sort by

5 publications mentioning dre-mir-146b

Open access articles that are associated with the species Danio rerio and mention the gene name mir-146b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 379
Expression levels of other known targets of miR-146 involved in innate immunity, such as irak1, traf6, irf5 and stat1, were not affected, but this was not unexpected since miRNAs can act by translational inhibition. [score:9]
MMP9 is not a predicted target gene of miR-146 in human or zebrafish, but human MMP9 was found to be down-regulated upon miR-146a/b overexpression in MDA-MB-231 breast cancer cells and in THP-1 macrophages [20, 52]. [score:8]
Combined knockdown of miR-146a and miR-146b does not have a major effect on pro-inflammatory gene expression during S. typhimurium infectionIn previous work, we observed that knockdown of a negative regulator of the immune response, the ptpn6 phosphatase gene, resulted in a hyperinduction of pro-inflammatory gene expression during S. typhimurium infection [39]. [score:8]
However, whereas knockdown of the ptpn6 gene caused hyperinflammation in zebrafish embryos [39], knockdown of miR-146 in the S. typhimurium embryo infection mo del had no major effect on pro-inflammatory gene expression or on the expression of transcriptional regulators and signal transduction components of known immune response mediators. [score:8]
The table lists the genes showing significantly up- or down-regulated expression due to S. typhimurium infection in embryos injected with a standard control morpholino or with a combination of morpholinos targeting miR-146a and miR-146b (experimental set-up shown in Figure 5A). [score:8]
Since another study had reported an inhibitory effect of miR-146a knockdown on leukocyte development at 1 dpf [38], we next analyzed the separate effects of miR-146a and miR-146b knockdown in more detail over a critical period of leukocyte development from 26 to 32 hpf. [score:7]
These data suggested that the miR-146 miRNAs function in a negative feedback pathway of TLR and cytokine signalling by targeting IRAK1 and TRAF6 mRNAs for down-regulation, a conclusion supported by recent analysis of miR-146a knockout mice [26]. [score:7]
In fact, one of the p53 pathway genes up-regulated by miR-146 knockdown, cdkn1a (p21), is an experimentally validated target of miR-146a in human [50]. [score:7]
The table lists the genes showing significantly up- or down-regulated expression in S. typhimurium-infected embryos under knockdown conditions of miR-146a and miR-146b in comparison with S. typhimurium-infected control embryos (experimental set-up shown in Figure 5A). [score:7]
The table lists the genes showing significantly up- or down-regulated expression under knockdown conditions of miR-146a and miR-146b in comparison with control embryos (experimental set-up shown in Figure 5A). [score:7]
Furthermore, we used morpholino knockdown to suppress the function of miR-146a and miR-146b and analyzed the effects of this down-regulation by RNA deep sequencing (RNAseq) of embryos infected with Salmonella typhimurium. [score:7]
146bMO2 positively affected miR-146a expression besides blocking miR-146b expression and caused developmental aberrations (J, K). [score:6]
Figure 3 The Traf6-MyD88 pathway is involved in up-regulation of miR-146a and miR-146b expression levels upon infection. [score:6]
In turn, knockdown of miR-146 itself had no major effects on the expression of known targets of MyD88-Traf6 signalling. [score:6]
Our results support the inhibitory function of miR-146 in lipid -mediated inflammatory responses and the proposed application as a therapeutic target. [score:5]
The miR-146a and miR-146b sequences are conserved between zebrafish and human as well as target sites in the 3′-UTR of mRNAs of innate immune pathway genes such as IRAK1 and TRAF6, which are experimentally validated targets of miR-146 [11, 26]. [score:5]
Our conclusion that myeloid development in zebrafish embryos is not inhibited by miR-146a or miR-146b deficiencies is in line with the phenotype of miR-146a knockout mice, which also were not impaired in myeloid differentiation but in fact showed hyperproliferation of myeloid cells leading to autoimmunity [26]. [score:5]
Embryos were injected with control morpholino (scMO) or with a combination of 146aMO1 and 146bMO1 (146a/bMOs) and infected with S. typhimurium or mock -injected with PBS as described in Figure 5. Gene expression of mmp9 was analyzed by qPCR and relative expression levels are shown with the mock control set at 1. The mmp9 induction level after S. typhimurium infection was significantly higher in miR-146a/miR-146b morphants than in control embryos, consistent with the results of (Additional file 4: Table S3). [score:5]
