sort by

30 publications mentioning ssc-mir-26a

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-26a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 285
Salvatori et al. (2011) find that expression of miR-26a in acute myeloid leukemia cells inhibits cell cycle progression by down -regulating cyclin E2 expression, and they highlight miR-26a as an attractive therapeutic target in leukemia 21. [score:10]
Ectopic expression of miR-26a influences cell cycle progression by targeting the bona fide oncogene EZH2, a polycomb protein and global regulator of gene expression that was not previously known to be regulated by miRNAs 25. [score:9]
Through targeting the EZH2 gene and repressing the expression of EZH2, miR-26a dramatically suppresses cell proliferation and colony formation by inducing G(1)-phase cell cycle arrest and inhibits tumorigenesis of nasopharyngeal carcinoma 22. [score:9]
To determine if miR-26a directly targets the PRRSV genome and/or regulates host genes, we first used two algorithms (PicTar and TargetScan Release 5.1) to predict the PRRSV gene targets of miR-26a. [score:9]
Our results demonstrate that at the protein, RNA, and viral levels, the replication of PRRSV was significantly inhibited by the over -expression of miR-26a, and PRRSV replication was aggravated by knock-down of miR-26a via miR-26a inhibitor transfection. [score:8]
As shown in Fig. 2F, the viability of MARC-145 cells remained unchanged up to 120 hpt, regardless of the up-regulation of miR-26a expression levels. [score:6]
Furthermore, their luciferase reporters show that miR-26a does not directly target the PRRSV genome but instead affects the expression of type I INF and the IFN-stimulated genes MX1 and ISG15 during PRRSV infection 27. [score:6]
Transfection of a miR-26a -expression plasmid before and after PRRSV infection significantly inhibited the replication of PRRSV in cells. [score:5]
miR-26a suppresses the replication of PRRSV by impairing the synthesis of viral subgenomic mRNAs, and its inhibitor exacerbates PRRSV infection. [score:5]
We found that cellular miR-26a significantly inhibits the replication of the highly pathogenic JXwn06 strain, as well as the traditional VR2332 strain, up to 120 hpi in a dose -dependent manner (Fig. 2), with evidence of alleviating CPE (Fig. 4 and Fig. S1), reducing the viral titer in cell supernatants (Fig. 1, 2, 3, 4), and inhibition of viral RNA and protein synthesis (Fig. 3, 4, 5). [score:5]
The microRNA expression plasmids miR-26a, miR-654, miR-591, miR-601, miR-608, miR-654, miR-509, miR-378, miR-939, miR-491 and miR-Ctr (the same nucleotides as miR-26a but randomized) were kind gifts of Professor Wenlin Huang from our institute 9. The plasmids and miRNA inhibitors were transfected into cells using Lipofectamine [TM]2000 (Invitrogen) according to the manufacturer’s recommendations. [score:5]
In the process of gliomagenesis, miR-26a is a direct regulator of PTEN (phosphatase and tensin homolog), which is involved in the Akt pathway, and highlights dysregulation of Akt signaling as crucial to the development of glioma 24. [score:5]
However, our results demonstrate that ectopic expression of miR-26a did not alter luciferase activity, indicating that miR-26a did not target the PRRSV genome (Fig. 5B). [score:5]
As shown in Fig. 3G-H, miR-26a expression in pre-infected cells was also able to effectively inhibit viral replication. [score:5]
miR-26a suppressed the replication of PRRSV by impairing the synthesis of viral subgenomic mRNA, and a miR-26a inhibitor exacerbated PRRSV infection. [score:5]
The miR-26a expression level was not significantly decreased by miR-26a inhibitor transfection (anti-miR-26a) or in the other four controls (miR-Ctr, anti-Control, mock infection, and virus only) (Fig. 4A). [score:5]
Similar to our results, Li et al. (2015) also prove that miR-26a suppresses PRRSV replication in cells using a synthesized miR-26a mimic instead of a plasmid -based expression system. [score:5]
