperm, and no effect on fertilization and preimplantation development was observed (supplementary material Table S3; Fig. S1). [score:2]
These negative data are consistent with the normal fertility test results (supplementary material Table S1), demonstrating that a lack of either miR-34b/c or miR-449a/b/c in sperm does not affect oocyte activation, first cleavage division, or subsequent preimplantation development both in vivo and in vitro. [score:2]
To test whether sperm lacking all five functionally related miRNAs (miR34b/c and miR-449a/b/c) could fertilize WT oocytes and support early embryonic development, we performed ICSI using miR-d KO sperm and WT oocytes (Table 1). [score:2]
Inactivation of either the miRNA-34b/c or the miR-449 miRNA cluster does not affect fertility. [score:1]
Histological and TUNEL analyses on developing testes of wild-type (WT) and miR-34b/c;miR-449 double KO (miR-d KO) male mice and the acridine orange (AO) staining of WT and miR-d KO spermatozoa. [score:1]
Inactivation of either the miRNA-34b/c or the miR-449 miRNA cluster does not affect fertilityAs reported previously, global miR-34b/c KO and miR-449 KO mice are viable (Choi et al., 2011; Bao et al., 2012). [score:1]
Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 loci. [score:1]
We observed no differences between WT controls and mating pairs with different combinations between KO and WT mice, suggesting that both miR-34b/c and miR-449 global KO males and females both have normal fertility. [score:1]
miR-449 KO mice are viable and fertile (Bao et al., 2012), and here we show that miR-34b/c global KO mice also display normal fertility. [score:1]
Two miRNA clusters consisting of five miRNAs (miR-34b/c and miR-449a/b/c) are present in sperm, but absent in oocytes, and miR-34c has been reported to be essential for the first cleavage division in vitro. [score:1]
Since the five miRNAs (miR-34b, miR-34c, miR-449a, miR-449b and miR-449c) share the same seed sequence of “GGCAGUG”, we analyzed two possible 6nt seed sequence combinations, including one with the 1 [st]–6 [th] nt and the other with the 2 [nd]–7 [th] nt (“selected words”). [score:1]
In summary, although either of the two miRNA clusters (miR-34b/c and miR-449) is dispensable for male fertility, ablation of both results in disrupted spermatogenesis and male infertility. [score:1]
Fig. 4. Histological and TUNEL analyses on developing testes of wild-type (WT) and miR-34b/c;miR-449 double KO (miR-d KO) male mice and the acridine orange (AO) staining of WT and miR-d KO spermatozoa. [score:1]
Bars represent proportions of red, yellow/orange, or red sperm in WT, miR-34b/c KO, miR-449 KO, and miR-d KO mice. [score:1]
Fig. 1. (A) qPCR analyses of levels of miR-16 (positive control), miR-34b/c and miR-449a/b/c in wild-type (WT) mouse sperm and oocytes. [score:1]
Adult (6–8 weeks) WT, miR-449 KO and miR-34b/c KO female mice were superovulated using pregnant mare's serum gonadotropin (PMSG, 5 IU/mouse, i. p. ), followed by human chorionic gonadotropin (hCG, 5 IU/mouse i. p. ) 48 h later. [score:1]
Moreover, miR-34c belongs to a family of five miRNAs including miR-34b, miR-34c, miR-449a, miR-449b, and miR-449c, which are encoded by two miRNA gene clusters: miR-34b/c and miR-449. [score:1]
Similarly, adult miR-449 KO males were bred with adult WT or miR-449 KO females. [score:1]
To evaluate whether miR-34c and the other 4 members of the miRNA family have an essential role in the first cleavage division both in vivo and in vitro, we analyzed miR-34b/c (Choi et al., 2011) and miR-449 (Bao et al., 2012) knockout mice, and also generated miR-34b/c; miR-449 double knockout (herein called miR-d KO) mice. [score:1]
As reported previously, global miR-34b/c KO and miR-449 KO mice are viable (Choi et al., 2011; Bao et al., 2012). [score:1]
[1 to 20 of 45 sentences]
10
[+] score: 63
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 The density of LCs in the epidermis is known to decrease with age in mice [21]. [score:19]
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 (A) LCs were isolated using AutoMACS with anti-MHCII-PE and anti-PE microbeadsfollowed by a cell sorter. [score:19]
Thus, upregulated miR-449 and miR-9 in aged LCs could downregulate the TGF-β signaling pathway and block LC development. [score:8]
Thus, upregualated miR-709 and miR-449 in aging LCs may downregulate the expression of IFR and CSFR, causing a deficiency in LCs development in aging mice. [score:7]
Based on the miRNAs potentially linked to LCs development and function, we have further confirmed that miR-709, miR-449 and miR-9 were upregualated in aging, while miR-200c and miR-10a were downregulated in aging by using single TaqMan RT-PCR assays (Figure 5 D). [score:4]
miRNAs miR-449 and miR-9 potentially target TGFβ1, TGFβRI, TGFβRII, RunX3 and C/EBP, which are involved in TGF-β signaling (Figure 6). [score:3]
Interestingly, miR-709 and miR-449 also target IFR8 and CSF1R. [score:3]
[1 to 20 of 7 sentences]
11
[+] score: 51
Hnf4a is essential to liver development and maintenance, and when suppressed, it can cause epigenetic changes that lead to increased incidence of hepatocellular cancer [59 Reduced expression of miR-449 in aging liver would increase Hnf4a expression, possibly preventing hepatocyte transformation. [score:8]
