sort by

37 publications mentioning dre-mir-1-2

Open access articles that are associated with the species Danio rerio and mention the gene name mir-1-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 118
Zhao and colleagues where the first to demonstrate that miR-1 can influence heart development, by showing that miR-1 overexpression in the developing mouse heart down-regulates the cardiogenic regulator Hand2 and results in premature withdrawal of cardiomyocytes from the cell cycle [34]. [score:8]
Later experiments involving the ectopic expression of miR-1 in mouse and human embryonic stem cells revealed that this miRNA is a strong promoter of mesoderm differentiation, displaying enhanced cardiomyocyte formation, while at the same time suppressing gene expression of other lineages [82]. [score:7]
By targeting the same transcription factors that regulate miR-1/miR133 expression and control cardiac progenitor cell proliferation and differentiation, miR-1 and miR-133 fine-tune multiple nodes of the genetic networks that control cardiac muscle differentiation. [score:6]
These miRs display a highly tissue specific expression pattern, with miR-124 being preferentially expressed in the brain and miR-1 in the skeletal muscle and heart. [score:5]
miR-1 and miR-133 are for the most part co-expressed and contribute to the establishment of a muscle specific gene expression program while having somewhat antagonistic roles in the control of proliferation and differentiation [94]. [score:5]
Further insights into the role of the miR-1/133 family in cardiac development were obtained through the generation of knock-out mice with targeted ablation of these miRs. [score:5]
Sokol N. S. Ambros V. Mesodermally expressed Drosophila microRNA-1 is regulated by Twist and is required in muscles during larval growth Genes Dev. [score:4]
As discussed above, miR-1 was later found to be encoded in two bicistronic clusters together with miR-133a, which displays the same overall expression pattern and is also a key regulator of muscle and cardiac cell differentiation. [score:4]
Finally, a more recent targeted ablation of a single miR-1/133 cluster did not show any significant developmental or cardiac defects, which were only observed upon deletion of both clusters [116]. [score:4]
These include marked changes in the cardiac contractibility apparatus, with a switch from fetal specific to adult isoforms of several sarcomeric proteins, and the silencing of smooth muscle proteins expressed early during cardiomyocyte differentiation, which appears to be regulated by both miR-1 and miR-133. [score:4]
In the embryonic heart, expression of the miR-1/miR-133 locus is transcriptionally regulated by the myogenic transcription factors SFR, MYOCD and MEF2. [score:4]
Interestingly, both miR-1 and miR-133 have been shown to be negative regulators of the same cardiogenic transcription factors that, in addition to promoting their expression, activate protein-coding genes involved in muscle function (e. g., sarcomere genes) [34, 92, 94, 95]. [score:4]
The existence of multiple independent enhancers of the miR-1/133 genes and the negative feedback loop established between miRs and transcription factors allow fine-tuning of temporal-spatial control of gene expression, providing a means of reinforcing the cardiac and skeletal-muscle-specific programs during development and cell differentiation. [score:4]
In spite of its duplication, ablation of the 21 nt miR-1 sequence in the miR-1-2 gene using a targeted recombination strategy designed to replace it with a Neo-LacZ selection marker was reported to resulted in 50% embryonic lethality with ventricular septation defects (VSD) [101]. [score:3]
Thus, the available data support the view that miR-1 and miR-133 play a critical synergistic role in the suppression the cardiac fetal gene program and enforcement of adult skeletal muscle properties, driving cardiac maturation. [score:3]
Interestingly, this phenotype could be rescued by muscle specific expression of miR-1, reinforcing its tissue-specific nature. [score:3]
A more defined view of the power of miRs to shift gene expression programs into cell type specific programs came from the transfection of miR-124 and miR-1 into HeLa cells, followed by microarray analysis [80]. [score:3]
Standing out among the miRs with roles in cardiac function is the highly conserved miR-1, originally identified in early studies in Drosophila and C. elegans and shown to be highly expressed in the human and mouse heart and skeletal muscle [96, 97, 98, 99]. [score:3]
This study was complemented by the analysis of the impact of inactivating miR-1 expression in Drosophila, which revealed the extent of conservation of miRNA functions [81]. [score:3]
These studies revealed for the first time a specific role for tissue-specific miRs in the establishment of cell differentiation programs, showing that miR-1 is required to maintain muscle gene expression and suggesting a high degree of functional conservation between flies and mammals. [score:3]
miR-1 knock-out (KO) led to major alterations in myofiber structure and muscle growth, resulting in larval paralysis and lethality. [score:2]
Only the miR-1/133 d KO displayed significant cardiac abnormalities during embryonic development, with no animal surviving past embryonic day E10.5 [116]. [score:2]