MARC-145 cells were transfected with either the miRNA expression vector (miR-26a or miR-Ctr) or miRNA inhibitor (anti-miR-26a or anti-control) or mock transfected. [score:5]
The transcripts of RIG-I, MDA5, IRF7 and TLR3 were also significantly up-regulated by miR-26a (Table 2). [score:4]
We performed parallel assays in MARC-145 cells by transfecting either the miRNA expression vector (miR-26a or miR-Ctr) or miRNA inhibitor (anti-miR-26a or anti-control). [score:4]
This indicates that miR-26a inhibited viral infection by regulating host genes that are involved in the control of PRRSV replication. [score:4]
Some IFN-stimulated genes were significantly up-regulated by miR-26a, including MX1, IFI44/IFI44L, the OAS family, and the IFIT family. [score:4]
Inhibition of viral replication by miR-26a in MACR-145 cells was dose dependent and long lasting. [score:3]
When miR-26a was over-expressed, the levels of each mRNA in the subgenome were dramatically decreased (Fig. 5D). [score:3]
Further, PRRSV induced miR-26a expression in a dose -dependent manner (Fig. 1C). [score:3]
How to cite this article: Jia, X. et al. Cellular microRNA miR-26a suppresses replication of porcine reproductive and respiratory syndrome virus by activating innate antiviral immunity. [score:3]
The most probable reason for this phenomenon is that miR-26a may target the 3`-UTR of the IFN-β gene and mediate its mRNA degradation 16. [score:3]
If miR-26a targeted the genome of PRRSV, luciferase activity would decrease. [score:3]
Transfection with plasmids expressing miR-26a resulted in a >50% increase in miR-26a levels in MARC-145 cells at 12 hpt, which peaked from 24–48 hpt (up to 3-fold) and gradually decreased to normal levels by 96 hpt (Fig. 2E). [score:3]
To confirm this result, recombinant plasmids encoding the non-structural and structural proteins of PRRSV (including nsp2, nsp9, Gp2a, E, Gp3, Gp4, Gp5, M and N) with a myc-tag at their N-terminus were co -transfected with either miR-26a or miR-Ctr, and IFA with an anti-myc monoclonal antibody was performed to determine if miR-26a inhibited the production of each protein. [score:3]
We found that the cells transfected at a higher dose of miR-26a displayed a stronger antiviral effect, both at the virus titer and N protein expression levels (Fig. 3E-F). [score:3]
Finally, osteogenic differentiation of human adipose tissue-derived stem cells is modulated by miR-26a targeting of the SMAD1 transcription factor 26. [score:3]
Dose -dependent and time-duration inhibition of viral replication by miR-26a. [score:3]
The inhibitory effect of miR-26a described above was observed at a MOI of 0.1. [score:3]
The expression of other antiviral genes, such as RSAD2 and BST2, were also enhanced by miR-26a. [score:3]
1, at 24 hpt, the relative expression of miR-26a in MARC-145 cells was detected by real-time PCR (A); Exp. [score:3]
The expression of miR-26a was measured by q-PCR and normalized to the expression of miR-18 in each sample. [score:3]
Although miR-26a activated the RIG-I/MDA5 and TLR3/MYD88 IFN signaling pathways, the expression of IFN-β was not increased in this study, which differs from the results of luciferase reporters 27. [score:3]
We found that only miR-26a suppresses PRSSV infection (Fig. 1A). [score:3]
As shown in Fig. 5B, miR-26a did not target the genome of PRRSV. [score:3]
Kota et al. (2009) report that delivery of miR-26a results in dramatic protection from hepatocellular carcinoma (HCC) by targeting cyclins D2 and E2 20. [score:3]
However, whether the targets of miR-26a (including BDNF, cyclin E2, EZH2, MTDH, PTEN, and SMAD1) are involved the replication of PRRSV remains unknown. [score:3]