Of the ten miRNAs downregulated in Ercc1 [−/−] MEFs, eight (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) were also down-regulated in both the progeroid and old WT mouse livers compared to the WT young (20 week) control mouse livers (Figure 1). [score:6]
Of the 8 downregulated miRNAs in Ercc1 [−/Δ] and WT old mouse liver compared to WT young mouse liver (Figure 1), three miRNAs (miR-449a, miR-455*, miR-128) were also downregulated in the kidneys of progeroid mice compared to WT young mice (Figure 2). [score:5]
These observations are in line with our results that miR-449a is downregulated in senescent cells. [score:4]
Three miRNAs (miR-128, miR-449a and miR-455*) are downregulated in late passage MEFs as well as liver and kidney tissues of both progeroid Ercc1 [−/Δ] and WT old mice. [score:4]
Additionally, we demonstrate that several miRNAs differentially expressed in the Ercc1 [−/−] MEFs (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) were also dysregulated in liver tissues of both progeroid Ercc1 [−/Δ] and old WT mice compared to young WT mice. [score:3]
We show that three of the above miRNAs (miR-449a, miR-455* and miR-128) were downregulated in kidney tissues from Ercc1 [−/Δ]progeroid and WT old mice compared to the young mice. [score:3]
The transcription factor, Hnf4a, is a target of miR-449a in liver cells [58]. [score:3]
MiR-449a targets critical cell cycle regulatory proteins such as Cyclin D1 [54, 55]. [score:3]
Previously confirmed gene targets of the miRNAs identified in this study that are linked to cellular senescence and aging (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) are listed in Supplemental Table S1. [score:3]
Three of these miRNAs (miR-128, miR-449a and miR-455*) were also downregulated in the kidneys of progeroid and WT old mouse compared to the young WT mouse kidneys (Figure 2). [score:3]
Eight miRNAs (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) are significantly downregulated in the livers of progeroid Ercc1 [−/Δ] and naturally aged mice compared to young adult mice (Figure 1). [score:3]
In summary, we identified several miRNAs that are similarly dysregulated in senescent primary MEFs and senescent tissues of progeroid and naturally aged mice (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b). [score:2]
We analyzed the levels of 13 miRNAs confirmed to be dysregulated in P7 Ercc1 [−/−] MEFs compared to P3 Ercc1 [−/−] MEFs (miR-680, miR-320, miR-22, miR-449a, miR-455*, miR-675-3p, miR-128, miR-497, miR-543, miR-450b-3p, miR-872, miR-369-5p and miR-10b) in RNA samples prepared from the livers of WT young (20 weeks), the progeroid Ercc1 [−/Δ] mice, and WT old mice (30 months). [score:1]
[1 to 20 of 14 sentences]
12
[+] score: 51
In contrast, miR-449a displayed the binary expression as miR-34b/c during spermatogenesis but had an overall lower expression (Fig. 2A–B). [score:5]
Mice heterozygous for the miR-34bc [Fl], targeted Dcr and miR-449 targeted alleles were crossed to Deleter Cre [43] to generate the miR-34b [−], Dcr [FH] and miR-449 [−] alleles, respectively. [score:5]
The targeting vector used for introduction of loxP flanked Neomycin (Neo) cassette into the miR-449 locus and the schematic map of the targeted miR-449 before and after Cre -mediated-recombination are shown. [score:5]
Our analysis identifies miR-34b/c and miR-449 loci as specifically and abundantly expressed in post-mitotic germ cells. [score:3]
miR-34b/c and miR-449 are selectively expressed in post-mitotic spermatogenesis. [score:3]
Northern blotting of testicular RNA revealed the robust expression of miR-34b/c and miR-449a at postnatal day 14, a time when the appearance of pachytene spermatocytes is observed. [score:3]
With the similarity of expression of miR-34b/c and miR-449 loci and their potential to be functionally redundant with respect to spermatogenesis, we generated miR-34bc [−/−];449 [−/−] mice (Fig. 3A) that were born in Men delian ratios. [score:3]
A 8 kb DNA fragment corresponds to the wild-type miR-449 locus, integration of loxP flanked neo cassette of introduces an additional BamHI site, thus decreasing the size of the BamHI DNA fragment recognized to 6.6 kb in the miR-449 targeted allele. [score:3]
A targeting construct was generated that contains the 5′ 4.9 kb and 3′ 4.7 kb homology arms, an loxP flanked neo cassette that replaces the sequences the encoding miR-449a, b and c. Southern blotting of the individual ES cell clones-derived genomic BamHI-digested DNA with an external 3′ probe was used to identify homologous recombinants. [score:3]
The Dcr [FH], miR-34bc and miR-449 targeting constructs were electroporated into A9 ES cells (ESCs) and manipulated to generate mice fully derived from ESCs [41]. [score:3]
Both the miR-34b/c and miR-449 showed highly restricted expression profiles across an assortment of mouse tissues (Fig. 2C) [32]. [score:3]
Next we wanted to determine the precise onset of miR-34b/c and miR-449a during spermatogenesis and we decided to take advantage of the first wave of spermatogenesis, as it proceeds in a near synchronous manner with the appearance of successive spermatogenic populations across juvenile mouse development (Fig. S1A). [score:2]
