sort by

10 publications mentioning dre-mir-10c

Open access articles that are associated with the species Danio rerio and mention the gene name mir-10c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 538
To show targeting of HoxB3a, 72 hpf embryos were analyzed for the expression of gcm-2. In miR-10 overexpression embryos we observe downregulation of gcm-2 (figure 6F) in the branchial arch region as would be expected for embryos with impaired HoxA3a and/or HoxB3a expression [43]. [score:12]
Overexpression of miR-10 leads to downregulation of HoxB1a and HoxB3a in their strong anterior hindbrain expression domains but does not influence the expression of the other Hox genes (figure 4A marked miR-10 siRNA). [score:10]
Inhibition of miR-10 leads to posterior target gene upregulation in case of HoxB1a, HoxA1a and HoxB3a but certainly not to the same high level found in their dominant anterior expression domains. [score:10]
These Hox genes have strong anterior expression domains in the hindbrain and are expressed at a low level in the spinal cord where their expression overlaps with miR-10 expression (figure 9A). [score:9]
There is strong upregulation of HoxB1b expression in the morphants but no downregulation is observed in the miR-10 siRNA injected embryos. [score:9]
Using sensor constructs, overexpression and morpholino knockdown, we show in Zebrafish that miR-10 targets HoxB1a and HoxB3a and synergizes with HoxB4 in the repression of these target genes. [score:8]
The inhibition of miR-10 leads to posterior upregulation of the targeted genes. [score:8]
To show that the VIIth nerve defect is directly due to targeting of HoxB1a by miR-10, we rescued the miR-10 overexpression by co-injecting 5pg HoxB1a RNA from a construct that does not contain any of the target sites. [score:8]
MiR-10 morphant embryos show upregulation of these target genes within the normal miR-10 expression domain, indicating that active repression occurs in the embryo. [score:8]
Consistent with the transcriptionally implied co-regulation, miR-10c has the same anterior boundary of expression as described for HoxB4a and is expressed in a mutually exclusive domain with the anterior strong r 5/6 expression domain of HoxB3a (single in situ, figure S1A). [score:8]
The upregulation of the target genes in the morphant embryos shows that the target genes are indeed repressed by miR-10 within this posterior domain. [score:8]
Morpholino knockdown of m iR-10 leads to upregulation of this transcript in both in situ hybridization and (figure 8D, E), confirming that it is indeed targeted by miR-10 in vivo. [score:7]
When 150pg HoxB4 is expressed together with miR-10 siRNA the expression domain of HoxB1a disappears and no clear rhombomere 5/6 stripe of HoxB3a expression can be detected. [score:7]
This high number of predicted target genes seems incompatible with the very specific phenotypic defects observed in the miR-10 overexpression embryos and strongly suggest that, at least for miR-10, there is a high component of false positives in the outcome of target prediction algorithms. [score:7]
In this latter domain, miR-10 knockdown results in upregulation of the target genes. [score:7]
Embryos were injected with either miR-10 siRNA or miR-10 morpholino and then analyzed at 24 hpf for the expression of the target genes HoxB1a and HoxB3a, and of HoxB2a, HoxB4a and HoxB5a, genes that are predicted not to be targets. [score:7]
We don't observe any changes in the expression of HoxA3a resulting from overexpression or knockdown of miR-10 (figure 4C). [score:6]
F) Gcm-2 expression is downregulated in miR-10 siRNA injected embryos, which is consistent with repression of HoxB3a. [score:6]
Effect of miR-10 knockdown and overexpression on endogenous Hox target transcripts. [score:6]
What however argues strongly against the targeting of HoxB1b is that the overexpression of miR-10 does not induce the same phenotypic changes as observed in the double HoxB1a/ HoxB1b knockdown [42]. [score:6]
0001396.g004 Figure 4Effect of miR-10 knockdown and overexpression on endogenous Hox target transcripts. [score:6]
Expression is upregulated in miR-10 morphant embryos (arrows). [score:6]
