sort by

26 publications mentioning gma-MIR167a

Open access articles that are associated with the species Glycine max and mention the gene name MIR167a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 280
Recent study using high osmotic stress in Arabidopsis has shown that 47 ath-miR167 also targets IAR3, an evolutionary conserved target, other than ARF6 and ARF8, which suggests that there might be additional target(/s) other than targets validated in natural/control condition. [score:9]
This suggests the miR167 mediated cleavage of novel Mdm-CNBL10 target mRNA and possible translational inhibition of novel Gma target mRNAs (as above). [score:9]
This suggests that changes in the spatiotemporal expression of miRNA or predicted target genes under stress or treatment may lead to validation of additional miR167 mediated target cleavage and regulation of biological processes. [score:8]
To understand conservation and diversification of miR167 target sites and the coevolution of miR167s and their target genes, we have done phylogenetic analysis with 27 UTSs along with total 44 selected target genes of 14 UmiR167s. [score:7]
Previous experimental studies on Arabidopsis miR167 37 have reported that over expression of only ath-miR167a (among four ath-miR167s) showed arrested flower development, similar to mutants of target arf6-2 and arf8-3 plants. [score:6]
Although this gene is not regulated by miR167 in Arabidopsis, the Mdm-CNBL10 homolog is targeted by mdm-miR167a due to sequence diversification in both miRNA and target site. [score:6]
Therefore, the uniqueness and sequence variation of miR167 sequences (on the basis of similarity) as well as their complementary target sequences are very important to understand the coevolutionary pattern of miR167s, their corresponding targets, and miR167 mediated gene regulation. [score:6]
As miR167 is a crucial family of plant miRNA implicated in multiple biological processes including gametophyte development, flower development and adventitious root development, we have attempted to trace back the evolutionary relationship of miR167 family members (as registered in miRBase database registry) and their target sequences among the land plants. [score:6]
We have used the psRNATarget web tool 46 for the identification of the novel target of the unique miR167 (Table 2). [score:5]
Phylogenetic tree was reconstructed using predicted target sequences and their unique miR167 binding sites to reveal the critical sequence variation in miRNA target sites. [score:5]
Each of other UmiR167s (UmiR167-7/8/9/11/12/14) are shared by only 1 miR167 sequence and also targets 1 gene except the UmiR167-12 (targeting 2 genes). [score:5]
A unique miR167 sequence may target transcripts of many genes, which may share the same miR167 complementary site (unique target sequence) despite their sequence variation at the whole gene level. [score:5]
The largest number of miR167 sequences (54) from 21 different species has the UmiR167-1 sequence, which has 3 UTSs (Unique Target Sequences), and is predicted to target transcripts from total 19 genes (Table 2). [score:5]
The complementary sequences of UmiR167 with their target genes, unique miR167 binding sites (on target mRNAs) were identified and numbered (Table 2). [score:5]
This suggests that besides miR167 sequences, the common target ARFs have also undergone sequence diversification resulting in ARF6/8 that are not targeted by miR167s in some cases. [score:5]
Predicted targets of unique miR167 sequences using psRNATarget web server tool. [score:5]
These unique miR167 (UmiR167) sequences were used for the prediction of targets of miR167s from all species (analyzed here) using psRNATarget tool 46. [score:5]
We have predicted that the unique miR167 sequences might target genes other than ARF6 and ARF8, which are the proved targets of miR167 in A. thaliana. [score:5]
Based on complementarity of unique miR167 sequences with their target genes, unique miR167 binding sites (on target mRNAs) were identified and numbered (as 1, 2, 3 etc. [score:5]
Variation in either of miR167 or its complementary target sequence may lead to functional diversity of miR167 mediated regulatory processes (Fig. 7). [score:4]
The absence of homologs of japonica Osa-ARF6 and Osa-ARF (targets of japonica UmiR167-1) (Table 2) in indica cultivars suggest the functional diversification of miR167 regulated ARFs. [score:4]
It was evident from our phylogenetic analysis that gma-miR167h/i and mdm-miR167a are clustered with 3′ derived miR167s rather than 5′ derived miR167s (Fig. 3) and predicted to cleave non-conserved target mRNAs. [score:3]
On the other hand, conserved target genes may undergo sequence variation in the miR167 binding sites. [score:3]
It is well known that ARF6/8 and IAA-Ala Resistant3 (IAR3) are evolutionary conserved targets of miR167 in Arabidopsis 47. [score:3]
We have also found CALCINEURIN B-LIKE10 (CNBL) to be a new target of mdm-miR167a, which has diverged from all other mdm-miR167s (Table 2, Fig. 3). [score:3]
Alignment of mdm-miR167a with their target gene Mdm-CNBL10 and sequenced 5′ RLM RACE PCR products. [score:3]
Similarly, target Mdm-CNBL10 is closely related to UTS 14 specific to mdm-miR167a (Fig. 7). [score:3]
Similarly, UmiR167-6, shared by 6 miR167 sequences from 4 species, is having only 1 UTS, and it targets 6 genes (Table 2). [score:3]
Though 8 miR167 sequences from 6 species share UmiR167-3, it has only one UTS belonging to one target gene. [score:3]
Validation of novel non-conserved target of miR167. [score:3]
Identification of Unique miR167 and Unique Target genes. [score:3]
ML Phylogeny of corresponding target sequences and miR167 using MEGA5 to show relatedness. [score:3]
Further, a phylogenetic analysis was done to understand the evolutionary pattern and reveal critical sequence variation in miR167 target sites. [score:3]
Therefore, coevolution of both miR167 and their respective target sequences played important role in the functional diversification among diverse species. [score:3]