Our study identifies the miR-34b/c and miR-449 as the first miRNA loci required for mammalian spermatogenesis. [score:1]
This strategy is designed to remove the miR-449 without affecting the Cdc20B gene. [score:1]
The miR-449a, miR-449b and miR-449c miRNAs are encoded in 1.6 kb of sequence within an intron of 20 Kb of the coding Cdc20B gene. [score:1]
For the miR-34bc [−/−];449 [−/−] experiments, miR-34bc [+/−];449 [+/−] or miR-34bc [+/−] or miR-449 [+/−] were used as control mice. [score:1]
Position of the DNA encoding the pre-miR-449a, pre-miR-449b and pre-miR-449c are indicated within the intron of Cdc20B. [score:1]
Representative images from one of three independent experiments are shown for panel E and F. (A) qRT-PCR of miR-34a, miR-34b, miR-34c and miR-449a from control (Ctl) and miR-34bc [−/−];449 [−/−] adult testis. [score:1]
The miR-34b/c miRNAs are part of a miR-34 family encompassing six miRNAs (miR-34a, b, c and 449a, b, c) encoded by three distinct loci (miR-34a, miR-34b/c and miR-449) (Fig. 2B). [score:1]
Having established that loss of both miR-34b/c and miR-449 loci results in oligoasthenoteratozoospermia, we next wanted to define the etiology of this disorder. [score:1]
Deletion of miR-34bc and miR-449 leads to sterility due to the production of abnormal spermatozoa with reduced motility. [score:1]
To generate mice lacking all miR-449 miRNAs, we replaced the hairpins that encode all miR-449s with loxP flanked neo cassette. [score:1]
[1 to 20 of 22 sentences]
13
[+] score: 36
As such, we searched for mRNA targets of miR-135b and miR-449a using the target-prediction softwares TargetScan and Pictar. [score:7]
Predicted targets of miR-449a that were differentially expressed included the following: lymphoid enhancer -binding factor 1 (lef1) and Kit ligand. [score:5]
Real time RT-PCR analysis confirmed the upregulation of miR-449a, miR-1, and miR-135b (Fig. 1B). [score:4]
Runx2 and lef1 are the downstream targets of WNT signaling suggesting that miR-135b and miR-449a may have a common function in regulating WNT signaling. [score:4]
However, it appears that the effect of the observed 6- and 60-fold induction of miR-449a and miR-135b on transcript levels of their predicted targets is negligible. [score:3]
For example, differential expression of miR-135b is found in human colon cancer samples [Sarver et al., 2009] and miR-449a is associated with antitumor activity in prostate cancer cells [Noonan et al., 2009]. [score:3]
First, the genes targeted by miR-449a and miR-135b in response to particle exposure may be different than the ones predicted in silico. [score:3]
Analysis by qRT-PCR confirmed the higher levels of miR-449a (fold six), miR-1 (2.6-fold), and miR-135b (60-fold) in this study (Fig. 1B) but not the suppression of miR-223 and miR-92a. [score:3]
gr/tarbase/) did not reveal any known targets of miR-449a or miR-135b. [score:3]
Thus, miR-1, miR-135b, and miR-449a may play a role in these biological processes. [score:1]
[1 to 20 of 10 sentences]
14
[+] score: 34
Then, downregulation of miR-449a by androgens and, consequently, upregulation of TBL1XR1 should positively regulate Wnt-β-catenin gene expression on GD 17.0. miR-449a is also known to target jagged 1 (jag1) mRNA, which encodes the ligand of the Notch 1 receptor. [score:12]
The combination of the two profiling studies revealed that the target genes inversely regulated by flutamide compared to miRNAs were involved in several biological processes and molecular functions relevant to lung development such as lipid metabolism, cell proliferation and differentiation, cell-cell signaling, several signaling pathways, angiogenesis, and more as presented in Figs.   3 and 4. Two miRNAs among the 20 most abundant miRNAs detected in the fetal lung on GD 17.5 [47] were downregulated by androgens (upregulated by flutamide) on GD 17.0 in our study, namely, miR-92a-1-5p and miR-449a. [score:10]
Our results showed that jag1 mRNA is also regulated by two other miRNAs (miR-126-5p and let-7b-3p) that, like miR-449a, were upregulated by flutamide. [score:5]
Transducin (beta)-like 1X-related protein 1 (TBL1XR1 or TBLR1) mRNA is a predictive target for miR-449a that is conversely regulated by androgens. [score:4]
It was previously demonstrated that the miR-449 family contributes to cell fate determination by targeting the Notch signaling pathway [50]. [score:3]
[1 to 20 of 5 sentences]
15
[+] score: 26
For instance, miR-449-5p exerts anti-IAV activities by inhibiting histone deacetylase and, therefore, inducing IFNβ expression (18), and inhibition of miR-223-3p (which was more highly expressed in the DBA/2J strain in our study) reduced mortality and delayed death of H5N2-infected mice (64). [score:9]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
Many miRNAs whose expression differed between DBA/2J and C57BL/6J mice during infection belong to the miR-467, miR-449, and miR-34 families. [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
The miR-34 and miR-449 families control epithelial barrier repair (65) and regulate multiciliogenesis via the Delta/Notch pathway (66, 67), which might help transport virions out of the respiratory tract (68) and reduce end-organ damage. [score:2]
