sort by

27 publications mentioning dre-mir-133b

Open access articles that are associated with the species Danio rerio and mention the gene name mir-133b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 333
Our in vivo findings (at 24 hpf of zebrafish development) showed that the exposure to cocaine produced a decrease in miR-133b expression in a manner similar to 3'UTR-Pitx3 microinjection, which increased the Pitx3 transcription level (due to a negative regulation between them), and hence the expression of the target genes of Pitx3 was altered, producing an upregulation of th, dat and drd2a in whole-mount embryos. [score:12]
miR-133b Alters the Expression of pitx3 and its Target GenesThe aim of microinjection of 3'UTR-Pitx3 was to increase the excess of targets that interact with miR-133b and thus silence its expression. [score:9]
Cocaine Affects the Expression of miR-133b and pitx3 and its Target GenesThe Pitx3 transcription factor, expressed in the CNS and also in muscle [51], [52], is required for the development and survival of midbrain dopaminergic neurons [67], [68] and miR-133b has been associated with Pitx3 regulation, binding specifically to 3'UTR-Pitx3 (in mammals [31] and zebrafish [69]). [score:9]
This alteration of the expression of miR-133b induced an increase of pitx3 and its targets genes: th, dat, drd2a, while the expression of drd2b was decreased (it should be noted that cocaine produced an increase of its expression in the encephalon). [score:9]
Effects of miR-133b on the Expression of pitx3 and its TargetsmiR-133b acts as a negative regulator of the expression of the Pitx3 transcription factor by binding to its 3'UTR region [31]. [score:8]
Likewise, pitx3 expression, the miR-133b target, showed a significant upregulation, reaching a level that almost doubled the control group (Fig. 7B). [score:8]
Our findings support the existence of a negative regulation between miR-133b and pitx3 in zebrafish embryos, since a downregulation of miR-133b produced an upregulation of pitx3, dat, th and drd2a. [score:8]
Cocaine Affects miR-133b and pitx3 ExpressionPitx3 activates the expression of different genes such as th, dat and drd2 in dopaminergic neurons [25] and it also induces miR-133b transcription by RNA polymerase II and miRNA binding to 3'UTR-Pitx3 [31], inducing mRNA degradation and blocking the translation of Pitx3. [score:7]
Since these genes are targets of the transcription factor Pitx3, and this latter is also target of miR-133b, it is likely that cocaine via miR-133b modulates the expression of dopamine receptors, dat and th. [score:7]
The aim of microinjection of the target of miR-133b (3′UTR-Pitx3) was to increase the excess of targets that interact with miR-133b and thus silence its expression. [score:7]
The present study using zebrafish embryos suggests that by altering the expression of miR-133b, cocaine affects the expression of its target gene pitx3. [score:7]
Although the expression of miR-133b was less intense in the CNS at 24 and 48 hpf as compared to its expression in somites, this level of expression could be sufficient to play a relevant role in the development and function of the CNS in zebrafish. [score:7]
In the present study, when embryos were injected with the target of miR-133b (the 3′UTR-Pitx3 sequence) we found a downregulation of miR-133b (Fig. 7A) levels and an increase in pitx3 (Fig. 7B), th and drd2a (Fig. 7C and E, respectively) transcript levels. [score:6]
In the CNS a decrease in miR-133b, induced by cocaine, at 48 hpf produced an upregulation of its target gene: the transcription factor pitx3. [score:6]
miR-133b Alters the Expression of pitx3 and its Target Genes. [score:5]
Cocaine Affects the Expression of miR-133b and pitx3 and its Target Genes. [score:5]
The Pitx3 transcription factor, expressed in the CNS and also in muscle [51], [52], is required for the development and survival of midbrain dopaminergic neurons [67], [68] and miR-133b has been associated with Pitx3 regulation, binding specifically to 3'UTR-Pitx3 (in mammals [31] and zebrafish [69]). [score:5]
The miR-133b target gene Pitx3 is expressed in the CNS and also in muscle [51], [52]. [score:5]
Thus, the changes produced by cocaine in the expression of miR-133b could alter the development of the dopaminergic system, at the periphery and in the CNS, during embryonic development of the zebrafish. [score:5]
Pitx3 activates the expression of different genes such as th, dat and drd2 in dopaminergic neurons [25] and it also induces miR-133b transcription by RNA polymerase II and miRNA binding to 3'UTR-Pitx3 [31], inducing mRNA degradation and blocking the translation of Pitx3. [score:5]
Expression of miR-133b, pitx3 and its targets genes (th, dat, drd2a and drd2b) at 24 and 48 hpf in whole-mount embryos (A–F), in the head (G–L) and at the periphery (M–R). [score:5]
Expression of miR-133b, pitx3 and its target genes (th, dat, drd2a and drd2b) in zebrafish embryos microinjected with the Pitx3-3'UTR sequence at 24 hpf. [score:5]
0052701.g007 Figure 7Expression of miR-133b, pitx3 and its target genes (th, dat, drd2a and drd2b) in zebrafish embryos microinjected with the Pitx3-3'UTR sequence at 24 hpf. [score:5]
The aim of microinjection of 3'UTR-Pitx3 was to increase the excess of targets that interact with miR-133b and thus silence its expression. [score:5]
miR-133 also underwent changes in the CNS that were important enough to produce changes in the expression of its target gene: the transcription factor Pitx3. [score:5]
0052701.g004 Figure 4Expression of miR-133b, pitx3 and its targets genes (th, dat, drd2a and drd2b) at 24 and 48 hpf in whole-mount embryos (A–F), in the head (G–L) and at the periphery (M–R). [score:5]
Expression of miR-133b (A), pitx3 (B) and its targets genes th, dat, drd2a and drd2b (C, D, E and F, respectively) at 24 hpf in whole-mount embryos. [score:5]
Effects of cocaine on the expression levels of miR-133b, pitx3 and its targets. [score:5]
Figure S1Doses effects of cocaine on the expression levels of miR-133b, pitx3 and its targets. [score:5]
Effects of miR-133b on the Expression of pitx3 and its Targets. [score:5]
Our aim was to determine the possibility that cocaine, via miR-133b, affects the expression of pitx3 and its target genes (th, dat and dopamine receptors) in zebrafish embryos. [score:5]
Moreover, it has been described that miR-133b regulates the maturation and function of midbrain dopaminergic neurons within a negative feedback loop including Pitx3 [31], where the Pitx3 transcription factor induces miR-133b expression and miR-133b decreases Pitx3 activity post transcriptionally [31]. [score:4]
The higher expression of miR-133b in somites indicates that it must play a crucial role in the proper development of skeletal muscle [70]. [score:4]
Thus, to determine the expression of miR-133b both in the CNS and at the periphery we decapitated the embryos at 24 and 48 hpf of embryonic development. [score:4]
Likewise, the cocaine -induced changes of miR-133b and its target gene, pitx3, depend on the stages of zebrafish embryonic development. [score:4]
This new insight into the actions of cocaine opens a door to the design and synthesis of specific drugs that could inhibit the activity of miR-133b to prevent or compensate the effects of cocaine and avoid possible damages in the development of the CNS in the embryos exposed to cocaine. [score:4]
In mammals, Pitx3 transcription is regulated by miRNA 133b (miR-133b), which inhibits the differentiation of midbrain dopaminergic neurons from embryonic stem cells [31]. [score:4]
In this sense our findings lead us to propose a possible mechanism of cocaine action, on the regulation of pitx3 and its target genes, through miR-133b (Fig. 8). [score:4]
miR-133b acts as a negative regulator of the expression of the Pitx3 transcription factor by binding to its 3'UTR region [31]. [score:4]