The efficiency of virus replication suppression induced by miR-26a at 4 or 8 h after viral infection was not different from that at 0 h after viral infection, and all of the associated viral titers were approximately 100-fold lower than that of the control groups (virus only and miR-Ctr). [score:3]
First, quantitative real-time PCR (qRT-PCR) showed that at 24 hpt, miR-26a was highly expressed due to miR-26a plasmid transfection (miR-26a). [score:3]
These results suggest that the inhibitory effect induced by miR-26a lasts for at least 120 hpi. [score:3]
Figure 5C shows that ectopic expression of miR-26a did not reduce the fluorescence intensity. [score:3]
To test if miR-26a could suppress PRRSV in previously infected cells, MARC-145 cells were infected with 0.1 MOI PRRSV, and 0, 4, or 8 h later, these cells were transfected with the miR-26a or miR-Ctr plasmids. [score:3]
Many recent studies indicate that miR-26a is involved in physiological and pathological processes such as proliferation, megakaryocytopoiesis, innate immunity, neurodegenerative diseases, and tumorigenesis. [score:3]
Four files of transcriptome data from the miR-Ctr-, miR-Ctr/V-, miR-26a- and miR-26a/V-inoculated groups were aligned to the UCSC Rhesus Macaque genome build in preparation for differential expression analysis. [score:3]
Using the Cuffdiff program, the numbers of differentially expressed genes (DEGs) between any two groups are shown in Table 1. Of the total transcripts, 156 were significant hits in the miR-26a -treated library, and 215 were significant in the PRRSV-infected plus miR-26a -transfected library. [score:3]
It was previously reported that miR-26a suppresses the replication of H1N1 (WSN) IAV 12. [score:3]
We found that miR-26a decreased the total viral titers of IAV, VSV and HSV-1 by approximately 10-fold (p < 0.05, Fig. 2A-C) and significantly inhibited the replication of PRRSV >100-fold (p < 0.001, Fig. 2D). [score:3]
Thus, cellular conditions and the transfection efficiency of plasmids expressing miR-26a may influence the antiviral function. [score:3]
For instance, miR-26a functionally antagonizes human breast carcinogenesis by targeting MTDH and EZH2 (a component of the Polycomb repressive complex 2) 19. [score:3]
To examine the duration of viral replication inhibition caused by miR-26a, MARC-145 cells were first transfected with 1 μg plasmid (miR-26a or miR-Ctr), followed by PRRSV infection (MOI = 0.1) at 24 hpt. [score:3]
The genome of PRRSV is not the target of miR-26a. [score:3]
Thus, our future work will focus on the identification of targets of miR-26a. [score:3]
These data indicate that miR-26a is a PRRSV infection-responsive miRNA that can inhibit PRRSV replication in MARC-145 cells. [score:3]
In addition, after PRSSV infection, miR-26a expression (RNA level) significantly increased from 4 to 36 hpi (Fig. 1B). [score:3]
In elucidating the mechanism of miR-26a antiviral activity, luciferase reporter assays and IFA were used to determine if the viral genome is the target of miRNA-26a. [score:2]
These results provide further evidence that miR-26a could negatively regulate PRRSV replication by enhancing the innate immune response. [score:2]
Then, co -expression of 1 μg miR-26a (or miR-Ctr) with the TK-ORFs in MARC-145 cells and luciferase activity assays were performed (B). [score:2]
The expression of miR-26a was analyzed using specific primers and probes (Applied Biosystems). [score:2]
These results indicated that some cellular transcription factor(s) participating in PRRSV transcription and/or replication are regulated by miR-26a (Fig. 5D). [score:2]
Further, some differences in virus titers after miR-26a transfection were observed in Fig. 3A, 3C,2D, as well as in the results of WB detection for PRRSV N protein in Fig. 3, though the antiviral functions of mi-R26a were significant in those experiments. [score:1]
MARC-145 cells were transfected with plasmids encoding miR-26a or control (miR-Ctr). [score:1]
miR-26a/V and the miR-Ctr vs. [score:1]
miR-26a is an antagonist of PRRSV. [score:1]