Using the ViTa Database, the human homologs of miR-135b-5p, miR-147-3p, miR-31-5p, miR-379-5p, miR-7a-5p, as well as the miR-449 (-5p) and miR-34 (-5p) families, were predicted to bind to viral RNA segments of influenza A/Puerto Rico/8/34/Mount Sinai (H1N1). [score:1]
An at least twofold greater induction in C57BL6/J mice was detected in eight miRNAs (miR-190a-3p, miR-449a-5p, miR-449a-3p, miR-449c-5p, miR-3096a-5p, miR-3096b-5p, miR-3096b-3p, and miR-669c-5p). [score:1]
Of note, miR-31-5p, miR-379-5p, miR-7a-5p, as well as some members of the miR-449 (-5p) and miR-34 (-5p) families were moderately to highly abundant (>10 CPM), making it more likely that they would bind to a biologically relevant number of viral RNAs. [score:1]
Of these two, the miR-449 family is of considerable interest with respect to the higher resistance of C57BL/6J mice, because—in addition to their different abundance in the two strains—these miRNAs were more strongly induced in C57BL/6J mice, suggesting that their higher abundance is less due to mere leukocyte infiltration. [score:1]
[1 to 20 of 9 sentences]
16
[+] score: 25
Seven of these miRNAs were found to be significantly downregulated (miR-449a-3p, miR-298-5p, miR-92a-1-5p, miR-423-5p, miR-423-3p, miR-128-3p, miR-340-3p), and 1 was found to be significantly upregulated (miR-21a-3p) at 6 hours after transient scrotal heat treatment. [score:7]
MiR-449a-3p, miR-298-5p, miR-92a-1-5p, miR-423-5p, miR-423-3p, miR-128-3p and miR-340-3p were found to be significantly downregulated (A-G, all p < 0.05), and miR-21a-3p was found to be significantly upregulated at 6 hours after heat treatment (J, p = 0.006). [score:7]
We further identified significant associations of miR-449a-3p, miR-92a-1-5p, miR-423-3p, and miR-21a-3p with the germ cell AI, suggesting that these miRNAs may directly or indirectly regulate apoptosis-related pathways. [score:4]
Finally, we validated the differential expression levels of miR-449a-3p, miR-92a-1-5p, miR-423-3p, miR-340-3p, and miR-21a-3p, which were in agreement with our sequencing results. [score:3]
Finally, some of the identified miRNAs (e. g., miR-449a-3p, miR-92a-1-5p, miR-423-3p, and miR-128-3p) correlated closely with germ cell apoptosis. [score:1]
The relative levels of miR-449a-3p (A), miR-92a-1-5p (C), miR-423-3p (E) and miR-128-3p (F) correlated significantly and negatively with the germ cell AI (r = -0.58, -0.58, -0.45, and -0.48, respectively; p = 0.007, 0.007, 0.045, and 0.033, respectively); the relative level of miR-21a-3p (H) correlated significantly and positively with the AI (r = 0.56, p = 0.01). [score:1]
Figure 7The relative levels of miR-449a-3p (A), miR-92a-1-5p (C), miR-423-3p (E) and miR-128-3p (F) correlated significantly and negatively with the germ cell AI (r = -0.58, -0.58, -0.45, and -0.48, respectively; p = 0.007, 0.007, 0.045, and 0.033, respectively); the relative level of miR-21a-3p (H) correlated significantly and positively with the AI (r = 0.56, p = 0.01). [score:1]
We found that the relative levels of miR-449a-3p, miR-92a-1-5p, miR-423-3p and miR-128-3p correlated significantly and negatively with the germ cell AI (r = -0.58, -0.58, -0.45, and -0.48, respectively; p = 0.007, 0.007, 0.045, and 0.033, respectively). [score:1]
[1 to 20 of 8 sentences]
17
[+] score: 24
The MYCN mo del systems, however, cannot confirm the positive correlation between miR-34c-5p and miR-449a and MYCN expression or activity observed in primary neuroblastoma tumors: miR-34c-5p is consistently downregulated in the murine mo dels, whereas the expression of miR-449a is not altered. [score:8]
Considering the 5 MYCN -induced miRNAs, the data in the LSL- MYCN;Dbh-iCre tumors again fully recapitulated the findings from the TH-MYCN progression mo del: miR-19a-3p, miR-19b-3p and miR-494-3p showed increased expression in tumors compared to wild-type control tissue (Fig. 4D), whereas miR-34c-5p and miR-449a are respectively significantly downregulated and not regulated in LSL- MYCN;Dbh-iCre tumors. [score:6]
The 2 remaining positively correlated miRNAs, miR-34c-5p and miR-449a, are, respectively, significantly downregulated and not regulated during tumor development (Fig. 4B). [score:6]
Although the expression of miR-34c-5p increases upon MYCN activation in the in vitro, the upstream region of miR-34c-5p does not contain E-box sequences (data not shown), and miR-449a, residing in the second intron of CDC20B, was not identified by Shohet and colleagues [24] in their screen for intronic miRNAs regulated by MYCN. [score:4]
[1 to 20 of 4 sentences]
18
[+] score: 20
In addition, miR-449 expression is not substantially increased in miR-34 -null mice, and activation of the p53 pathway does not lead to significant upregulation of miR-449 (Figure S8). [score:6]
Figure S8Expression of miR-449a, miR-449b and miR-449c. [score:3]
Although our observation that single KO and miR-34 [T KO/T KO] mice produce viable offspring argues against an essential role for miR-34 in these processes, members of the related miR-449 family, that are particularly highly expressed in the testis (Figure S8), could partially compensate for miR-34 loss in this context. [score:3]
A notable exception is represented by the testis, in which expression of miR-449a is particularly elevated (Figure S8). [score:3]