Computational identification provided an extensive list of potential miR167 targets for diverse plant species (Table 1). [score:3]
5′RLM-RACE PCR based validation of novel miR167 targets. [score:3]
The availability of well annotated complete genome sequences of diverse mo del land plants such as P. patens, O. sativa A. thaliana and Z. mays (as described in the materials & methods) have enabled the comparative genomics studies to explore the evolutionary relationship of the pre-MIR167 gene family and their targets across diverse plant species. [score:3]
In course of evolution of miR167 sequences, the complementary sequence of target genes has also been subjected to evolutionary selection pressure. [score:3]
The UmiR167-5 is shared by 7 miR167 sequences from 5 species and has 6 UTSs belonging to 7 target genes. [score:3]
Not only at mature and precursor level, but target genes of bra-miR167 are also conserved. [score:3]
Interestingly, only 2 miR167 sequences share the UmiR167-4 from 2 species and is having 5 UTSs belonging to 6 target genes. [score:3]
Therefore, we suggest that in monocots (except O. sativa), miR167 mediated gene regulation is least affected during the course of evolution resulting into their functional conservation including auxin signaling, (Fig. 7). [score:2]
This is likely to provide functional diversification of miR167 mediated gene regulation and stress response in apple. [score:2]
This functional diversification is caused by mutation in critical region of mature miR167 sequences, as we have earlier shown for ppt-miR166m 44. [score:2]
So it could be assumed that not all miR167* are degraded during the processing of precursor, rather they function as miR167-3p as evident from deep sequencing results in miRBase (http://www. [score:1]
Therefore, a separate phylogenetic tree was reconstructed using reverse complementary sequences of miR167-3ps (miR167-3p-RC) along with other miR167s (Fig. 4). [score:1]
Phylogenetic analysis of mature miR167 sequences. [score:1]
However, precursors osa-pre-MIR167a/b/c have clustered discretely within clade I, osa-pre-MIR167d/f/g/h/j clustered in clade III of group II and osa-pre-MIR167e/i clustered in group I (Fig. 6). [score:1]
The branch length suggests that ath-miR167c and aly-miR167c-5p evolved faster with less substitution rate than acq-miR167 and cme-miR167e. [score:1]
We retrieved one hundred and fifty three mature miR167 and their precursor MIR167 (pre-MIR167) sequences from thirty three diverse plant species including basal plants like moss (Physcomitrella patens), monocot (Oryza sativa, Zea mays etc. ) [score:1]
Interestingly, the miRNAs represented as miR167-3p formed another group. [score:1]
The clade I of group II has further diverged through the duplication of sequences in the evolutionary process to a major sub-clade consisting of twenty five pre-MIR167 genes. [score:1]
The gma-miR167h and gma-miR167i map to Gm10: 46574263-46574413 [+], Gm20: 37901842-37901992 [−] chromosomal scaffolds respectively, whereas there is no genomic context annotated to mdm-miR167a (http://www. [score:1]
Except mdm-miR167a, all other mdm-miR167b–j were conserved and clustered in group II. [score:1]
In clade II, the precursor sequence zma-pre-MIR167g has diverged with higher rate of substitution from ssp-pre-MIR167b, sof-pre-MIR167a (which also have conserved mature miR167 sequences; Fig. 3) and sof-pre-MIR167b, which are separated from sbi-pre-MIR167e (Fig. 6). [score:1]
Interestingly, our phylogenetic analysis suggests that sequences of Brassica rapa is conserved at mature as well as precursor (miR167/MIR167) level and the event of duplication had occurred with a slow rate of substitution, since their precursor sequences are of almost equal length with maximum similarity. [score:1]
At precursor level, mdm-pre-MIR167b/e, mdm-pre-MIR167c/d and mdm-pre-MIR167a/f/g/h/i/j have clustered in clade I, VII and VIII, respectively (Fig. 6). [score:1]
The csi-pre-MIR167a, ctr-pre-MIR167 and ccl-pre-MIR167a/b also have a common ancestor. [score:1]
This is due to the less conservation of pre-MIR167 of sequences, as shown in the alignment statistics (Fig. 2). [score:1]
We have observed huge variation in the length of mdm-pre-MIR167 sequences, which is another cause of their diversification at precursor level in addition to the variation in the present sequences. [score:1]
Our analysis on evolutionary relationship among miR167 sequences shows that the mature miR167 family members, except gma-miR167i, gma-miR167h and mdm-miR167a which together produced a different group, are conserved and clustered in a single clade (Fig. 3). [score:1]
Unlike its mature miR167s, which are mostly conserved, the pre-MIR167 sequences of A. thaliana (ath-pre-MIR167) and A. lyrata (aly-pre-MIR167) are distributed in four clusters in both group I and II, and have diverged more (Fig. 6). [score:1]
One such branch has ghr-pre-MIR167b diverged from tcc-pre-MIR167a with faster rate of substitution. [score:1]
Similarly ~0.25 fraction of the total sequences in MIR167 (B) have >22% sequence identity. [score:1]
The first divergence from common ancestral sequence was of acq-miR167 and cme-miR167e, whereas the subsequent evolutionary divergence has resulted in the separation of ath-miR167c and aly-miR167c-5p (two orthologous miR167 sequences). [score:1]
This tree shows that all the miR167s, which are processed from the 3′ end of the irrespective pre-MIR167, made one cluster as in group I (Fig. 3). [score:1]
The miR167-3ps are thought to be processed from 3′ end of stem loop precursors, which are complementary to miR167-5p counterparts (Fig. 4). [score:1]
Unlike the miR166 sequences, where sequences were intermingled in Multiple Sequence Alignment (MSA) 45, the miR167 sequences from different species (as specified in Table 1) taken for our studies are aligned at a distinct position (Fig. 1). [score:1]
The topology of both ML and NJ phylogenetic tree for miR167 family members was found to be mostly similar, except changes in position of some members (Fig. 3 and Supplementary Fig. S1). [score:1]
