sort by

64 publications mentioning hsa-mir-202

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-202. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 227
Afterwards, we demonstrated that the over -expression of miR-202 inhibited the expression of cyclin D1 protein by targeting its 3′UTR of cyclin D1, suggesting that cyclin D1 is indeed a direct target of miR-202. [score:12]
In conclusion, this work suggested that miR-202 is down-regulated in the progression and development of CC through inhibition of cyclin D1 expression, and miR-202 can be recommended as a effective tumor-suppressing miRNA. [score:11]
Recently, some reports showed that miR-202 acts as a tumor suppressor, and the expression of miR-202 is identified to be down-regulated in colorectal carcinoma [19], gastric cancer [20], myeloma [21]. [score:8]
Inhibited cyclin D1 expression enhances the inhibitory effects of miR-202. [score:7]
Thus, it should be inferred that miR-202 may affect cell proliferation, migration and invasion directly or indirectly via inhibition of expression of MMP2 and MMP9. [score:7]
In the present work, we further demonstrated that the overexpression of cyclin D1 reverses the inhibitory effects of over-expressed miR-202 on CC cancer cell proliferation, migration and invasion. [score:7]
Among 100 cases of CC samples, the expression of miR-202 was obviously down-regulated in 68 cases of samples. [score:6]
And moreover, the expression of miR-202 was obviously up-regulated in all adjacent normal cervical tissues (Figure 1B). [score:6]
In addition, the transwell assay also showed that inhibited expression of cyclin D1 in miR-202 -overexpressing SiHa and HeLa cells affected the migration and invasion potentials of SiHa and HeLa cells in comparison with si-control (Figure 7B, 7C). [score:6]
To further figure out the relationships between miR-202 and cyclin D1, we conducted a gene silencing assay, and transfected cyclin D1 siRNA and control siRNA into miR202 -overexpressing SiHa and HeLa cells to inhibit the expression of cyclin D1 protein. [score:6]
To figure out the significance of miR-202 expression in the development of CC, firstly, the expression of miR-202 was detected using qRT-PCR and RT-PCR in CC cell lines, including SiHa, HeLa, and Caski, and human non-tumor keratinocyte line HaCaT as well as CC samples. [score:6]
To further figure out the relationships between miR-202 and cyclin D1, we transfected pcDNA3.1(+)-cyclin D1 plasmids into miR-202 -overexpressing SiHa and HeLa cells to overexpress cyclin D1 protein (Figure 5B). [score:5]
cyclin D1 inhibition enhanced the inhibitory effect of miR-202 on CC cell proliferation, migration and invasion. [score:5]
cyclin D1 overexpression reversed the inhibitory effect of miR-202 on CC cell proliferation, migration and invasion. [score:5]
For instance, down-regulated miR-202 regulates Mxd1 and Sin3A repressor complexes, by which miR-202 mediates the proliferation and apoptosis of pancreatic cancer cells. [score:5]
Enforced cyclin D1 expression attenuates the inhibitory effects of miR-202. [score:5]
The outcome suggested that cyclin D1 is a downstream target of miR-202, and miR-202 plays a crucial role in CC cell proliferation, migration and invasion by directly regulating cyclin D1. [score:5]
In this study, our findings showed that miR-202 was down-regulated, and miR-202 was involved in the development of CC. [score:5]
Thus, the deregulation of any factors including Drosha and Dicer enzyme in the generation of miR-202 will lead to the down-regulation of miR-202. [score:5]
Accumulating studies showed that the expression of miR-202 was deregulated in different cancers, including colorectal carcinoma [19], gastric cancer [20], myeloma [21], osteosarcoma and lung carcinoma [22, 23]. [score:4]
Here we listed the potential reasons why miR-202 was down-regulated. [score:4]
In addition, the transwell assay also revealed that overexpression of cyclin D1 in miR-202 -overexpressing SiHa and HeLa cells enhanced the migration and invasion capacity of SiHa and HeLa cells in comparison with vector control (Figure 6B, 6C). [score:4]
Figure 7(A) The proliferation capacity of miR-202 -overexpressing SiHa and HeLa cells was partially inhibited when cells were transfected with si-cyclin D1 compared with si-control. [score:4]
In addition, the non-parametric test U Mann Whitney revealed that the down-regulation of miR-202 was closely related to the grade (p = 0.001) and stage (p = 0.002) of cervical cancer. [score:4]
Up to date, the expression and potential role of miR-202 in the development of CC is little known. [score:4]
Our findings revealed that the expression of miR-202 is remarkably down regulated in human CC samples. [score:4]
At the same time, we also found that 68 patients with low miR-202 expression have shorter survival period compared with the rest with high miR-202 expression using the survival curve and log-rank test (p = 0.012). [score:4]
cyclin D1 is a candidate target of miR-202. [score:3]
cyclin D1 is identified as a target of miR-202. [score:3]
The expression of miR-202 is decreased in CC cell lines and samples. [score:3]
The tranwell assay revealed that overexpression of miR-202 suppressed the migration and invasion of SiHa and HeLa cells compared with miR-NC control (Figure 3A, 3B). [score:3]
Firstly the overexpression of miR-202 was confirmed in SiHa and HeLa cells using qRT-PCR (Figure 2A). [score:3]
However, the expression and mechanism of miR-202 in cervical cancer remain to be unclear. [score:3]
Reduced miR-202 expression in CC cell lines and tissues. [score:3]
miR-202 inhibits CC cell proliferation. [score:3]