First, in the tissues and cells used in our experiments, the expression of miR-449 members is much lower compared to miR-34a and miR-34c, as judged by multiple independent methods including qPCR, Northern blotting and high throughput sequencing (Figure S8 and data not shown). [score:2]
In particular, members of the miR-449 family (miR-449a, b and c) have the same “seed” sequence as miR-34, and miR-34 antagonists could in principle impair their function as well. [score:1]
For each tissue, the same membrane was serially probed first for the three members of the miR-449 family and lastly for miR-34a. [score:1]
A conclusive test for this hypothesis will require the generation of compound miR-34 and miR-449 mutant animals, but several lines of evidence suggest that this explanation is not particularly likely. [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 20
In particular, miR-31 and miR-34c were not modulated (Figures 1B,C); miR-206 was up-regulated (Figure 1D) and miR-449 and miR-335 were down-regulated (Figures 1E,F) in the diaphragm of 4-week-old mdx mice. [score:7]
In particular, we observed a down-regulation of miR-449 (Figure 2C), and an up-regulation of miR-206 (Figure 2D) in the diaphragm of 4-week-old mdx/mIGF-1 mice, compared to mdx littermates. [score:6]
In contrast, mIGF-1 overexpression modulated regenerative miR-449 and miR-206 (Figures 2C,D) but not miR-335 expression (Figure 2B). [score:5]
miR-335 and miR-449 are potent mediators of cell differentiation (Lizé et al., 2011; Tomé et al., 2011), whereas miR-494 has been proven critical for the myocytes’ adaptation and survival during hypoxia/ischemia (Han et al., 2011). [score:1]
Dystrophic-signature miRNAs has been divided into three main classes: degenerative miRNAs (miR-1, miR-29c, and miR-135a), regeneration miRNAs (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), and inflammatory miRNAs (miR-222 and miR-223) (Greco et al., 2009). [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 17
Ren X. S. Yin M. H. Zhang X. Wang Z. Feng S. P. Wang G. X. Luo Y. J. Liang P. Z. Yang X. Q. He J. X. Tumor-suppressive microRNA-449a induces growth arrest and senescence by targeting E2F3 in human lung cancer cells Cancer Lett. [score:5]
Ye W. W. Xue J. S. Zhang Q. Li F. Y. Zhang W. Chen H. J. Huang Y. B. Zheng F. Y. MiR-449a functions as a tumor suppressor in endometrial cancer by targeting CDC25A Oncol. [score:4]
Zhou Y. Q. Chen Q. Y. Qin R. Zhang K. F. Li H. MicroRNA-449a reduces cell survival and enhances cisplatin -induced cytotoxicity via downregulation of NOTCH1 in ovarian cancer cells Tumor Biol. [score:3]
First, mmu-mir-449a has been shown as a tumor suppressor in endometrial cancer [16, 19], gastric carcinoma [15], lung cancer [17, 32], ovarian cancer [33], prostate cancer [18], etc. [score:3]
In the current study, we showed that three of the fifteen microRNAs, mmu-mir-449a, mmu-mir-1935 and mmu-mir-1894, had significant effects on lung metastasis of cancer cells. [score:1]
Of these microRNAs, fifteen constructs, including mmu-miR-487b [11, 12], mmu-miR-467e [13], mmu-miR-466d [14], mmu-miR-449a [15, 17, 18, 32, 33], mmu-miR-148a [20], mmu-miR-133a-1 [21], mmu-miR-1-2-as [22], mmu-miR24-2 [23], mmu-miR-1940, mmu-miR-1935, mmu-miR-1931 [24], mmu-miR-1902, mmu-miR-1895, mmu-miR-1894 [24], and mmu-miR-1193, were examined in this study. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 17
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
[1 to 20 of 4 sentences]
22
[+] score: 16
Furthermore, qPCR was performed again to validate the downregulated and upregulated expression of selected miRNAs that may be relevant to development and confirmed that miR-135, miR-302, miR-449a, miR-200b, miR-200c, miR-193b, miR-130, and miR-141 were downregulated, whereas miR-10a, miR-181, and miR-470 were upregulated by RA treatment (Fig 4C and 4D). [score:16]
[1 to 20 of 1 sentences]
23
[+] score: 15
To identify critical potential miRNA:mRNA interactions that regulate switching from the M0 to the M2a phenotype we performed correlation analysis on the following up-regulated miRNAs: miR-449a, - 295, -145, -297-5p, and -214 and the following down-regulated miRNAs: miR-124, -154*, -2133, -384-5p, -2135, -3473, -326, -2132, -133, -383, -2861, -2138, -762, -1224 and -711. [score:8]
Interestingly, down-regulation of miR-711 or mir-124 are as significant as up-regulation of either miR-145 or miR-449a in establishing the M2a phenotype based on –log(p-value) score (Fig 4D and Table S5). [score:7]
[1 to 20 of 2 sentences]
24
[+] score: 15
However miR-449 expression was shown to be significantly downregulated in the antrum of gastrin knockout mice relative to wild-type counterparts [25]. [score:7]
Dysregulation of the miR-449/pRB-E2F1 regulatory loop therefore increases E2F1 activity and promotes cell cycle progression and inhibits apoptosis in gastric cancer. [score:5]
The transcription factor E2F1 promotes miR-449 transcription which inhibits the oncogenic genes CDC25A and CDK6. [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 14
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, mmu-mir-449c, mmu-mir-449b
We found at least three members of the miR‐34/449 family, miR449a, miR34a, and miR34b, expressed at levels similar to those of miR‐7‐a‐1 (Fig  2A). [score:3]
miR449 mimic, under JAM‐A overexpression). [score:3]