Consistent with a previous report proposing miR-146a as a negative regulator of LDL accumulation in human macrophages and a therapeutic target for atherosclerosis treatment [52], our results suggest a possible function of miR-146 in regulating apolipoprotein -mediated lipid transport under the inflammatory conditions of S. typhimurium infection. [score:5]
To study the pathway by which miR-146 expression is induced in zebrafish embryos upon infection we used embryos in which TLR signalling was disrupted by morpholino knockdown of traf6 or by mutation of myd88. [score:5]
The efficiency of the knockdown was confirmed by TaqMan qPCR analysis, showing that basal expression of miR-146a and miR-146b (Figure 4A,B) as well as their infection inducibility (Figure 2A-C) was reduced by morpholino treatments. [score:4]
Similar as under traf6 knockdown conditions, miR-146a and miR-146b were still infection-inducible in myd88 mutant embryos, but their expression levels were significantly higher in infected wild type siblings (Figure 3B). [score:4]
Both of the morpholinos designed for miR-146a (146aMO1 and 146aMO2) did not affect miR-146b expression, therefore showing specific knockdown of miR-146a only (Figure 4A,B). [score:4]
Click here for file Effect of S. typhimurium infection on gene expression in control embryos and under conditions of miR-146a and miR-146b knockdown. [score:4]
In conclusion, knockdown of miR-146a and miR-146b in zebrafish embryos did not have a strong effect on innate immunity signalling in the first 8 hours of the response to S. typhimurium infection, despite the increased expression of these miRNAs during this phase. [score:4]
By targeting components of TLR signalling, miR-146 has been shown to function as a negative regulator of the innate immune response in mammals [11, 26]. [score:4]
Increased mmp9 expression in S. typhimurium infection under knockdown conditions of miR-146a and miR-146b. [score:4]
However, one of the miR-146b morpholinos (146bMO1) showed knockdown of both miR-146a and miR146b expression (Figure 4A,B). [score:4]
However, in our analysis we found no evidence for an inhibitory effect of miR-146 deficiency on myeloid cell development. [score:4]
Click here for file Increased mmp9 expression in S. typhimurium infection under knockdown conditions of miR-146a and miR-146b. [score:4]
In the same experimental set-up, S. typhimurium infection of zebrafish embryos after knockdown of ptpn6 resulted in hyperinduction of mmp9 and a wide range of cytokines, other immune effectors genes, and transcriptional regulators of the immune response [39], while in the case of miR-146 knockdown only mmp9 was slightly higher induced. [score:4]
Several of these miRNAs were commonly up-regulated by both of the infection conditions, including miR-21 (mature miRNA and its star sequence), miR-29a, miR-29b, miR-146a, and miR-146b (Figure 1A). [score:4]
Combined knockdown of miR-146a and miR-146b does not have a major effect on pro-inflammatory gene expression during S. typhimurium infection. [score:4]
The combined knockdown of miR-146a and miR-146b in zebrafish embryos infected with S. typhimurium had no major effect on the expression of pro-inflammatory genes and transcription factors known to be downstream of the MyD88-Traf6 pathway. [score:4]
Figure 6 Increased infection-induction of apolipoprotein gene expression under conditions of combined miR-146a and miR-146b knockdown. [score:4]
Dysregulation of miR-146a and miR-146b has been observed in many types of malignant tumors and several studies implicate these miRNAs as metastasis suppressors [18- 23]. [score:4]
Click here for file Effect of miR-146a and miR-146b knockdown on gene expression during S. typhimurium infection. [score:4]
Click here for file Effect of miR-146a and miR-146b knockdown on gene expression in the absence of infection. [score:4]
Dysregulation of the miR-146 family has often been linked to inflammatory diseases and malignancies. [score:4]
For miR-146b we also did not observe an effect on leukocyte development with two different morpholinos targeting this miRNA. [score:4]
Notably, the effect of miR-146 knockdown was minor in comparison with knockdown analysis of ptpn6, which encodes a SH2-domain phosphatase that functions as a negative regulator of innate immunity [53, 54]. [score:4]
Only S. typhimurium-infected embryos were analyzed, since (Figure 5) showed an effect of miR-146 morpholinos on apolipoprotein gene expression levels in infected embryos but not in mock -injected controls. [score:3]
The IRAK1 and TRAF6 homologs of both zebrafish and human contain putative target sites for miR-146 in their 3′-UTRs, suggesting that miR-146 feedback control of TLR signalling is evolutionary conserved. [score:3]
In a microarray analysis of miRNA expression in zebrafish, both of the miR-146 family members, miR-146a and miR-146b, were found to be inducible by S. typhimurium and M. marinum infections. [score:3]