Figure 5(A) The miR-202 mimics inhibited the luciferase activity controlled by wild-type cyclin D1-3′-UTR, but did not affect the luciferase activity controlled by mutant cyclin D1-3′-UTR in SiHa cells. [score:3]
Figure 6(A) The proliferation capacity of miR-202 -overexpressing SiHa and HeLa cells was partially improved when cells were transfected with cyclin D1 plasmids in comparison with miR-NC. [score:3]
Besides, we also identified that miR-202 plays a crucial role in cell proliferation, migration and migration by directly regulating cyclin D1 in CC cells. [score:3]
Afterwards, the mechanisms underlying the down-regulation of miR-202 were investigated in the development of CC. [score:3]
At the same time, miR-202 mimics inhibited the luciferase activity controlled by wild-type cyclin D1-3′-UTR, but did not affect the luciferase activity controlled by mutant cyclin D1-3′-UTR in HeLa cells. [score:3]
Secondly, overexpression of miR-202 led to obviously reduced proliferation capacity in both SiHa and HeLa cells (Figure 2B). [score:3]
Recently miR-202 was reported as a tumor suppressor miRNA. [score:3]
Figure 1(A) Relative miR-202 expression in CC cell lines (SiHa, HeLa, and Caski) and human non-tumor keratinocyte line HaCaT. [score:3]
To figure out the value of miR-202 in cell proliferation of cervical cancer, we applied miR-202 overexpressing SiHa and HeLa cells by transiently transfecting cells with miR-202 mimics. [score:3]
miR-202 inhibits CC cell migration and invasion. [score:3]
In this wok, we found that SiHa, HeLa, and Caski cell lines had significantly lower expression of miR-202 compared with normal HaCaT cells (Figure 1A). [score:2]
These finding also indicated that miR-202 is implicated in the development of CC. [score:2]
And then the PCR amplification was carried out using TaqMan miRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and TaqMan Human MiRNA Assay Kit (Applied Biosystems, Foster City, CA, USA), by which the expression of miR-202 and U6 can be quantified. [score:2]
It has been reported that miR-202 was found to be decreased in some kinds of tumors. [score:1]
Besides, we made a correlation analysis to elucidate the negative association of miR-202 and cyclin D1 in SiHa, HeLa, and Caski cells. [score:1]
Previously published reports demonstrated that the cyclin D1 3′UTR can act as a putative miR-202 binding site [23]. [score:1]
In this work, we explored the potential role of miR-202 in the progression of cervical cancer. [score:1]
In this study, we examined the existence of miR-202 -induced cyclin D1 pathway in CC, and elucidate the significance of miR-202 -induced cyclin D1 pathway. [score:1]
SiHa and HeLa cells were transfected with miR-202 mimics or scramble control miRNA. [score:1]
Figure 2(A) Relative miR-202 expression in SiHa and HeLa cells was measured after the cells were transfected with miR-202 mimics or scramble control miRNA using real-time RT-PCR. [score:1]
miR-202 affects the cell proliferation, migration and invasion. [score:1]
miR-202 mimic (Life technologies, Shanghai, China), and corresponding negative controls miR-NC (GenePharma, Shanghai, China) were transiently transfected into cells as reported previously [18]. [score:1]
Finally, we analyze the correlation between cyclin D1 and miR-202 mRNA levels in 100 tumor samples and also found the negative association of miR-202 and cyclin D1 in the 100 tumor samples. [score:1]
For example, miR-202 was found to be obviously altered in most of pancreatic cancer tissues. [score:1]
The reaction conditions were as follows: 95°C for 30 s, followed by 48 cycles of 95°C for 5 s, 60°C for 10 s and 72°C for 30 s. Relative miR-202 expressions were calculated with normalization to U6, and GAPDH was used to as internal controls. [score:1]
After that, all cells were cultured in 24-well plates, and then transfected with wild-type (wt) or mutant (mut) 3′-UTR vectors of cyclin D1 together with miR-202 mimics using Lipofectamine 2000. [score:1]
[1 to 20 of 61 sentences]
2
[+] score: 89
Increased expression of Sufu, a target of miR-202-3p and a negative regulator of Hh signalling, is associated with poor prognosis in CLL. [score:6]
[36] In our study, the expression of Sufu was variable among the CLL cases used but did show a negative correlation with miR-202-3p expression. [score:5]
Expression of miR-202-3p and its target Sufu mRNA in CLL cells. [score:5]
[37, 38] In fact, both Sufu mRNA transcript variants 1 and 2 contain miR-202 target sequences in their 3’ untranslated region (UTR) (Figure D in S1 File). [score:5]
Next, we focused on a known target of miR-202-3p, namely Sufu a regulator of the Gli-Hedgehog signalling pathway with an established role in the oncogenesis of CLL. [score:4]
D) Fold change of miR expression in exosomes vs cellular CLL samples showing the enrichment of miR-202 by RT-qPCR in two representative cases. [score:3]
This data supports an effect of exosomal miR-202-3p on target HS-5 cellular Sufu mRNA. [score:3]
0141429.g005 Fig 5 (A) HS-5 cells incubated with MEC-1 exosomes for 24 hrs show increased expression of miR-202-3p by RT-qPCR analysis. [score:3]
To study whether encapsulated miRs in CLL exosomes are transferred to recipient cells we incubated HS-5 cells with MEC-1 derived exosomes, as miR-202-3p expression levels in exosomes derived from MEC-1 cells or primary CLL cells are quantitatively similar (not shown). [score:3]
Figure F: miR-202-3p expression in exosomes derived from CLL cells and Normal B cells. [score:3]
Box plots show the expression level of miR-202-3p relative to a miR-U6B control for normalisation. [score:3]