However, the apparent haplo-insufficiency of miR-1 in heart development has been questioned by more recent double KO mice, which do not show any embryonic lethality [113]. [score:2]
The miR-1/133 Family is a Critical Component of Cardiogenic Regulatory Networks. [score:2]
Figure 5 Transcriptional regulatory networks controlled by miR-1 and miR-133 during cardiac muscle differentiation. [score:2]
In mammals, the duplicated miR-1/miR-133 locus is transcribed into a bicistronic transcript that is regulated by multiple independent upstream intronic enhancers. [score:2]
Wystub K. Besser J. Bachmann A. Boettger T. Braun T. miR-1/133a clusters cooperatively specify the cardiomyogenic lineage by adjustment of myocardin levels during embryonic heart development PLoS Genet. [score:2]
One of the first known examples of these regulatory loops involves the interplay of miR-1 and the cardiogenic and myogenic transcription factors (Figure 5). [score:2]
Strikingly, deletion of the single miR-1 gene in Drosophila also resulted in a spectrum of defects in muscle and cardiac differentiation [81, 109]. [score:1]
Furthermore, the manipulation of some of these miRs in vitro (miR-1 and miR-499) and in vivo (the miR-17/92 cluster), was shown to be able to modulate CP cell fate [135, 136] (Figure 6). [score:1]
Examples include the let-7 family, which contains the first miRNA to ever be described [59] or the miR-1/133 and miR-15 families. [score:1]
One of the miR-1 paralogs was later converted into the skeletal muscle specific miR-206, roughly at the time of the teleost divergence [110]. [score:1]
In addition, this switch is associated to significant changes in energy metabolism, moving from glycolytic pathways in fetal cardiomyocytes to fatty acid oxidation in the adult heart, which seems to be also affected in the absence of miR-1. Finally, the cessation of cell proliferation, a hallmark of the fetal to adult transition, was also reported to be affected in four of these mouse mo dels, where cardiomyocytes division was observed to occur late after birth [101, 113, 115]. [score:1]
The genomic duplication events at the base of vertebrate evolution therefore resulted not only in the appearance of the three cardiogenic GATA genes (GATA4, GATA5 and GATA6) but also created the miR-1/133 gene family. [score:1]
Kwon C. Han Z. Olson E. N. Srivastava D. MicroRNA1 influences cardiac differentiation in Drosophila and regulates Notch signaling Proc. [score:1]
miR-1 is actually a member of an evolutionarily conserved family that in mammals is organized as three bicistronic TUs (Figure 3A). [score:1]
Sluijter J. P. G. van Mil A. van Vliet P. Metz C. H. G. Liu J. Doevendans P. A. Goumans M. J. MicroRNA-1 and -499 regulate differentiation and proliferation in human-derived cardiomyocyte progenitor cells Arterioscler. [score:1]
Chen J. F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation Nat. [score:1]
Interestingly, miR-133 is also conserved in Drosophila, but it is not clustered with the single dm-miR-1 gene. [score:1]
The complete loss of miR-1/133a did not interfere with formation of the primary heart tube, but affected maturation and further specification of embryonic cardiomyocytes during expansion of the compact layer of the myocardium. [score:1]
miR-1 is encoded by two genes, miR-1-1 and 1-2, which are clustered with miR-133a-2 and miR-133a-1, respectively. [score:1]
The first report of an equivalent reprogramming event used an ‘educated guess’ approach to test the individual and combined effects of six miRs with reported cardiac functions (miR-1; miR-126-3p; miR-133a; miR-138, miR-206; miR-208a) to induce fibroblast trans-differentiation [90]. [score:1]
Indeed, while miR-1 is acknowledged to trigger differentiation of both mouse and human embryonic stem (ES) cells into the cardiomyocytes, miR-133 was found to act in partial opposition to miR-1, by promoting muscle progenitor expansion and preventing terminal differentiation [82]. [score:1]
Interestingly, the lack of miR-1/miR133 seems to affect multiple cellular pathways required for this transition. [score:1]
Indeed, Wei and colleagues do not report any embryonic lethality in the mir-1 d KO mice [113]. [score:1]
[1 to 20 of 45 sentences]
2
[+] score: 98
In our findings, the downregulation of miRs-133a and b started at 24 h and peaked at 2–3 days post the surgery, whereas miR-1 peaked already at 24 h. Thus, we suggest that the early expression of is necessary to contrast the caspase protein translation in all injured hearts (due to miR-133 downregulation). [score:11]
The immunohistochemistry has been focused on three markers linked with the investigated miRs: (1), as a marker of recovery activities as well as the block of apoptosis and controlled by miRs expression; (2) Wilms tumour 1 (WT1), as a specific marker for development/regeneration activity of the epicardium 26, 27 and in the epithelial–mesenchymal transition (EMT) [28]; (3) or component of cardiac troponin T, as a marker of differentiated myocardial cells because its expression is essential for sarcomere assembly and directly mediated by miR-1 upregulation [29]. [score:8]
a Expression of miR-1; b expression of miR-133a; c expression of miR-133b. [score:7]
