sort by

11 publications mentioning dre-mir-30e-2

Open access articles that are associated with the species Danio rerio and mention the gene name mir-30e-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 250
However, the overexpression of a more upstream pathway component such as Shh (Fig. 4F) is suppressed by miR-30 overexpression (Fig. 4G) indicating the miR-30 target is located between Shh and dnPKA in the pathway. [score:9]
To establish that Hh pathway activity is regulated by miR-30 via direct targeting of smoothened, rather than another pathway component, ptc1 expression was compared in embryos overexpressing either Shh or dnPKA in conjunction with miR-30 (Fig. 4). [score:8]
To test whether miR-30 directly targets the proposed target site within the smoothened 3′UTR, we assessed the ability of miR-30 to negatively regulate three reporter mRNAs. [score:7]
By 26 hpf the expression pattern of miR-30a-30e is overlapping and ubiquitous with noticeable expression in the cerebellum, retina and somites, while miR-30e shows additional expression in the linear heart tube (Fig. S1A). [score:7]
The protector is complementary to the proposed target sequence within the smoothened 3′UTR, and specifically disrupts the miR-30- smoothened interaction [56], [57], thus providing valuable information about the physiological role of this pair without the interference of other targets or potential secondary targets [57]. [score:7]
In the current study we have demonstrated that inhibition of the miR-30 microRNA family causes elevated ptc1 expression and increased numbers of superficial slow muscle fibres during zebrafish muscle development, consistent with an increase in Hh pathway activity. [score:6]
Expression analysis of the miR-30 family was carried out in parallel with control experiments using a sense LNA probe for miR-159, as recommended by the manufacturer, which had no detectable expression at the same developmental time points (Fig. S1B). [score:6]
To further verify that miR-30 levels are linked to Hh pathway activity a miR-30 RNA sequence duplex was overexpressed in zebrafish embryos (Fig. 2D,H,L) and showed reduced ptc1 expression (Fig. 2H), suggesting that the microRNA family is involved in regulating Hh pathway activity. [score:6]
Together our results indicate that cyclopamine inhibition of Smoothened suppresses the phenotype associated with loss of miR-30 function, supporting the hypothesis that miR-30 modulates Hh signalling by regulation of smoothened. [score:6]
In situ hybridisation of 24 hpf embryos injected with the miR-30 morpholino exhibited increased ptc1 expression (Fig. 2F) suggesting upregulation of the pathway. [score:6]
miR-30e shows additional expression in the linear heart tube (arrowhead) (B) Negative control in situ hybridisation using a sense miR-159 LNA probe shows no detectable expression at 8 hpf, 16 hpf and 24 hpf. [score:5]
MicroRNA-140 was chosen as it has no reported similarity to any members of the miR-30 family and previous expression analysis in zebrafish has shown that miR-140 is expressed in the palatal skeleton and head cartilage [42], [43] No phenotype was observed in these embryos (Fig. S1C). [score:5]
To determine whether the miR-30 knock down phenotype was due to a mis-regulation of Hh signalling we analysed ptc1 expression as a read out of Hh activity (Fig. 2E–H) [48], [49]. [score:5]
The location of the miR-30 target between these two components of the Hh pathway adds further confidence to the hypothesis that smoothened is the target gene. [score:5]
To confirm that the observed phenotypic, transcript and protein alterations were directly due to miR-30 regulation of smoothened we sought to rescue the miR-30 morpholino phenotype using the Smoothened inhibitor cyclopamine (Fig. 5E–M and Fig. S4) [54]. [score:5]
We observe phenotypic similarities between miR-30 knockdown and Hh misexpression and show that Smoothened protein levels are directly affected in vivo. [score:5]
Consistent with the location of Smoothened upstream of dnPKA in the Hh pathway, overexpression of miR-30 is unable to suppress the effect of dnPKA. [score:5]
Since then, several potential targets of miR-30 regulation have been identified, many of which are implicated in the development of cancer [36]– [38]. [score:5]
miR-30 directly targets the 3′UTR of the Hedgehog transmembrane receptor smoothened. [score:4]