A possible explanation for the presence of target gene/microRNA combinations within single transcription units and for the targeting of nearby Hox genes by both miR-10 and miR-196, may lie in the complexity of the Hox regulatory mechanisms which involve multiple global and local transcriptional elements. [score:6]
In silico target analysis in Teleosts has predicted the presence of miR-10 target sites within the Hox clusters [34]. [score:5]
When coexpressed with miR-10, we observe a complete disappearance of the rhombomere 4 HoxB1a expression stripe (figure 7A). [score:5]
Whether they are true targets remains to be seen; HoxA1a, despite not being near to a clear target site, responds strongly to the loss and gain of miR-10. [score:5]
Overexpression of 40pg HoxB3a results in severe anterior and posterior truncations that are rescued by co-injection with miR-10 siRNA E-YFP sensor constructs containing the HoxB1a and HoxB3a 3′UTR target sequences were tested for their sensitivity to silencing by miR-10 (figure 2B). [score:5]
The short genomic distances between miR-196 and miR-10 and their targets are remarkable; miR-10c is ∼25 kb from the target sites in HoxB3a and ∼48 kb from those in HoxB1a and (in mammals) a miR-196 paralogue is located at ∼18 kb from HoxB8 and HoxC8 and at ∼14 kb from HoxA7. [score:5]
The other Hox genes, which are also not affected by the overexpression of miR-10 siRNA, show no change in expression levels in morphant embryos. [score:5]
Overexpression of miR-10 also induces specific phenotypes related to the loss of function of these targets. [score:5]
This transcript is thus expressed more posteriorly than the main HoxB3a expression domain and completely within the domain of the miR-10c microRNA, a feature also expected from the presence of miR-10c on the HoxB3a splv2 primary transcript. [score:5]
A) Schematic representation of miR-10 and target gene expression in the Zebrafish hindbrain. [score:5]
In situ hybridization with probes matching each of the miR-10 isoforms (figure S2) excludes that other miR-10 isoforms, which are possibly not detected by the miR-10c LNA probe, are expressed in domains overlapping with or anterior to the main expression domain of HoxB3a. [score:5]
HoxB1a and HoxB3a have a dominant hindbrain expression domain anterior to that of miR-10 but overlap in a weaker expression domain in the spinal cord. [score:5]
In overexpression experiments, miR-10 synergizes with HoxB4 in the repression of these target genes. [score:5]
The co -expression and implied co-regulation of miR-10c with HoxB4a suggest that it could be regulated in the same way. [score:5]
However, as miR-10 appears to target HoxB1a and HoxB3a and possibly other 1 and 3 paralogue genes, the phenotype of miR-10 overexpression is expected to combine at least the loss of function phenotypes for these genes. [score:5]
Surprisingly, both HoxA1a and HoxB1b are strongly upregulated in the spinal cord in miR-10 morphant embryos (figure 4C, E), suggesting either direct de-repression by miR-10 or activation by the now de-repressed HoxB1a gene. [score:5]
The target genes HoxB1a and HoxB3a are expressed in a strong domain (dark colour) anterior in the anterior hindbrain and in a weaker domain (light colour) in the area where they overlap with miR-10. [score:5]
0001396.g009 Figure 9A) Schematic representation of miR-10 and target gene expression in the Zebrafish hindbrain. [score:5]
In HoxA3a, one putative miR-10 target site is present in the HoxA3a 3′ UTR (777 nt downstream of the ORF), in HoxB1b one putative target site is located in the 3′ UTR (125 nt downstream of the ORF) and in HoxA1a, a seed sequence is located 5472 nt downstream of its ORF. [score:5]
On the basis of our experiments and the presence of putative target sites, only HoxA1a, HoxB1a, HoxA3a and HoxB3a genes are candidate miR-10 targets. [score:5]
When miR-10 knockdown embryos are stimulated with 10 [−6] RA, an increased upregulation of HoxB1a but not HoxB4a is observed (figure 5C) compared to wildtype treated embryos. [score:4]