In agreement, we have previously shown that mmp9 induction by S. typhimurium infection is mediated by Traf6, which is a known target of miR-146 [11, 26, 36]. [score:3]
Besides cdkn1a, only one other gene, fibrinogen beta chain (fgb), showed an overlap with the predicted targets of zebrafish miR-146a and miR-146b in miRBase. [score:3]
MiR-146a and miR-146b knockdown does not affect leukocyte development in zebrafish embryos. [score:3]
Using a custom-designed microarray platform for miRNA expression we found that both members of the zebrafish miR-146 family, miR-146a and miR-146b, were commonly induced by infection of zebrafish embryos with Salmonella typhimurium and by infection of adult fish with Mycobacterium marinum. [score:3]
Therefore, it is likely that both the MyD88-Traf6 -dependent pathway and parallel MyD88-independent signalling routes contribute to the infection -induced expression of miR-146. [score:3]
This study reports on miR-146a and miR-146b as infection-inducible miRNAs in zebrafish, which has emerged as a mo del species for human disease. [score:3]
The S. typhimurium -induced expression levels of miR-146a and miR-146b were significantly lower in traf6 knockdown embryos compared to controls (Figure 3A). [score:3]
Figure 4 Knockdown of miR-146a and miR-146b does not affect leukocyte development. [score:3]
This analysis also demonstrated the specificity of morpholinos 146aMO1, 146aMO2, and 146bMO2 for their respectively target miRNAs, whereas 146bMO1 could not discriminate between the a and b forms of miR-146. [score:3]
To test this hypothesis, we studied the effect of the combination of miR-146a and miR-146b morpholinos on gene expression in infected and mock -injected embryos by RNA deep sequencing (RNAseq) (Figure 5A). [score:3]
Since miR-146 has also been proposed as a negative regulator of innate immunity [11], we hypothesized that miR-146 knockdown might have a similar effect. [score:3]
Several genes in the p53 pathway, including p53 itself, were up-regulated in miR-146 morphants as compared to controls under infected as well as non-infected conditions. [score:3]
To confirm the induction of these miR-146 family members we analyzed miR-146a and miR-146b expression by TaqMan qPCR analysis. [score:3]
By microarray analysis of miRNA expression in zebrafish we found that miRNAs of the miR-21, miR-29, and miR-146 families were commonly induced by infection of embryos with S. typhimurium and by infection of adult fish with M. marinum. [score:3]
Furthermore, miR-146 overexpression reduced intracellular LDL cholesterol content and secretion of IL6, IL8, and MMP9 via TLR4 -mediated signalling. [score:3]
Infection-inducible expression of miR-146a and miR-146b is affected by defects in signalling via the MyD88-Traf6 pathway. [score:3]
The specificity of miRNA inductions was analyzed with morpholinos (MO) targeting miR-146a (146aMO1) or miR-146b (146bMO1). [score:3]
For miR-146b, the first morpholino (146bMO1: 5′GACACCCTTGGAATTCAGTTCTCAA3′) also targets the guide strand, and the second morpholino (146bMO2: 5′CGTGGGCTGAATATAAAGCAGACAC3′) overlaps with both dicer cleavage sites and part of the star strand (Additional file 1: Figure S1B). [score:3]
In total we found 73 genes which were significantly up-regulated in miR-146 infection as compared to control infection. [score:3]
Target sites of miR-146a and miR-146b morpholinos on their respective miRNAs. [score:3]
Direct statistical comparison between the infected control and morpholino groups also showed a higher number of infection-regulated genes in miR-146 morphants (118 genes, Figure 5A). [score:3]
Click here for file Target sites of miR-146a and miR-146b morpholinos on their respective miRNAs. [score:3]
Here we report on a microarray study of miRNA expression, which showed that miR-146a and miR-146b are commonly induced by infection of zebrafish embryos with Salmonella typhimurium and by infection of adult fish with Mycobacterium marinum. [score:3]
Embryos were injected at the 1-cell stage with morpholinos targeting miR-146a (146aMO1 and 146aMO2) or miR-146b (146bMO1 and 146bMO2) or were injected with standard control morpholino (scMO). [score:3]
In contrast, apolipoprotein -mediated lipid transport emerged as an infection-inducible pathway under miR-146 knockdown conditions, suggesting a possible function of miR-146 in regulating lipid metabolism during inflammation. [score:3]
Figure 2 Expression of miR-146a and miR-146b is enhanced upon bacterial infections. [score:3]
While the overall knockdown effect observed in our was relatively minor, apolipoprotein -mediated lipid transport emerged as an infection-inducible pathway under miR-146 knockdown conditions. [score:3]
We focused our study on the miR-146 family, which is strongly linked with immune-related diseases in human. [score:3]