The miR-30 microRNA family shows high sequence similarity and overlapping expression patterns throughout embryonic development. [score:4]
These features are a result of direct targeting of the Hh transmembrane receptor smoothened by the microRNA family, representing a novel role for miR-30 in muscle fibre specification and distribution. [score:4]
To assess directly the effect of the miR-30-Smoothened interaction on zebrafish muscle structure a smoothened target protector morpholino was injected into embryos and the somite structure analysed at 24 hpf. [score:4]
In situ hybridisation analysis of smoothened shows an overlap of expression with miR-30 family members, both temporally and spatially throughout zebrafish embryonic development, allowing for a potential interaction [44]. [score:4]
miR-30 Acts to Negatively Regulate Smoothened As with most microRNAs, many targets are predicted by algorithms and sequence analysis [51]. [score:4]
A GFP reporter construct was made with the GFP open reading frame followed by perfect target sites for the miR-30 microRNA. [score:3]
These experiments indicate that the miR-30 family has a negative regulatory role on the level of Hedgehog signaling during zebrafish embryonic development. [score:3]
The miR-30 microRNAs show strong sequence similarity and overlapping expression patterns, which may result in functional redundancy. [score:3]
Images are shown of wild type embryos (A, E, I), miR-30 morpholino treated embryos (B, F, J), dnPKA treated embryos (C, G, K) and miR-30 overexpression embryos (D, H, L). [score:3]
Three different constructs were generated, each containing the GFP ORF followed by either tandem repeats of the miR-30 perfect target site (GFP-PTS) (Fig. 3A–B), an entirely complementary sequence to the microRNA, the smoothened 3′UTR sequence (GFP-SMO) (Fig. 3C–D), or no UTR sequence (GFP-no UTR) (Fig. 3E–F) as a negative control. [score:3]
Here we report a biological role for the miR-30 family in zebrafish embryonic muscle development by regulation of Hedgehog pathway activity. [score:3]
Based on such analysis we identified a potential miR-30 target site within the zebrafish 3′UTR sequence of the transmembrane receptor smoothened (smo) [52], [53]. [score:3]
Duisters et al. (2009) were the first to report a target, connective tissue growth factor, for miR-30 [35]. [score:3]
Figure S1(A) Expression of the miR-30 family as determined by in situ hybridisation at 8, 16 and 26 hpf. [score:3]
GFP protein was quantified by Western blot and demonstrated 72% inhibition of miR-30 activity by the morpholino (Fig. S2). [score:3]
The miR-30 family is required during early embryonic development to regulate Hh pathway activity. [score:3]
As a negative control for the knockdown studies an unrelated microRNA was selected to ensure the phenotypes observed were specific to knockdown of the miR-30 family and was not a generic consequence of morpholino introduction. [score:3]
This is supported by the observation that miR-30 overexpression, and hence Hh pathway activity reduction, can be rescued by coinjection with Shh mRNA but not with dnPKA mRNA. [score:3]
Furthermore, a reduction in ptc1 expression was observed following cyclopamine rescue of miR-30 morpholino embryos indicating that Hh pathway activity had been reduced (Fig. 5L). [score:3]
The miR-30 family is known to regulate several biological processes, including pancreatic islet cell development [31], mitochondrial fission [32], adipogenesis [33] and osteoblast differentiation [34]. [score:3]
By acting to modulate the activity of Smoothened, and subsequently the entire Hh pathway, the miR-30 family undertake a key role in early zebrafish embryonic development. [score:2]
The miR-30 Family is Required for Early Muscle Development. [score:2]
Here, we show that such an increase in Smoothened protein levels is induced by morpholino -mediated knock-down of the miR-30 family in zebrafish embryos. [score:2]
MicroRNA-30 family knockdown produced a severe muscle phenotype, (Fig. 2A and 2B) indicating a potentially crucial role in early embryonic development. [score:2]
The resulting phenotype was milder than miR-30 family knockdown, however a significant change in somite structure was detected. [score:2]
The average slow muscle fibre number in untreated embryo somites was 23.01±3.13 (Fig. 2I), compared to 38.03±9.90 (p<0.0001) in miR-30 morpholino treated embryos (Fig. 2J) and 17.5±6.4 (p<0.0001) in miR-30 overexpression embryos (Fig. 2L). [score:2]