In fact, the expression of miRNA-1, 133a and 133b during regenerative phenomenon showed a downregulation around the first 48 h post the surgery, suggesting that the transition from epicardial and other tissue has already started. [score:6]
miR-1 is not expressed by ERK1,2 activity because of the expression of cardiac embryonal genes and relative proteins such as GATA4. [score:5]
Most of these genes were demonstrated to be, directly or indirectly, a target of miR-1 and miR-133a and miR-133b (ref. [score:5]
When the genes of differentiation are expressed, such as MyoD, miR-1 start to be highly transcripted and act as a repressor of GATA4 translation and other embryonic key proteins. [score:5]
Although different patterns of miR expression are found by transcriptome analyses during regeneration, miR-1 and miRs-133a/b seem to be commonly expressed in mammals as well as in zebrafish [53]. [score:5]
In the rationale, we have suspected that during regeneration, the downregulation of miRs-133a, 133b and miR-1 could occur before 7 days after the resection and that could be differently regulated by the cell-type (i. e., epicardium and CM). [score:5]
However, miR-1 is a direct repressor of and its upregulation was demonstrated during the regeneration of zebrafish heart [5]. [score:5]
In particular, miR-1 and miR-133b have undergone a significant downregulation at 1 dpa. [score:4]
The translation of vegf and raldh2 are directly repressed by miR-1 (refs. [score:4]
Particularly, miR-1, miR-133a and miR-133b have been detected in 1 dpa in different data sets of down-regulated transcripts. [score:4]
In the myocardium formation, Tbx can activate the transcription factors and morphogens such as MyoD (maintained by miR-1 expression) and Myf5 [50]. [score:3]
From 7 dpa, the miR-1 expression has been slowly returned to the control values (data not shown). [score:3]
Xu C The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, and caspase-9 in cardiomyocytesJ. [score:3]
Hearts were harvested from 24 h to 30 dpa, and analysed for miRs (miR-1 and miR-133a/miR-133b) by qPCR to know how their expression levels vary at different stages of regeneration. [score:3]
Regarding miR-133a (Fig.   1b), the qPCR data show that at 24 hpa there is a decrease (but not statistically significant, 0.707 ± 0.065), while the values of expression on days 2, 3 and 7 are similar to those of the miR-1 (0.519 ± 0.079, 0.255 ± 0.016, 0.560 ± 0.145, respectively) (Fig.   2). [score:3]
The results indicated that miR-1 has been strongly downregulated in the RC already at 24 hpa (0.060 ± 0.021, P < 0.001) as compared to control and EPCs. [score:3]
miR-1 is the most conserved miRNA during evolution [16], whereas a gene duplication probably has formed the miR-133 gene, which in fact is positioned in the same genetic locus of the miR-1 [31] and, in mammals, it regulates transcription of myoD [19]. [score:2]
Fig. 7 A proposed schematic mo del of miR-1 and miR-133 actions in blocking the FGF -dependent transduction pathway in the cells involved in cardiac regeneration: CMs, fibroblast, EPCs and endocardial cells. [score:1]
It is probable that the block of myogenic or hyperplastic role of miR-1 is crucial in activating the regeneration process. [score:1]
miR-1 at 1 dpa has evidenced a value of 0.566 ± 0.008 and 0.526 ± 0.004 on the second day. [score:1]
miR-1/miR-133 are mainly implicated in post lesion in mammals as well as in zebrafish 14, 17, 22, 23. [score:1]
[1 to 20 of 24 sentences]
3
[+] score: 92
Several in vitro studies have indicated that the 3′ untranslated region (3′UTR) of EDN1 is a direct target of miR-1, and hence miR-1 inhibit the EDN1 expression and lead to attenuation of cell proliferation [28]. [score:10]
In this study, we found that miR-1 was significantly down-regulated and EDN1 was up-regulated in HCC tissues. [score:7]
Finally, we are the first to report that the up-regulation of EDN1 in HCC is correlated with a down-regulation of miR-1. Notably, the correlation between EDN1 and miR-1 was observed in the tissues of HCC patients, highlighting the clinical significance of our observations. [score:7]
These results suggested that up-regulation of EDN1 in HCC may be caused by a down-regulation of miR-1 in these patients. [score:7]
Because the edn1 gene in the edn1 transgenic fish does not include the 3′ UTR, the edn1 expression in the fish should not be targeted by miR-1. Moreover, the edn1 mRNA levels were at high levels at all ages of the transgenic fish. [score:5]
As shown in Fig. 9A, miR-1 was expressed at high levels in the 3-month-old edn1 transgenic fish (Fig. 9A1), but the expression was reduced in the 9-month-old edn1 transgenic fish with HCC (Fig. 9A2). [score:5]
microRNA-1 (miR-1) inhibits cell proliferation in HCC by targeting EDN1 [28]. [score:5]
0085318.g009 Figure 9(A) The RNA expression of miR-1 in the edn1 transgenic fish and human specimens was determined by in-situ hybridization, and EDN1 protein expression in human specimen by IHC. [score:5]
miR-1 inhibits EDN1 expression and leads to attenuation of hepatoma cell proliferation [28]. [score:5]
miR-1 is abnormally down-regulated in several types of cancers, including lung, colorectal, prostate, and thyroid cancers and rhabdomyosarcoma. [score:4]