Human miR-146 family members are known as inflammation-inducible miRNAs involved in negative feedback regulation of Toll-like receptor (TLR) signalling. [score:2]
Only 68 genes were affected by knockdown of miR-146a and miR-146b, among which 5 genes are members of the p53 signalling pathway (Figure 5B, Additional file 2: Table S1). [score:2]
In addition, 3′-UTR luciferase reporter assays demonstrated that the TLR signalling intermediates IRAK1 and TRAF6 are potential targets of miR-146a and miR-146b [11]. [score:2]
Figure 5 Effect of combined miR-146a and miR-146b knockdown on the transcriptome response to S. typhimurium infection. [score:2]
We used S. typhimurium infection of zebrafish embryos, which results in strong pro-inflammatory gene induction, to analyze the knockdown effect of miR-146a and miR146b by. [score:2]
First, we analyzed the effect of combined knockdown of miR-146a and miR-146b at 2 dpf. [score:2]
Combined knockdown of miR-146a and miR-146b leads to increased infection-inducibility of apolipoprotein genes. [score:2]
Based on these results, we conclude that miR-146a and miR-146b are not required for leukocyte differentiation during zebrafish embryo development. [score:2]
Knockdown of miR-146a (A) and miR-146b (B) was confirmed by TaqMan qPCR. [score:2]
The combined morpholino knockdown of miR-146a and miR-146b led to slightly increased induction of this gene during S. typhimurium infection; however, this induction of mmp9 was not accompanied by a general hyperinduction of other pro-inflammatory markers in the. [score:2]
Furthermore, hyperinflammation in ptpn6 morphants impaired control of S. typhimurium infection [39], while miR-146 knockdown had no such effect (data not shown). [score:2]
This might reflect a non-specific effect of the miR-146 knockdown procedure, since morpholino effects on the p53 pathway are relatively common [40]. [score:2]
However, in our study of S. typhimurium infection in zebrafish embryos, miR-146 knockdown did not have a strong impact on the induction of proinflammatory genes. [score:2]
However, as miR-146 has been frequently linked with cancer, a direct effect on the p53 pathway cannot be excluded [18, 48, 49]. [score:2]
showed that under conditions of S. typhimurium infection, the expression levels of genes apoa1a, apoa4, apoba, apobb, apoc1l, apoeb were between 1.5- and 3- fold higher in miR-146 morphants compared with control embryos. [score:2]
Knockdown of traf6 and use of myd88 mutants demonstrated that the induction of miR-146a and miR-146b by S. typhimurium infection was affected by disruption of the MyD88-Traf6 pathway that mediates transduction of TLR signals and cytokine responses. [score:2]
In contrast, several members of the apolipoprotein gene family (apoa1a, apoa4, apoba, apobb, apoc1l, and apoeb) were infection inducible only under miR-146 knockdown conditions. [score:2]
In statistical comparison between uninfected and infected groups, the total number of infection-regulated genes was higher in miR-146 morphants (753 genes) than in control embryos (574 genes) (Figure 5A, Additional file 3: Table S2). [score:2]
For knockdown of miR-146a and miR-146b two morpholinos were used against each of them. [score:2]
Instead, RNA sequencing analysis showed that miR-146 knockdown led to an increased induction of six members of the apolipoprotein gene family in S. typhimurium-infected embryos. [score:2]
Other pro-inflammatory genes, such as interleukin 1b (il1b), CXCL and CCL family chemokines, and transcriptional regulators of the immune response were induced to similar levels in miR-146 morphants and controls. [score:2]
These results support that in the early response of zebrafish embryos to S. typhimurium infection Ptpn6 functions as a much stronger negative feedback regulator than miR-146. [score:2]
The LPS-inducible miR-146 family comprises two members in human, miR-146a and miR-146b, which are transcribed from different genes on chromosome 5 and 10, respectively [18]. [score:1]
Therefore, miR-146a and miR-146b of zebrafish may function in feedback control of TLR signalling, like the human and murine counterparts [11, 26]. [score:1]
Next, we analyzed miR-146a and miR-146b induction in a myd88 mutant line [37]. [score:1]
We used zebrafish at the embryo stage, when only innate immunity is functional, as an in vivo mo del to study the role of miR-146 during bacterial infection. [score:1]
Experimental conditions were the same as for infection with wild type S. typhimurium (miR-146a: single experiment, miR-146b: mean ± SEM of three replicates). [score:1]
miR-146a and miR-146b are induced during zebrafish infection with S. typhimurium and M. marinumMiRNAs of the miR-146 family, which emerged as infection-inducible miRNAs from the microarray analysis of embryonic and adult zebrafish, have previously been linked to the innate immune response in mammalian systems [11]. [score:1]