This indicates that miR-133b is regulating the actions of pitx3 and its target genes in zebrafish embryos. [score:4]
The effect of cocaine on the expression of miR-133b in muscle is difficult to determine (D and F). [score:3]
The expression of miR-133b is mostly found in the skeletal muscles (A, C and E) and to a lesser extent in the CNS (A, C and E). [score:3]
We analyzed the distribution of the miR-133b expression pattern in control and cocaine-exposed embryos at 24 (Fig. 5) and 48 hpf (Fig. 6). [score:3]
A dorsal view of miR-133b (C) shows that this miRNA is mainly present in somites, although it is difficult to determine whether cocaine affects the expression of miR-133b in this area (D). [score:3]
Expression of miR-133b (A), pitx3 (B), th (C), dat (D), drd2a (E) and drd2b (F) in zebrafish embryos microinjected with the Pitx3-3'UTR. [score:3]
The exposure of zebrafish embryos to cocaine did not reveal evident changes by ISH in the expression of miR-133b in the brain and at the periphery at 24 and 48 hpf. [score:3]
In the control embryos studied at 48 hpf, miR-133b was strongly expressed in skeletal muscle and the pectoral fins, while in the brain it was more localized in the midbrain and hindbrain, following the pathway of the median longitudinal fasciculus (Fig. 6 A, C and E). [score:3]
The qPCR experiments showed that cocaine decreased the expression of miR-133b at 24 and 48 hpf in the head (Fig. 4G) (P<0.001 and P<0.05, respectively). [score:3]
Considering the importance of miR-133b and Pitx3 in the differentiation of dopaminergic neurons, we studied the cocaine -induced changes in the expression of miR-133b and pitx3 at 24 and 48 hpf by qPCR. [score:3]
In the present study, both microinjection of 3′UTR-Pitx3 sequence (which simulates the silencing of miR-133b) and exposure to cocaine, in embryos of zebrafish, induced a decrease of miR-133b expression. [score:3]
In order to determine the expression (qPCR) of miR-133b both in the CNS and at the periphery, we decapitated the embryos at 24 and 48 hpf with the aim of analysing the changes of miR-133b in the CNS and the periphery. [score:3]
We observed by qPCR that miR-133b was expressed in higher amounts at the periphery (Fig. 4M) than in the CNS (4G). [score:3]
miR-133b expression in skeletal muscle seemed to be unaffected by exposure to cocaine at both 24 and 48 hpf. [score:3]
Cocaine produced a decrease in miR-133b expression in the midbrain and hindbrain (Fig. 6B, D and F). [score:3]
It is remarkable to see that cocaine induced, in whole-mount embryos, different effects on the expression of miR-133b at 24 and 48 hpf (increase and decrease, respectively). [score:3]
0052701.g008 Figure 8In the present study, both microinjection of 3′UTR-Pitx3 sequence (which simulates the silencing of miR-133b) and exposure to cocaine, in embryos of zebrafish, induced a decrease of miR-133b expression. [score:3]
miR-133b is weakly expressed in the diencephalon, midbrain, and hindbrain. [score:3]
In a lateral view of miR-133b expression (A), the miRNA is mainly localized in somites and weakly in the brain (diencephalon, midbrain, MHB and hindbrain). [score:3]
The expression of miR-133b was also analysed in the encephalon of zebrafish embryos (the embryos were decapitated, see Material and Methods) and at the periphery (the rest of the body after decapitation). [score:3]
At the periphery, the expression of miR-133b was decreased at 24 and 48 hpf (Fig. 4M) (P<0.01; P<0.05). [score:3]
These results, at 24 and 48 hpf, indicate that a decrease of miR-133b in the CNS induce an increase of its putative target gene, pitx3. [score:3]
First, for the dopamine receptors - drd1, drd2a, drd2b and drd3- we studied the effect of cocaine at the 8, 16, 24, 48 and 72 hpf of embryonic developmental stages to see whether it produced any change, then, we chose 24 and 48 hpf stages to analyse the pitx3 transcription factor and miR-133b since both stages are essential in embryonic development, 24 hpf determines the end of the segmentation period, during which the CNS (Central Nervous System) is being formed and differentiated, and 48 hpf defines the end of organogenesis [80]. [score:3]
We observed that miR-133b was expressed in higher amounts at the periphery (Fig. 4M) than in the CNS (4G). [score:3]
Cocaine Affects miR-133b and pitx3 Expression. [score:3]
At 48 hpf we observed that the expression of miR-133b was more intense in the region of somites, unlike at 24 hpf, where it was less marked. [score:3]
1.5 µM cocaine HCl induced substantial changes in gene expression of most genes studied (miR-133b, pitx3, dat, th, drd2a and drd2b) in comparison to the control group. [score:3]
These results are similar to those found by Sánchez-Simón et al. [69] in the regulation of pitx3 by miR-133b. [score:2]
These results lead us to propose that cocaine via miR-133b may affect the development and the function of the dopaminergic system. [score:2]
Moreover, the action of cocaine on miR-133b, related to the development of the dopaminergic system, indicates that this miRNA could play an important role in drug addiction. [score:2]
In this investigation we report that embryos exposed to cocaine in the blastula stage (5 hpf) of zebrafish embryos show alterations in the expression of the dopamine receptors (drd1, drd2a, drd2b and drd3) and pitx3; these changes caused by cocaine would be via miR-133b. [score:1]
In our case, cocaine exposure at 24 hpf produced a slight decrease in the diencephalon and MHB (Fig. 5B), whereas no clear changes were observed in the somites of miR-133b (Fig. 5B and D) due to exposure to the drug. [score:1]
At 24 hpf, in control group, miR-133b was strongly detected in somites along the tail and also in the brain; mainly in the diencephalon (Fig. 5A and C). [score:1]
These results are consistent with our ISH analyses of miR-133b (Fig. 5A and 6A). [score:1]
This was left overnight at 64°C (in the case of miR-133b) and 65°C (in the case of dopamine receptors) to hybridize. [score:1]
Cocaine Decreases miR-133b Levels in the Encephalon and at the Periphery Body. [score:1]
Our results working with whole-mount embryos (Fig. 4A) revealed that cocaine reduced the number of miR-133b molecules at 24 and 48 hpf with respect to the control group (P<0.01; P<0.05). [score:1]
miR-133b distribution in zebrafish embryos at 24 hpf by whole-mount ISH. [score:1]
miR-133b distribution in zebrafish embryos at 48 hpf by whole-mount in situ hybridization (ISH). [score:1]
To our knowledge, this is the first time that the spatial distribution of miR-133b has been studied in zebrafish. [score:1]
These results were consistent with our ISH analyses of miR-133b (Fig. 5A and 6A). [score:1]
Thus, in order to silence miR-133b, 750 pg of the DNA sequence of 3′UTR-Pitx3 was microinjected into the one-cell stage of zebrafish. [score:1]
The decrease of miR-133b (Fig. 4A) was correlated with an increase of pitx3 at 24 hpf, surprisingly the same effects were not seen at 48 hpf; a decrease of pitx3 was found (Fig. 4B). [score:1]
Then, the digoxigenin-labeled oligoprobe was added (10 ng/µl) and hybridization was carried out with the miR-133b riboprobe (miRCURY LNA™ microRNA Detection Probes for in situ hybridization, Exiqon) or dopamine receptor riboprobe. [score:1]
The ABI Prism 7300 detection system (Applied Biosystems) was used to amplify the different genes under the following conditions: 10 min at 95°C followed by 36 cycles of 15 s at 95°C and 1 min at 55–60°C (ef1α and β-actin, 55°C ; drd3, 56°C ; th, pitx3 and miR-133b, 57°C ; drd2a, 59°C ; drd1 and drd2b, 60°C). [score:1]
Effects of Cocaine on the Distribution of miR-133b in Embryos at 24 and 48 hpf. [score:1]
Possible mechanism of action of cocaine through miR-133b in zebrafish embryos. [score:1]
Accordingly, the major changes observed in our qPCR experiments (Fig. 4A) occurred at the periphery (Fig. 4M), although miR-133 also displayed changes in the CNS to a lesser extent (Fig. 4G). [score:1]