Our results show that the viral titers were reduced by approximately 2 logs of TCID [50] in each experimental group transfected with miR-26a (Fig. 3G-H), suggesting that miR-26a might be applied as an effective anti-PRRSV strategy during PRRS outbreaks. [score:1]
Two runs were then conducted using the miR-26a vs. [score:1]
In addition, 150 DEGs were found after PRRSV infection in MARC-145 cells, 124 DEGs were significant after virus infection in the miR-26a transfected cells, but only 18 hits were found in both libraries (Fig. 6A). [score:1]
INF responses were triggered by miR-26a. [score:1]
Our results implicate that cellular miR-26a may be used as a potential therapeutic strategy against PRRSV infection in the future. [score:1]
miR-26a is a broad-range, anti-viral antagonist that is effective against PRRSV. [score:1]
miR-26a triggers the INF signaling pathway. [score:1]
To measure the dose -dependent suppression of viral replication, MARC-145 cells seeded in 24-well plates were first individually transfected with the miR-26a or miR-Ctr plasmids in increasing amounts (0, 0.25, 0.5, 0.75, and 1 μg) and then infected with PRRSV (MOI = 0.1) at 24 hpt. [score:1]
To systematically study the anti-PRRSV infection mechanism of miR-26a, host cell transcripts were analyzed by RNA-seq after transfecting miR-26a with or without PRRSV infection in MARC-145 cells. [score:1]
In the present study, we demonstrated that miR-26a is an effective antagonist against several RNA viruses (including IAV, VSV, and PRRSV) and a DNA virus (HSV-1). [score:1]
The genome of PRRSV was not the targe t of miR-26a. [score:1]
We found that the viral titers were significantly reduced by approximately 1,000- to 10,000-fold by miR-26a (Fig. 3A). [score:1]
MARC-145 cells were first transfected with 1 μg plasmid (miR-26a or miR-Ctr), followed by PRRSV VR2332 strain infection at 24 hpt. [score:1]
In this report, we found that a miR-26a -mediated antiviral mechanism is utilized by host cells to defend against PRRSV infection. [score:1]
miR-26a is a broad-range antagonist of viral replication. [score:1]
We found that the seed sequence of miR-26a was partially complementary to each of the PRRSV subgenomic sequences. [score:1]
In addition, many ISGs were activated by miR-26a, including OASL, OAS1, OSA2, OAS3, MX1 and ISG15, which have high antiviral activity 28. [score:1]
Heat-maps indicate that both the IFN signaling pathway and antigen presentation pathway were triggered by miR-26a and then enhanced by PRRSV infection (Fig. 6C). [score:1]
These data suggest that miR-26a may act as a broad-spectrum viral antagonist, especially for PRRSV. [score:1]
Host-encoded miR-26a had an antiviral effect on PRRSV replication via induction of the innate INF response. [score:1]
MARC-145 cells were transfected with miR-26a or miR-Ctr for 24 h and then infected with PRRSV (VR2332) or mock infected. [score:1]
However, no CPE was observed in the miR-26a and mock groups, while CPE in the anti-miR-26a group was increased relative to the infected control groups (Fig. 4B). [score:1]
Following transfection with miRNA-26a or miR-Ctr, MARC-145 cells were mock infected or infected with PRRSV VR2332 at MOI = 2 and then harvested 24 hpi. [score:1]
Thus, we next investigated whether miR-26a displays the same suppression at lower and higher MOIs (0.001, 0.01, 0.1, 1 and 10) of PRRSV infection. [score:1]
Additionally, the level of miR-26a in the transfected cells from 12-120 hpt was validated using real-time PCR. [score:1]
To address whether miR-26a could counteract virus replication in infected cells, MARC-145 cells were transfected with miR-26a 0, 4, and 8 hpi with PRRSV VR2332. [score:1]
MARC-145 cells were transfected with 1 μg miR-26a and, 24 h later, infected with IAV (H1N1 or H9N2), VSV, HSV-1, or PRRSV (VR2332 or JXwn06) at a multiplicity of infection (MOI) of 0.1. [score:1]