Closer inspection revealed a 3 [rd] possible target sequence corresponding to nucleotide 2-7 flanked by a T at position 1. After introduction of a point mutation into this seed sequence the construct is no longer repressed by injection of miR-10 (figure 2C). [score:4]
HoxB2a, HoxB4a and HoxB5a are unresponsive to miR-10 overexpression or knockdown. [score:4]
RA treatement results in miR-10c upregulation. [score:4]
0001396.g005 Figure 5Retinoid induction of miR-10c and upregulation of HoxB1a in miR-10 morphants. [score:4]
0001396.g008 Figure 8Evolutionary conservation of miR-10 targetsites and autoregulation of miR-10c. [score:4]
HoxB1a upregulation by retinoic acid is elevated in miR-10 morphants. [score:4]
B) shows similar temporal expression during development of HoxB4a (28 cycles) and miR-10c pre-miRNA (35 cycles). [score:4]
A) Wildtype (WT), miR-10 morphant (MO1, MO2) and miR-10 siRNA overexpression embryos at 72 hpf show no apparent developmental differences. [score:4]
HoxB3a is upregulated in miR-10 morphant embryos. [score:4]
We also determined the responses of HoxA3a, HoxA1a and HoxB1b to overexpression and knockdown of miR-10. [score:4]
Retinoid induction of miR-10c and upregulation of HoxB1a in miR-10 morphants. [score:4]
Evolutionary conservation of miR-10 targetsites and autoregulation of miR-10c. [score:4]
HoxB1a is strongly upregulated in miR-10 morphants. [score:4]
In situ hybridization shows that treatment with 10 [−6] M RA leads to upregulation of miR-10c (figure 5A), in a manner similar to that of HoxB4a, showing that transcription of miR-10c is indeed activated by RA. [score:4]
All of the Teleosts for which sequence information could be found (note that the available HoxBa Medaka contig stops 300 nt downstream of HoxB1) posses a candidate miR-10 target site in the 3′ UTR of their HoxB1a gene. [score:3]
We find that HoxB1a and HoxB3a are targeted by miR-10. [score:3]
ClustalW alignment of the 5 miR-10 paralogue precursor sequences reveals a region of extended conservation in the stem loop 5′ to the mature microRNA (figure 3A), which allows the design of two morpholino reagents with only minor overlap to control against off-target effects. [score:3]
Apparently RA simultaneously activates expression of both HoxB1a and miR-10 and miR-10 modulates the downstream response to retinoid signaling. [score:3]
A) Embryos injected with HoxB4, miR-10 siRNA and HoxB4+ miR-10 siRNA analyzed for the expression of HoxB1a and HoxB3a at 24 hpf. [score:3]
We searched the anterior part of the HoxB(a) clusters in Medaka, Three spined stickleback, Tetraodon, Takifugu, Xenopus, Oppossum, Mouse, Rat, Cow and Human for the presence of putative miR-10 target sites (seed nucleotide 1-7). [score:3]
The light red box in the HoxB1a 3′ UTR is a target site flanked at position one by a T instead of an A. C) Validation of the HoxB1a and HoxB3a E-YFP sensor constructs by injection of wildtype (WT) and seed mutant (mut) constructs in presence and absence of miR-10 siRNA. [score:3]
In situ hybridization with the ‘sensor part’ of HoxB3a shows that this region responds identically to overexpression of miR-10 (figure S1B). [score:3]
A polycistronic transcript including both HoxB3a and miR-10c is targeted by miR-10. [score:3]
Considering that these are the same genes that are targeted by miR-10 and that there exists a close association between the microRNA gene and the HoxB4 open reading frame, this could indicate a synergistic action between miR-10 and HoxB4. [score:3]
Inspection of the Zebrafish HoxBa cluster with the miR-10 seed sequence (nucleotide1-7) indicates the presence of putative target sites primarily in the 3′ part of the cluster. [score:3]
B) Embryos injected with HoxB4, miR-10 siRNA and HoxB4+ miR-10 siRNA analyzed for the expression of endogenous HoxB4a at 48 hpf. [score:3]
Analysis of the miR-10 overexpression phenotype by immunolabeling with the primary neuron specific 3A10 antibody shows that the Mauthner neurons are still present (figure 6B). [score:3]
HoxB1a and HoxB3a respond to both gain and loss of function (arrows) of miR-10 with a decrease and increase in expression levels respectively. [score:3]
There could be several reasons why miR-10 targets particular Hox-1 and Hox-3 genes and not others. [score:3]