[1 to 20 of 87 sentences]
2
[+] score: 292
We searched several databases, including TargetScan Fish, miRBase and microcosm Targets, and identified potential targets containing complementary regions to miR-133b seed sequences in their 3′-UTR. [score:7]
Similar to the adverse function of miR-133b during M-cell regeneration process, it inhibits fin regeneration in adult zebrafish by targeting Mps1 (Yin et al., 2008) and negatively regulates zebrafish heart regeneration via restricting injury -induced cardiomyocyte proliferation (Yin et al., 2012). [score:6]
Fascin-1 overexpression and miR-133b downregulation in the progression of gastrointestinal stromal tumor. [score:6]
M-cells expressing only rhodamine-dextran (3,000 molecular weight, Invitrogen) (named None) seemed to have similar outgrowths to those expressing non-sense duplex (named Negative Control), while both explicated a slight increase, even though without significant discrepancy, compared to M-cells in experimental group (expressing miR-133b duplex), not matter at 1 dpa or 2 dpa (1 dpa: None: 142.3 ± 19.0 μm, n = 26 fish; Negative control: 140.0 ± 15.8 μm, n = 24 fish; miR-133b duplex: 102.7 ± 17.6 μm, n = 23 fish; 2 dpa: None: 464.8 ± 40.5 μm, n = 20 fish; Negative control: 396.7 ± 32.5 μm, n = 22 fish; miR-133b duplex: 373.4 ± 33.9 μm, n = 23 fish; Figure S1). [score:6]
Tppp3 expression was down-regulated by miR-133b at the mRNA level. [score:6]
Figure 1Vector -based overexpression of miR-133b by single-cell electroporation inhibits M-cell regeneration. [score:5]
By single-cell electroporation and a vector -based expression system, we successfully altered the expression of miR-133b specifically in the M-cell. [score:5]
Overexpression of miR-133b in single M-cell inhibits axon regeneration. [score:5]
Video S2 In vivo imaging of mitochondrial movement in miR-133b overexpressed group Axonal mitochondrial motility along M-cell axon overexpressing miR-133b. [score:5]
To examine whether miR-133b overexpression had any effects on mitochondrial dynamics, we co -transfected pUAS-mito-EGFP and pUAS-mcherry-miR-133b driven by the expression of pCMV-GAL4 via single-cell electroporation at 4 dpf and visualized the movement of mitochondria at 6 dpf via in vivo time-lapse confocal imaging, through which stable vs. [score:5]
Collectively, our findings identify a cell intrinsic mechanism involving miR-133b and its direct target tppp3 in regulating axon regeneration in vivo. [score:5]
To testify the ability of this plasmid in blocking miR-133b activity in zebrafish, we examined the expression of a known miR-133b target gene, mps1 (Yin et al., 2008), in 10 hpf zebrafish embryos injected with a combination of pUAS-mCherry-8 × miR-133b sponge and pCMV-GAL4-VP16 at one-cell stage. [score:5]
Error bars represent S. E. M. We firstly detected the mRNA level of tppp3 in miR-133b overexpressed or miR-133b sponge expression zebrafish embryos. [score:5]
Error bars represent S. E. M. We firstly detected the mRNA level of tppp3 in miR-133b overexpressed or miR-133b sponge expression zebrafish embryos. [score:5]
Expression of miR-1, miR-133a, miR-133b and miR-206 increases during development of human skeletal muscle. [score:4]
Since regulation of axonal microtubule (MT) dynamics influence axon regeneration (Sengottuvel and Fischer, 2011; Bradke et al., 2012; Hur et al., 2012), and pharmacological stabilization of MTs by paclitaxel or related molecules promotes axon regeneration in vitro and in vivo (Hellal et al., 2011; Sengottuvel et al., 2011; Ruschel et al., 2015), we hypothesized that miR-133b might regulate axon regeneration through directly modulating tppp3 mRNA in vivo. [score:4]
miR-133b acts as a tumor suppressor and negatively regulates FGFR1 in gastric cancer. [score:4]
miR-133b regulates the MET proto-oncogene and inhibits the growth of colorectal cancer cells in vitro and in vivo. [score:4]
Figure 2Knockdown of miR-133b by expressing miR-133b sponge facilitates M-cell regeneration. [score:4]
We further uncovered a novel regeneration -associated gene, tppp3, as a direct target of miR-133b in this process. [score:4]
We regulated the expression of miR-133b at single-cell level and severed axons by two-photon laser axotomy, which only damaged axon at a minuscule area, separating the intracellular and intercellular factors influencing axon regeneration in vivo and reflecting the intrinsic role of miR-133b during axon regeneration process. [score:4]
We have further identified tppp3 as the target of miR-133b in regulating axonal regeneration in zebrafish M-cell (Figure 7). [score:4]
Error bars represent S. E. M. To test whether knockdown of tppp3 might cause regenerative defects similar to miR-133b overexpression, we used designed shRNAs to silence tppp3 based on the miR-ShRNAs system. [score:4]
Error bars represent S. E. M. To test whether knockdown of tppp3 might cause regenerative defects similar to miR-133b overexpression, we used designed shRNAs to silence tppp3 based on the miR-ShRNAs system. [score:4]
Our qRT-PCR results showed that the mRNA level of tppp3 in 10 hpf zebrafish embryos overexpressing miR-133b was lower than that in control (Figure 3B), while tppp3 mRNA level was increased in embryos expressing miR-133b sponge compared with that in control (Figure 3C). [score:4]
By counting and analyzing mitochondria in M-cells, we identified that the percentage of motile mitochondria was much lower in miR-133b overexpressing conditions than in control (Figure 6B, Video S2), and this reduction was more significant in retrograde than in anterograde directions (Total: control: 20.31 ± 2.34%, n = 11 fishes vs. [score:4]
MiR-133b Promotes neurite outgrowth by targeting RhoA expression. [score:4]
In summary, our study identifies miR-133b as cell-intrinsic inhibitor of axon regeneration, which performs its function, at least partly, via regulating tppp3 (Figure 7). [score:4]
Thus, as we focus on miR-133b's role during regeneration process of M-cells in our experiments, which has been mature during our experimental time window, we believe our conclusion of miR-133b inhibiting M-cell axon regeneration does not conflict with the conclusions mentioned above. [score:3]
Consistent with our axonal regeneration data, motile mitochondria rate and mitochondrial velocity were both decreased accompanying worsening regenerative capability upon miR-133b overexpressing. [score:3]
To figure out whether miR-133b has an effects on mitochondrial motility or not, we performed an experiment to visualizing mitochondrial motility in miR-133b overexpression group, as mitochondrial dynamics has shown to have a positive correlation with regenerative capability (Zhou et al., 2016; Xu et al., 2017). [score:3]
Consistent with the effects of miR-133b sponge on axonal regeneration (Figure 4A), overexpression of tppp3 in M-cell significantly increased the total regeneration length (Regenerative length: control: 255.6 ± 37.2 μm, n = 27 fish vs. [score:3]
Moreover, mitochondrial velocity in the miR-133b overexpression group was slower in both transport directions compared with that in control, though in retrogra dely moving mitochondria it did not reach significance (Total: control: 0.501 ± 0.018 μm/s, n = 54 mitos from 11 fishes vs. [score:3]
Second, we uncover a previously unknown molecular target of miR-133b, tppp3, and show that it is a critical cell-intrinsic factor in promoting axon outgrowth. [score:3]
To explore the role of miR-133b in M-cell axon regeneration, we performed cell type-specific overexpression. [score:3]
Figure 3Sequence alignment and the show that miR-133b targets tppp3. [score:3]
Error bars represent S. E. M. Next, we used this vector system to overexpress miR-133b in individual M-cells at 4 dpf via single-cell electroporation. [score:3]