To determine if miR-26a is a non-specific anti-viral agent, the inhibition of VSV, HSV-1 and PRRSV by miR-26a was investigated. [score:1]
MARC-145 cells seeded in 24-well plates were transfected with miR-26a and control (miR-Ctr) plasmids for 24 h and then infected with VR2332 PRRSV at MOI = 0.1. [score:1]
Further, in the presence of miR-26a, no CPE was induced by PRRSV at any MOI tested (Fig. S1). [score:1]
The samples were divided into four groups: miR-Ctr, miR-Ctr/V, miR-26a, and miR-26a/V (where “V” stands for PRRSV infection). [score:1]
Notably, these viral genomes do not contain putative miR-26a binding sites as defined by the MicroInspector program (data not shown). [score:1]
[1 to 20 of 100 sentences]
2
[+] score: 18
MiR-26a is up-regulated during myoblast differentiation and can suppress Enhancer of Zeste homolog 2 (EZH2) to promote myogenesis [31]. [score:5]
The unified set of top 10 unique miRNAs over the two pig breeds correspond to 15 unique miRNAs, 11 of which (ssc-let-7a-1/2-5p, ssc-let-7c-5p, ssc-let-7e-5p, ssc-miR-10a-5p, ssc-miR-10b-5p, ssc-miR-127-3p, ssc-miR-148a-3p, ssc-miR-199a-1/2-5p, ssc-miR-21-5p, ssc-miR-26a-5p, ssc-miR-125b-1-5p) had been frequently reported highly expressed in skeletal muscle during porcine prenatal and postnatal developmental stages. [score:4]
Study of Mai et al. revealed that ssc-let-7a-1/2-5p, ssc-miR-10a-5p, ssc-miR-127-3p, ssc-miR-148a-3p, ssc-miR-199a-1/2-5p, ssc-miR-26a-5p were the most highly expressed unique miRNAs over five porcine muscle developmental stages from 90 dpc to 7 y after birth [27]. [score:4]
MicroRNA-26a targets the histone methyltransferase Enhancer of Zeste homolog 2 during myogenesis. [score:2]
For example, Qin et al. had reported that ssc-let-7a, ssc-miR-10a, ssc-miR-10b, ssc-miR-127, ssc-miR-148a, ssc-miR-21, ssc-miR-26a were the most abundant miRNAs during porcine skeletal muscle developmental stages from 35 days post coitum to postnatal day 180 [25]. [score:2]
Hou et al. shows that ssc-let-7a, ssc-let-7c and ssc-miR-26a were the common most abundant miRNAs in longissimus dorsi muscle of three pig breeds (Landrace, Tongcheng, and Wuzhishan) at postnatal day 240 [26]. [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 14
All raw data and statistical results of these real-time PCR tests are available in Supplementary Document 6. Figure 3 shows that Salmonella inoculation down-regulated miR-125b, miR-221, miR-27b and up-regulated miR-26a. [score:7]
The expression of miR-26a was up-regulated 14-fold in at 2 days after Salmonella infection (P<0.05). [score:6]
The hybridization of miR-145, miR-125b, miR-221 and miR-27b showed signals that were approximately 22 nt in size, whereas the let-7f, miR-142, miR-26a, miR-19b and miR-99a detected not only the mature form but also the approximately 75-nt precursors on the same blots (Figure 2). [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 14
The expression of the miR-30 family strongly increased while miR-26a and miR-212 were strongly down-regulated in the pituitary gland with ACTH-secreting adenomas [30]. [score:6]
The up-regulation of miR-141, miR-200a, miR-200c, miR-26a, and miR-29 we detected were also accordant either with mice or with humans. [score:4]
Thus far, only a few studies have addressed the involvement of miRNAs in the functions of the pituitary; miR-26 has recently been reported to be critical for anterior pituitary development [28], and most others are related to the development of tumors. [score:3]
Bak et al. reported 8 miRNAs (mir-7, mir-7b, mir-375, mir-141, mir-200a, mir-200c, mir-25and mir-152) with more than 3-fold enrichment in the pituitary of adult mice in a profile of the miRNAs in the central nervous system [36]; and Farh et al. and Landgraf et al. reported 6 (mir-7, mir-212, mir-26a, mir-191, mir-375 and mir-29) when comparing the miRNAs in normal and tumor pituitary cells [37], [38]. [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 13