To test this hypothesis we overexpressed HoxB4 and miR-10 individually and combined. [score:3]
Embryos were injected with 150pg hoxB4 RNA, miR-10 siRNA or a combination of the two and analyzed for HoxB1a and HoxB3a expression. [score:3]
The endogenous expression of miR-10b and miR-10c is no longer detected. [score:3]
HoxA3a also possesses one candidate target site but seems unaffected by gain and loss of miR-10. [score:3]
A) Putative miR-10 target sites are indicated by seed sequences in the sense strand of the anterior vertebrate HoxB(a) clusters. [score:3]
0001396.g002 Figure 2 miR-10 target sites within the HoxBa cluster. [score:3]
C) Whole mount in situ hybridization on different stage Zebrafish embryos shows mutually exclusive expression of the HoxB3a rhombomere 5/6 domain (red) with miR-10c (purple). [score:3]
We observe that the HoxB4 overexpression phenotype is significantly enhanced by miR-10. [score:3]
Overexpression of miR-10 induces HoxB1a and HoxB3a loss of function phenotypes. [score:3]
In addition HoxA1a also responds strongly to overexpression of the miR-10 siRNA. [score:3]
Injection of either MO1 or MO2 leads to absence or very strong reduction of the signal for each of the 4 miR-10 isoforms in northern blots (figure 3B), showing that their processing is efficiently inhibited. [score:3]
Overexpression of miR-10 indeed induces the phenotypes associated with the loss of HoxB1a and HoxB3a. [score:3]
The exact anterior boundary of the neural expression of miR-10c was determined in double in situ hybridization together with the anterior neighboring gene HoxB3a (figure 1C). [score:3]
Overexpression of miR-10 induces phenotypes associated with loss of HoxB1a and HoxB3a but not HoxB1b. [score:3]
The conservation of the miR-10 target sites in the 3′UTR and coding regions of HoxB3(a) genes is clear; all species investigated have at least 2 target sites associated with the ORF or 3′ UTR region. [score:3]
Spatial and temporal expression profile of miR-10c. [score:3]
In this light, the presence of miR-10c and its target HoxB3a on a single primary transcript is also interesting. [score:3]
The expression patterns of the miR-10 isoforms differ in that the probes for miR-10b and miR-10d show a more posterior rostral boundary, with highest intensity staining caudal to the hindbrain, while miR-10a and miR-10c probes have an anterior boundary at r6/7. [score:3]
These defects are completely rescued by co-injection of miR-10 siRNA, indicating absence of overexpressed HoxB3a protein. [score:3]
0001396.g006 Figure 6Overexpression of miR-10 induces HoxB1a and HoxB3a loss of function phenotypes. [score:3]
MiR-196 is known to represses HoxB8, HoxC8, HoxD8 and HoxA7 and we have identified HoxB1a and HoxB3a as targets for miR-10. [score:3]
The seed mutant construct for HoxB1a in which the two target sites are mutated is still partially silenced however after co-injection with miR-10 (data not shown). [score:3]
We show that miR-10 represses the nearby HoxB1a and HoxB3a genes and that its overexpression also induces the associated loss of function phenotypes for both genes. [score:3]
0001396.g001 Figure 1Spatial and temporal expression profile of miR-10c. [score:3]
miR-10 target sites within the HoxBa cluster. [score:3]
uk/) is listed, there are however 1969 predicted target genes for Zebrafish miR-10. [score:3]
The miR-10c/ HoxB3a polycistronic transcript includes both the microRNA and a target gene. [score:3]
This transcript includes the full HoxB3a open reading frame together with the 3 miR-10 target sites. [score:3]
These experiments identify the predicted HoxB1a and HoxB3a 3′UTR and ORF target sites as mediators of miR-10 repression. [score:3]
In this case the miR-10c microRNA apparently acts on parts of its own primary transcript and is therefore autoregulatory. [score:2]
with primers located 5′ of miR-10c and in the HoxB4a coding sequence shows that miR-10c and HoxB4a are located on the same primary transcript (figure 1A) and for the individual genes shows the same temporal expression pattern (figure 1B). [score:2]