In situ hybridization of E14 cortical slices further showed that miR‐34b and miR449a are predominantly expressed in the ventricular and subventricular zone of the neocortex, where neural progenitors reside (Fig  2B and C). [score:3]
This suggests that excessive mitotic spindle rotation is a direct consequence of miR449a mimic transfection and not necessarily linked to prolonged mitosis. [score:2]
miR449 mimic), * P‐value = 0.01928 (Neg. [score:1]
miR449 mimic). [score:1]
Transfection of the miR449a mimic caused excessive spindle rotation in cells that were delayed in mitosis, but also in cells that progressed to anaphase with normal timing (Fig  1D and E). [score:1]
[1 to 20 of 7 sentences]
26
[+] score: 13
[14] and miR-21a, miR-26b, miR-30b, miR-103, miR-194, miR-449a found to be upregulated in both the present study and in that of Gapp et al. [60] In addition, let7f, let7g and let7i were found to be upregulated in both this study and Gapp et al. [60] It is important to emphasize that we are not discounting the importance of other small RNAs not common between the studies to-date because they are potentially acting as secondary molecular mediators of the offspring phenotypes under specific study conditions. [score:7]
Expression of miR-449a was also not significantly altered by CORT treatment (t [(4.4)]=2.16, P=0.091), although variability in the CORT -treated samples was significantly different from controls (P=0.014; Figure 5d). [score:3]
miR-190b, miR-26b, miR350 and miR-449a have predicted binding sites for Bdnf. [score:1]
An independent cohort of CORT -treated animals was generated to validate the five top miRNA candidates, miR-190b, miR-192, miR-449a, miR-98 and miR-144, using SNORD95 as a reference gene (Figure 5d). [score:1]
miR-192, miR-449a and miR-98 have predicted binding to Igf2 (Figure 5c). [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 12
Following chronic CS exposure, 12 miRNAs (miR-146a, miR-148a, miR-152, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-342-3p, miR-376b* and miR-449) were differentially expressed in both lung tissue and BAL supernatant of which 10 showed concordant up- or down-regulation. [score:6]
By focusing on the overlap between subacute and chronic CS exposure within the same compartment, or the overlap between miRNAs with altered expression levels in BAL and lung, we narrowed the pool of interesting miRNAs down to 18: let-7b, let-7c, miR-135b, miR-138, miR-146a, miR-148a, miR-152, miR-155, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-322*, miR-342-3p, miR-376b* and miR-449. [score:3]
Only miR-449 and miR-148a displayed different expression patterns in the two compartments (Fig.   3b). [score:3]
[1 to 20 of 3 sentences]
28
[+] score: 10
MiR-449a and miR-449c are expressed during somitogenesis and neurogenesis, and these genes regulate Notch ligand Delta-like 1 (Dll1) expression [23]. [score:6]
Those down-regulated miRNAs included miR-134-5p, miR-296-3p, miR-381-3p, miR-449a-5p, miR-449c-5p, and miR-302 clusters. [score:4]
[1 to 20 of 2 sentences]
29
[+] score: 9
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
miR-669 is involved in c-Myc expression through p53 [95], miR-500 regulates MET protooncogenes and affects NF-kB [96], miR-466 is involved in mammary tumor development, miR-466c is involved in tumor growth [95], miR-449a regulates breast cancer development and inhibits cell proliferation [71], [97], [98] and miR-Let7b plays a role in myeloid leukemia [99]. [score:9]
[1 to 20 of 1 sentences]
30
[+] score: 9
On the other hand, miR-192 and miR-194 were highly expressed in the kidney and small intestine, and miR-449a was highly expressed in the lung (Figures 3(d) and 3(e)). [score:5]
The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure. [score:3]
In addition, we identified miR-449a as a lung-specific miRNA in rodents in the present study. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 8
However, some of the miRNAs identified in this study have not followed this expression pattern, for instance, miR-34c-5p and miR-449a-5p showed higher expressions with more differentiated cells, suggesting important roles at the final spermatogenic process stages, as has also been observed in previous studies [21, 61, 62]. [score:5]
The miR-34c-5p and miR-449a-5p dysregulations have been related with murine oligoasthenoteratozoospermia and sterility [63]. [score:2]
Nevertheless, some miRNA exceptions increased their levels with samples being more highly differentiated (Fig. 8B), as for instance miR-34c-5p, miR-449a-5p or miR-375-3p. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 8
In addition, the lack of a strong effect of genetic deletion of miR-34a could also be secondary to functional redundancy provided by the other miR-34 members or other p53-regulated tumor suppressor miRNAs [45– 49] or by the p53-independent miR-449 family, which shares a seed sequence with miR-34 [50]. [score:4]
In mice, miR34b/c and the related miR-449 cluster are expressed specifically in multiciliated epithelia and their KO causes infertility and respiratory dysfunction [6, 7], supporting their distinct roles. [score:3]
Three chromosome 5q11.2 miRNAs (miR-449a/b/c) share a seed sequence with miR-34, and have a tissue distribution similar to that of miR-34b/c [6, 7]. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 8