The expression of miR-1 was at the high level in 3-month-old edn1 transgenic fish which is normal in pathological analysis (A1) and was decreased in the 9-month-old edn1 transgenic fish with HCC (A2). [score:3]
The association of EDN1 and miR-1 expression in patients with HCC was determined using the Wilcoxon signed-rank test [40]. [score:3]
MiR-1 regulates EDN1 expression in HCC. [score:3]
The results showed that the expression of miR-1 was significantly higher in normal liver tissue (Fig. 9A5) than in the HCC specimens at stages I to III (Figs. 9A6–A8). [score:3]
Association of EDN1 and miR-1 expression in patients with HCC. [score:3]
Thus, the miR-1 level is inversely related to the development of HCC. [score:2]
These results suggest that a decrease of miR-1 -mediated repression of EDN1 may contribute to the development of HCC. [score:2]
These findings indicated a potential role of miR-1 in EDN1 regulation HCC. [score:2]
Interestingly, the miR-1 levels were decreased in the HCC samples of the 9 month-old fish compared to those in the normal tissue samples of the 3 month-old edn1 transgenic fish, suggesting that miR-1 may be negatively regulated by edn1. [score:1]
In situ hybridization of miR-1. Sirius Red, Periodic Acid-Schiff, TUNEL, and oil red O staining. [score:1]
Locked nucleic acid (LNA) -modified DNA oligonucleotide probe (hsa-miR-1, ACATACTTCTTTACATTCCA; Exiqon, Vedbaek, Denmark) were used to detect the in situ hybridization signals of miR-1 in liver tissue sections. [score:1]
Statistical analysis demonstrated that there was an inverse correlation between the EDN1 and miR-1 levels in the HCC tissues (Figs. 9B–C). [score:1]
In addition, it has been reported that methylation -mediated silencing of the miR-1 gene induces hepatoma cell proliferation [29]. [score:1]
To assess the relation of miR-1 to EDN1, we initially measured the expression level of miR-1 in the edn1 transgenic fish. [score:1]
The Liver cancer survey tissue array (catalog#: LV809) were purchased from US Biomax (Rockville, MD, USA) for miR-1 in situ hybridization and EDN1 immunohistochemistry analysis. [score:1]
In situ hybridization of miR-1 In situ hybridization of miR-1 was performed using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon, Vedbaek, Denmark). [score:1]
The positive signal is shown in purple for miR-1 in-situ and brown for EDN1 IHC (200X). [score:1]
The miR-1 signal was very intense in the normal human liver tissues (A5), but was weakened in the tissue of HCC at stage I to III tissues. [score:1]
In situ hybridization of miR-1 was performed using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon, Vedbaek, Denmark). [score:1]
[1 to 20 of 29 sentences]
4
[+] score: 40
Suppression of Target GFP Expression by Wild-type or Mutated miR-1-2. Screening of Founders. [score:7]
Consistent with these predictions, functional studies indicated that the wild-type pre-miR-1-2 but not the pre-miR-1-2 mutants could effectively suppress the target GFP reporters containing either three imperfect complementary sites to miR-1-2 or the 3′UTR sequence of a reported miR-1-2 target gene [36] (Fig. 1C and Fig. 1D). [score:7]
GFP-3XIPT-miR-1-2, GFP sensor containing three imperfect complementary sites to miR-1-2; GFP- cnn2–3′UTR, GFP sensor containing the 3′UTR sequence of cnn2 (a miR-1-2 target gene); dsRed-miR-1-2, RFP indicator expressing mature miR-1-2. (A) Frequency and spectrum of TALEN induced miR-1-2 mutations. [score:6]
GFP-3XIPT-miR-1-2, GFP sensor containing three imperfect complementary sites to miR-1-2; GFP- cnn2–3′UTR, GFP sensor containing the 3′UTR sequence of cnn2 (a miR-1-2 target gene); dsRed-miR-1-2, RFP indicator expressing mature miR-1-2. More than half of the miRNA genes occur as gene clusters in many vertebrates genome [38]. [score:5]
0076387.g001 Figure 1Targeted disruption of zebrafish miR-1-2. (A) Frequency and spectrum of TALEN induced miR-1-2 mutations. [score:4]
The GFP sensor plasmid containing three imperfect complementary sites to miR-1-2 and the RFP indicator plasmid expressing the wild-type miR-1-2 precursor were from a previous study [35]. [score:3]
Targeted disruption of zebrafish miR-1-2.. [score:3]
The miR-1-2 precursor mutants were generated by mutation PCR and cloned into the 3′ end of the pSP64T+dsRed coding sequence between EcoRI and XhoI. [score:2]
DNA sequence encoding the mature miR-1-2 is underlined, with the seed sequence in bold. [score:1]
GFP sensor (100 pg) was coinjected with the wild-type or mutated miR-1-2 (300 pg) into one-cell stage embryos. [score:1]
Using our optimized TALEN platform [16], we have assembled TALENs for two zebrafish miRNAs (miR-1-1 and miR-1-2). [score:1]
[1 to 20 of 11 sentences]
5
[+] score: 26
Other miRNAs from this paper: cel-let-7, cel-mir-1, cel-mir-35, cel-mir-52, cel-mir-58a, dme-mir-1, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, dme-bantam, mmu-let-7d, dme-let-7, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-1a-2, cel-lsy-6, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-1, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-1b, cel-mir-58b, mmu-let-7j, mmu-let-7k, cel-mir-58c
Translational activity was monitored through measurement of RL activity in the presence of miR-35 2′- O-Me inhibitor or a non-cognate miR-1 2′- O-Me inhibitor. [score:5]