The MiR-10 paralogues are associated with the 5′ genomic region of Hox-4 genes and microRNA specific Locked Nucleic Acid (LNA) in situ hybridization [16], [31] and transgenic sensor lines [24] have revealed similar patterns of expression as for the Hox-4 paralogues. [score:2]
MiR-10 is expressed posterior from the rhombomere 6/7 boundary. [score:2]
D) Phenotypic sensor assay to validate the HoxB3a ORF miR-10 target sites. [score:2]
In the case of a long range HoxB3a transcript that includes miR-10c within its primary transcript, we show that the microRNA acts in an essentially auto regulatory fashion. [score:2]
This synergistic action between miR-10 and HoxB4 suggests that post-transcriptional gene regulation by microRNAs plays a role in posterior prevalence. [score:2]
0001396.g003 Figure 3Morpholino knockdown of miR-10. [score:2]
MiR-10 target sites are present in HoxB1a and HoxB3a. [score:2]
Morpholino knockdown of miR-10. [score:2]
In the case of a HoxB3a splice variant that includes miR-10c within its primary transcript, we show that the microRNA acts in an autoregulatory fashion. [score:2]
Overexpression of 40pg HoxB3a results in severe anterior and posterior truncations that are rescued by co-injection with miR-10 siRNA To investigate the role of miR-10 in the regulation of endogenous Hox genes, we performed miR-10 gain and loss of function experiments. [score:2]
MiR-10 is expressed in the hindbrain and spinal cord posterior to the rhombomere 6/7 boundary and occupies an axial domain similar to those of Hox-4 paralogue genes. [score:2]
B) Mauthner neuron development as visualized by 3A10 neurofilament immunostaining in 72 hpf embryos shows no differences between miR-10 siRNA injected embryos and controls. [score:2]
MiR-10 is expressed in a Hox-4 like pattern. [score:2]
A) ClustalW alignment of the 5 Zebrafish miR-10 precursor sequences. [score:1]
Indicated are the positions of the mature microRNA, the hairloop and the miR-10* (antisense pairing sequence in the hairpin). [score:1]
The combination of HoxB4 together with the miR-10 siRNA induces a stronger phenotype with more severe anterior and posterior truncations than injection with HoxB4 alone. [score:1]
The miR-10 siRNA sense strand corresponds to a mix of miR-10a (UACCCUGUAGAUCCGAAUUUGUGUG) and miR-10b (UACCCUGUAGAACCGAAUUUGUGUG), sequence of the antisense strand is (CACAAAUUCGGAUCUACAGGGGCAU). [score:1]
Analysis of the same genes in miR-10 morphant embryos shows patterns similar to wildtype embryos (figure S3). [score:1]
LNA probes were obtained from Exiqon, Denmark and sequences are: miR-10a (CACAAATTCGGATCTACAGGGTA), miR-10b (ACAAATTCGGTTCTACAGGGTA), miR-10c (CACAAATCCGGATCTACAGGGTA), miR-10d (ACACATTCGGTTCTACAGGGTA ). [score:1]
For MO2 we observe a slight recovery of the signal at 48 and 72 hpf (hours post fertilization), but overall, injection results in a very strong decrease of mature miR-10 levels. [score:1]
A) LNA in situ hybridization for miR-10c in wildtype (WT) and 10 [−6]M retinoic acid (RA) treated embryos. [score:1]
In situ hybridization with miR-10 LNA probes also shows no signal in morpholino injected embryos (figure 3C). [score:1]
Membranes were pre-hybridized at 60°C for 1 hr in hybridization buffer (0.36 M Na [2]HPO [4], 0.14M NaH [2]PO [4], 1 mM EDTA, 7%SDS, 0.1 mg/ml yeast tRNA, 0.04% Blocking reagent (Roche #1096176)) and subsequently hybridized overnight at 60°C in hybridization buffer containing miR-10 LNA probes, labeled and purified as mentioned above, and diluted 1∶50.000. [score:1]
In addition to the protein coding Hox genes, the miR-10, miR-196 and miR-615 families of microRNA genes are conserved within the vertebrate Hox clusters. [score:1]
Injection with the miR-10 siRNA has no effect. [score:1]
The primary transcript for this isoforms includes miR-10c. [score:1]
Morpholinos were obtained from genetools, OR, USA; miR-10 morpholino reagent 1 corresponds to a mix of miR-10a (CACAAATTCGGATCTACAGGGTA) and miR-10b (CACAAATTCGGTTCTACAGGGTA) antisense morpholino, the sequence of miR-10 morpholino reagent 2 is (TCTACAGGGTATATATAGACGAC). [score:1]
In the Zebrafish genome, miR-10 is present in 5 paralogues representing 4 different isoforms (a, b, c and d), which differ from each other at 1 to 3 positions [16], [17]. [score:1]