We constructed a plasmid containing 8 bulged target sites complementary to miR-133b in 3′-UTR of mCherry reporter gene driven by the UAS promoter (Figure 2A). [score:3]
The mps1 mRNA level increased in zebrafish larvae expressing the miR-133b sponge, suggesting that it could reduce miR-133b activity in zebrafish (Figure 2B). [score:3]
First, using Mauthner cells as the mo del, we demonstrate, through both loss and gain-of-function experiments, a critical cell-intrinsic role of miR-133b in inhibiting axon regeneration. [score:3]
Tppp3 is an in Vivo target of miR-133b. [score:3]
With another two miRNAs (miR-23a and miR-21) having different effects on axon regeneration, we reported that overexpression of miR-133b specifically reduced the regenerative length in M-cell (Figure 7). [score:3]
MiR-133b acts as a tumor suppressor and negatively regulates TBPL1 in colorectal cancer cells. [score:3]
Our qRT-PCR data showed that miR-133b in experimental group (EG) was more than three times of that in control, indicating that our constructed plasmid UAS-mCherry-miR-133b could successfully drive overexpression of miR-133b (Figure 1C). [score:3]
Error bars represent S. E. M. Next, we used this vector system to overexpress miR-133b in individual M-cells at 4 dpf via single-cell electroporation. [score:3]
To overexpress miRNAs, a construct containing pri-miR-133b/pri-miR-23a/pri-miR-21 was made by amplifying a genomic region containing the miR-133b/miR-23a/miR-21 precursor. [score:3]
To further verify the specific role of miR-133b in regulating axon regeneration, we overexpressed another two miRNAs, miR-23a and miR-21, with the same assay as mentioned above. [score:3]
Our imaging data showed that most M-cells in control could regenerate a certain length, while M-cell overexpressing miR-133b could hardly regenerate [control: 243.7 ± 32.9 μm, n = 33 fish vs. [score:3]
Also, miR-133b can enhance axon regeneration and promote functional recovery after SCI in zebrafish and mice by targeting RhoA (Yu et al., 2011; Theis et al., 2017). [score:3]
As for the divergence between our results and the results showing miR-133b can promote regeneration after SCI by targeting RhoA, one plausible explanation might be related to the different modes of injury. [score:3]
Since miR-133b has been proved to reduce the activated microglias/microphoges at injury site (Theis et al., 2017), it is possible that miR-133b enables the neurons a higher regenerative capacity after SCI by, to some degree, playing a significant role in diminishing the inhibitory extracellular milieu. [score:3]
miR-133b overexpression (OE): −14.8 ± 20.7 μm, n = 16 fish] (Figures 1E,F). [score:3]
We constructed a vector containing dre-pri-miR-133b sequence (miRBase Accession: MI0001994) in the 3′-UTR of mCherry, which conveniently marked the cells that expressed the miR-133b (Figure 1A). [score:3]
Since researches on dre-miRNAs often explore their roles in different processes using miRNA duplex, to further verify miR-133b's role on axon regeneration, we also expressed the miR-133b duplex in M-cell by single-cell electroporation. [score:3]
With a combination of gain-of-function and loss-of-function experiments, we demonstrated that miR-133b inhibits the regenerative process in M-cells. [score:3]
Collectively, these results demonstrate that blocking the function of miR-133b promotes M-cell axon outgrowth, which is a phenotype that is complementary to overexpressing miR-133b in M-cells. [score:3]
MiR-133b, the miRNA of interest in this study, has been wi dely reported to participate in many regulatory processes. [score:2]
In our study, tppp3 gain or loss-of-function produced a regulation on axon outgrowth mimicking the effect of miR-133b loss or gain-of-function. [score:2]
miR-185 and miR-133b deregulation is associated with overall survival and metastasis in colorectal cancer. [score:2]
Regulation of zebrafish heart regeneration by miR-133. [score:2]
The direct interaction between miR-133b and tppp3 mRNA was confirmed by. [score:2]
Together, our results suggest that miR-133b is an important cell intrinsic regulator of mitochondrial dynamics during M-cell axon regeneration. [score:2]
Error bars represent S. E. M. Next, we examined the consequence of knocking down miR-133b activity in axon regeneration. [score:2]
Error bars represent S. E. M. Next, we examined the consequence of knocking down miR-133b activity in axon regeneration. [score:2]
Figure 7Working mo del of how miR-133b involved in regulating axonal regeneration of M-cell. [score:2]
At the same time, our data do not exclude possibility that there is another gene that is regulated by miR-133b in this process too. [score:2]
A feedback circuit between miR-133 and the ERK1/2 pathway involving an exquisite mechanism for regulating myoblast proliferation and differentiation. [score:2]
Morphine regulates dopaminergic neuron differentiation via miR-133b. [score:2]
Normal midbrain dopaminergic neuron development and function in miR-133b mutant mice. [score:2]
Finally, we reveal that miR-133b negatively regulates mitochondrial dynamics, which further supports the negative effects of miR-133b on axon regeneration. [score:2]
Lentiviral delivery of miR-133b improves functional recovery after spinal cord injury in mice. [score:1]
When the seed sequence in the 3′-UTR of tppp3 was mutated, we found no difference in EFGP signals between non-sense RNA duplex and miR-133b RNA duplex (negative control: 100.0 ± 11.9%, n = 10 fish vs. [score:1]
MicroRNA miR-133b is essential for functional recovery after spinal cord injury in adult zebrafish. [score:1]
miR-133b OE: 0.396 ± 0.017 μm/s, n = 41 mitos from 13 fishes; retro: control: 0.535 ± 0.052 μm/s, n = 15 mitos from 11 fishes vs. [score:1]
miR-133b OE, P = 0.0001; antero: control vs. [score:1]
Combining with the results of axon outgrowth in miR-133b sponge group, we identified the negative role of miR-133b during M-cell regenerative process. [score:1]
miR-133b sponges: 835.2 ± 131.4 μm, n = 20 fish; Figure 2E). [score:1]
Impairment of miR-133b function in M-cell promotes axon outgrowth. [score:1]
This result was consistent with the results obtained by vector -based system, indicating that miR-133b has negatively effects on M-cell axon regeneration. [score:1]
M-cell was labeled with mito-EGFP and mCherry-miR-133b. [score:1]
We focused on one gene, tppp3, which has a single binding site for miR-133b at its 3′-UTR. [score:1]
miR-133b sponges: 296.7 ± 40.5 μm, n = 20 fish; Figure 2D). [score:1]
However, when a synthesized duplex of miR-133b was co -injected, EGFP signals were dampened by almost 50% with no detective changes in mCherry signals (negative control: 100.0 ± 7.0%, n = 10 fish vs. [score:1]
miR-133b OE, P = 0.0063; antero: control vs. [score:1]
In this study, we examined the role of miR-133b in M-cell regeneration. [score:1]
miR-133b duplex: 43.5 ± 3.7%, n = 10 fish; Figures 3D,E). [score:1]
miR-133b OE: 7.91 ± 1.92%, n = 13 fishes; retro: control: 7.10 ± 1.11%, n = 11 fishes vs. [score:1]
Fgf -dependent depletion of microRNA-133 promotes appendage regeneration in zebrafish. [score:1]
miR-133b duplex: 117.1 ± 12.0%, n = 10 fish; Figures 3F,G). [score:1]
To knock down miR-133b, we used the miRNA “sponge” assay, which presents an efficient and permanent miRNA loss-of-function by imperfectly binding to a miRNA of interest (Cohen, 2009). [score:1]
Together, these results indicate that the reduction of M-cell regenerative capability by miR-133b is specific and cell intrinsic. [score:1]
miR-133b OE, P = 0.0640; retro: control vs. [score:1]
What's more, we found that this tendency seems shrunk at 2 dpa, which might be due to a degradation of miR-133b duplex. [score:1]
While the mechanism on this finding needs to be further explored, this result that miR-133b reduces mitochondrial dynamics, at least, further reinforces our conclusion that miR-133b diminishes regenerative capacity in M-cells. [score:1]