RL-6×-miR-35-p(A) [0] reporter translation was specifically de-repressed when the extract was treated with a miR-35 2′- O-Me inhibitor, but not when supplemented with a non-cognate miR-1 control (Figure 5B). [score:5]
In untreated or mock -depleted extracts, a 2- to 4-fold increase in RL light counts was observed when a miR-35 2′- O-Me inhibitor was added prior to RL-6×-miR-35-pA [86] reporter translation, in comparison with a non-cognate miR-1 2′- O-Me control (Figure 4A, left panel). [score:5]
Translation counts were monitored over time in the presence of miR-35 or miR-1 2′- O-Me inhibitors. [score:5]
In a mock -depleted extract, as in an untreated extract, the reporter was significantly de-repressed when treated with miR-35 2′- O-Me inhibitor, but not when treated with a non-cognate miR-1 inhibitor (Figure 5C). [score:5]
S10 Worm lysate was pre-cleared with 25 μl of T1 streptavidin beads (Invitrogen) and non-specific 2′- O-Me oligonucleotides (miR-1, 10 pmol) for 1 h at 4°C with rotation. [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 25
Other miRNAs from this paper: dre-mir-1-1, dre-mir-206-1, dre-mir-206-2
However, we further found that Rtn4a expression is specifically inhibited by miR-206, not miR-1. Based on this evidence, we concluded that the regulatory pathway related to somite boundary formation is miR-206-specific, which is strongly supported by the hypothesis proposed by Lin et al. [5], who demonstrated that miR-1 and miR-206 target different genes and play different roles during zebrafish embryogenesis. [score:8]
In order to exclude the off-target effect of MO injection, we knocked down endogenous miR-206 by injection of miR-206-MO which specifically inhibits both miR-206-1 and miR-206-2 in zebrafish embryos without affecting the production of miR-1 with the same seed sequence as that of miR-206 [5]. [score:6]
Both miR-1 and miR-206 are known to share common expression in the skeletal muscle of organisms, ranging from Caenorhabditis elegans to humans [47, 48]. [score:3]
However, the protein level of Rtn4al remained unchanged in the embryos injected with miR-1-MO (figure 2 j, lane 2), which shares an identical seed sequences with miR-206 and whose antisense oligonucleotide sequence were previously described by Lin et al. [5], indicating that the amount of Rtn4al protein is specifically regulated by miR-206, not miR-1, thus confirming our speculation. [score:2]
This evidence indicated that miR-206 can only specifically silence the reporter gene through cited3- and rtn4a-3′UTR, even though miR-1 and miR-206 have identical seed sequences. [score:1]
These constructs were co -injected with either pre- miR-1 RNA or pre- miR-206 RNA into one-cell zebrafish embryos. [score:1]
The sequence and injected amount of each MO were as follows: miR-1-MO (AATACATACTTCTTTACATTCCA, 8 ng) [5], miR206-MO (GATCTCACTGAAGCCACACACTTCC, 8 ng) [5], miR206- 5-mis-MO (GAT ATCA ATGAA CCCA AACA ATTCC, 8 ng) (the mismatched nucleotides are underlined) [5], rtn4a-MO (GAAAACAAACAAACCTTGAGCGAGT, 2 ng), cxcr4a-MO (AGAAGTCTTTTAGAGATGGCTTAT, 8 ng) [34], and thbs3a-MO (AGTAAAAGGCGAAAGATTTGTGCGT, 1 ng). [score:1]
The resultant RNAs were diluted with distilled water for final molecular mass of microinjection into one embryo as follows: pre- miR-206 RNA, 200 pg; pre- miR-1 RNA, 200 pg; cited3 mRNA, 200 pg; rtn4al mRNA, 200 pg; rtn4am mRNA, 200 pg; rtn4an mRNA, 200 pg; and thbs3a mRNA, 400 pg. [score:1]
In zebrafish embryos, we co -injected 5 ng µl [−1] of pGL3-TK, which also served as an internal control, 5 ng µl [−1] of each examined plasmid, including phRL-Myf5, phRL-Myf5- cited3-3′UTR, phRL-Myf5- gadd45ab-3′UTR, phRL- znf142-3′UTR and phRL-Myf5- rtn4a-3′UTR, and 200 pg of synthesized pre- miR-206 or pre- miR-1 RNA. [score:1]
On the other hand, the luc activities of embryos injected with pre- miR-1 RNA combined with plasmids phRL-Myf5- cited3-3′UTR, phRL-Myf5- gadd45ab-3′UTR, PhRL-Myf5- znf142-3′UTR and phRL-Myf5- rtn4a-3′UTR were 0.96 ± 0.07, 1.08 ± 0.07, 0.75 ± 0.04 and 1.05 ± 0.07, respectively (figure 1 c). [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 18
During zebrafish embryo development, miR-1 is known to express ubiquitously where as miR-144 and miR-142a-3p show strong expression in blood cells [35]. [score:6]
Previous studies of these miRNAs have implicated miR-1 in regulating muscle gene expression and miR-144 in zebrafish embryonic α-globin synthesis [23], [36]. [score:4]
However, to the best of our knowledge distinct functional roles of miR-144, miR-1 and miR-142a-3p in vascular development are yet to be explored. [score:2]
Of these, three miRNAs, miR -144, miR-1 and miR-142a-3p revealed specific non-overlapping phenotypes affecting vascular development. [score:2]
Of the eight-selected miRNA tested using zebrafish as a mo del system, we observed specific non-overlapping phenotypes affecting vascular development for three miRNAs, namely miR-1, miR-144 and miR-142a-3p (Figure 2). [score:2]
K,L,M - Zebrafish embryos injected with miR-1 display accumulation of blood cells in LDA/YSL. [score:1]
Microinjection of duplex miR-1 (10 µM) in zebrafish embryos showed accumulation of blood cells in lateral dorsal aorta (LDA) and yolk syncitial layer (YSL) with disrupted blood flow at 2 dpf in approximately 60% of injected animals (n = 56/93). [score:1]