In conclusion, the relatively higher levels of miR-202-3p in CLL derived exosomes, compared to the parental cells suggests that such selective sequestration into the secreted exosomes is an active and regulated process, and of likely relevance in disease biology and behaviour. [score:3]
Furthermore, miR-202-3p expression showed a significant negative correlation with Sufu mRNA levels in CLL cells (Fig 5E; R = -0.70, p = 0.01). [score:3]
[48, 49] Increased expression of miR-202-3p is generally associated with cell differentiation. [score:3]
CLL exosomes alter the levels of miR-202-3p and its target Sufu mRNA in recipient cells. [score:3]
Thus, our data suggest that CLL cells specifically package miR-202-3p in order to influence cellular Sufu levels and affect disease behaviour. [score:3]
In our profiling data we found important miRs, already reported to be of relevance in disease biology, [17, 18, 35] to be equally abundant in cells and exosomes while other miRs such as miR-202-3p, miR-628-3p, and miR-1290 were specifically enriched in exosomes. [score:3]
A further analysis of miR-202-3p expression in paired exosomal RNA and parental cells by RT-qPCR confirmed significant enrichment of miR-202-3p in contrast to other miRs that are equally abundant in cells and exosomes. [score:3]
These data support linked tumour-suppressive and oncogenic roles in CLL for miR-202-3p and Sufu respectively. [score:3]
Deregulation of miR-202-3p is well documented in various tumour types such as cervical, breast, colorectal and gastric cancers. [score:2]
We next compared miR-202-3p levels in exosomes derived from CLL cells (n = 9) and normal B-cells (n = 3) and found variable expression by RT-qPCR analysis. [score:2]
To understand the relevance of miR-202-3p expression in CLL, we performed an RT-qPCR analysis of cellular RNA in CLL cells, and compared this with that in normal B-lymphocytes. [score:2]
To obtain confirmation of selective enrichment miR levels in exosomes derived from in vivo sources, we compared the expression of miR-202-3p in exosomes derived from CLL and healthy donor plasma by RT-qPCR analysis and show that there are significantly lower levels in the latter (Fig 6A; p = 0.03, n = 3 cases). [score:2]
Taken together, these data show that CLL exosomes carry a miR cargo, which largely represents their cell of origin, but are also selectively enriched for miR-202-3p. [score:1]
CLL exosomes selectively encapsulate miRs and are enriched in miR-202-3p. [score:1]
With respect to CLL, exosomal release of miR-202-3p from malignant cells into the microenvironment is likely to result in a decrease of its anti-tumorigenic effect. [score:1]
In particular, we suggest that the biology surrounding miR-202-3p as a tumour suppressor in CLL is worthy of further investigation. [score:1]
The HS-5 cell line was transfected with miR-202-3p mimic or scrambled control (Life technologies) using the Lipofectamine 2000 transfection reagent according to the manufacturer’s protocol (Invitrogen). [score:1]
0141429.g006 Fig 6 (A) Exosomes sourced from plasma obtained from CLL patients or healthy donors (n = 3 each) were subjected to RT-qPCR analysis for absolute levels of miR-202-3p using a standard curve method. [score:1]
More importantly, we demonstrate a selective enrichment of miR-202-3p in CLL exosomes. [score:1]
The levels of miR-202-3p are significantly higher in exosomes purified from CLL plasma (p = 0.03). [score:1]
However, we found that certain candidate miRs are specifically enriched or counter-selected in exosomes including miR-202-3p, miR-1290, and miR-628-3p but are less abundant in the parental cells (Fig 4A). [score:1]
The enrichment of miR-202-3p in implies the existence of specific sorting mechanisms within CLL cells that dictate the molecular content of released exosomes. [score:1]
Figure D: Binding site of miR-202-3p in the Sufu 3’UTR. [score:1]
This would suggest that in contrast to normal B-cells, there is a significant active and deliberate packaging of miR-202-3p into CLL exosomes. [score:1]
Indeed, HS-5 cells tranfected with a miR-202-3p mimic, but not a scrambled oligonucleotide control, showed a concentration -dependent reduction in Sufu mRNA levels (Fig 5C). [score:1]
Importantly, miR-1290, miR-628-3p, and miR-202-3p were enriched within the exosomal RNA (Fig 4A). [score:1]
[1 to 20 of 37 sentences]
3
[+] score: 74
Previous studies have suggested that miR-202 expression increases in testicular tissue postnatally and during development, suggesting that the expression of miR-202-5p is up-regulated in the testis at later developmental stages [14]. [score:10]
Previous studies have suggested that miR-202 expression increases in testicular tissue postnatally and during development, indicating that the expression of miR-202-5p is up regulated in the testis at later stages during development [14]. [score:8]
These data indicate that miR-202-5p expression is associated with male gonad development, and its expression is restricted to Sertoli cells in the adult testis. [score:6]
The absence of germ cells can result in de-differentiation of Sertoli cells, so that Sertoli cell function reflects that of immature Sertoli cells, leading to loss of expression of miR-202-5p expression. [score:5]
MicroRNA-202-5p is localized to Sertoli cells and its expression dramatically differs between fertile men and men whose germ cells are depleted, suggesting a novel interaction for regulating microRNA expression between the somatic and germ cell components of the seminiferous epithelium. [score:5]
This germ cell -dependent expression of miR-202-5p suggests a functional role of this miRNA in Sertoli cell maturation and/or regulation of spermatogenesis. [score:4]
miR-202-5p is expressed in Sertoli cells in the early XY gonad [20]. [score:3]