The members of the miR-10 family are located at positions associated with Hox-4 paralogues. [score:1]
C) In situ hybridization with HoxA1a and HoxA3a on 24 hpf embryos injected with MO1, MO2 or miR-10 siRNA. [score:1]
We reveal an interaction between miR-10 and the anterior HoxB1a and HoxB3a genes. [score:1]
It is interesting to note that the miR-10 microRNA has been lost from the tunicates [17], [54]. [score:1]
Sensor construct RNA was injected with or without miR-10 siRNA. [score:1]
In addition to the Hox coding genes, the miR-10, miR-196 and miR-615 microRNA gene families have been identified within the vertebrate Hox clusters [8]– [11]. [score:1]
Co-injection with miR-10 siRNA restores migration of the VIIth nerve as show by both islet-1 and tag-1 in situ hybridization (figure 6E). [score:1]
These analyses show that miR-10 is able to induce specific phenotypes associated with the loss of function of HoxB1a and HoxB3a/ HoxA3a genes but not of HoxB1b. [score:1]
In the Hox clusters, miR-10 genes are closely associated with the positions of Hox-4 paralogue members, miR-196 is located 5′ of Hox-9 paralogues and the more recently cloned miR-615 is located in the HoxC5 intron in mammals but appears to be absent from Teleosts and Xenopus tropicalis. [score:1]
These experiments indicate that miR-10 synergizes with HoxB4 in the repression of HoxB1a and HoxB3a and also attains a greater posteriorizing activity in the presence of miR-10. [score:1]
In miR-10 siRNA injected embryos the VIIth nerve does no longer migrate out of rhombomere 4. E) Co-injection of 5pg HoxB1a RNA rescues the miR-10 siRNA induced migration defect of the VIIth cranial nerve as shown by islet-1 and tag-1 in situ hybridization. [score:1]
Note that the antisense sequence has mismatches with the miR-10 sense strand at its 3′ end resulting in the specific incorporation of the sense miR-10 strand in the microRNA silencing complex. [score:1]
A) Whole mount in situ hybridization with probes for hoxB1a, B2a, B3a, B4a and B5a on 24hpf embryos injected with morpholino reagent 1 or 2 (MO1 or MO2), miR-10 siRNA or non injected controls (NIC). [score:1]
This sequence is conserved in the mouse in which it has been shown to mediate the neural response of HoxB1 to RA [38] C) Different response of HoxB1a to RA stimulation in wildtype or miR-10 morphant embryos. [score:1]
D) Islet-1 and tag-1 in situ hybridization on 30 hpf wildtype and miR-10 siRNA injected embryos. [score:1]
Until now, the function of the miR-10 microRNA family has remained unclear but, based on its evolutionary conservation within the anterior part of the Hox clusters, an associated role in anterior-posterior patterning seems likely. [score:1]
Wildtype and miR-10 siRNA injected embryos are similar. [score:1]
In addition to this, we observe a stronger phenotype at 48 hpf, with more severe anterior and posterior truncations in embryos injected with the combination of HoxB4 RNA and miR-10 siRNA (figure 7B). [score:1]
C) LNA in situ hybridization for miR-10b and miR-10c in 72 hpf miR-10 morphants. [score:1]
B) Northern blot for all 4 different miR-10 isoforms in morpholino injected embryos at 24, 48 and 72 hpf. [score:1]
The primary unspliced form of this long transcript thus includes both HoxB3a and the miR-10c microRNA. [score:1]
Either morpholino has maximally one nucleotide mismatch with any of the 5 miR-10 paralogues. [score:1]
In situ hybridization on 30 hpf miR-10 injected embryos shows that branchiomotor neurons of the VIIth nerve no longer migrate into rhombomere 5 and 6 but remain in rhombomere 4 (figure 6D). [score:1]
This further adds to the implied relevance of the repression of HoxB1a and HoxB3a by miR-10. [score:1]
Both HoxB1a and HoxB3a wildtype sensor constructs are strongly repressed by the microRNA (figure 2C), while the seed point mutant construct proves insensitive to repression by miR-10. [score:1]
On the right groups of embryos injected with HoxB4 or the combination of HoxB4 and miR-10 siRNA are shown. [score:1]
The miR-10c microRNA gene is indicated in green. [score:1]