Likewise, another branch has cme-pre-MIR167b diverged from vvi-pre-MIR167c and sly-pre-MIR167. [score:1]
In the sub-clade of mdm-pre-MIR167a/h/i, ahy-pre-MIR167 has evolved with higher rate of substitution from gma-pre-MIR167e/f. [score:1]
A total of 14 unique miR167 (UmiR167-1 to UmiR167-14) sequences have been identified, where 6 UmiR167s are shared by multiple species, 2 UmiR167 have more than 1 miR167 sequences of same species, and 6 UmiR167 sequences have only one miR167 sequence (Table 2). [score:1]
We have reconstructed the phylogeny of miR167 sequences for studying their sequence conservation and diversification among diverse plant species. [score:1]
Unusually, this cleavage took place at 5 [th] position rather than 10 [th] from the 5′ end of the mdm-miR167a, probably due to the presence of a mismatch at 9 [th] position (Fig. 8D,E). [score:1]
The ML tree is divided into two groups, Group I (comprising of twenty three pre-MIR167 sequences) and remaining sequences in Group II (Fig. 6). [score:1]
This suggests that there is a prime requirement of miR167a to be conserved in the diverse plant species. [score:1]
The results show that miR167-3p-RC sequences have also clustered together (Fig. 4) as their corresponding miR167-3p sequences (Fig. 3). [score:1]
To identify the number of miR167 sequences available, we used the miRNA registry database (miRBase version 19, http://microrna. [score:1]
The gma-pre-MIR167g/h and gso-pre-MIR167a have diverged from lja-pre-MIR167. [score:1]
The clustering of the mdm-pre-MIR167a with the other precursor sequence of apple (mdm-MIR167) species such as mdm-pre-MIR167j, h, i (Fig. 6, clade VIII) suggests that the members of the pre-MIR167 have evolved through probable duplication of same pre-MIR167 sequence and exist as ortholog or homolog in other species 49. [score:1]
Since there are no supporting experimental evidences for the evolutionary relationship of miR167 family till now, it was imperative to study the phylogenetic evolution of miR167. [score:1]
As we have suspected, all these miR167-3p-RCs formed a separate group from miR167-5p similar to their corresponding miR167-3p sequences (Fig. 4 and Fig. 3). [score:1]
An unrooted ML phylogeny of miR167s along with reverse complementary sequences of miR167-3p using MEGA5. [score:1]
The group I contains three miR167-5p (processed from 5′ of precursor) sequences such as gma-miR167h/i and mdm-miR167a along with all miR167-3ps. [score:1]
In those cases, we have verified miR167 using both RNAshape 55 and Mfold RNA secondary structure prediction 45 tool, using the few parameter settings for secondary structure prediction. [score:1]
We have also observed that two conserved pre-MIR167s, namely ath-pre-MIR167a and aly-pre-MIR167a, shares the common ancestor with the other two plant pre-MIR167 precursors of Brassica rapa (bra-pre-MIR167s) and Brassica napus (bna-pre-MIR167s). [score:1]
In group I, gma-miR167h and gma-miR167i have been separated from all other miR167 members in that species (Group II), and made a single cluster in group I (Fig. 3). [score:1]
The ClustalW alignment in the MEGA5 shows many unique miR167 sequences; each unique mature miR167 sequence may be derived from multiple precursor sequences (Fig. 1). [score:1]
Similar paralogous sequences like zma-pre-MIR167h and zma-pre-MIR167i are also found in group I. Among ten rice osa-pre-MIR167 sequences, only osa-pre-MIR167e is found in group I with higher substitution rate (Fig. 6). [score:1]
One of the major branches among them has no sub-clade containing only ptc-pre-MIR167a/c, whereas former one evolved faster with higher rate of substitution (Fig. 6). [score:1]
The GeneDoc analysis showed that the nta-pre-MIR167b has 41% sequence identity with the nta-pre-MIR167c, whereas nta-pre-MIR167a has 39% sequence similarity with these two sequences respectively (Fig. 2). [score:1]
This suggests that the miR167-3p mature sequences were processed from the 3′ end of their precursor sequences and represented as separate miR167-3p, rather than miR167*. [score:1]
The miR167 entries in miRBase were further verified using BLAST search in NCBI, (http://www. [score:1]
Similarly, mature sbi-miR167a-i are highly conserved and clustered in group II and their precursors also have followed the similar pattern as in case of osa-pre-MIR167s. [score:1]
The MIR167 precursors of clade VIII have diverged into three branches, where the two major branches are mdm-pre-MIR167a/h/i and mdm-pre-MIR167g/f. [score:1]
Phylogenetic analysis of pre- MIR167 sequences. [score:1]
The clustering of these sequences in group I, where all the miR167 sequences are processed from 3′ end of stem loop precursors, suggests that these sequences are also processed from 3′ end. [score:1]
Deletion or addition of sequences during duplication process might have caused the changes in the length of precursors/genes during evolution of mdm-pre-MIR167 family. [score:1]
The separation of precursor sequences of some conserved mature miR167 sequences in precursor phylogenetic tree such as ath-miR167a/b, sbi-miR167, zma-miR167, ptc-miR167 etc. [score:1]
Similarly, the diversity in sequences (within the mature miRNA part of some species such as gma-miR167h/i and mdm-miR167a) from their corresponding other mature miR167 family members are due to critical changes in the mature sequence in the course of evolution (Table 2). [score:1]
Similarly, mdm-miR167a clustered with ptc-miR167f-3p, ptc-miR167g-3p and ptc-miR167h-3p (Fig. 3). [score:1]
This indicates that the ppt-miR167, with faster and higher substitution rate, had undergone sequence diversification from others in group II. [score:1]
Although precursor gma-pre-MIR167s are clustered in group II, their conservation is discrete and appeared in different clades such as gma-pre-MIR167a/b/d, gma-pre-MIR167h/i and gma-pre-MIR167e/f/g/j in clades I, IV and VIII, respectively (Fig. 6). [score:1]