[1 to 20 of 7 sentences]
8
[+] score: 16
Down-regulation of micro -RNA-1 (miR-1) in lung cancer. [score:4]
Expression of miR-1, miR-133a, and miR-206 increases during development of human skeletal muscle. [score:4]
Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin -induced apoptosis by miR-1. J. Biol. [score:3]
The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70, and caspase-9 in cardiomyocytes. [score:3]
microRNA-1/133a and microRNA-206/133b clusters: dysregulation and functional roles in human cancers. [score:2]
[1 to 20 of 5 sentences]
9
[+] score: 16
For each microRNA, we therefore used TargetScanFish (release 6.2; Ulitsky et al., 2012) to identify an endogenous zebrafish transcript with a 3′ UTR enriched in its predicted target sequences: respectively tagln2 (miR1), clcn6 (miR126), and BX927290.1 (miR499). [score:5]
In zebrafish, microRNA miR-1 is highly expressed in muscle, with little to no expression in the nervous system (Wienholds et al., 2005). [score:5]
We constructed a UAS:epNTR-TagRFPT reporter vector, which comprises a fusion of enhanced-potency nitroreductase to TagRFPT followed by the ocean pout antifreeze protein 3′ UTR, which we modified to include miR-1, miR-126, and miR-199 target sites (utr. [score:3]
zb1, we designed a DNA fragment with target sequences for miR1-3p, miR126-3p, and miR199-5p. [score:3]
[1 to 20 of 4 sentences]
10
[+] score: 15
Other miRNAs from this paper: dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-210, dre-mir-214, dre-mir-219-1, dre-mir-219-2, dre-mir-221, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-21-1, dre-mir-21-2, dre-mir-25, dre-mir-30e-2, dre-mir-101a, dre-mir-103, dre-mir-107a, dre-mir-122, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-126a, dre-mir-129-2, dre-mir-129-1, dre-mir-130b, dre-mir-130c-1, dre-mir-130c-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-135c-1, dre-mir-135c-2, dre-mir-140, dre-mir-142a, dre-mir-142b, dre-mir-150, dre-mir-152, dre-mir-462, dre-mir-196a-2, dre-mir-196b, dre-mir-202, dre-mir-203b, dre-mir-219-3, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-mir-455-1, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-135b, dre-mir-135a, dre-mir-499, dre-mir-738, dre-mir-429b, dre-mir-1788, dre-mir-196c, dre-mir-107b, dre-mir-455-2, dre-mir-222b, dre-mir-126b, dre-mir-196d, dre-mir-129-3, dre-mir-129-4
Indeed, deletion of miR-1 altered regulation of cardiogenesis, electrical conduction and cell cycle of cardiomyocites, and miR-133 plus miR-1 regulate cardiac hypertrophy, as their over expression inhibits it. [score:7]
Dre-miR-1 and dre-miR-133a were expressed in muscle and heart, where they play an important regulatory role in other organisms [60, 61]. [score:4]
The heart showed accumulation of dre-miR-101a, dre-miR-130b, dre-miR-130c, dre-miR-221 and dre-miR-499, while dre-miR-1 and dre-miR-133a expression was detected in both muscle and heart. [score:3]
Dre-miR-499 was heart specific, dre-miR-1 and dre-miR-133a were detected in both muscle and heart and dre-miR-103 and dre-miR-122 were gut/liver specific. [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 13
In this sense, a suite of miRNAs, including miR-1, −133a, −133b, −206, −208a, −208b, −214 and −499, were identified as highly enriched or specifically expressed in cardiac and/or skeletal muscle cells of animals (reviewed in [9]). [score:3]
We have found a relative conservation of miR-1-2/-133a-1 within its respective intron, once their locations were unchanged for the majority of species. [score:1]
Another duplication of miR-1/-133a cluster must have occurred on a gnathostome ancestor, before the split of Chondrichthyes, Actinopterygii, Sarcopterygii and Tetrapoda lineages. [score:1]
Exceptions were found for spotted gar and elephant shark that presented the miR-1-2/-133a-1 at the same intronic position detected in horse (intron 11). [score:1]
For instance miR-1 and miR-133, whose origin remounts to a common ancestor of Protostomia and Deuterostomia [25], were amongst the most conserved miRNAs (Table  2). [score:1]
Additionally, to better understand the evolutionary dynamics of miR-1, −133, −206, −208, −214 and −499, we performed an analysis of synteny of fish chromosomal segments harboring these miRNA genes. [score:1]
In this hypothetical scenario a birth event of the clusterized and intronic miRNA miR-1-2/-133a-1 took place on a common Chordata ancestor [46]. [score:1]
Conversely, conserved blocks of coding genes surrounded the gene-neighborhood of the paralog miR-1-2/-133a-1 cluster (intronic of Mib1 gene) in ray-finned fish genomes (Figure  1B). [score:1]
Then, this extra copy of the miR-1/-133a cluster probably acquired a function and was maintained in Chondrichthyes, whereas it was converted into a novel miR-206/-133b cluster retained in the genome of the remaining vertebrate groups over evolution [36]. [score:1]
In zebrafish, however, miR-1-2/-133a-1 cluster presents a few conserved protein-coding flanking genes (Gata6 and Cables1), perhaps because it is situated on the scaffold_3540 that has a limited length of 28,134 bp and has not yet been anchored into zebrafish chromosomes. [score:1]