Figure 2 ISH of miR-202-5p, blue precipitate indicate cellular expression of miRNA in normal testicular tissue, 1 spermatogonia, 2 primary spermatocyte, 3 Sertoli cell, 4 spermatid, scale 50 μm. [score:3]
L’expression de miR-202-5p est réduite d’un facteur 17 (P < 0.00001) dans le tissu des hommes SCO par rapport au tissu des hommes à spermatogenèse normale. [score:3]
Our study demonstrates that miR-202-5p is selectively expressed in Sertoli cells in men with normal germ cells, but not in the Sertoli cells of men with SCO. [score:3]
miR-202-5p is highly expressed in Sertoli cells when germ cells are present. [score:3]
Figure 1 ISH of miR-202-5p, blue precipitate indicate cellular expression of miRNA in normal testicular tissue, *normal seminiferous tubules, scale 200 μm. [score:3]
These observations reflect that miR-202-5p are selectively expressed in Sertoli cells in men with normal germ cells, but not in the Sertoli cells of men with SCO. [score:3]
To date, no direct physiological function for miR-202-5p has been identified in humans. [score:2]
miR-202-5p expression was reduced by 17-fold (P < 0.00001) in SCO men compared to normal. [score:2]
MiR-202-5p expression was reduced by 17-fold (P < 0.00001) in tissue from SCO men compared to normal. [score:1]
Further rodent studies may help elucidate whether loss of miR-202-5p is the cause or a consequence of loss of germ cells in men with Sertoli Cell Only syndrome. [score:1]
Figure 4 ISH miR-202-5p in testicular tissue of men with SCO, arrow Sertoli cells, scale 50 μm. [score:1]
This localization pattern of miR-202-5P is consistent with our qPCR results. [score:1]
miR-202-5p/3p are a member of the let-7 family. [score:1]
Hybridization signal specific for of miR-202-5p was specifically detected in the Sertoli cells of men with normal spermatogenesis (Figures  1, 2 and 3). [score:1]
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
MicroRNA Spermatogenesis Male infertility miR-202-5p Sertoli cells microARN Spermatogenèse Infécondité masculine miR-202-5p Cellules de Sertoli Infertility affects 10%–15% of couples worldwide (WHO, 1983) [1]. [score:1]
Using ISH, miR-202-5p was localized to Sertoli cells of men with normal spermatogenesis, but not in the Sertoli cells of men with SCO. [score:1]
The tissue of men with confirmed SCO had no signal detectable for miR202-5p in Sertoli cells (Figures  4 and 5). [score:1]
Double-Dig-labeled probe for miR-202-5p (miRCURY LNA™ Detection probe, 5′-DIG and 3′-DIG labeled hsa-miR-202-5p, Exiqon, Cat No. [score:1]
[1 to 20 of 26 sentences]
4
[+] score: 70
MiR-202-5p also inhibits the expression of γ-catenin and BCL-2. It seems that miR-202-5p may function as a novel tumor suppressor in gastric cancer, and its anti-tumor activity may attribute the direct targeting and inhibition of Gli1 [48]. [score:12]
Colorectal cancer pathway with interaction between significant up-regulated miRNAs, let-7f-5p, miR-455-3p, miR-98, miR-155-5p, and down-regulated miRNAs, miR-1, miR-127-5p, miR-142-5p, miR-202-5p after radiation and SN38 treatments and their target genes. [score:9]
Heatmap of four most significant up-regulated miRNA, let-7f-5p, miR-455-3p, miR-98 and miR-155-5p, as well as four most down-regulated miRNA, miR-1, miR-127-5p, miR-142-5p and miR-202-5p after radiation and SN38 treatments, and different pathways by clustering from pathway union. [score:7]
Moreover, from EBarrays, we found miRNAs, such as let-7f-5p, miR-455-3p, miR-98, miR-155-5p, up-regulated to the highest degree and miRNAs, miR-1, miR-127-5p, miR-142-5p, miR-202-5p were down-regulated most, after the radiation and SN38 treatment. [score:7]
We also found in KM12C and KM12L4a cells with p53 mutation, let-7f-5p, miR-455-3p, miR-98, miR-155-5p and miRNAs were up-regulated, whereas miR-1, miR-127-5p, miR-142-5p and miR-202-5p remained undetected after the radiation and SN38 treatment. [score:5]
The results showed that let-7f-5p, miR-455-3p, miR-98 and miR-155-5p were up-regulated in KM12C (Supplementary Figure S1) and KM12L4a (Supplementary Figure S2) cell lines after radiation and SN38 treatment, whereas miR-1, miR-127-5p, miR-142-5p and miR-202-5p were undetected in KM12C and KM12L4a cell lines after radiation and SN38 treatment. [score:4]
In summary, after radiation and SN38 treatment, we found that most significant up- or down-regulation and interactions of 8 miRNAs (let-7f-5p, miR-455-3p, miR-98, miR-155-5p, miR-1, miR-127-5p, miR-142-5p, miR-202-5p), 7 cytokines (IL-1β, IL-4, IL-6, IL-10, IFN- γ, VEGF, TNF- α) and 2 chemokines (IL-8, MIP-1-α) were dependent on p53 status in colon cancer cells. [score:4]
miR-202-5p was down-regulated in HCT116 [p53−/−] cells after the SN38 treatment. [score:4]
miR-202-5p is also frequently down-regulated in gastric cancer. [score:4]
On the other hand, miR-202-5p was down-regulated (>9.5 times) in HCT116 [p53−/−] cells after the treatment. [score:4]
Transcriptional factor Gli1 is a target of miR-202-3p and plays an essential role as a mediator of the biological effects of miR-202-5p in gastric cancer. [score:3]
RNA22 and DIANA-microT describe possible interactions with VEGF, while RNA22 alone foretells about its interaction with TNF- α. miR-142-5p: miRanda points towards possible interactions of has-miR-142-5p with IL-6. miR-202-5p: TargetScan, PicTar, and miRanda foretell about miR-202-5p interaction with IL-6. RepTar describes two interaction sites of has-miR-202 in IL-10. [score:3]
To validate our results found in HCT116 cells, we further examined the expression of miRNAs, let-7f-5p, miR-455-3p, miR-98, miR-155-5p, miR-1, miR-127-5p, miR-142-5p and miR-202-5p in KM12C and KM12L4a human colon cancer cell lines. [score:3]