The sequencing results confirmed the cleavage of Mdm-CNBL10 mRNA at 689 bp downstream of ATG (including ATG) at the complementary site of mdm-miR167a (Fig. 8D–E, Supplementary information S3A). [score:1]
The group I clade of ML tree supported thirty miR167 sequences and rest clustered in group II (Fig. 3). [score:1]
Apart from these, three other sequences are processed from 3′ end of stem loop sequences of gma-miR167h, gma-miR167i and mdm-miR167a, which we have observed in our analysis using the Mfold 44 and RNAshape software tools. [score:1]
The key word “miR167” was used as query against miRBase to search the miR167 family members in each plant species. [score:1]
Interestingly, this has been reflected in our phylogenetic analysis of mature miRNAs (Fig. 3), where group I caries all of the miR167a but one exception - mdm-miR167a. [score:1]
Percentage Identity of aligned sequences, using Kalmogorov-Smirnov statistical test in GeneDoc (version 2.7), shows that ~0.25 fraction of mature miR167 sequences have ~90% sequence identity. [score:1]
This might be due to the separate evolution pattern of gma-miR167h/i and mdm-miR167a, because these were processed from 3′ end. [score:1]
We have identified 153 mature miR167 sequences from thirty three different plant species using miRBase Registry database (Table 1). [score:1]
Among all four pre-MIR167s from both A. thaliana and A. lyrata, only ath-pre-MIR167b and aly-pre-MIR167b clustered in clade I. The sequences in group I has diverged in three branches, one branch consisting of five pre-MIR167s namely nta-pre-MIR167a, nta-pre-MIR167b, nta-pre-MIR167c, dpr-pre-MIR167c and cme-pre-MIR167d, whereas three sequences of Nicotiana tabacum – nta- pre-MIR167a/b/c made a single cluster (Fig. 6). [score:1]
There are five conserved paralogous pairs of pre-MIR167 like zma-pre-MIR167c/d, tae-pre-MIR167a/b, mdm-pre-MIR167b/e, ath-pre-MIR167b and aly-pre-MIR167b, gma-pre-MIR167b/d (sister to gma-pre-MIR167a) and ptc-pre-MIR167b/d (Fig. 6, clade I). [score:1]
This tree is similar to Fig. 3, but contains reverse complementary sequences of miR167-3p (highlighted, encircled portion) along with three miR167-5ps namely, gma-miR167h/i and mdm-miR167a. [score:1]
The clustering of monocot pre-MIR167s, namely sbi-pre-MIR167e/ zma-pre-MIR167g, sof-pre-MIR167a/b and ssp-pre-MIR167b with dicot ath-pre-MIR167c/ aly-pre-Mir167c (Fig. 6, clade II) indicates the origin of ath-pre-MIR167c prior to monocot-dicot divergence. [score:1]
This is also evident from our phylogenetic analysis that gma-miR167h/i and mdm-miR167a are not clustered with 5′ derived miR167s, however, clustered with 3′ derived miR167s (Fig. 3), whilst in the phylogenetic analysis of pre-MIR167s these gma-pre-MIR167h/i and mdm-pre-MIR167a are clustered close to those pre-MIR167s which give rise to 3′ derived miR167s (Fig. 6). [score:1]
Interestingly, maximum number of pre-MIR167s in clade I are pre-MIR167b and pre-MIR167a from multiple species. [score:1]
In another sub-clade, mdm-pre-MIR167g/f, gma-pre-MIR167g/h and gso-pre-MIR167a have evolved from a common ancestor. [score:1]
Similarly, ~0.25 fraction of the total/precursor sequences (pre-MIR167) have >22% sequence identity (Fig. 2). [score:1]
We have further cross verified the precursor MIR167 sequences by Mfold 44 and RNAshape software tools and found that gma-miR167h, gma-miR167i and mdm-miR167a are processed from the 3′ end of their respective precursor sequences (Fig. 5). [score:1]
Here, mdm-pre-MIR167a/h/i has diverged from mdm-pre-MIR167j and mdm-pre-MIR167g/f has diverged from ptc-pre-MIR167e/h with higher rate of substitution. [score:1]
The Multiple Sequence Alignment of miR167 sequence was performed using ClustalW (Version 2.0) 56 with default parameter settings in MEGA5 phylogenetic analysis tool 57 (Fig. 1). [score:1]
Interestingly, all osa-miR167s/−5ps, except osa-miR167a, are highly conserved, and present in group II (Fig. 3). [score:1]
Our phylogenomic analysis has suggested that gma-miR167h/i and mdm-miR167a are processed from 3′ end of their precursors, rather than conventionally known processing from 5′ end. [score:1]
The UmiR167-10 is shared by bna-miR167a/b and UmiR167-13 is shared by mdm-miR167h/i/j within their respective species B. napa and M. domestica only. [score:1]
Stem-loop structures of three MIR167 precursor sequences. [score:1]
Further verification by reconstructing the tree with the reverse complementary sequences of these miR167-3ps along with other (5p miR167s) proved that miR167-3ps are indeed separate from 5p. [score:1]
Each mature miR167 sequence was carefully cross checked for its identification using the plant miRNA database web server tools and the sequence data of miR167 obtained were used in this study. [score:1]
Validation of mdm-miR167a mediated cleavage of Mdm-CNBL10 through 5′RLM-RACE PCR confirms its functional diversification (Fig. 8B–E). [score:1]
On the other hand, all zma-miR167a–j (−5p) are highly conserved and clustered in group II (Fig. 3), while their precursors are clustered in group I and II (clade I–III). [score:1]
These identified unique miR167 binding sites, known as UTS, were selected on the basis of highest UPE vale (Table 2). [score:1]
Sequences in group-I (Fig. 3) show that gma-miR167h/i and mdm-miR167a are distantly separated, but in Fig. 4, these three are clustered in group I and separated from group II consisting of all other miR167 family members of the respective species. [score:1]
Likewise, vvi-pre-MIR167a, bdi-pre-MIR167a and mtr-pre-MIR167a having longer branch length imply their faster evolution with higher rate of substitution in group I. The divergence of pre-MIR167s, within the group I, is very discrete among species (Fig. 6). [score:1]
ClustalW alignment of one hundred and fifty three miR167 sequences retrieved from miRBase database registry (version 19) using MEGA5. [score:1]
The phylogeny places the ppt-miR167 separately in the group II, but along with most conserved miR167 sequences from the other species (Fig. 3). [score:1]
Phylogenetic analysis of pre- MIR167 sequencesThe pre-MIR167s showed variations in divergence and clustering of sequences. [score:1]