Looking at miRNAs location we found that miR-1-1/133a-2, miR-1-2/133a-1 and miR-206/133b form bicistronic clusters in fish, exactly as in the genome of mammals [32, 33]. [score:1]
[1 to 20 of 11 sentences]
12
[+] score: 12
For example, the main function of miR-1, miR-133 and miR-206 is inhibition of their target genes in order to promote differentiation of muscle cells [7]– [9]. [score:5]
The expressions of miR-1, miR-133, miR-206 and miR-208 in muscle cells are mainly controlled by MRFs, serum response factor (SRF) and MEF2 [12]– [15]. [score:3]
The target genes for zebrafish miR-1 and miR-133 are involved in actin -binding, as well as actin-related and vesicular transport [11]. [score:3]
Absence of miR-1 and miR-133 by co-injection of mopholinos (MOs) into embryos disturbs the organization of actin in muscle fibers. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 10
3.4In addition to myofilament proteins, the expression of four microRNAs (miRNA, miR) involved in cardiac development and function was analysed (Fig. 2B): miR-133a and b, miR-1 and miR-499. [score:4]
In addition to myofilament proteins, the expression of four microRNAs (miRNA, miR) involved in cardiac development and function was analysed (Fig. 2B): miR-133a and b, miR-1 and miR-499. [score:4]
MiR-133a and b (a regulator of myocyte enhancer protein 2) and miR-1 (important in myoblast to myotube differentiation) significantly increased over time in developing mouse hearts yet were present at very low levels in the adult zebrafish heart. [score:2]
[1 to 20 of 3 sentences]
14
[+] score: 10
The dre-miR-206 is a member of zebrafish miR-1 family, which control angiogenesis by regulating VegfA expression during embryonic development [38] and abundantly expressed throughout all eight stages (Figure  5C). [score:7]
Furthermore, the top 5 most abundant miRNA families expressed at each stage were selected, including dre-let-7a, dre-miR-1, dre-miR-10a-5p, dre-miR-124, dre-miR-181a-5p, dre-miR-184, dre-miR-192, dre-miR-22a, dre-miR-25, dre-miR-430a and dre-miR-456 families (Figure  5C). [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 8
Other miRNAs from this paper: dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-1, dre-mir-7a-3, dre-mir-30c, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-206-1, dre-mir-206-2, dre-mir-375-1, dre-mir-375-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j
Similar to mouse miR-1 [15], miR-375 copies survived evolution and are expressed similarly in time and space, probably to ensure the high intracellular concentration of miR-375 necessary to repress many weakly binding targets. [score:5]
Thus, both transcripts are expressed in the pituitary gland and the pancreatic islet, similar to miR-1 in the developing mouse heart [15]. [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 5
A network buffering function has also been suggested for the regulation of muscle development by miR-1 throughout evolution, regulation of the Wnt pathway by miR-8, and fine-regulation of Pten dosage by a variety of miRNAs [48]– [50]. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
miR-1 regulates the balance between proliferation and differentiation during cardiogenesis by targeting key cardiac regulatory proteins [5]. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 5
Notably, cardiac-specific miR-1, miR-133, miR-208 and miR-499 were all suppressed by two or more orders of magnitude [34], [35], as were the stemness and cell cycle repressors miR-141 and miR-137 [36]; in contrast, the proliferative miRNAs, miR-222 [37], increased dramatically in MDCs, and miR-221 was undetectable in myocytes but highly expressed in MDCs (Figure 5D). [score:5]
[1 to 20 of 1 sentences]
19
[+] score: 4
Other miRNAs from this paper: dre-mir-1-1, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b
For the first time the research of Ceci et al., has demonstrated the early activation of the heart of zebrafish from 24 h (hrs) post injury due to downregulations of miR1, miR133a, and miR133b. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 4
Expression of miR-1, miR-133a, miR-133b and miR-206 increases during development of human skeletal muscle. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 4
Furthermore, the muscle-specific microRNA-1 (miR-1), which normally keeps CDK9 derepressed at the transcriptional level [139], was downregulated at a very early stage, following cardiac hypertrophy induced in a mouse mo del of aortic constriction -induced hypertrophy. [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 3
Emerging evidence has revealed that miRNAs are also present in the CNS [32], [33], where cocaine administration alters the expression of many miRNAs (let-7d, miR-1, miR-124, miR-181a, miR-29b, miR-31, miR-382 and miR-212) in brain regions related to cocaine addiction (nucleus accumbens, ventral tegmental area, prefrontal cortex and dorsal striatum) [34], [35], [36]. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
For example, miR-1 and miR-133 are specifically expressed in muscles. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