RNA22 detects probable miR-202-5p interactions with chemokine MIP-1 α. PicTar also forecasts interaction with IL-8. Increasing dose (2Gy-10Gy) of radiation was used to test the cellular viability of HCT116 [p53+/+], HCT116 [p53+/−] and HCT116 [p53−/−], and 2Gy radiation is used as an ID [50] value for all the subsequent experiments. [score:1]
[1 to 20 of 14 sentences]
5
[+] score: 58
The number of targets that passed quality control filters for the remaining HPD-miRNA were hsa-mir-202 (1145 targets), hsa-mir-1304 (710 targets), hsa-mir-1269a (488 targets), hsa-mir-4482-1 (144 targets), hsa-mir-449c (69 targets), and hsa-mir-4707 (1 target). [score:15]
Recent in vitro functional data demonstrated that the T-allele was protective against breast cancer mortality by first increasing mature hsa-mir-202 expression levels, leading to subsequent down-regulation of its gene targets, including cancer related genes CRYBB2, DICER1, SART1, S100A8, P2RX3, and BRCA1[42]. [score:8]
Of the 31 PD-miRNAs, 7 miRNAs (hsa-mir-202, hsa-mir-196a-2, hsa-mir-423, hsa-mir-943, hsa-mir-520h, hsa-mir-1908 and hsa-mir-647) were identified in prior studies as being differentially expressed in human diseases representing a significant increase above expectation (1.1 out of 31) for disease -associated miRNAs (95% C. I. = 1.08 – 1.11; p = 2.2 × 10 [−16]) (Figure  5B). [score:7]
In the context of tissue specific expression, hsa-mir-202 expression varies considerably by tissue type and is more highly expressed in prostate cells compared to breast or ovarian tissues (Additional file 2: Figure S7). [score:6]
Tissue specific expression of hsa-mir-202. [score:3]
Notably, one of our PD-miRNAs, hsa-mir-202, contains a T-allele with known effect on miRNA expression and a protective effect on breast cancer mortality [42]. [score:3]
Diminished expression of mature hsa-mir-202 in individuals harboring at least one non T-allele resulted in a significantly elevated risk of non-Hodgkin lymphoma (OR = 1.83, 95% CI: 1.17–2.85; P = 0.008) [42]. [score:3]
Notably, hsa-mir-202, a potential breast cancer biomarker, was found to show significantly high allele frequency differentiation at SNP rs12355840, which is known to affect miRNA expression levels in vivo and subsequently breast cancer mortality. [score:3]
Figure 6 The role of miRNA hsa-mir-202 SNP in gene expression and breast cancer. [score:3]
Specifically, we find a T-allele at SNP rs12355840 in hsa-mir-202, that has been shown to increase miRNA expression in vivo and to be protective against breast cancer mortality [42], and to be highly PD between African and non-African populations. [score:3]
Our data showed that African and African American populations had a lower frequency of the T-allele compared to European and Asian populations, suggesting decreased baseline expression levels of mature hsa-mir-202 in African populations. [score:2]
Overall, we identify 7 PD-miRNAs that are currently implicated as cancer biomarkers or diagnostics: hsa-mir-202, hsa-mir-423, hsa-mir-196a-2, hsa-mir-520h, hsa-mir-647, hsa-mir-943, and hsa-mir-1908. [score:1]
Allele Frequency for hsa-mir-202 T-allele. [score:1]
[1 to 20 of 13 sentences]
6
[+] score: 47
miR-149, miR-202, and miR-410 were identified using TargetScan 5.1 (Figure S4), and miR-let7a expression was also measured as it is a known functional modulator of IL-6 expression [34]. [score:5]
To evaluate the ability of the putative IL-6 -targeting microRNAs to regulate expression of IL-6, the BEAS-2B cell line was transfected with a negative control (NegCO) microRNA or mimics for miR-149, miR-202 or miR-410. [score:4]
0090401.g006 Figure 6 To evaluate the ability of the putative IL-6 -targeting microRNAs to regulate expression of IL-6, the BEAS-2B cell line was transfected with a negative control (NegCO) microRNA or mimics for miR-149, miR-202 or miR-410. [score:4]
Comparison of constitutive (0 µg/ml) and LPS -induced (1 µg/ml, 6 h post-treatment) microRNA expression in primary airway epithelial cell cultures derived from one-year-old juvenile rhesus monkeys with prior ozone and/or LPS exposure as described in Figure 1. (A) miRNA-149, (B) miRNA-202, (C) miRNA-410, (D) miRNA-let7a. [score:3]
Relative luciferase units observed in HBE cells co -transfected with IL-6 gene target luciferase reporter plasmid and miR-202 or miR-410 were similar to transfection with the negative microRNA mimic. [score:3]
Similar to miR-149, miR-202 expression at baseline was lowest in the ozone + in vivo LPS group, with exposure -dependent effects that were near statistical significance (Figure 5B; two-way ANOVA for in vivo exposure and in vitro LPS treatment; p = 0.06 for exposure and p = 0.04 for LPS). [score:3]
Effect of postnatal ozone exposure on miR-149, miR-202, miR-410 and miR-let7a expression in juvenile monkey airway epithelial cell cultures. [score:3]
There was also a trend towards exposure -dependent differences in miR-202 expression in airway epithelium, with reduced levels in cultures derived from animals with prior ozone exposure (Figure 5B). [score:3]
To evaluate the ability of putative IL-6 targeting microRNAs (miR-149, miR-202, miR-410) to modulate IL-6 mRNA and/or protein expression, the human bronchial epithelial cell line, BEAS-2B S. 6 was transfected with microRNA mimics (Figure 6A). [score:3]
In contrast, miR-202 expression levels were reduced in response to in vitro LPS treatment. [score:3]
The immortalized human bronchial airway epithelial cell line BEAS-2B S. 6 [35] was transfected with 30 nM mirVana mimics of hsa-miR-149-5p, hsa-miR-202-3p, hsa-miR-410 and the miR#1 negative control (lacking any mammalian target) using lipofectamine (Applied Biosystems). [score:3]