The precursor sequences of nta-pre-MIR167b and nta-pre-MIR167c are placed as the paralogous to the nta-pre-MIR167a. [score:1]
Three of the mature miR167s pairs ath-miR167c/aly-miR167c, gma-miR167h/i and acq-miR167/cme-miR167e have maintained their conservation at the precursor level in clade II, IV and V, respectively (Fig. 6). [score:1]
[1 to 20 of 138 sentences]
2
[+] score: 41
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
miR167 targets auxin response factors, which are the transcription factors that regulate the expression of auxin-responsive genes and play critical roles in plant development [38], [39], [40]. [score:7]
Targeted gene families were mostly involved in developmental processes and auxin response factors were targeted by two miRNA families - miR160 and miR167. [score:6]
However, target genes for miR167 were detected only in predicted gene mo dels, and miR171 had predicted target genes only in mesocarp cDNA sequences. [score:5]
In Ptc2, the miR167 locus was tandemly duplicated. [score:1]
Relationship between date palm contigPDK_30s943301 containing an miR167 locus and orthologous segments from seven other plant species. [score:1]
However, only one of two orthologous segments in Arabidopsis thaliana, Oryza sativa and Citrus sinensis had an miR167 locus. [score:1]
However, one contig containing the miR167 locus showed collinearity between both monocots and dicots (Figure 1). [score:1]
Evolution of an miR167 Locus within a Conserved Contig between Plant Species. [score:1]
Our analysis of orthologous contigs containing miR167 between remotely related plant species indicated that genomic duplications significantly influenced the conservation and expansion of miR167 locus (Figure 1). [score:1]
In Osa7, the miR167 locus was shuffled to a nearby region. [score:1]
Of 18 orthologous regions, 14 (78%) had an miR167 locus in the collinear region, and four orthologous regions - Ath4, Osa3, Osa10 and Csi5 - lost the miR167 locus. [score:1]
Phoenix dactylifera and Solanum lycopersicum had one orthologous miR167 locus, indicative of the ancient state of this unduplicated region. [score:1]
Adding this monocot species into a comparative analysis between different land plants, we analyzed the evolution of an miR167 locus in an orthologous DNA segment shared between eight species from different families. [score:1]
These observations imply that copies of miR167 can be lost or retained due to different species evolutionary histories, with genome-wide duplication as a major factor, but that conservation of a single copy is universally selected for. [score:1]
The miR167 locus along with its flanking region was duplicated in seven species from different families, with the miRNA loci maintained in this region (Figure 1 and 4). [score:1]
Detailed alignments and comparison of orthologous regions in date palm contigPDK_30s943301 (containing one miR167 locus) were conducted to highlight the variation and divergence between date palm and the other reference genomes (Figure 4). [score:1]
Plants belonging to the Fabids (Populus trichocarpa, Malus domestica and Glycine max) had the highest number of conserved segments, and all miR167 loci were preserved. [score:1]
Red arrows represent the miR167 loci. [score:1]
Previous studies have observed that there are two miR167 loci [12], and our analysis showed that one of the two loci was preserved in genomic duplication. [score:1]
miR167 was predicted to be involved in auxin response transcription factors, which are important for plant architecture. [score:1]
The results suggest that this miR167 locus may be crucial for both monocots and dicots, as it is far more highly preserved in the process of genomic duplication and new species formation than other miRNAs. [score:1]
The gain and loss of the conserved miR167 loci implies that conserved miRNAs are maintained despite sequence divergence between different plants as a result of genomic duplication. [score:1]
Although miR167 was conserved in most orthologous regions from different plants, the flanking genes varied. [score:1]
Our analysis of duplicated miRNA-containing segments indicated that two miR167 segments in poplar and soybean were duplicated very recently. [score:1]
The black bars represent the conserved segment, and the triangles indicate the presence of an miR167 locus in the extant plant genomes. [score:1]
Our analysis indicated that these ancient and conserved segments varied in their maintenance of miR167. [score:1]
[1 to 20 of 26 sentences]
3
[+] score: 31
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1514a, gma-MIR1514b, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4345, gma-MIR396d, gma-MIR4369, gma-MIR482b, gma-MIR167g, gma-MIR4397, gma-MIR156f, gma-MIR4409, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5373, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR1513c, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR1512c, gma-MIR5767, gma-MIR5770a, gma-MIR393b, gma-MIR5781, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR5770c, gma-MIR1446, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Overall, three miRNA families that are associated (miR167, miR393 and miR390 and TAS3 siRNAs all displayed either high or moderate upregulation) with auxin sensing and signalling are upregulated in response to water stress. [score:7]
For instance, Li et al. [8] found that miR166b, miR169d, miR1507a, miR167, miR482, miR4369 and miR4397 were upregulated while miR394 is downregulated. [score:7]
The downregulation of these 2 ARFs (Glyma16g02760.1 and Glyma06g00950.1) in primary root tips is consistent with the observed upregulation of miR167, which is induced by almost 2 fold (Table  2). [score:7]
Of these, 17 are auxin response factors that include targets of miR167 (Glyma16g02760.1) and TAS3siRNAs (Glyma06g00950.1), which are downregulated especially under mild and severe stress conditions [12]. [score:6]