Response of endogenous Hox genes to miR-10 gain and loss of function. [score:1]
Here, we address the function of miR-10 with relation to a possible role in anterior-posterior patterning. [score:1]
We find that miR-10 acts to repress HoxB1a and HoxB3a within the spinal cord and show that this repression works cooperatively with HoxB4. [score:1]
In situ hybridization for the endogenous HoxB4a shows that in the HoxB4+ miR-10 siRNA co -injected embryos, the parts anterior and posterior to the endogenous HoxB4a domain are reduced more strongly than in embryos injected with HoxB4a only. [score:1]
[1 to 20 of 162 sentences]
2
[+] score: 13
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-204-1, dre-mir-181a-1, dre-mir-214, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-10b-2, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-25, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3, dre-mir-30d, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-100-1, dre-mir-100-2, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-mir-126a, dre-mir-143, dre-mir-146a, dre-mir-462, dre-mir-202, dre-mir-204-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-181a-2, dre-mir-1388, dre-mir-222b, dre-mir-126b, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-204-3
The most enriched GO term was segment polarity determination (GO:0007367), which contained target mRNA for the miR-10 and miR-125 families, as well as miR-181a-5p miR-21-5p, miR-222a-3p, and miR-430b-3p. [score:3]
Several miRNAs, namely let-7a-1–5p, let-7c-5p, let-7d-5p, miR-181a-5p, miR-222a-3p, miR-430b-3p, and miR-462-5p were typically more abundant in earlier stages of gonadal development, whereas miR-100-5p, miR-10a-5p, miR-10b-5p, miR-10c-5p, miR-202-5p, and miR-30d-5p were abundant during later stages of development. [score:3]
miR-10b-5p belongs to the evolutionarily conserved miR-10/100 family, which are associated with suppressing homeobox (hox) genes 37; hox genes are highly conserved transcription factors which guide stem cell differentiation 38. [score:3]
In our study, we detected several miRNAs with either templated additions or truncations at the 5′ end, notably in the miR-10 family and in both miR-202-5p and 3p arms (Fig. 8b, Supplementary Dataset S6). [score:1]
Modifications at 5′ end were detected in 8 miRNAs; miR-100-5p, miR-10a-5p, miR-10b-5p, miR-10c-5p, and miR-126a-5p were truncated, while miR-202-5p, miR-202-3p, and miR-214-3p had templated additions (Supplementary Dataset S6). [score:1]
Notably, all miRNAs from the miR-10 family showed a significant increase in abundance in ovaries at 24 wpf, while miRNAs from the let-7 family showed a significant increase at 6 wpf only. [score:1]
miR-222a-3p was the only miRNA with no significant change in abundance over time, while miR-10a-5p, miR-10c-5p, miR-125a-5p, miR26a-5p, and miR-92b-3p showed no significant change in abundance from 3 to 12 wpf. [score:1]
[1 to 20 of 7 sentences]
3
[+] score: 8
The three families we identified, miR-10, miR-99/100 and miR-196, are highly conserved and are dysregulated in a number of human diseases. [score:4]
The miR-10, miR-99/100 and miR-196 families are some of the most common Hox gene -targeting miRNAs yet described. [score:3]
We also tested the intrinsic preference of Zcchc11 toward miR-26a, a miRNA with reported Zcchc11 -dependent uridylation in cells, but found that it did not support strong uridylation similar to let-7 or miR-10 (6). [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 7
The analyses revealed the existence of mir196-Ba in all teleosts – except for medaka – and mir10-Ba was found in all species but A. burtoni, due to missing sequence data [see Additional File 3]. [score:1]
D. rerio retains the mir10-Db copy between the lunapark b and metaxin2 genes, even though the hox genes in this genomic region have been lost [85]. [score:1]
Interestingly, the mir10-Bb could be identified in all species except again for O. latipes [see Additional File 4]. [score:1]
Our analysis also found the mir10-db in all species [see Additional File 7]. [score:1]
Data for H. sapiens were copied from [86] and the mir-10-db of Danio rerio according to [85]. [score:1]
