sort by

2 publications mentioning dre-mir-99-2

Open access articles that are associated with the species Danio rerio and mention the gene name mir-99-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 14
e Heat maps profiles for change in expression of selected miRNAs Table 2 Cold shock -induced differential expression of known miRNAs miRNA Mature miRNA sequence Fold change Up-regulated miRNAs  Dre-mir-29b-1 UAGCACCAUUUGAAAUCAGUGU 3.90  Dre-mir-99-2 AACCCGUAGAUCCGAUCUUGUG 2.04  Dre-mir-99-1 AACCCGUAGAUCCGAUCUUGUG 1.79  Dre-mir-92a-2 UAUUGCACUUGUCCCGGCCUGU 1.75  Dre-mir-2184 AACAGUAAGAGUUUAUGUGCU 1.73 Down-regulated miRNAs  Dre-mir-737 AAUCAAAACCUAAAGAAAAUA −1.71  Dre-mir-9-2 UCUUUGGUUAUCUAGCUGUAUGA −1.75  Dre-mir-363 AAUUGCACGGUAUCCAUCUGUA −1.79  Dre-mir-125b-2 UCCCUGAGACCCUAACUUGUGA −1.91  Dre-mir-199-1 CCCAGUGUUCAGACUACCUGUUC −2.79 After eliminating miRNAs whose expression might be changed due to development process during incubation (control vs normal). [score:14]
[1 to 20 of 1 sentences]
2
[+] score: 8
The three families we identified, miR-10, miR-99/100 and miR-196, are highly conserved and are dysregulated in a number of human diseases. [score:4]
The miR-10, miR-99/100 and miR-196 families are some of the most common Hox gene -targeting miRNAs yet described. [score:3]
The predicted miRNAs found in our search comprise four families, specifically: let-7, miR-99/100, miR-196a/b and miR-10a/b family members. [score:1]
[1 to 20 of 3 sentences]