Among the highly conserved 23 miRNA families [23], two (miR156 and miR166) were classified as high, three (miR168, miR396 and miR172) as moderate and seven (miR169, miR171, miR164, miR390, miR159, miR160 and miR167) as low and two (miR395 and miR399) as extremely low abundantly expressed miRNA families in primary root tips of soybean. [score:3]
Nineteen miRNA families (miR5767, miR4345, miR169, miR2109, miR482, miR2119, miR2118, miR171, miR164, miR4413, miR390, miR1514, miR159, miR160, miR5781, miR167, miR5373 and miR4409) displayed lower abundances (1000 to 10,000 RPTM) (Additional file 2). [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 26
Collectively, this suggests that miR394, miR396, miR1509, and miR2218 were up-regulated in the apical hook by FRc; In the hypocotyl, miR168, miR166, and miR1507 were down regulated and miR167 was up-regulated by FRc (Figure 5A; Table S6). [score:8]
miR167, for example, is known to target Auxin Response Factors ARF6 and ARF8 to correct the patterning of ARF6 and ARF8 expression domains during ovule and anther development (Wu et al., 2006). [score:6]
miR167 was down-regulated by FRc in the cotyledons (Figure 5A). [score:4]
Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. [score:3]
For some of the microRNAs, e. g., miR166, miR167, and miR396, their mRNA targets have been well characterized to regulate plant growth and development (Williams et al., 2005; Wu et al., 2006; Jung and Park, 2007; Liu et al., 2009; Rodriguez et al., 2010). [score:3]
Recently, soybean miR167 was also implicated in Nematode defense (Li et al., 2012a). [score:1]
In our study, miR167 was found to be DE. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 24
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1520d, gma-MIR167d, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR4348a, gma-MIR4361, gma-MIR4368b, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR4414a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171e, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR862a, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR5372, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR1512b, gma-MIR167j, gma-MIR1512c, gma-MIR5559, gma-MIR5774b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR5786, gma-MIR156t, gma-MIR2606a, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR4348b, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR4348c, gma-MIR319q, gma-MIR4348d, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR4414b, gma-MIR399n, gma-MIR399o
Recently, Xu et al. studied detailed response of miRNAs to low N availability in maize shoots and roots at the whole genome level and found that under long-term low N condition, miR167, miR169, miR395, miR399, miR408, and miR528 were down-regulated in maize roots, and in maize leaves miR164, miR172, and miR827 were up-regulated while miR169, miR397, miR398, miR399, miR408, and miR528 were down-regulated. [score:10]
We found that in soybean roots, gma-miR408 family were up-regulated in response to long-term low N, and some species of gma-miR160 and gma-miR319 family were down-regulated in response to short-term low N. However, members of gma-miR167 and gma-miR168 were not responsive, which were contrary to the results obtained from research of Xu et al. [30]. [score:7]
In our research, all species of gma-miR167 family did not show significantly differential expression in the two varieties under long-term and short-term N limitation. [score:3]
For example, Gifford ML et al. found that high N repressed miR167a and resulted in the ARF8 transcript to accumulate in the pericycle to regulate root architecture [28]. [score:2]
For example, miR167 was found to mediate a pericycle specific response to N [28]. [score:1]
Nine miRNA families (miR164, miR169, miR172, miR397, miR398, miR399, miR408, miR528, and miR827) and nine miRNA families (miR160, miR167, miR168, miR169, miR319, miR395, miR399, miR408, and miR528) were identified to respond to low N in maize shoots and roots respectively [30]. [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 18
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The high expression of 11 miRNAs (gma-miR164, miR167, miR168b, miR319a, miR396a, miR482b, miR482b*, miR2118a, miR2118b, miR1508a, and miR1509a) in soybean leaves has been verified by microarray analysis, as were low expression levels of miR169a, miR390c, miR1507c, and miR1510a [35]. [score:5]
In general, miRNAs that are conserved across plants, such as miR156, miR164, miR167 and miR169, target transcription factors (TFs), whereas less-conserved miRNAs target fewer TFs (Additional file 8). [score:5]
Ata-miR164 mediates lateral root development through attacking NAC1, and miR167 modulates adventitious rooting via targeting ARF6 and ARF8 [40]. [score:4]
In regards to other nutrients, miR167 and miR393 were found to regulate root development in response to nitrogen (N) [12, 13]. [score:3]
MicroRNA chip experiments showed that eight miRNAs (miR156/157, miR167, miR168, miR319, miR159, miR894, miR1507, and miR1509) were induced by Pi starvation in soybean leaves, and seven miRNAs (miR159, miR894, miR1507, miR1509, miR396, miR474, and miR482) were induced in soybean roots by low P [31]. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 17
During Se treatment, auxin response factor 8-like was upregulated while miR167 was downregulated; The expression of omeobox-leucine zipper protein HOX32-like, Class III HD-Zip protein, DNA (cytosine-5)-methyltransferase CMT3-like, F-box protein SKIP2-like protein was up-regulated by Se exposure but based on the degradome data, their targeting miRNAs, miR166, miR166i, miR399k, miR399h-5p, were down-regulated, respectively. [score:17]
[1 to 20 of 1 sentences]
8
[+] score: 10
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1523a, gma-MIR1528, gma-MIR1535a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR1509b, gma-MIR396d, gma-MIR4366, gma-MIR4382, gma-MIR4389, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR4411, gma-MIR171c, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, gma-MIR1507c, gma-MIR1508c, gma-MIR1535b, gma-MIR4996, gma-MIR1523b, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5374, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5667, gma-MIR5761a, gma-MIR4416c, gma-MIR5761b, gma-MIR4416b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR167k, gma-MIR167l, gma-MIR169w