miR-133b OE, P = 0.0038. [score:1]
In addition, it has been proved that miR-133b enhance neurite outgrowth in cultured neurons (Lu et al., 2015; Theis et al., 2017). [score:1]
miR-133b OE, P = 0.1081, [**] P < 0.01, [***] P < 0.001. [score:1]
miR-133b OE: 2.79 ± 0.77%, n = 13 fishes; Figure 6C). [score:1]
However, miR-133b exhibits different effects on different tissue regeneration. [score:1]
The plasmid UAS-mCherry-miR-133b was co -injected with pCMV-Gal4-VP16 into one-cell zebrafish embryos. [score:1]
Although we did not detect the change at protein level of tppp3 because of the limitation of antibody performing in zebrafish, it did not cast much doubts on the credibility that tppp3 is a downstream gene of miR-133b in vivo. [score:1]
The role of dre-miR-133b in regeneration appears context -dependent in different organs (Yin et al., 2008, 2012; Yu et al., 2011; Xin et al., 2013). [score:1]
In addition, tppp3 corresponds perfectly to nucleotides 2–7 of the mature miR-133b in zebrafish (Figure 3A). [score:1]
When applicable, 10 μM miR-133b duplex was added as an experimental group, while 10 μM non-sense duplex was added as a control. [score:1]
To determine whether loss of miR-133b in single M-cells could also regulate its axon regeneration, we needed an assay that could achieve long-term miRNA loss-of-function. [score:1]
In conclusion, our results indicate that tppp3 is a downstream gene of miR-133b in vivo. [score:1]
The plasmid pUAS-mcherry-8 × miR-133b sponge was designed by ourselves and then constructed by Sangon (Shanghai, China). [score:1]
miR-133b OE: 0.4294± 0.034 μm/s, n = 14 mitos from 13 fishes; Figure 6D). [score:1]
miR-133b OE: 10.70 ± 2.14%, n = 13 fishes; antero: control: 13.21 ± 1.89%, n = 11 fishes vs. [score:1]
miR-133b OE, P < 0.0001; control vs. [score:1]
To further verify the validity of our vector -based system, we also delivered the miR-133b duplex into M-cell via single-cell electroporation. [score:1]
Given the effects of miR-133b on tppp3 expression and the role of miR-133b in neurite outgrowth, we next planned to investigate the effects of gain or loss-of-function of tppp3 on regenerative axon growth. [score:1]
miR-133b OE: 0.404 ± 0.015 μm/s, n = 55 mitos from 13 fishes; antero: control: 0.488 ± 0.015 μm/s, n = 39 mitos from 11 fishes vs. [score:1]
Moreover, we cannot totally deny that miR-133b might play a role in differentiation in cultured neurons and miR-133b has been reported to promote differentiation process via ERK 1/2 pathway (Sanchez-Simon et al., 2010; Feng et al., 2013). [score:1]
miR-133b sponges: 4.50 ± 0.83 μm, n = 20 fish; Figure 2F). [score:1]
These mRNAs were co -injected into one-cell zebrafish embryos, in the presence of miR-133b RNA duplex or non-sense duplex (GenePharma). [score:1]
miR-133b OE, P = 0002; retro: control vs. [score:1]
MiR-133b modulates M-cell regenerative capacity via diminishing tppp3 mRNA level, a novel gene that regulates axon outgrowth. [score:1]
[1 to 20 of 118 sentences]
3
[+] score: 135
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
While there is little known about a direct role of mir133b on the development of the craniofacial cartilage, these results suggest that it is involved in both muscle and neuronal development, both of which can influence, either directly or indirectly, formation of the craniofacial complex. [score:6]
Potential Mir23b and Mir133b functions and targetsHere we have shown that Mir23b is expressed in the developing face of mouse embryos and in the head of zebrafish embryos and that its overexpression in zebrafish embryos results in ectopic cartilage structures in the viscerocranium. [score:6]
To examine whether the pattern of expression of mir23b and mir133b was also conserved between mouse and zebrafish embryos, we examined expression of both miRNAs in 30–72 hpf embryos. [score:5]
mir133b has the potential to target the same set of myogenic targets in zebrafish, but only Histone Deacetylase 4 contains a seed sequence for mir133b. [score:5]
In these abnormal contexts, MIR133b in human cervical carcinoma targets EGFR and FGFR1, similarly acting as a tumor suppressor (Namløs et al., 2012). [score:5]
Expression of MiR133b was not observed in the maxilla or palatal shelves, suggesting that the expression observed by miRNA-seq might reflect presence of other tissue in dissected samples. [score:5]
From our expression analysis, it is plausible that overexpression of Mir133b may lead to changes in facial muscle which affects subsequent viscerocranium development. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
At 30 hpf, mir133b expression was also observed in the head region (around the eye and portions of the brain; Figure 6A), though expression was weaker than that of mir23b. [score:5]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafishTwo potential methods for assessing function of genes in zebrafish are over -expression and gene inactivation. [score:5]
Other groups have performed miRNA expression profiling of the developing mouse orofacial region using microarrays (Mukhopadhyay et al., 2010) and have found similar differential expression across time for miRNAs that included Mir133a and Mir133b. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
Mir133b is strongly expressed in facial muscles, including the masseter (ma), and in the muscles of the eye (em; D) and tongue muscle (t; E–I) Expression is not observed in the palatal shelves (ps; E,F). [score:4]
While we have not determined the numbers of dopaminergic neurons in zebrafish in which mir133b is over-expressed, we do see specific defects in cartilage differentiation, including hypoplasia of the ethmoid plate and specific gaps or missing cartilage in the viscerocranium, suggesting that mir133b may act non-cell autonomously to regulate cartilage differentiation. [score:4]
Expression of mir23b and mir133b is conserved in zebrafish facial structuresBased on analysis of mir140 action, miRNA function during facial development is also present in zebrafish embryos. [score:4]
Further, like the comparison between MiR23b and MiR24.1, expression of MiR206 was much weaker than the expression observed for MiR133b. [score:4]
Our in situ hybridization and overexpression analyses provide evidence that Mir23b and Mir133b are important regulators of craniofacial development. [score:4]
Zebrafish mir133b is expressed in the midbrain at low levels and regulates pitx3 to control dopaminergic neuron differentiation (Sanchez-Simon et al., 2010). [score:4]
Figure 6Expression of mir133b in zebrafish embryos. [score:3]
In addition, we have shown that over -expression of mir23b and mir133b results in changes in craniofacial cartilage morphogenesis. [score:3]
As in 30 hpf embryos, mir133b was strongly expressed in the somites (Figure 6E). [score:3]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafish. [score:3]
By 72 hpf, mir133b expression was observed in trunk muscles (Figure 6F), otic vesicle and heart (Figure 6C). [score:3]
Expression of mir23b and mir133b is conserved in zebrafish facial structures. [score:3]
More roles have been ascribed for FGF signaling in craniofacial development, with FGFR1 specifically linked to skeletal dysplasias and craniosynostosis in both humans and mice, suggesting a mechanism by which Mir133b may regulate craniofacial development (Moosa and Wollnik, 2016). [score:3]
In addition, Mir133b is down-regulated in several cancers, including muscle rhabdomyosarcoma, osteosarcoma, and prostate, colorectal and gastric cancers (Namløs et al., 2012; Qin et al., 2012; Mo et al., 2013). [score:3]
Morphine regulates dopaminergic neuron differentiation via miR-133b. [score:2]
Expression of MiR23b and MiR133b in mouse facial structures at E12.5. [score:2]
Figure 4Expression of Mir133b in mouse facial muscles at E12.5. [score:2]