Three microRNAs had decreased expression in the bleomycin treated lungs (miR-26a, miR-151-3p and miR-676) while eight microRNAs had increased expression in the bleomycin treated lungs (miR-146b, miR-199a-5p, miR-21, miR-34a, miR-335-5p, miR-207, miR-301a and miR-449a). [score:5]
Using a mo del of intraperitoneal delivery of bleomycin, Cushing et al. [30] reported the altered expression of additional microRNAs common to the present work, miR-449a and miR-146b, further to their evidence of miR-21, miR-34a within the fibrosis microRNA profile at 10 and 28 days following bleomycin administration. [score:3]
[1 to 20 of 2 sentences]
34
[+] score: 7
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
Similarly, expression of miRNAs from the respiratory epithelium, such as miR-449, is abolished in E16.5 Foxg1-Cre [+/−]; Dicer [loxP/loxP] mutants, confirming that Dicer function can be effectively knocked out in all structures originating from the olfactory placodes (Figure 3C). [score:4]
Five of 24 probes, including miR-449 and miR-205, displayed expression limited to the nonneural respiratory epithelium (Figure 2A, left column, and Table S3). [score:3]
[1 to 20 of 2 sentences]
35
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
[1 to 20 of 2 sentences]
36
[+] score: 7
Infection with ma81 but not w81 resulted in the unique upregulation of miR-139-5p, miR-27a-5p, miR-29b-1-5p, and miR-877-3p and the downregulation of miR-449a-5p at both 1 and 3 dpi (Tables  1 and 2). [score:7]
[1 to 20 of 1 sentences]
37
[+] score: 7
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In a number of single studies, miRNAs such as let-7d [26], let-7i [26] and miR-210 [23] were also found to be up-regulated in prostate cancer, in contrast to let-7g [23], miR-27b [28], miR-99a [23], miR-126 [54], miR-128 [26], miR-152 [28], miR-200a [58] and miR-449a [59] which were down-regulated in prostate cancer samples. [score:7]
[1 to 20 of 1 sentences]
38
[+] score: 7
MiR-29 activates p53 by targeting p85-alpha and CDC42 (18), miR-449 targets SIRT1 and HDAC1 (19), and miR-32 targets TSC1 and activates mTOR in human glioblastoma multiforme (20), all of which lead to the stabilization of p53. [score:7]
[1 to 20 of 1 sentences]
39
[+] score: 6
Specifically, E2F1 induces cell cycle progression but also potentiates apoptosis via upregulating pro-apoptotic miR-449a/b expression [91]. [score:6]
[1 to 20 of 1 sentences]
40
[+] score: 6
We also found that miR-29c regulates the miR-34c and miR-449 expression by targeting DNMT3a and DNMT3b in NPC cells [10]. [score:6]
[1 to 20 of 1 sentences]
41
[+] score: 5
Sandbothe M The microRNA-449 family inhibits TGF-beta -mediated liver cancer cell migration by targeting SOX4J. [score:5]
[1 to 20 of 1 sentences]
42
[+] score: 5
A group of 39 miRNAs was significantly down-regulated by Nkx2-1 knock-down including miR-1195 (−4.9 fold), miR-378 (−4.6 fold), miR-449a (−2.1 fold), and miR-130a (−1.9 fold) (Figure  2A and Table  1). [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 5
A recent paper reported that inactivation of two miRNA clusters, miR-34b/c and miR-449 clusters, with identical seed sequences, affected brain development, and microtubule dynamics (Wu et al., 2014). [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
Of the 6 miRNAs in this miRNA seed family (miR-34a,b,c, and miR-449a,b,c) only miR-34a and miR-34c are annotated in pig, in agreement with the detected miRNAs in our profiling experiment. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 4
Ye W. Xue J. Zhang Q. Li F. Zhang W. Chen H. Huang Y. Zheng F. MiR-449a functions as a tumor suppressor in endometrial cancer by targeting CDC25A Oncol Rep. [score:4]
[1 to 20 of 1 sentences]
45
[+] score: 4
In lung cancer, NEAT1 is regulated by microRNA-449a, which can inhibit tumor cell growth [45]. [score:4]
[1 to 20 of 1 sentences]
46
[+] score: 4
MiR-449a exerts tumor-suppressive functions in human glioblastoma by targeting Myc -associated zinc-finger protein. [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 3
MiR-18a promotes the proliferation, migration and invasion of glioma cells, whereas miR-146a and miR-449a inhibit glioma growth by inducing cellular apoptosis [20– 22]. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
Thus, p73, by increasing the expression of Ago-1/2, it could increase the processing of miRNAs, such as let-7 (HMGA2; lin-28; EGFR; Kras; c-myc; Bcl-xL), miR-134 (Nanog; LRH1; Oct-4; Collagenase-3; Stromelysin), miR-130b (ERK2; Fosl1; TGFβR1; ERα; Tcf-4; Collagenase-3; Ago4; Dicer; p63), miR-214 (EZH2; CTNNB1), miR-449a (CDK6; SirT1; HDAC1; E2F-1), miR-503 (CCND1; Fosl1), miR-181d (ERK2; TGFβR1; Tcl-1; ERα; AID; Bcl-2) and miR-379 (lin-28) [Figure 2] [31], [32]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Other miRNAs candidates including miR-214, clustered with miR-199a-2 on mouse chromosome 1 as well as other miRNAs that have been previously associated to fibrosis, including miR-221-222 and miR-449a [37], [38] also showed an enhanced expression in the lung fibrosis-susceptible mice. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