For instance, in previous studies, miR167 was up-regulated in response to the chilling stress in soybean nodules and miR169 was down-regulated 24. [score:7]
Most of these known miRNAs, such as miR3522, miR1510, miR408, miR1509, miR4996, miR1508, miR1507 and miR167, were relatively highly expressed in both the control and chilling -treated libraries. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 8
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1510a, gma-MIR1511, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR4998, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5368, gma-MIR5371, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR4413b, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
In addition, the results of the present study revealed conserved miRNAs detected in other plants, such as miR166 (regulating shoot apical meristem and floral development in Arabidopsis) [63, 64], miR482 (in resistance to disease or abiotic stress via NBS-LRR proteins) [65], miR319 (affecting organ development and the processes of phase change in Arabidopsis) [46], miR160 (responses to the plant hormone auxin) [66], miR167 (involved in the floral organ formation) [27], miR390 (influence not only vegetative developmental transitions but also organ polarity in flowering plants) [67, 68], miR395 (regulating sulfate accumulation and allocation) [69], and miR408 (influenced through a variety of environmental conditions) [70, 71]. [score:8]
[1 to 20 of 1 sentences]
10
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR1520h, gma-MIR1520i, gma-MIR1520j, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR4406, gma-MIR169d, gma-MIR1520q, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR167k, gma-MIR167l, gma-MIR169w
In our study, we identified a large number of ARF genes as targets for different miRNAs such as gma-miR160 and miR167. [score:3]
In Arabidopsis, miR160 and miR167 are involved in auxin signaling via regulation of ARF genes [1]. [score:2]
In rice, a number of ARF encoding genes have been identified which are regulated by osa-miR160 and osa-miR167, respectively [33, 34]. [score:2]
In each of the four Glyma mo dels, a clear peak for the absolute number of tags is found at the predicted cleavage site for gma-miR159, gma-miR4406, gma-miR167, or gma-miR164. [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 7
Other miRNAs from this paper: gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
For example, miR167 regulates the transcript levels of auxin response activator ARF8 [29, 37] and miR160 regulates the transcript levels of auxin response repressors ARF10, 16 and 17 [38]. [score:3]
Of the 10 conserved miRNAs tested, 9 were detectable by Northern expression analysis except miR167 (Figure 5). [score:3]
UCGGACCAGGCUUCAUUCCCG 21 H, N (21 nt) 167 gma-MIR167a,b UGAAGCUGCCAGCAUGAUCUA 21 H, P gma-MIR167c UGAAGCUGCCAGCAUGAUCUG 21H, P [d] gma-MIR167? [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 5
Wang Y. W. Li K. Chen L. Zou Y. Liu H. Tian Y. Li D. Wang R. Zhao F. Ferguson B. J. MicroRNA167-directed regulation of the auxin response factors GmARF8a and GmARF8b is required for soybean nodulation and lateral root developmentPlant Physiol. [score:3]
Interestingly, there is evidence indicating that the nodes miR172c- APETALA2-1 and miR167- GmARF8 control early events (e. g., rhizobia -induced root hair deformation and the activation of symbiosis-related genes) of this symbiosis and nodule development in common bean and soybean, respectively [62, 63]. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 5
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR156a, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR1508a, gma-MIR1510a, gma-MIR1515a, gma-MIR167d, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR390c, gma-MIR2118a, gma-MIR2118b, gma-MIR1508c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR4413b, gma-MIR167j, gma-MIR393b, gma-MIR4416b, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR156q, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR167k, gma-MIR167l, gma-MIR169w
For example, the targets of miR156 family belong to Squamosa Protein binding-Like (SPL) proteins and targets of miR167 to Auxin Response Factors (ARF6 and 8). [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 4
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR482a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR390c, gma-MIR398c, gma-MIR482c, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319l, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR166l, gma-MIR2111e, gma-MIR2111f, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Except for a few miRNAs (miR160, miR167, and miR393) that directly target components of the auxin signaling pathway or auxin-responsive genes, our data establish a new link between auxin signaling and a broad spectrum of biochemical and cellular processes via various miRNAs. [score:4]
[1 to 20 of 1 sentences]
15
[+] score: 3
Wang Y. Li K. Chen L. Zou Y. Liu H. Tian Y. Li D. Wang R. Zhao F. Ferguson B. J. MicroRNA167-Directed Regulation of the Auxin Response Factors GmARF8a and GmARF8b Is Required for Soybean Nodulation and Lateral Root DevelopmentPlant Physiol. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR162a, gma-MIR167c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1517, gma-MIR1520d, gma-MIR1520c, gma-MIR167d, gma-MIR1507b, gma-MIR1508b, gma-MIR167e, gma-MIR167f, gma-MIR172d, gma-MIR4341, gma-MIR4361, gma-MIR1520j, gma-MIR4369, gma-MIR4374b, gma-MIR482b, gma-MIR1520n, gma-MIR4387a, gma-MIR167g, gma-MIR4396, gma-MIR4397, gma-MIR1520r, gma-MIR4399, gma-MIR156f, gma-MIR4407, gma-MIR169d, gma-MIR156g, gma-MIR394a, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR398c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR156q, gma-MIR319n, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