Several gene targets involved in innate immune responses have also been described for both miR-410 and miR-202; it has been speculated that these microRNAs play a role in repressing inflammatory reactions [56], [57], [58]. [score:3]
0090401.g005 Figure 5Comparison of constitutive (0 µg/ml) and LPS -induced (1 µg/ml, 6 h post-treatment) microRNA expression in primary airway epithelial cell cultures derived from one-year-old juvenile rhesus monkeys with prior ozone and/or LPS exposure as described in Figure 1. (A) miRNA-149, (B) miRNA-202, (C) miRNA-410, (D) miRNA-let7a. [score:3]
The Taqman MicroRNA Reverse Transcription Kit was used for reverse transcription of hsa-miR-let7a, hsa-miR-149-5p, hsa-miR-202-3p and hsa-miR-410 with target-specific stem loop structure primers (Applied Biosystems). [score:2]
Comparatively, transfection with miR-202 or miR-410 did not significantly affect IL-6 mRNA or protein levels. [score:1]
miR-149, miR-202 and miR-410 were selected based on conservation within the mammalian species and a low total context score (<−0.1) for human IL-6 3′ UTR (Supporting Data Figure 4). [score:1]
[1 to 20 of 16 sentences]
7
[+] score: 30
logFC p-value B-statistic microRNA 0.98 3.53E-08 9.07 hsa-miR-1244 0.74 2.34E-07 7.34 hsa-miR-494 0.45 6.83E-07 6.34 hsa-miR-1979 0.31 3.97E-06 4.66 hsa-miR-1826 0.77 9.14E-06 3.85 hsa-miR-1281 −0.31 1.13E-05 3.65 hsa-miR-202 −0.37 1.14E-05 3.64 hsa-miR-4284 −0.49 1.70E-05 3.25 hsa-miR-221-star −0.89 6.51E-05 1.94 hsa-miR-3172 −0.63 9.48E-05 1.57 hsa-miR-548a-3p −0.43 1. 02E-04 1.49 hsa-miR-1272 −0.34 1.29E-04 1.27 hsa-miR-15a −0.40 1.59E-04 1.06 hsa-miR-3152 −0.22 2.56E-04 0.59 hsa-miR-142–5p 0.24 3.03E-04 0.43 hsa-miR-4270 −0.29 3.27E-04 0.35 hsa-miR-1910 −0.42 3.29E-04 0.35 hsa-miR-34a-star −0.18 3.78E-04 0.21 hsa-miR-381 −0.30 4.10E-04 0.13 hsa-miR-450b-5p 0.30 4.34E-04 0.08 hsa-miR-1469 We also looked for differentially expressed miRNAs (BH adjusted p < 0.05) that may target differentially expressed mRNAs (BH adjusted p < 0.05). [score:7]
Consistently across all 11 LCL cell lines, MTHFD2 (expressed as an average of probeset ID 8042830 & 8084064) showed increased expression whereas hsa-miR-202 showed decreased expression after pemetrexed exposure. [score:7]
Supplemental Table  3 shows the correlated miRNAs and mRNAs with their p-values from the analyses of differential expression after pemetrexed exposure, including the pair MTHFD2 (methylenetetrahydrofolate dehydrogenase, p = 1.46 × 10 [−5]) and hsa-miR-202 (p = 1.13 × 10 [−5]), as well as SUFU (pair suppressor of fused homolog, p = 1.1 × 10 [−4]) and hsa-miR-494 (p = 2.34 × 10 [−7]). [score:5]
Figure 3 MTHFD2 and hsa-miR-202 expression in pemetrexed treated and untreated LCL samples. [score:3]
Consistently across all 11 cell lines, pemetrexed treatment resulted in an increase in expression levels of MTHFD2 with a corresponding decrease in hsa-miR-202 levels (Fig.   3). [score:3]
One of the miRNA/mRNA pairs we identified as relevant following treatment with pemetrexed was hsa-miR-202 and one of its predicted targets MTHFD2. [score:3]
The miRNA hsa-miR-202 is a putative regulator of MTHFD2. [score:2]
[1 to 20 of 7 sentences]
8
[+] score: 26
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
This network visualization shows that (1) all modules contain at least 2 genes that are predicted targets of a deregulated miRNA identified in this study, except the module “Apoptosis and NAFLD”; (2) dre-miR-2189, the only DE miRNA that was downregulated, targets many genes in modules that are predominantly upregulated such as Cell cycle (4 target mRNAs), Apoptosis and Autophagy (19 targets), Epigenetics and Apoptosis/Autophagy (2 targets) and Receptors (4 targets); (3) certain miRNAs have only 1 target gene in the selected modules, including dre-miR-184 (“Oxidative phosphorylation”), dre-miR-430a and dre-miR-430b (“Apoptosis and Autophagy”); (4) while other miRNAs have common target genes in the same modules, i. e., dre-miR-725/dre-miR-724/dre-miR-193a, dre-miR-202, dre-miR-205 and dre-miR-133a that have several common target genes in modules “Oxidative phosphorylation and NAFLD”, “Apoptosis/Autophagy”, “NAFLD” and “Cell cycle”. [score:26]
[1 to 20 of 1 sentences]
9
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
The effect of masculinization treatment with either a synthetic androgen (17-α-methyl testosterone) or an inhibitor of cytochrome P450 aromatase (Fadrozole) on miRNA expression has been studied in Atlantic halibut; masculinization treatment resulted in differential expression of let-7a, miR-19b, miR-24, and miR-202-3p in gonads (Bizuayehu et al. 2012b). [score:7]
Similarly, 52 miRNAs, such as hsa-miR-202, hsa-miR-365, and hsa-miR-412 have active splice sites within a pri-miRNA, which can be a regulatory factor for their expression in tissue- and development-specific manner (Melamed et al. 2013). [score:5]
Also, miR-202-5p/3p transcripts were identified as potential regulators of mouse embryonic gonad differentiation with strong expression in Sertoli cells (Wainwright et al. 2013). [score:4]
The expression of let-7a, miR-143, miR-145, and miR-202-3p was significantly higher in adult testis compared with adult ovary, and miR-451 was significantly downregulated in brain of juveniles compared with adult females (Bizuayehu et al. 2012b). [score:4]
Ramachandra et al. (2008) Oocyte and early embryo miR-34 Zebrafish Knockdown, microarray, qRT–PCR Nervous system development Soni et al. (2013) Oocyte miR-15, miR-29, miR-92, miR-101, miR-126, miR-181-3p, miR-196, miR-202-5p, miR-202-3p, miR-221, miR-301, miR-338, and miR-2184 Rainbow trout Microarray ? [score:3]