In contrast, mice in which Mir133b has been inactivated have normal dopaminergic neuron numbers and normal PITX3 protein levels (Heyer et al., 2012) even though Mir133b can target the Pitx3 message. [score:2]
Mir133b is clustered in the genome with Mir 206.1, which does not have the same seed sequence but is predicted to bind some of the same targets in mouse including Histone Deacetylase 4, DNA Polymerase α, and Connexin43 (Anderson et al., 2006; Chen et al., 2006; Kim et al., 2006; Goljanek-Whysall et al., 2012). [score:2]
Normal midbrain dopaminergic neuron development and function in miR-133b mutant mice. [score:2]
When using LNA probes against Mir23b and Mir133b, robust expression was present in a variety of facial structures, though overall background staining on the sections was high (Supplemental Figure 2). [score:2]
Potential Mir23b and Mir133b functions and targets. [score:2]
Like MiR23b, MiR133b was also strongly expressed in the craniofacial region at E12.5. [score:2]
Like Mir23b, Mir133b exists in a cluster with Mir206, which had a similar pattern of expression to that of Mir133b. [score:2]
Thirty-three micrometers of MiR23b duplex (5′—3′), 6.25 μM of MiR133b (5′—3′), and 33 μM of standard control miRNA (5′- CTTACCTCAGTTACAATTTATA -3 duplexed with 5′- TAAATTGTAACTGAGGTAAGAG-3′) were injected into single cell zebrafish embryos and allowed to grow for 6 dpf. [score:1]
While Crispr-Cas9 -mediated gene inactivation is underway, we began our analysis of potential function by injecting 1–2 cell zebrafish embryos with duplex RNA for MiR23b and MiR133b examining cartilage development at 6 dpf. [score:1]
Whole-mount in situ hybridization analysis with a digoxigenin-labeled probe against mir133b at 30–72 hpf. [score:1]
MicroRNA-133b is a key promoter of cervical carcinoma development through the activation of the ERK and AKT1 pathways. [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 41 sentences]
4
[+] score: 90
In our findings, the downregulation of miRs-133a and b started at 24 h and peaked at 2–3 days post the surgery, whereas miR-1 peaked already at 24 h. Thus, we suggest that the early expression of is necessary to contrast the caspase protein translation in all injured hearts (due to miR-133 downregulation). [score:11]
The miR-133 expression is regulated by extracellular signal-regulated kinase 1/2 activation and is inversely correlated with vascular growth [23], since it is strongly related to FGF-receptor expression [24]. [score:7]
a Expression of miR-1; b expression of miR-133a; c expression of miR-133b. [score:7]
Most of these genes were demonstrated to be, directly or indirectly, a target of miR-1 and miR-133a and miR-133b (ref. [score:5]
At 7 days after amputation (dpa), the level of miR-133 expression in the ventricle of the heart was lower than control individuals and suggested that miR-133 is an endogenous inhibitor of EC proliferation [25]. [score:5]
miR-133b is instead involved in the transition from endothelial to mesenchymal cells by blocking directly the expression of connective tissue growth factor (CTGF) In accordance with this finding, we have explored the possibility that the activation could be already between the 1 and 2 dpa. [score:4]
In endothelial cells, and thus also in endocardial cells, it was recently proven that the miR-133b is directly responsible for the repression of the connective tissue growth factor (CTGF) translation [51]. [score:4]
Particularly, miR-1, miR-133a and miR-133b have been detected in 1 dpa in different data sets of down-regulated transcripts. [score:4]
In zebrafish, transgenic-inducing elevation of miR-133 levels after injury provoked an inhibition of myocardial regeneration, while the knockout of miR-133 showed increased CM proliferation [30]. [score:4]
In particular, miR-1 and miR-133b have undergone a significant downregulation at 1 dpa. [score:4]
Xu C The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, and caspase-9 in cardiomyocytesJ. [score:3]
In zebrafish, miR-133 antagonism that occurred during FGF-receptor inhibition has accelerated the regeneration of appendage or heart damage through increased proliferation within the regeneration blastema [25]. [score:3]
Hearts were harvested from 24 h to 30 dpa, and analysed for miRs (miR-1 and miR-133a/miR-133b) by qPCR to know how their expression levels vary at different stages of regeneration. [score:3]
Also miR-133b has downregulated significantly already at 24 hpa (EPCs, 0.62 ± 0,096; RC 0.530 ± 0.010; P < 0.001) as compared to controls (EPCs, 1 ± 0.535; RC, 1.024 ± 0.062). [score:3]
Yang L Hou J Cui XH Suo LN Lv YW MiR-133b regulates the expression of CTGF in epithelial-mesenchymal transition of ovarian cancerEur. [score:3]
For example, among the target genes of miR-133, the genes for fibroblast growth factor receptor 1 (FGFR1) and protein phosphatase-2A-catalytic subunit (PP2AC, including Ppp2ca and Ppp2cb) seem to be promising to understand the possible induction. [score:3]
Again, the miR-133b could be a key miR because of its direct control on the CTGF protein, necessary to regulate the transition in endocardial cells from epithelial to mesenchymal elements. [score:3]
miR-1 is the most conserved miRNA during evolution [16], whereas a gene duplication probably has formed the miR-133 gene, which in fact is positioned in the same genetic locus of the miR-1 [31] and, in mammals, it regulates transcription of myoD [19]. [score:2]
Feng Y A feedback circuit between miR-133 and the ERK1/2 pathway involving an exquisite mechanism for regulating myoblast proliferation and differentiationCell Death Dis. [score:2]
Previous studies indicated that during myogenesis, the signalling pathway of MyoD are regulated by both miR-133a and miR-133b [24]. [score:2]
Even at 7 days, the expression of miR-133b is less than approximately 50% when compared to the control (0.574 ± 0.068) and it starts to grow until the regenertion is complete. [score:2]
Fig. 7 A proposed schematic mo del of miR-1 and miR-133 actions in blocking the FGF -dependent transduction pathway in the cells involved in cardiac regeneration: CMs, fibroblast, EPCs and endocardial cells. [score:1]
There are two members in the miR-133 family: miR-133a and miR-133b. [score:1]
Particularly, miR-133 has two isoforms, miR-133a and miR-133b, and their activity seems to be similar at the moment [23]. [score:1]
miR-133b (Fig.   1c) decreases by about 42% at 1 dpa (0.657 ± 0.00). [score:1]
miR-1/miR-133 are mainly implicated in post lesion in mammals as well as in zebrafish 14, 17, 22, 23. [score:1]
Recently, an involvement of miRs has been shown by the array analysis at 7 days post operation dpa [25], and in particular of miR-133 [31]. [score:1]
[1 to 20 of 27 sentences]
5
[+] score: 69
Situation Reference Translational regulation of utrophin:, related to Duchenne muscular dystrophy, mediates the repression, and confirms repression of miR-206Basu et al. (2011) Formation of homologue clusters with miR-206: dysregulation roleNohata et al. (2012) Upregulation during late stages of human, fetal muscle developmentKoutsoulidou et al. (2011) When downregulated, may have important implications in pathogenesis of essential hypertensionYu et al. (2011a) Co-regulation of with miR-206, novel biomarkers of Th 17-type immune reactionsHaas et al. (2011) Desregulation of is associated with overall survival and metastasis in colorectal cancerAkcakaya et al. (2011) Increase of in mouse pectoralis muscle: regulation by myostatinRachagani et al. (2010) Upregulated in mouse liver by tyrosine hormoneDong et al. (2010) MiR-133b is upregulated on head and neck cancerLiu et al. (2009) Mir-133b is regulated by endurance exercise in human skeletal muscleNielsen et al. (2010) Mir-133b is a biomarker of myocardial infectionD’Alessandra et al. (2010) MiR-133b targets prosurvival molecules MCL-1 and BCL262 in lung cancerCrawford et al. (2009) Table 2 Downregulation of in different cancers. [score:27]