To assess the role of the entire miR-30 family, a multi-blocking morpholino was designed to knock-down all 5 family members simultaneously in one experiment (Fig. 2). [score:2]
miR-30 Acts to Negatively Regulate Smoothened. [score:2]
There is significant similarity between the embryos treated with dnPKA and the miR-30 knockdown embryos, with primary defects in the early patterning and establishment of the somites resulting in U shaped somites and overall curvature of the embryo. [score:2]
Ptc1 expression analysis was used as a read out of Hh pathway activity, showing elevated levels in miR-30 morpholino and dnPKA treated embryos when compared to wild type embryos (E–H). [score:2]
Our results suggest that the miR-30 microRNA family is a critical regulator of muscle cell specification and differentiation. [score:2]
Our data suggest that in the wild-type embryo miR-30 regulation of smoothened mRNA maintains the correct cellular level of Smoothened protein and the appropriate Ptc:Smo ratio to ensure normal patterning of the somitic mesoderm. [score:2]
Further evidence of a direct relationship between miR-30 and smo was shown by an increase of 73% in Smoothened protein level following miR-30 morpholino treatment (Fig. 3I–J). [score:2]
Analysis of Ptc1 reveals the position of miR-30 regulation in the Hh pathway. [score:2]
miR-30 Misregulation Affects Hh Pathway Activity. [score:2]
MicroRNA-30 regulation of the Hh pathway, via modulation of Smoothened, represents a prime example of a pathway that is particularly sensitive to changes in its key components in some cell types and therefore microRNA regulation represents an ideal mechanism to maintain the level of control needed for precise activation. [score:2]
miR-30 acts to negatively regulate smoothened in developing embryos. [score:2]
We noticed that the phenotype we generated by alterations in the level of the miR-30 family mimics misregulation of the Hh pathway, displaying downwards curvature of the embryos and characteristic U-shaped somites associated with Hh pathway misregulation (Fig. 2B) [14], [47]. [score:1]
Immunohistochemical analysis revealed that following cyclopamine treatment the number of slow muscle fibres in miR-30 morpholino treated embryos (38.03±9.90) reduced to the wild type range (23.01±3.13) with an average of 24.1±3.58 slow muscle fibres per somite (p = 0.0784) (Fig. 5G, 5J, 5M and Table S1). [score:1]
The miR-30 family shows extremely high sequence similarity and an identical seed sequence, as highlighted by the red box. [score:1]
Figure S4 Cyclopamine treatment rescues the miR-30 morpholino phenotype. [score:1]
miR-30 is Required for Correct Specification of the Distinct Muscle Cell Types. [score:1]
The phenotype generated from target protection of the miR-30 site within the smoothened mRNA transcript, demonstrating the specific effect of this interaction, produces a defect in early muscle specification resulting in flattened somites and loss of the characteristic chevron structure. [score:1]
0065170.g001 Figure 1 The miR-30 family shows extremely high sequence similarity and an identical seed sequence, as highlighted by the red box. [score:1]
Somite structure of (A) wild type embryos (B) miR-30 morpholino injected embryos (C) smoothened protector morpholino injected embryos. [score:1]
Figure S2 Validation of the miR-30 morpholino. [score:1]
At 6.25 µM the miR-30 morpholino phenotype improved to resemble the wild type phenotype with elongation of the tail and improved somite structure (F). [score:1]
Analysis of the miR-30 morpholino treated embryos showed a significant increase in slow-muscle fibre number and altered distribution to a more internal position within the somite, suggesting an increase in Hedgehog activity (Fig 2J and Table S1). [score:1]
In parallel both uninjected and miR-30 morpholino -injected embryos were treated with identical amounts of DMSO to act as a negative control which produced no effect on the phenotypes of the resulting embryos (Fig S4C+D). [score:1]
Injection of the miR-30 morpholino yielded embryos with broader, rounded U-shaped somites and alteration of the tail size and structure (Fig. 2B). [score:1]
The miR-30 family members are encoded from 3 different genomic locations and form 3 microRNA clusters. [score:1]