For example, NAAA, enoyl-CoA hydratase domain containing 2 (ECHDC2), and taxilin gamma (TXLNG) were down-regulated in LD pigs and negatively regulated by miR-26a. [score:5]
LD group was associated with lipid metabolism and organ morphology; the NAAA gene is central to this network, hypermethylated and down-regulated in LD pigs compared with TC pigs, and negatively regulated by miR-26. [score:4]
NAAA plays a key role in the degradation of N-acylethanolamines, which are ethanolamides of long-chain fatty acids 81. miR-26 expression has been reported to promote energy dissipation and differentiation of myoblasts 82 83. [score:3]
LD group, the highest scoring network, based on Fisher’s exact test, had a network score of 73 and was associated with lipid metabolism, and organ morphology; N-acylethanolamine-hydrolyzing acid amidase (NAAA), miR-128, and miR-26a were key components in the network (Fig. 7A). [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 10
In accordance with the most stable miRNAs described in the literature [20]– [22], [24], [26]– [28], ten candidate miRNAs (Ssc-let-7a, Ssc-miR-103, Ssc-miR-17-3p, Hsa-miR-25, Hsa-miR-93, Ssc-miR-106a, Ssc-miR-191, Ssc-miR-16, Ssc-miR-26a and Ssc-miR-17-5p, Table 1) were selected to study their expression stability in different porcine tissues and breeds. [score:3]
In kidney it is recommended miR-17-5p, miR-93 and miR-26a. [score:1]
Although all miRNAs showed good stability values, the most stable miRNA was miR-93, followed by miR-25, miR-106a, miR-17-5p and miR-26a (Figure 1). [score:1]
The least stable miRNAs were miR-191 in Iberian and Landrace breeds, miR-16 in Large White and Vietnamese breeds and miR-26a in Meishan breed (data not shown). [score:1]
curve correlation mean * Ssc-let-7a 125 1/2000 95.52% (2.11%) 0.9991 (0.0005) Ssc-miR-103 250 1/2000 96.27% (5.15%) 0.9981 (0.0013) Ssc-miR-17-3p 250 1/200 99.96% (7.25%) 0.9971 (0.0026) Hsa-miR-25 250 1/2000 97.14% (3.76%) 0.9989 (0.0004) Hsa-miR-93 200 1/2000 98.10% (3.12%) 0.9973 (0.0012) Ssc-miR-106a 250 1/2000 99.73% (11.05%) 0.9978 (0.0015) Ssc-miR-191 250 1/2000 97.45% (3.91%) 0.9978 (0.0009) Ssc-miR-16 250 1/2000 98.31% (4.98%) 0.9990 (0. 0004) Ssc-miR-26a 250 1/2000 93.35% (0.62%) 0.9991 (0.0005) Ssc-miR-17-5p 250 1/2000 98.52% (5.00%) 0.9980 (0.0009) * The numbers in brackets denote the standard error for the mean values. [score:1]
If the study is focused in skeletal muscle, we encourage using Let-7a, miR-17-5p and miR-25, but if we are working with liver, the most stable miRNAs to be used as reference miRNAs are miR-26a, miR-103 and Let-7a. [score:1]
It is recommended the use of five reference miRNAs: miR-93, miR-25, miR-106a, miR-17-5p and miR-26a in studies which include multiple tissues. [score:1]
miR-93 remained the most stable miRNA in Iberian and Meishan breeds, miR-26a in Landrace and Vietnamese breeds and miR-25 in Large White breed. [score:1]
[1 to 20 of 8 sentences]
7
[+] score: 10
miR-145 was expressed at high levels in the spleen, lung, and small intestine, and miR-26a was relatively strongly expressed in the heart, lung, and kidney (Figure 4). [score:5]
Although the expression patterns of the precursor and mature forms of miR-26a and miR-191 were consistent across tissues, the expression levels of the precursor forms of mir-26a and mir-191 were much lower than those of their mature forms. [score:5]
[1 to 20 of 2 sentences]
8
[+] score: 10
For example, we found that the expressions of ssc-miR-26a and ssc-miR-125b were much higher than their expressions reported in the previous study [40]. [score:5]
Thus, ssc-miR-26a and ssc-miR-125b may play vital roles in the regulation of skeletal muscle postnatal hypertrophy. [score:2]
MicroRNA-26a targets the histone methyltransferase Enhancer of Zeste homolog 2 during myogenesis. [score:2]