In medaka, we were not able to identify mir196-Ab, mir196-Ba and mir10-Bb, even though sequences were complete and without gaps in these intergenic regions. [score:1]
The CNSs were mainly teleost and neoteleost-specific, and we could identify two microRNAs in all species: mir196-Ca and mir10-Ca [see Additional File 5]. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 5
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-183, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-mir-1-2, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-10d, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-20a, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-101a, dre-mir-101b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-145, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-499, ola-mir-430a-1, ola-mir-430c-1, ola-mir-430b-1, ola-mir-430c-2, ola-mir-430c-3, ola-mir-430d-1, ola-mir-430a-2, ola-mir-430c-4, ola-mir-430d-2, ola-mir-430a-3, ola-mir-430a-4, ola-mir-430c-5, ola-mir-430d-3, ola-mir-430b-2, ola-mir-430c-6, ola-mir-430c-7, ola-mir-20a-1, ola-mir-92a-2, ola-mir-9a-2, ola-mir-101a, ola-mir-9b-1, ola-mir-499, ola-let-7a-1, ola-mir-9a-3, ola-mir-183-1, ola-let-7a-2, ola-mir-29b-1, ola-mir-29a, ola-mir-124-1, ola-mir-124-2, ola-mir-9a-4, ola-mir-101b, ola-let-7a-4, ola-mir-10d, ola-mir-9a-1, ola-mir-92b, ola-mir-9b-2, ola-mir-1-2, ola-mir-124-3, ola-mir-15a, ola-mir-10b, ola-mir-92a-1, ola-mir-20a-2, ola-mir-17, ola-mir-29b-2, ola-mir-29c, ola-mir-183-2, ola-let-7a-3, ola-mir-9a-5, ola-mir-145, dre-mir-29b3
We found e. g., miR-10, miR-29 and miR-92 showing potential to be significantly involved in the down-regulation of genes in the aging brain of N. furzeri, like cell cycle regulators (ccne2 [22], nek6 [38], cdk13 [42]) or cancer related genes (mycn [8, 12], vav2 [13, 28]), both processes involved in aging. [score:5]
[1 to 20 of 1 sentences]
6
[+] score: 5
Moreover, one of the microRNA families that we found to be amplified in both species, miR-10, has specifically shown to be overexpressed in NF1 -associated MPNSTs, and its inhibition slowed cell proliferation in cell lines derived from such tumors [88]. [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 5
The mir-196 family regulates Hox8 and Hox7 genes, the function of mir10 is unknown. [score:2]
A few microRNAs are apparently linked to protein coding genes, most notably mir-10 and mir-196 which are located in the (short) intergenic regions in the Hox gene clusters of vertebrates [4- 7]. [score:1]
The mir10 and the mir196 precursors are located at specific positions in the Hox gene clusters [4- 7]. [score:1]
mir10 is a good example of this typical substitution pattern, which gives rise to a hairpin structure. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 4
For example, miR-101a regulates adult zebrafish heart regeneration (Beauchemin et al., 2015), and miR-10 regulates angiogenesis by affecting the behavior of endothelial cells (Hassel et al., 2012). [score:3]
MicroRNA-10 regulates the angiogenic behavior of zebrafish and human endothelial cells by promoting vascular endothelial growth factor signaling. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
Others, the mir-10, 99, 100, 125 family for example, diverge in the mature forms (See additional file 8: The mir-10, 99, 100, 125 family). [score:1]
Sequence alignment and selected secondary structure of the miRNAs in the mir-10, 99, 100, 125 family. [score:1]
Click here for file The mir-10, 99, 100, 125 family. [score:1]
The mir-10, 99, 100, 125 family. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-148a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-34c, hsa-mir-148b, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-21-1, dre-mir-21-2, dre-mir-122, dre-mir-135c-1, dre-mir-135c-2, dre-mir-148, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-459, hsa-mir-499a, dre-let-7j, dre-mir-499, dre-mir-34c, dre-mir-734, hsa-mir-499b, dre-mir-7146, dre-mir-7147, dre-mir-7148
The data was analysed with comparative Ct method (2–[delta][delta]Ct) using two miRNA housekeeping genes (dre-let-7a and dre-miR-10c). [score:1]
[1 to 20 of 1 sentences]