To evaluate the role of the miR-30 family in muscle development we investigated the effect of miR-30 up- and downregulation on muscle fibre distribution by immunohistochemistry. [score:1]
Embryos were injected with the miR-30 morpholino and allowed to develop in water treated with cyclopamine, dissolved in DMSO, at a range of concentrations between 100 µM and 6.25 µM. [score:1]
The miR-30 family has been studied extensively and has been used to identify the precise mechanisms of Drosha activity [29], as well as the sequence requirements for miRNA biogenesis and function [30]. [score:1]
The optimum cyclopamine concentration for rescue of the miR-30 morpholino phenotype was 6.25 µM, which achieved rescue of the somite structure in 70% of embryos. [score:1]
In the miR-30 morphants, Smoothened levels are elevated and as such the somitic cells located more laterally are capable of pathway activation and hence develop into slow rather than fast muscle fibres. [score:1]
In situ hybridisation with Locked Nucleic Acid (LNA) probes showed that the miR-30 family was detected as early as 8 hpf, unusual for miRNAs in zebrafish [39]. [score:1]
Analysis of the somite boundaries showed that miR-30 morpholino embryos treated with cyclopamine had an improved angular somite structure (Fig. 5K) that more closely resembled that of the wild type embryo somite (Fig. 5E). [score:1]
The miR-30 family morpholino is 35 bp in length. [score:1]
0065170.g005 Figure 5(A–D) Somite angle analysis in wild type, miR-30 morpholino and smoothened protector morpholino injected embryos. [score:1]
This experiment demonstrated the effectiveness of the miR-30 morpholino, as shown by a rescue in the levels of GFP protein. [score:1]
Images as shown of wild type embryos (E,F,G), miR-30 morpholino embryos (H,I,J) and miR-30 morpholino embryos treated with cyclopamine (K,L,M). [score:1]
In order to understand the role of the miR-30 family we conducted a series of experiments using the zebrafish mo del system. [score:1]
This was injected into embryos singly, with the miR-30 RNA and with both the miR-30 RNA and the miR-30 morpholino. [score:1]
Cyclopamine was dissolved in DMSO and both wild type and miR-30 morpholino injected embryos were treated with DMSO as a negative control (A–D) which had no effect on embryo development when compared to untreated. [score:1]
Constructs were injected either alone (A,C,E) or with the miR-30 duplex RNA (B,D,F). [score:1]
Cyclopamine rescue yielded miR-30 morpholino treated embryos with more obvious chevron-shaped somites (Fig. 5K). [score:1]
The effect of miR-30 knockdown was compared to the effect of Hh pathway overactivation by injection of dnPKA mRNA [47]. [score:1]
Coinjection of dnPKA and miR-30 RNAs also demonstrates elevated ptc1 levels (Fig. 4E). [score:1]
Significantly lower levels of GFP were detected in the GFP-PTS+miR-30 embryos (p<0.0001) (Fig. 3B) and GFP protein levels remained unchanged in embryos injected with GFP- noUTR with or without miR-30 (p = 0.305) (Fig. 3E–F). [score:1]
These mRNAs were injected into zebrafish embryos either singly or in combination with the miR-30 duplex sequence. [score:1]
Table S1 Number of muscle cell types in miR-30 morpholino treated embryos. [score:1]
Fertilized one-cell zebrafish embryos were injected with 6 ng miR-30 morpholino in 1 nl (TGCATTATTACTCACGGTACGAGTTTGAGTC), 50 pg of miR-30 duplex RNA and 50 pg in vitro-transcribed capped GFP mRNAs. [score:1]
The somite structure of (E) wild type (H) miR-30 morpholino and (K) miR-30 morpholino and cyclopamine treated embryos. [score:1]
To achieve phenotypic rescue of the miR-30 morpholino phenotype cyclopamine was used at a concentration range of 100 µM-6.25 µM. [score:1]
The experiments conducted in this study demonstrate a critical interaction between the miR-30 family and smoothened mRNA in the developing zebrafish embryo. [score:1]
[1 to 20 of 95 sentences]
2
[+] score: 55
The backbone of miR-30 is one of the most frequently used microRNA sequence to direct the processing and maturation of shRNA, because its stem sequence could be substituted with exogenous sequences that match different target genes and to produce 12 times more mature shRNAs than simple hairpin designs [12], [14], and its ability to prevent interferon-stimulated gene expression and associated off-target effects and toxicity in cultured cells and mouse brain [17], [28]. [score:8]