A limited number of genes were shown to be regulated by EVI1 in a direct manner and to contribute to some of its biological effects, e. g., Gata2 [24], Pbx1 [40], Pten [41], Gpr56 [42], miR-1-2 [43], miR-9 [44], miR-124 [45, 46], and miR-449A [47]. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
LncARSR promoted sunitinib resistance by competitively binding miR-34/miR-449 to facilitate AXL and c-MET expression [22]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
ICC experiments confirmed that Cx43 and cTnT were convincingly turned on upon over -expression of miRNA449 alone and even more so in combination with miRNA133 (Fig. 3B). [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
Wu J Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesisProc. [score:2]
Comazzetto S Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 lociPLoS Genet. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 3
LncARSR promoted sunitinib resistance by competitively binding miR-34/miR-449 to facilitate AXL and c-MET expression [34]. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 2
The proposed microRNAs that are regulated through the processing machinary include let-7, miR-200c, miR-143, miR-107, miR-16, miR-145, miR-134, miR-449a, miR-503, and miR-21 [16]. [score:2]
[1 to 20 of 1 sentences]
56
[+] score: 2
Other miRNAs from this paper: mmu-mir-449c, mmu-mir-449b
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway. [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
For human miRNAs with same id numbers, only 2 are separated in the consensus families, namely mir-92/mir-92b and mir-449/mir-449b, showing that most of the miRNA families are robust to the variation in the input of the PBC pipeline. [score:1]
We further examined the alignments for mir-92/92b and mir-449/449b. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 1
Both miR-208b and miR-449 have been shown to be highly elevated by cardiovascular damage [41], while several plasma miRNAs have been shown to be specifically affected by drug -induced liver damage [42]. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
In these mice, 5 miRNAs were altered in blood but not in lung (miR-34b, miR-106a, miR-449, miR-466, miR-493). [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-223, mmu-mir-146b, mmu-mir-449b
Six candidate miRNAs were found (miR-146a, miR-146b-5b, miR-223*, miR-561, miR-449a and miR-449b). [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Yuan et al. reported that miR-34b/c and miR-449a/b/c are necessary for spermatogenesis [28]. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Other miRNAs from this paper: mmu-mir-449c, mmu-mir-449b, xla-mir-449
In mammals as well as in Xenopus, the Ccno gene is adjacent to the genes Mcidas and Cdc20b, which incorporates the miR-449 family in intron 2 (Supplementary Fig. 4a,b). [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
Plasma miR208b and miR449 have been shown to be highly elevated by cardivascular damage [42]. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
This is exemplified by the miR-34/miR-449 family (Fig. 1b). [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Mmu-miR-449a-5p was down 10-fold by both RMA and LVS. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
Genes that are involved in transcriptional processes, such as Polr3f, Polr2a, Polr3g and Polr2a were also mapped to the eQTL for miR-409, miR-681, miR-34 and miR-449. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
In addition to miR-492, other miRs such as miR-494 and miR-449 were also reported to be associated with various cancers [21- 23]. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Of these 116 miRNAs, miR-466d-3p (1520 fold), miR-449a (975 fold), miR-29a (479 fold), miR-146b (278 fold) and miR-409-3p (255 fold) were the top five miRNAs which had the highest fold changes across the dataset. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Mir-34b/c and mir-449a/b/c are required for spermatogenesis, but not for the first cleavage division in mice. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
MicroRNAs are thought to be important in fertility since the double inactivation of miR-34b/c and miR-449 miRNA clusters results in male infertility due to reduced sperm production and decreased sperm motility [6, 31]. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
The expression of mature miRNAs was assayed using TaqMan MicroRNA Assays (Applied Biosystems, Foster City, CA) specific for hsa-miR-486 (ID 001278), hsa/mmu-miR-21a (ID 000397), hsa-miR-455 (ID 001280), hsa-miR-151-3p (ID 002254), mmu-miR-1a (ID 002222), mmu-miR-133b (ID 002247), mmu-miR-5128 (ID 462199_mat), mmu-miR-223 (ID 002295), mmu-miR-146b (ID 001097), mmu-miR-133a (ID 001637), mmu-miR-449a (ID 001030), mmu-miR-122 (ID 002245), mmu-miR-351-3p (ID 464446_mat), mmu-miR-193a-5p (ID 002577), mmu-miR-151-3p (ID 001190), mmu-miR-574-3p (ID 002349), mmu-miR-3107/486 (ID 001278). [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
cortex, we found a single microRNA, Mirlet7f-1, with significant difference in association with Q, opposite sign of association with Q in striatum and cortex, and FDR<0.05 for association with Q in both tissues, and additional 6 microRNAs (Mir206, Mir301b, Mir92b, Mir378b, Mir208b, Mir449a) satisfying p<0.05 for association with Q in both tissues. [score:1]
[1 to 20 of 1 sentences]