MiR-133b can participate in both systems, depending whether it is overexpressed (act as oncogenes, repressing tumor suppressor genes), or underexpressed (functioning as a tumor suppressor, negatively regulating oncogenes). [score:9]
Morphine Modulates the Expression of miR-133b Target Pitx3. [score:5]
Addition of naloxone effectively abolished the morphine -induced changes in the expression levels of miRNA-133b, pitx3, th, and dat, suggesting that morphine regulates the level of the dopaminergic genes via the control of by activating zfMOR. [score:4]
Morphine regulates miR-133b expression in hippocampal neurons. [score:4]
The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70, and caspase-9 in cardiomyocytes. [score:3]
Morphine Modulates the Expression of miR-133b. [score:3]
MiR-133b can act as an oncogene or as a tumor suppressor, making the interaction between this miRNA and morphine crucial in the control of a defined cancer pathology. [score:3]
The Role of zfMOR in Morphine-Induced Regulation of miR-133b Pathway. [score:2]
Morphine-Induced Regulation of the miR-133b Pathway Depends on ERK1/2 Activity. [score:2]
Role of the DORs in morphine -induced regulation of miR-133b pathway. [score:2]
miR-133b and the Delta Opioid Receptor. [score:1]
Three different miR-133 sequences are known: miR-133a-1,-2, and. [score:1]
miR-133b. [score:1]
Zebrafish as a Mo del to Study the Relationship between miR-133b and Morphine. [score:1]
miR-133b and the Dopaminergic System. [score:1]
[1 to 20 of 16 sentences]
6
[+] score: 43
By targeting the same transcription factors that regulate miR-1/miR133 expression and control cardiac progenitor cell proliferation and differentiation, miR-1 and miR-133 fine-tune multiple nodes of the genetic networks that control cardiac muscle differentiation. [score:6]
miR-1 and miR-133 are for the most part co-expressed and contribute to the establishment of a muscle specific gene expression program while having somewhat antagonistic roles in the control of proliferation and differentiation [94]. [score:5]
Interestingly, both miR-1 and miR-133 have been shown to be negative regulators of the same cardiogenic transcription factors that, in addition to promoting their expression, activate protein-coding genes involved in muscle function (e. g., sarcomere genes) [34, 92, 94, 95]. [score:4]
These include marked changes in the cardiac contractibility apparatus, with a switch from fetal specific to adult isoforms of several sarcomeric proteins, and the silencing of smooth muscle proteins expressed early during cardiomyocyte differentiation, which appears to be regulated by both miR-1 and miR-133. [score:4]
An older study using knock-outs for miR-133a-1 and miR-133-a2 with removal of the selection markers also supports the redundancy of these genes during heart development, as only the double knock-out mice displayed detectable cardiac phenotypes [115]. [score:4]
In the embryonic heart, expression of the miR-1/miR-133 locus is transcriptionally regulated by the myogenic transcription factors SFR, MYOCD and MEF2. [score:4]
Thus, the available data support the view that miR-1 and miR-133 play a critical synergistic role in the suppression the cardiac fetal gene program and enforcement of adult skeletal muscle properties, driving cardiac maturation. [score:3]
A third paralogous gene cluster encodes the miR-206/miR-133b pair, which is only expressed in the skeletal muscle. [score:3]
Figure 5 Transcriptional regulatory networks controlled by miR-1 and miR-133 during cardiac muscle differentiation. [score:2]
In mammals, the duplicated miR-1/miR-133 locus is transcribed into a bicistronic transcript that is regulated by multiple independent upstream intronic enhancers. [score:2]
For the miR-133 d KO animals, albeit a modest reduction in viability is observed during embryonic development, along with a high number of VSD related deaths soon after birth (day P0/P1), about half of the mice hearts developed with a relatively normal morphology [115]. [score:2]
Interestingly, the lack of miR-1/miR133 seems to affect multiple cellular pathways required for this transition. [score:1]
Indeed, while miR-1 is acknowledged to trigger differentiation of both mouse and human embryonic stem (ES) cells into the cardiomyocytes, miR-133 was found to act in partial opposition to miR-1, by promoting muscle progenitor expansion and preventing terminal differentiation [82]. [score:1]
Interestingly, miR-133 is also conserved in Drosophila, but it is not clustered with the single dm-miR-1 gene. [score:1]
Chen J. F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation Nat. [score:1]
[1 to 20 of 15 sentences]
7
[+] score: 38
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 MiRNAs are small, 19–23 nucleotide non-coding RNAs that function as post-transcriptional repressors of gene expression, either through messenger RNA (mRNA) degradation or translational repression (Bartel, 2009). [score:14]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 Using microarray analysis, the expression profile of murine miRNAs in the developing lip and PS were analyzed from E10 to E14 (Mukhopadhyay et al., 2010; Warner et al., 2014). [score:12]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 CS, CC, JV: Conception of the work, drafting of the manuscipt, revision of the manuscript, final approval of the manuscript. [score:10]
However, several additional miRNAs were identified including miR-23b and miR-133b. [score:1]
MicroRNA profiling during craniofacial development: potential roles for Mir23b and Mir133b. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 37
Furthermore, the expression of CTGF in reactive astrocytes was significantly increased through the down-regulation of miR-133b (Xin et al., 2013), while CTGF expression by reactive astrocytes is associated with matrix deposition and glial scar formation in human cerebral infarction (Schwab et al., 2000). [score:8]
Connective tissue growth factor (CTGF) is a target of miR-133, and it is down-regulated by miR-133 (Duisters et al., 2009). [score:6]
These findings suggest that down-regulation of miR-133b may be responsible, at least in part, for DEGs specific to mammalian SCI. [score:4]
For example, the expression of miR-133b was increased at 1 and 7 days after SCI in zebrafish and knockdown of miR-133b significantly attenuated axonal regeneration (Yu et al., 2011). [score:4]
Consistent with this, 19 genes identified as mammalian SCI-specific DEGs at 3 dpi are also predicted to be targets of miR-133b (Wong and Wang, 2015). [score:3]
It has been demonstrated that the expression of miR-133b was increased and decreased after SCI in zebrafish (Yu et al., 2011) and rat (Liu et al., 2009), respectively. [score:3]
In contrast, the expression of miR-133b was transiently increased at 4 h after SCI and dramatically decreased at 1 day after SCI in rat (Liu et al., 2009). [score:3]
There are several targets of miR-133b that are involved in regeneration after SCI (Vajn et al., 2013). [score:3]
miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
MicroRNA miR-133b is essential for functional recovery after spinal cord injury in adult zebrafish. [score:1]
[1 to 20 of 10 sentences]
9
[+] score: 22
This causes increased expression of miR-133 target genes such as cx43 (Yin et al., 2012; Banerji et al., 2016). [score:5]
Although rescue using Tg(hsp70:miR-133sp [pd48]) supports our mo del that cx43 is functionally activated downstream of Esco2 and Smc3, because miR-133 has multiple targets (Yin et al., 2008), we cannot rule out the possibility that a different target gene is responsible for the rescue. [score:5]
In this line, heat shock induces expression of the miR-133 target sequence fused to EGFP and therefore sequesters the miR-133. [score:5]
Knocking down miR-133 (which targets cx43 for degradation) via the ‘sponge’ transgene (three miR-133 binding sites) results in the increase of cx43 levels (Yin et al., 2012). [score:4]