To test whether the mir-shRNA [EGFP-ORF] was able to knockdown the EGFP expression, we first microinjected the EGFP-ORF sensor (containing the targeted site within its ORF; Figure 2C, top) with either miR-30e precursor control or mir-shRNA [EGFP-ORF] into one-cell stage embryos (Figure 2D). [score:6]
Efficient inhibition of EGFP expression by zebrafish mir-30e precursor in vivo. [score:5]
0006125.g001 Figure 1Efficient inhibition of EGFP expression by zebrafish mir-30e precursor in vivo. [score:5]
Efficient Knockdown of Reporter Gene In Vivo by Mir-shRNAIt has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:4]
Coinjection of in vitro synthesized capped pri-miR-30e mRNAs and sensor EGFP mRNAs containing two tandem perfectly complementary target sites (2×PT for miR-30e binding) in its 3′UTR (EGFP-2×PT [mir30e]; Figure 1B) into one-cell stage embryos, resulted in a striking decrease of both EGFP fluorescence and proteins (Figure 1C, D, right panels). [score:3]
Here, we report that multiple copies of small hairpin RNA (shRNA) are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA). [score:3]
It has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:3]
As a control, injection of miR-155 did not have any effects on the expression of EGFP-2×PT [mir30e] (Figure 1B–D, left panels). [score:3]
In contrast, injection of miR-30e precursor control had no detectable effects on EGFP expression (Figure 2E–I, left panels). [score:3]
The result suggests that the 409 bp of pri-miR-30e precursor contains flanking sequence capable of directing the production of functionally mature miR-30e in vivo. [score:2]
In combination with a natural backbone of the primary miR-30 microRNA (miRNA), higher amounts of synthetic shRNAs can be produced from the pol III promoter than from the simple hairpin design [12]. [score:1]
We therefore used miR-30e precursor as a backbone in the following experiments. [score:1]
We first identified zebrafish homologues of mammalian miR-30 and miR-155 genes based on their sequence identity (data not shown), and cloned both zebrafish pri-miR-30e (409 bp) and pri-miR-155 (447 bp) genomic precursor sequences into the pCS2 [+] vector (Figure 1A. [score:1]
The precursor sequences of zebrafish mir30e (409 bp) and mir155 (447 bp) were cloned from the genomic DNA of Tubingen adult fish into the pCS2 [+] vector. [score:1]
The resultant construct mir-shRNA [EGFP-ORF] contained the same sequence (including a di-nucleotide bugle [17]) as the native miR-30e precursor, except that the strand of the mir-30 hairpin stem has been replaced with the 22 nt-long sequences complementary to EGFP open reading frame (ORF) at the position of 121–142 (Figure 1A and Figure 2A). [score:1]
The 68-bp mir30e stem-loop region was replaced with a linker sequence containing two Bbs I sites using two-step PCR. [score:1]
The capped EGFP sensor mRNAs were co -injected with either miR-30e or miR-155 precursor mRNAs into one-cell stage embryos (B, bottom). [score:1]
The stem-loop region of miR-30e precursor was replaced with chemically synthesized shRNA [EGFP-ORF] oligonucleotides containing the same sequence as the miR-30e stem-loop, except that the miR-30e hairpin stem was changed to the sequence that was complementary to the open reading frame (ORF) of EGFP transcript. [score:1]
Compared with the mir-30e, injection of the capped miR-155 mRNAs showed less efficiency to knockdown the EGFP sensor containing 2×PT for miR-155 binding (EGFP-2×PT [mir155]) (data not shown). [score:1]
We next replaced the miR-30e stem-loop sequence with a 24 nt-long linker containing two Bbs I restriction sites that allowed insertion of a synthesized shRNA [EGFP-ORF] stem-loop and preserved all flanking sequences intact (Figure 2A). [score:1]
[1 to 20 of 21 sentences]
3
[+] score: 10
mmu-miR30 -based plasmids: Artificial miRNA expressing the dre-miR30 cassette was amplified from pCS2-mir-linker (gift from Dr Min Deng) 7. Primers used (52_Forw_miR30 and 53_Rev_miR30) were designed to add BamHI in 5′ of the dre-miR30 cassette, as well as BglII and XhoI in 3′, thus allowing easy chaining of dre-miR30 (Fig. 1). [score:2]
According to the cell-specific observations above, miR218 and miR155 backbones led to potent global knockdown with ∼74 and 83% reduction in red fluorescence, respectively, while the miR30 backbone reduced fluorescence modestly by ∼33%. [score:2]
However, the backbone based on dre-miR30 achieved only weak red fluorescence inhibition compared with mmu-miR155 or hsa-miR218 backbones. [score:2]