Juanchich et al. (2013) let-7, miR-10, miR-21, miR-24, miR-25, miR-30, miR-143, miR-146, miR-148, and miR-202 Rainbow trout NGS ? [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 20
During development of the mouse testes, miR-202-5p is a direct transcriptional target of SOX9, a transcription factor that plays a role in male sex determination [50]. [score:5]
For example, fru-miR-202-5p exhibited much higher expression levels in the ovaries than in the somatic tissue, although the proportion of miRNAs in somatic tissue is much greater than that in the gonads, suggesting that they play crucial roles in germ cells. [score:3]
Even though the ovaries and testes had a much lower proportion of miRNAs than somatic tissue, some miRNAs, such as fru-miR-202-5p and fru-miR-2478-3p, had higher levels of expression in the ovaries and testes, respectively, than in somatic cells. [score:3]
They exhibited an approximately 24-fold higher expression level, in the ovaries compared with the testes, followed by fru-miR-202-5p, fru-miR-24-3p, and fru-miR-145b-5p, whose expression levels were approximately 22-, 20-, and 20-fold higher, respectively, in the ovaries compared with the testes. [score:3]
These results suggest that miR-202-5p has an important function that involves sex determination during testes development, and also plays a crucial role in postnatal ovaries and testes [50]. [score:2]
For example, fru-miR-1-3p was muscle specific, fru-miR-196a-5p was skeletal muscle specific, fru-miR-499-5p was heart and slow muscle specific, fru-miR-204-5p was eye specific, fru-miR-9-3p was brain and eye specific, fru-miR-192-5p was intestine and liver specific, fru-miR-122-5p was liver specific, and fru-miR-202-5p was ovary specific. [score:1]
However, in our study, fru-miR-202-5p was detected in both the ovaries and the testes because our sample was at a mature stage, a result that is consistent with previous studies; miR-202-5p is a postnatal gonad-specific miRNA in Atlantic halibut (Hippoglossus hippoglossus), Xenopus, mice, pigs, and humans [52– 56]. [score:1]
miR-202-5p exhibits sexual dimorphism during gonadal sex differentiation [49, 50]. [score:1]
However, for fru-miR-499-5p, fru-miR-192-5p, fru-miR-196a-5p, fru-miR-202-5p (data not shown) and fru-miR-2478-3p, the results from q-PCR were not consistent with the sequencing results. [score:1]
[1 to 20 of 9 sentences]
11
[+] score: 18
Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-498
The repressive role of the 3-C1-AHPC/miR-202/Mad1 axis on hTERT expression was supported by the observation that the overexpression of pre-miR-202 and inhibition of miR-202 resulted in the decreased and increased repressive activity of Mad1 on hTERT expression, respectively. [score:9]
For example, 4-[3-(1-adamanyly)-4-hydroxyphenyl]-3-chlorocinnamic acid (3-C1-AHPC), an adamantyl-related molecule, has been shown to inhibit the expression of miR-202, which targets Mad1 gene, and hence lead to de-repression of hTERT gene and increased telomerase activity [140]. [score:7]
Farhana L. Dawson M. I. Fontana J. A. Down regulation of miR-202 modulates Mxd1 and Sin3A repressor complexes to induce apoptosis of pancreatic cancer cells Cancer Biol. [score:2]
[1 to 20 of 3 sentences]
12
[+] score: 17
This deviant DNA methylation causes damping of miRNA tumour suppressors such as let-7, miR-101, and miR-202 that target MYCN; miR-9 that targets tyrosine kinase (Trk) C, RE-1 silencing transcription factor (REST), DNA -binding protein inhibitor (ID2), and Matrix metalloproteinase-14 (MMP-14); miR-34a that targets E2F transcription factor 3 (E2F3), B-cell lymphoma 2 (Bcl-2) and MYCN; miR-340 that targets SRY (sex determining region Y)-box 2 (SOX2); miR-184 that targets v-akt murine thymoma viral oncogene homolog 2 (Akt2); and miR-335 that targets Mitogen-Activated Protein Kinase 1 (MAPK1), leucine-rich repeat 1 (LRG1), and Ser/Thr Rho kinase 1 (ROCK1) [101] (Figure 1). [score:17]
[1 to 20 of 1 sentences]
13
[+] score: 15
In the context of a putative role of miRNA in pGE, it is noteworthy that several mRNAs, upregulated upon mTEC maturation, showed tissue-specific expression patterns, i. e. being restricted to brain (miR-124 and miR-129), heart (miR-499), testis (miR-202), skin (miR-203) or embryo (miR-467 and miR-302). [score:6]
miR-202 was affected in the opposite manner, being highly upregulated in both immature and mature mTECs of Aire null mutants (Fig. 2B). [score:4]
miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were stably expressed at two- to tenfold higher level in the mTEC [high] subset independent of the maturation marker used for sorting the cells (Fig. 1C). [score:3]
Interestingly, miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were differentially regulated in immature and mature Aire [neg] versus mature Aire [pos] mTEC subsets. [score:2]
[1 to 20 of 4 sentences]
14
[+] score: 14
Normalization with miR-202 showed a significant upregulation of miR-328, miR-362-3p, miR-451 and miR-486 (Fig. 4). [score:4]
By this method, we identified that miR-202 was stably expressed among all the injury groups as well as in the control group and therefore it was selected as endogenous control for all the subsequent experiments. [score:3]
MiR-202, which gave most stabilized expression both in control and TBI samples, was used as an endogenous control for the validation of all selected candidate miRNAs. [score:3]
Normalization was done with mir-202 which showed the least standard deviation and was selected as a normalizing control. [score:1]
Each miRNA was calibrated to a selected endogenous control miR-202 to get a delta Ct (ΔCt) value for each miRNA (miRNA Ct value–miR-202 Ct value). [score:1]