Regulation of zebrafish heart regeneration by miR-133. [score:2]
Fgf -dependent depletion of microRNA-133 promotes appendage regeneration in zebrafish. [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 18
Specifically, miRNA-seq analysis identified 5 up-regulated cardiac specific miRNAs (miR-29a, miR-29b, miR-133, miR-193 and miR-223) previously identified for being regulators of cardiac development and homeostasis (Fig.   2). [score:6]
Targetscan software [50] predicted about 51 common targets for miR-29a, miR-29b, miR-133, miR-193 and miR-223 (Fig.   2C, middle panel). [score:5]
Table  2, miR-29a, miR-29b, miR-133, miR-193 and miR-223 were selected among the 10 most up-regulated miRNAs associated to the aging heart 43, 47– 49. [score:4]
Venn diagrams depicting the distribution of miR-133, miR-193, miR-29a/b, miR-223 predicted targets (middle panel). [score:3]
[1 to 20 of 4 sentences]
11
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Three of the 107 genes are previously identified targets of the downregulated miRNAs, including mmp14, a known target of miR-133 [64], mmp9 (targeted by miR-204 and miR-338) and timp2 (targeted by miR-24 and miR-204). [score:12]
Recently, zebrafish appendage regeneration studies have revealed two differentially regulated miRNAs, miR-133 [27] and miR-203 [28], as essential regulators of caudal fin regeneration. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 15
Other miRNAs from this paper: dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-210, dre-mir-214, dre-mir-219-1, dre-mir-219-2, dre-mir-221, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-21-1, dre-mir-21-2, dre-mir-25, dre-mir-30e-2, dre-mir-101a, dre-mir-103, dre-mir-107a, dre-mir-122, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-126a, dre-mir-129-2, dre-mir-129-1, dre-mir-130b, dre-mir-130c-1, dre-mir-130c-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133c, dre-mir-135c-1, dre-mir-135c-2, dre-mir-140, dre-mir-142a, dre-mir-142b, dre-mir-150, dre-mir-152, dre-mir-462, dre-mir-196a-2, dre-mir-196b, dre-mir-202, dre-mir-203b, dre-mir-219-3, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-mir-455-1, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-135b, dre-mir-135a, dre-mir-499, dre-mir-738, dre-mir-429b, dre-mir-1788, dre-mir-196c, dre-mir-107b, dre-mir-455-2, dre-mir-222b, dre-mir-126b, dre-mir-196d, dre-mir-129-3, dre-mir-129-4
Indeed, deletion of miR-1 altered regulation of cardiogenesis, electrical conduction and cell cycle of cardiomyocites, and miR-133 plus miR-1 regulate cardiac hypertrophy, as their over expression inhibits it. [score:7]
Dre-miR-133 expression was higher in muscle and dre-miR-430 showed higher expression in developmental samples. [score:6]
Interestingly, dre-miR-133b and dre-miR-133c were mainly detected in muscle and were not present in the heart. [score:1]
Dre-miR-133b and dre-miR-133c were mainly found in muscle and were not detected in the heart, while dre-miR-103 and dre-miR-122 were specific of gut/liver and dre-miR-150 and dre-miR-738 were enriched in gills and skin. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 12
For example, the main function of miR-1, miR-133 and miR-206 is inhibition of their target genes in order to promote differentiation of muscle cells [7]– [9]. [score:5]
The expressions of miR-1, miR-133, miR-206 and miR-208 in muscle cells are mainly controlled by MRFs, serum response factor (SRF) and MEF2 [12]– [15]. [score:3]
The target genes for zebrafish miR-1 and miR-133 are involved in actin -binding, as well as actin-related and vesicular transport [11]. [score:3]
Absence of miR-1 and miR-133 by co-injection of mopholinos (MOs) into embryos disturbs the organization of actin in muscle fibers. [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 10
A comparison of in regenerated versus un-injured zebrafish myocardium identified miR-133 as being specifically down-regulated during the period of cardiomyocyte proliferation and regeneration [7]. [score:4]
There are three genomic loci producing miR-133 with only-1 and-2 being expressed in the heart [15]. [score:3]
miR-133 is one of the most abundant cardiac miRNA [16] and is essential for normal cardiogenesis in mice, through regulation of serum response factor (SRF) [GenBank: NM_020493] dependent transcription [17]. [score:2]
Microarray miR-133 miR-590 miR-199a Cardiomyocyte Proliferation From late gestation, the majority of human cardiomyocytes cease proliferating due to either an absence of karyokinesis and/or cytokinesis [1– 3]. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 8
miR-133 acts in a negative feedback loop with serum response factor (SRF) to promote myoblast differentiation in vitro, and suppresses BMP2 -induced osteogenesis by targeting Runx2 [77], [78]. [score:5]
Of the 22 non-coding transcripts, we identified 2 differentially expressed genes in the proximal tail categorized within the miRNA precursor families miR-133 and miR-324. [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 5
Notably, cardiac-specific miR-1, miR-133, miR-208 and miR-499 were all suppressed by two or more orders of magnitude [34], [35], as were the stemness and cell cycle repressors miR-141 and miR-137 [36]; in contrast, the proliferative miRNAs, miR-222 [37], increased dramatically in MDCs, and miR-221 was undetectable in myocytes but highly expressed in MDCs (Figure 5D). [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 4
Other miRNAs from this paper: dre-mir-1-2, dre-mir-1-1, dre-mir-133a-2, dre-mir-133a-1
For the first time the research of Ceci et al., has demonstrated the early activation of the heart of zebrafish from 24 h (hrs) post injury due to downregulations of miR1, miR133a, and miR133b. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 3
However, the expression levels of miR-124-3p, miR-124-5p, miR-124-6-5p, miR-133a-3p, miR-133b-3p, miR-135b-3p, miR-135b-5p, miR-137-3p and some other miRNAs were rather low (Excel S1). [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
For example, miR-1 and miR-133 are specifically expressed in muscles. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 2
Regulation of zebrafish heart regeneration by miR-133. [score:2]
[1 to 20 of 1 sentences]
21
[+] score: 2
Additional data indicate that FGF and BMP signaling pathway interactions are regulated by negative feedback loops involving microRNAs, particularly miR-130 and miR-133 [48, 49]. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 1
Other miRNAs from this paper: dre-mir-133a-2, dre-mir-133a-1, dre-mir-133c
Fgfr1 control of growth rate is exerted by miR-133 mediation (Yin and Poss, 2008). [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
For instance miR-1 and miR-133, whose origin remounts to a common ancestor of Protostomia and Deuterostomia [25], were amongst the most conserved miRNAs (Table  2). [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Similarly reports suggest that linc-MD1 could interact with miR-133 and miR-135 and promote muscle differentiation [38]. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
The role of microRNAs in lower vertebrates with a known regenerative ability is gaining a lot of attention, with several recent studies identifying miRNAs associated with spinal cord repair (e. g., miR-125b in axolotl, miR-133b in zebrafish; [28, 29]) and appendage regeneration (e. g. miR-196 in axolotl tail, miR-203 in zebrafish fin; [30, 31]). [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
Chen J. -F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. -Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiationNat. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Yin VP Fgf -dependent depletion of microRNA-133 promotes appendage regeneration in zebrafishGenes Dev. [score:1]
[1 to 20 of 1 sentences]