Therefore, we conclude that miR-146a and miR-146b induction is at least partially dependent on MyD88 and Traf6. [score:1]
miR-146a and miR-146b are induced during zebrafish infection with S. typhimurium and M. marinum. [score:1]
The stem-loop sequences of the zebrafish miR-146a and miR-146b homologs, dre-miR-146a (A) and dre-miR-146b (B) are shown with the miRNA guide strand in lower case. [score:1]
All miR-146 morpholinos could be used at a concentration of 0.75 mM without causing morphological defects, except146b-MO2, which was highly toxic. [score:1]
Therefore, miR-146 miRNAs may be involved in fine-tuning of lipid -mediated inflammatory responses of the zebrafish embryo. [score:1]
RNAseq showed a 1.5-fold higher infection-induction of this gene in miR-146 morphants, which was confirmed by qPCR analysis (Additional file 5: Figure S2). [score:1]
The induction of members of the miR-21, miR-29, and miR-146 families was in line with earlier microarray studies, which reported these along with some other miRNAs, like miR-9, miR-132, miR-147, and miR-155 as infection-inducible [13, 26, 43, 44]. [score:1]
In agreement with the microarray data, induction of miR-146a and miR-146b was also confirmed in adult zebrafish infected with M. marinum (Figure 2D). [score:1]
The induction levels of miR-146a and miR-146b upon S. typhimurium infection were reduced under conditions of traf6 or myd88 deficiency, but induction was not completely abolished. [score:1]
MiR-146 has previously been implicated in negative feed-back regulation of these pathways [11, 26], similar to a number of signalling proteins, including the protein-tyrosine phosphatase Ptpn6 [53, 54]. [score:1]
The miR-146 family members were commonly induced during infections of embryos and adult fish, along with miRNAs of the miR-21 and miR-29 families, which also have been implicated in immunity and infection. [score:1]
Six members of the apolipoprotein family (Figure 5C) were significantly induced upon S. typhimurium infection of miR-146 morphants but not in infected control embryos. [score:1]
MiRNAs of the miR-146 family, which emerged as infection-inducible miRNAs from the microarray analysis of embryonic and adult zebrafish, have previously been linked to the innate immune response in mammalian systems [11]. [score:1]
As in mammals, the zebrafish miR-146 family has two members, named dre-miR-146a and dre-miR-146b, which are present within genes located on chromosome 13 and 21, respectively. [score:1]
For instance, lipopolysaccharide (LPS) stimulation of TLR4 and downstream NFκB activity induced miR-146, miR-147, and miR-155 [11- 13]. [score:1]
Furthermore, induction of miR-146a and miR-146b was detected in zebrafish larvae at an advanced stage of M. marinum Mma20 infection (Figure 2C). [score:1]
Another morpholino design for miR-146b was not recommended by GeneTools. [score:1]
The S. typhimurium-induction of miR-146b in embryos could also be reduced by morpholino treatment, (Figure 2A,B), but the miR-146b morpholino was no longer effective at the larval stage where M. marinum infection was analyzed. [score:1]
Induction of miR-146a and miR-146b by infection was shown to be affected by deficiencies in Traf6 and Myd88, which are central intermediates of Toll-like receptor and cytokine signalling pathways. [score:1]
We used a combination of morpholinos against miR-146a and miR-146b in the RNAseq study to avoid that the two miRNAs might compensate for each other’s loss-of-function, as their mature sequences differ only by two nucleotides. [score:1]
Instead of a significant effect on known innate immune response genes, the revealed a possible effect on lipid transport pathways in S. typhimurium-infected miR-146 morphants. [score:1]
[1 to 20 of 121 sentences]
2
[+] score: 9
Taganov K. D. Boldin M. P. Chang K. J. Baltimore D. NF-ĸB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses Proc. [score:5]
miR-146 was identified as a regulator of enterovirus replication by targeting key elements of the MyD88 signal pathway [29]. [score:4]
[1 to 20 of 2 sentences]
3
[+] score: 8
Other miRNAs from this paper: dre-mir-146a
Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. [score:8]
[1 to 20 of 1 sentences]
4
[+] score: 2
RT-qPCR assays again validated the unique expression of miR-146-5p, miR-143-5p and miR-340-5p in early EPCs (Figure  2B). [score:2]
[1 to 20 of 1 sentences]
5
[+] score: 1
Other miRNAs from this paper: dre-mir-146a
Micro -RNAs (miRNAs), including members of the miR-146 family, have been implicated in fine-tuning of the mammalian innate immune response and, in zebrafish embryos, miR-146 is induced by S. typhimurium in a Myd88-Traf6 -dependent manner. [score:1]
[1 to 20 of 1 sentences]