The sequence used in our experiments may not be compatible with the pri-dre-miR30 sequence. [score:1]
Both the PCR product and pME -RNAi651 plasmid were digested by BamHI and XhoI to exchange the mmu-miR155 backbone with the dre-miR30 one (plasmid was purified before ligase reaction). [score:1]
pME -RNAi651 is based on a mmu-miR155 backbone, pME -RNAi661 on a dre-miR30 backbone and pME -RNAi671 on a hsa-miR218 backbone. [score:1]
Nonetheless, pri-dre-miR30 still presents limitations in terms of use. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 7
ShRNA expression vector was constructed in the following way: The modified mir30e backbone (Dong et al., 2013) was firstly synthesized with PacI-NheI sites for cloning target shRNA oligos. [score:5]
This modified mir30e precursor was cloned into pmini-Tol2-UAS-tdTOM vector downstream of tdTOM ORF to generate pmT2-UAS-tdTOM-mir30e-ShRNA (SG1180-A). [score:1]
We designed shRNAs employing the primary miR-30 backbone. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 6
Other miRNAs from this paper: dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-210, dre-mir-214, dre-mir-219-1, dre-mir-219-2, dre-mir-221, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-21-1, dre-mir-21-2, dre-mir-25, dre-mir-101a, dre-mir-103, dre-mir-107a, dre-mir-122, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-126a, dre-mir-129-2, dre-mir-129-1, dre-mir-130b, dre-mir-130c-1, dre-mir-130c-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-135c-1, dre-mir-135c-2, dre-mir-140, dre-mir-142a, dre-mir-142b, dre-mir-150, dre-mir-152, dre-mir-462, dre-mir-196a-2, dre-mir-196b, dre-mir-202, dre-mir-203b, dre-mir-219-3, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-mir-455-1, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-135b, dre-mir-135a, dre-mir-499, dre-mir-738, dre-mir-429b, dre-mir-1788, dre-mir-196c, dre-mir-107b, dre-mir-455-2, dre-mir-222b, dre-mir-126b, dre-mir-196d, dre-mir-129-3, dre-mir-129-4
Since this was also observed in the chicken embryo for mir-30e and mir-219 [64] and in Drosophila melanogaster where several miRNA* are present at physiologically relevant levels and associate with Argonaute proteins, it is likely that both strands are loaded into RISC and may guide target repression. [score:3]
For example, dre-miR-30e, dre-miR-199, dre-miR-219 and dre-miR-462 showed similar bias for both mature and star strands. [score:1]
Dre-miR-30e, dre-miR-199, dre-miR-219 and dre-miR-462 showed similar strand-bias towards both mature and star strands, suggesting that both strands may be incorporated into the RISC complex. [score:1]
Dre-miR-30e, dre-miR-199, dre-miR-219 and dre-miR-462 showed similar strand-bias of both mature and star strands. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 5
Other miRNAs from this paper: dre-mir-30a, dre-mir-30b, dre-mir-30c, dre-mir-30d
To further confirm the stmn4 MO -induced precocious elavl3 expression in dorsal midbrain, we utilized shRNA targeting the 3′ UTR of stmn4 (Fig. 2a) by employing the UAS-miR-30 backbone in combination with the Gal4-UAS system. [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 5
Alignments were carried out within miR-27, miR-30 and miR-181 family of zebrafish and human, respectively (Figure 7). [score:1]
Three miRNA families, miR-27, miR-30 and miR-181, were analyzed to determine gain and loss of miRNA family members and changes in their sequences (miRNA sequences were downloaded from miRBase). [score:1]
Sequence comparison of miR-27, miR-30 and miR-181 family members in zebrafish and human. [score:1]
miR-27, miR-30 and miR-181 family members in different lineages. [score:1]
Similar gene loss events were also observed in the miR-30 family in the lineage of teleosts. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 3
The mature miR-27b sequences containing the miR-30e stem-loop region [54] and the miR-27b targeting sequences (TS; 5′-TGCAGAACTTAGCCACTGTGAA-3′) and its mutant sequence (mTS; 5′-TGCAGAACTTAGCCACAAAGAA-3′) were synthesized as DNA oligonucleotides (Invitrogen, Waltham, MA, USA). [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 2
This mo del uncovered novel miRNAs and protein coding genes not considered before in the HOS such as miR-34a and miR-30 and their targets. [score:2]
[1 to 20 of 1 sentences]
11
[+] score: 2
miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
[1 to 20 of 1 sentences]