MiR-1, -133a, -133b, and -499-5p, in fact, increased within few hours after onset of symptoms associated with myocardial infarction [36]; miR-126 has been proposed as a reliable biomarker for endothelial senescence in elderly subjects and for aged diabetic patients [41]; miR-122, sensitive to hyperlipidemia, seems to correlate with severity of coronary artery disease [37]. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
In this sense, it is known that different exogenous agents can induce the increase or decrease of specific miRNAs, for instance, cocaine administration alters the expression of many miRNAs (miR-1, miR-124, miR-181a, miR-29b, miR-31, miR-382, miR-212 and let-7d) in brain regions related to cocaine addiction (nucleus accumbens, ventral tegmental area, prefrontal cortex and dorsal striatum) [21], [64], [65]. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Fig. 2 miR-1 and miR-206 silence different target genes and play opposing roles in zebrafish angiogenesis. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 2
Other miRNAs from this paper: dre-mir-1-1
Misregulation of miR-1 processing is associated with heart defects in myotonic dystrophy. [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 2
Rau F. Freyermuth F. Fugier C. Villemin J. P. Fischer M. C. Jost B. Dembele D. Gourdon G. Nicole A. Duboc D. Misregulation of miR-1 processing is associated with heart defects in myotonic dystrophyNat. [score:2]
[1 to 20 of 1 sentences]
29
[+] score: 2
For example, miRNA-1–2 knockout mice have decreased levels of the cardiac transcription factor Hand2, which results in heart malformations (VSD) similar to those observed in Hand2 -deficient mice [53, 54]. [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 2
microRNA-1 and microRNA-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7. [score:2]
[1 to 20 of 1 sentences]
31
[+] score: 2
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-183, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-20a, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-101a, dre-mir-101b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-145, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-499, ola-mir-430a-1, ola-mir-430c-1, ola-mir-430b-1, ola-mir-430c-2, ola-mir-430c-3, ola-mir-430d-1, ola-mir-430a-2, ola-mir-430c-4, ola-mir-430d-2, ola-mir-430a-3, ola-mir-430a-4, ola-mir-430c-5, ola-mir-430d-3, ola-mir-430b-2, ola-mir-430c-6, ola-mir-430c-7, ola-mir-20a-1, ola-mir-92a-2, ola-mir-9a-2, ola-mir-101a, ola-mir-9b-1, ola-mir-499, ola-let-7a-1, ola-mir-9a-3, ola-mir-183-1, ola-let-7a-2, ola-mir-29b-1, ola-mir-29a, ola-mir-124-1, ola-mir-124-2, ola-mir-9a-4, ola-mir-101b, ola-let-7a-4, ola-mir-10d, ola-mir-9a-1, ola-mir-92b, ola-mir-9b-2, ola-mir-1-2, ola-mir-124-3, ola-mir-15a, ola-mir-10b, ola-mir-92a-1, ola-mir-20a-2, ola-mir-17, ola-mir-29b-2, ola-mir-29c, ola-mir-183-2, ola-let-7a-3, ola-mir-9a-5, ola-mir-145, dre-mir-29b3
For detailed lists of miRNA family assignments, see Supplement Table 4 The age -dependent expression of the following miRNAs was previously demonstrated by qPCR: tni-miR-15a, tni-miR-101a, tni-miR-101b, dre-miR-145, hsa-miR 29c-1 (100% identical to dre-miR-29a), hsa-let-7a-5p, hsa-miR-124a-1, hsa-miR-1-2, olamiR-21, ola-miR-183-5p and, from cluster dre-miR-17a/18a/19a, and dre-miR-20a (the used primers were Qiagen miScript primer). [score:1]
For detailed lists of miRNA family assignments, see Supplement Table 4 The age -dependent expression of the following miRNAs was previously demonstrated by qPCR: tni-miR-15a, tni-miR-101a, tni-miR-101b, dre-miR-145, hsa-miR 29c-1 (100% identical to dre-miR-29a), hsa-let-7a-5p, hsa-miR-124a-1, hsa-miR-1-2, olamiR-21, ola-miR-183-5p and, from cluster dre-miR-17a/18a/19a, and dre-miR-20a (the used primers were Qiagen miScript primer). [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 1
Other miRNAs from this paper: dre-mir-1-1
D. Length (number of segments) and direction (ipsilateral, contralateral, or bilateral) of descending axon projections were assigned as follows [25], [54]: CRN, CC, and IC all descend 5 segments; RoR1, RoL2; RoL2c, and MiD2i descend 8 segments; MeM, MeM1, MeL, MeLr-m, MeLc, RoM1r, RoL1, Vestibulospinal descend 13 segments; RoM1c, RoM2m, RoL2r, RoV3, RoL3, MiD2cm, Mid3cm-cl, MiD3i, MiT descend 18 segments; RoM2l, RoM3m-l, Mauthner, MiM1, MiV1, MiR1, MiR2, MiV2, MiD2cl, CaD, CaV descend 25 segments; Mauthner, MiD2c, MiD3cm, MiD3cl, CaD, CRN made contralateral connections; 84.8% of descending neurons connect to ipsilateral cord. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
We also identified 18 (unique) computationally-inferred interactions between our hubs and other heart regeneration miRs: hsa-miR-1, hsa-miR-195 and hsa-miR-199a 51. [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
Chen J. -F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. -Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiationNat. [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
The family defining bootstrap cutoff values are tree-specific, and are set to be the smallest bootstrap value of the reference miRNA families (let7, mir-124, mir-17 and mir-1, See additional file 3: Reference miRNA families) in each input tree. [score:1]
[1 to 20 of 1 sentences]
37
[+] score: 1
Likewise, miR-1, miR-124, miR-125b, miR-132, bantam, miR-34 and the miR-310 cluster have all been implicated in the modulation of synaptic homeostasis [70]– [76]. [score:1]
[1 to 20 of 1 sentences]