Two miRNAs, ssc-miR-26a [29, 30] and ssc-miR-378 [31], that ranked 2 [nd] and 3 [rd], respectively, have been reported to be involved in the proliferation and differentiation processes of skeletal muscle. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 9
Besides the miR-1 and miR133a that we found highly expressed in all the stages (McCarthy & Esser, 2007), miR-26a also showed abundant expression (Huang, Sherman & Lempicki, 2008; Huang et al., 2008). [score:5]
miR-26a promotes myogenesis in C2C12 cells via post-transcriptionally repressing Ezh2, which is a known suppressor of skeletal muscle cell differentiation (Wong & Tellam, 2008). [score:3]
Of these miRNAs, six (miR-133a-1/-2-3p, let-7a-1/-2-5p, miR-27b-3p, miR-26a-5p, miR-1-3p, and let-7f-1/-2-5p) were shared by all five stages and were closely related to myogenesis, cell growth, myocyte proliferation, and cell apoptosis. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 9
Of these, 40 miRNAs are minimally expressed (0 < average signals ≤ 100; p ≤ 0.01), 77 miRNAs are modestly expressed 100 < average signals ≤ 1,000; p ≤ 0.01), 85 miRNAs were highly expressed (1,000 < average signals ≤ 10,000), and, in particular, 20 miRNAs were extremely highly expressed in the anterior pituitary (average signals ≥ 10,000; p ≤ 0.01), including ssc-miR-7, Y-90, ssc-miR-26a, ssc-miR-125b, Y-1, ssc-miR-125a, Y-77, ssc-let-7g, ssc-miR-29a, ssc-let-7i, ssc-let-7a, ssc-let-7f, ssc-miR-148a, ssc-miR-21, ssc-miR-335, ssc-miR-30b-5p, ssc-miR-191, ssc-miR-29c, ssc-miR-23b, and ssc-miR-23a (Fig 1C). [score:9]
[1 to 20 of 1 sentences]
11
[+] score: 9
According to sequence count, nine miRNAs highly expressed (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Ssc-miR-532-5p, Ssc-miR-92a, Ssc-miR-26a and Bta-miR-193b, n>100) and four miRNAs lowly expressed (Ssc-miR-423-5p, Ssc-miR-29c, Ssc-miR-486 and Ssc-let-7f, n<100) in the kidney miRNAome were selected to measure their expression levels by RT-qPCR. [score:5]
Ssc-miR-99a, Bta-miR-193b and Ssc-miR-423-5p were selected to be up regulated in EU, Hsa-miR-200b-3p, Ssc-miR-532-5p and Ssc-let-7f to be up regulated in AS and, Hsa-miR-200c-3p, Ssc-miR-92a, Ssc-miR-26a, Ssc-miR-486 and Ssc-miR-29c to be up regulated in EA. [score:4]
[1 to 20 of 2 sentences]
12
[+] score: 9
miRNAs overexpressed in E. coli F18-sensitive individuals include ssc-miR-143 (highest expression), ssc-let-7f, ssc-miR-143, ssc-miR-192, ssc-miR-21, ssc-miR-215, ssc-miR-378, ssc-miR-145, ssc-miR-26a, and ssc-miR-30e. [score:5]
In another important human disease, diabetes, the study by Melkman et al. [5] into the effects of miRNAs on insulin synthesis revealed that knocking out miR-24, miR-26, miR-182, or miR-148 reduced the transcriptional activity of the insulin gene promoter, thereby reducing the level of insulin mRNA. [score:4]
[1 to 20 of 2 sentences]
13
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 6
miR-26a inhibits PRRSV replication by upregulating type I interferons [18]. [score:6]
[1 to 20 of 1 sentences]
15
[+] score: 5
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
They recorded changes in the expression levels of eight miRNAs (miR-1a, miR-181a, miR-133a, miR-214, miR-133b, miR-206, miR-146, and miR-26a) shown to be involved in a strong resumption of myogenesis (Zhu et al., 2014). [score:3]
Ramachandra et al. (2008) discovered 14 miRNAs in early embryos (5 dpf); among these, miR-21, miR-30d, miR-92a, miR-200, and miR-26 are associated with differentiation and development. [score:2]
[1 to 20 of 2 sentences]
16
[+] score: 5
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
Microarray profiling identified miR-26a as being highly expressed in both libraries, however, this highly expressed miRNA was not identified by sequencing. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 5
Other miRNAs from this paper: ssc-mir-27a, ssc-mir-1, ssc-mir-29a, ssc-mir-27b, ssc-mir-26b