Previous studies have reported that members of miR167, miR319, and miR393 were similarly regulated in stress tolerance [9, 42, 43]. [score:2]
Especially those present in high abundance, such as miR156, miR166, and miR167. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1514a, gma-MIR1514b, gma-MIR1536, gma-MIR1530, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR398d, gma-MIR167k, gma-MIR167l, gma-MIR169w
A series of targets for known miRNAs, including gma-miR156, gma-miR159, gma-miR160, gma-miR164, gma-miR167, gma-miR169, gma-miR396, gma-miR398 and gma-miR1514, belong to this class (Tables 3, 4). [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, gma-MIR1508a, gma-MIR1509a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR1517, gma-MIR167d, gma-MIR396c, gma-MIR1508b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4357, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR482c, gma-MIR1508c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR1512c, gma-MIR5559, gma-MIR393b, gma-MIR4416c, gma-MIR4416b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR1515b, gma-MIR399i, gma-MIR167k, gma-MIR167l, gma-MIR4405b, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Differential expression of miRNAs such as gma-miR167, gma-miR172, gma-miR399, gma-miR396 and gma-miR169c in soybean nodules, and mtr-miR2568, mtr-miR107 in M. truncatula were also identified [34– 36]. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR1515a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR156t, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
These miRNAs including miR156, miR158, miR165, miR167, miR168, miR169, miR171, miR393, miR394 and miR396 were responsive to salt stress and may fine-tune plant stress responses at multiple levels through targeting the genes with different functions including large sets of genes that encode various transcription factors [15, 19, 20]. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
MicroRNA167-directed regulation of the auxin response factors, GmARF8a and GmARF8b, is required for soybean (Glycine max L. ) nodulation and lateral root development. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 2
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1516a, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR4387c, gma-MIR1520h, gma-MIR1520i, gma-MIR396d, gma-MIR1520j, gma-MIR4365, gma-MIR4387b, gma-MIR482b, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR4387a, gma-MIR4387d, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR169d, gma-MIR1520q, gma-MIR171c, gma-MIR169e, gma-MIR4413a, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR862a, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR1516b, gma-MIR169h, gma-MIR167h, gma-MIR5039, gma-MIR169i, gma-MIR396f, gma-MIR5041, gma-MIR396g, gma-MIR167i, gma-MIR862b, gma-MIR5372, gma-MIR5374, gma-MIR5376, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5668, gma-MIR5671a, gma-MIR1512c, gma-MIR4387e, gma-MIR393b, gma-MIR1516c, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1516d, gma-MIR398d, gma-MIR5671b, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
There were 16 miRNA families which were co-regulated in both two genotypes, among them, miR156, miR162, miR166a, miR167, miR319, miR397, miR398, miR408 were conserved miRNAs between plants species, two miRNA families, miR2119 and miR3522 were conserved in fabaceae, while miR1520, miR4365, miR4387, miR4413, miR4996 and miR5671 were soybean specific miRNAs. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 2
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR391, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
We found six families (miR159, miR160, miR167, miR170/171, miR396 and miR399) in 30–39 species; seven (miR164, miR168, miR172, miR393, miR395, miR398 and miR408) in 20–29 species; and five (miR162, miR390, miR397, miR403 and miR437) in 10–19 species (Table 1). [score:1]
Six families (miR159, miR160, miR167, miR170/171, miR396 and miR399) were found in 30–39 diverse plant species (Table 1). [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR156a, gma-MIR156b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR166l, zma-MIR166m, zma-MIR156k, osa-MIR535, gma-MIR167c, gma-MIR1507a, gma-MIR167d, gma-MIR1507b, gma-MIR167e, gma-MIR167f, zma-MIR156l, zma-MIR166n, zma-MIR167j, gma-MIR167g, gma-MIR156f, gma-MIR156g, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR167j, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR166l, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR167k, gma-MIR167l
The plant miRNAs used in the search include miR156, miR166, miR167, miR168, miR535 and miR3522. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Some of the miRNAs were very abundant in certain tissues such as members of the miR167 family and gma-1512c, which were highly prevalent in the seed coats from multiple samples. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ahy-MIR156a, ahy-MIR156b, ahy-MIR156c, ahy-MIR159, ahy-MIR167, ahy-MIR394, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR394e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
Of the 22 miRNA families, three miRNA families (miR156/157, miR166, and miR167) were predicted [34, 38, 41] using a comparative genomics -based strategy [38]. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR482a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR530a, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR2111a, gma-MIR530b, gma-MIR828a, gma-MIR156p, gma-MIR530c, gma-MIR828b, gma-MIR530d, gma-MIR156q, gma-MIR169o, gma-MIR319n, gma-MIR530e, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR169t, gma-MIR2111e, gma-MIR2111f, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
Seven miRNA families (miR167, miR168, 172, 393, 394, 398 and 399) were angiosperm-specific and present in both eudicots and monocots. [score:1]
[1 to 20 of 1 sentences]