Expression rates were corrected for PCR efficiencies using dilution curves and the expressions of the candidate reference genes (let7a, miR-26, miR-27, RNU6B) were entered in Normfinder [13] for identification of the most stable transcripts. [score:5]
[1 to 20 of 1 sentences]
19
[+] score: 5
Gene targeted by the disease miRNA26. [score:5]
[1 to 20 of 1 sentences]
20
[+] score: 4
Moreover, several hypoxia-regulated miRNAs play roles in cell survival in hypoxic environments and have been implicated in the regulation of both upstream and downstream HIF signaling pathways, e. g., miR-20b and miR-17-92 clusters, while miR-199a regulates HIF-1α under hypoxic conditions [8– 10], and miR-107, miR-210, miR-373, miR-23, miR-24, and miR-26 are induced by HIFs [7, 11, 12]. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 3
miR-26a targets the histone methyltransferase enhancer of Zeste homolog 2 during myogenesis [42]. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Potential reference genes (let-7a, mir-17 and mir-26a for subcutaneous adipose tissue and mir-17 and mir-20 for abdominal adipose tissue, liver and skeletal muscle) were tested for stability using GeNorm [41] and NormFinder [42] algorithms and were all used as reference genes to normalize the expression of the individual samples in the qPCR experiment. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
Previous studies have demonstrated that the myomiRs miR-1, miR-133a/b, miR-206, miR-486, miR-26a, miR-27b, miR-378, miR-148a and miR-181 are highly enriched in skeletal muscle and play a key role in skeletal muscle metabolism [28, 29, 30, 31]. [score:1]
The top nine most abundant miRNAs shared between the two groups were ssc-miR-10b, ssc-miR-22-3p, ssc-miR-486, ssc-miR-26a, ssc-miR-27b-3p, ssc-miR-191, ssc-miR-378, ssc-126-5p and ssc-miR-181. [score:1]
In our sequencing libraries, five of these known myomiRs (miR-486, miR-26a, miR-27b, miR-378 and miR-181) were identified with the greatest abundance, accounting for 26% and 29% of the total normalized miRNA reads in the LPS-challenged and saline -treated groups, respectively. [score:1]
[1 to 20 of 3 sentences]
24
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 2
60 −16.78 −6.45 miR-30a-5p 226 −7.87 −9.07 −1.15 let-7b-5p 209 −3.64 −5.76 −1.58 miR-26a-5p 206 −5.33 −3.84 1.39 miR-339-5p 176 −4.97 −22.89 −4.60 let-7d-3p 171 −1.36 −8.66 −6.38 miR-19b 144 −6.97 −4.30 1.62 miR-23a-5p 126 −11.83 −27.63 −2.34 let-7i-5p 122 −5.40 −6.29 −1.17 miR-505-5p 117 −15.46 −25.93 −1.68 miR-4454 104 −3.32 −7.51 −2. [score:1]
Hsa-miR-93, Hsa-miR-25, Ssc-miR-106a, Ssc-miR-17-5p, Ssc-miR-26a were used as reference miRNAs [41], [42]. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 2
11025060:+ 13_28851 40,621.2 79,667 uucaaguaacccaggauaggcu 22 hsa-miR-26a-5p hsa-mir-26a-1 96.1 7.00E − 20 13:24,885,255.. [score:1]
24885316:− 13_28851 40,621.2 79,667 uucaaguaacccaggauaggcu 22 hsa-miR-26a-5p hsa-mir-26a-2 95.8 4.00E − 06 13:24,885,255.. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 1
After evaluation of its stability by geNorm v3.5 algorithm [36], five miRNAs (ssc-miR-26a, ssc-let-7a, ssc-miR-103, ssc-miR-17-5p and ssc-miR-16-5p) were used as reference to normalize expression [37]. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
To verify the accuracy of the high-throughput sequencing results, stem-loop quantitative (q)RT-PCR was performed on 12 significantly DE miRNAs (ssc-miR-10b, ssc-miR-486, ssc-miR-24-3p, ssc-miR-195, ssc-miR-19b, ssc-let-7f, ssc-miR-146b, ssc-miR-novel-chr16_17559, ssc-miR-novel-GL892871-2_41708, ssc-miR-novel-chr2_21624, ssc-miR-novel-chr12_7961, and ssc-miR-26a). [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
The first one harbored known miRNAs such as miR-26a, miR-27a, miR-125b, miR-130a and miR-145 but the latter was mainly composed of novel and not conserved miRNAs. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 1 sentences]