Normalization was done with miR-202 which showed the least standard deviation and was selected as a normalizing control. [score:1]
The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p, miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. [score:1]
[1 to 20 of 7 sentences]
15
[+] score: 14
Vice versa, miR-202 showed down-regulation of miR-202-3p (p = 0.05) while miR-202-5p was significantly up-regulated (p = 0.04). [score:7]
Clearly, the 3p form is up-regulated while the 5p form is down regulated for miR-3180 (panel a) while miR-202 shows the opposite behavior (panel b). [score:5]
Pileup plots for both miRNAs showing the accurate mapping pattern of reads to the mature miRNAs are presented in Figure  4 (a: miR-3180, b: miR-202). [score:1]
In this figure, opposite fold changes of the 3p and the 5p mature form of miRNAs is shown for two miRNAs, miR-3180 in panel a and miR-202 in panel b. The right part shows the pileup plots, the sequence in the middle represents the precursor, the two mature forms are highlighted in red (5p) and blue (3p) and with the blue shaded area. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 12
miR-202 and miR-500 were expressed constitutively but their expression did not change after activation by Poly(I:C) or IFN-γ in both cell type. [score:5]
MiR-144*, miR-30d-3p, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p and miR-302c* expression was determined by RT-qPCR in RAFLS (n = 3) and SScHDF (n = 3) stimulated with Poly (I:C) (10 µg/mL) or IFN-γ (0.1 or 5 ng/mL) for 72 h. were normalized to U6snRNA and expressed as fold change compared with samples from RAFLS or SScHDF incubated with medium. [score:4]
uk/enright-srv/microcosm/htdocs/targets/v5) identified several miRNAs candidates: miR-144*, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p, miR-302c* and miR-30 family members (miR-30a, d and e which share the same seed sequence). [score:3]
[1 to 20 of 3 sentences]
17
[+] score: 11
It has been found that, in chronic gastritis, the expression of miR-1 and miR-155 is upregulated, whereas the expression of miR-20, miR-26b, miR-202, miR-203, and miR-205 is downregulated. [score:11]
[1 to 20 of 1 sentences]
18
[+] score: 11
In chicken, the expression of miR-202 was observed to be sexually dimorphic, with up regulation in the development of testis from the onset of sexual differentiation. [score:5]
miR-202-5p was highly expressed in adult human testis, which is consistent with the observation in mouse testis [6]. [score:3]
These findings indicated that miR-202 may function in the regulation of testicular development and spermatogenesis [59]. [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 11
Other miRNAs from this paper: bta-mir-202
d The effect of DMI methylation on bta-mir-202 expression, top: methylation distribution of CGs in DMIs by tissue, bottom: expression level of bta-mir-202 by tissue. [score:5]
One of the significantly correlated genes, bta-mir-202, was reported to be only expressed in testis and ovary of cattle [45]. [score:3]
Thus, our results supported the negative correlation between a reduced CG island methylation and an increased expression of bta-mir-202 in the testis. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 9
- In, miR-448 (position 7), miR-450 (position 8), and miR-202 (position 11) show up-regulation; miR-453 (position 6) is a borderline case, although the Western blot suggests that it could be classified as a true positive. [score:4]
5 miRs from the 23 targets that were predicted only by HuMiTar and which are not included in the PicTar's database, i. e. miR-202, miR-248, miR-412, miR-453, and miR-450. [score:3]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
Analysis of 39 miRs that were predicted exclusively by HuMiTar shows that 11 of them (miR-101, miR-126, miR-129, miR-134, miR-144, miR-151, miR-202, miR-384, miR-412, miR-450, miR-453) are included in the Western blot on Figure 3. Among them, nine are true positives, miR-453 is a borderline case, and miR-412 is a false positive. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 9
The top most highly expressed miRNAs in ERBB2 overexpressing cell lines included hsa-let-7b, hsa-miR-640, hsa-miR-200c, hsa-miR-378, hsa-miR-141, hsa-miR-196a, hsa-miR-29c, and hsa-miR-18a*, whereas hsa-miR-501-5p, hsa-miR-202, hsa-miR-760, and hsa-miR-626 were more highly expressed in luminal cell lines lacking ERBB2 overexpression (fold change ≥ 1.5) (see Table S8 in Additional file 1). [score:9]
[1 to 20 of 1 sentences]
22
[+] score: 9
A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
Real-time PCR revealed that hsa-miR-133b, hsa-miR-204-5p, hsa-miR-30e-5p, hsa-miR-4270, hsa-miR-129-2-3p, hsa-miR-202-3p, hsa-miR-195-5p, hsa-miR-664b-3p, hsa-miR-497-5p, hsa-miR-34b-5p, hsa-miR-513a-5p, and hsa-miR-101-3p were statistically upregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3A). [score:3]
Figure 3 A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
[1 to 20 of 3 sentences]
23
[+] score: 8
HHV-6A infection, but not -6B or −7 infections, induced a decrease in miR-155_2 expression and an increase in miR-1238 expression in thyrocytes, as well as an increase in the expression levels of several autoimmunity -associated miRNAs in T lymphocytes, including miR-16_1, miR34a, miR-130a, miR-143_1, miR-202, miR-301b, miR-302c, miR-449b, miR-451_1, and miR-1238_2. [score:7]
In fact, HHV-6A infection (but not HHV-6B or HHV-7 infection) induced a remarkable increase in several autoimmunity-related miRNAs, namely: miR-16, miR-34a, miR-130a, miR-202, miR-301b, miR-302c, and miR-449b. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 8
Zhang Y et al. found that miR-202 suppresses cell proliferation in human hepatocellular carcinoma by downregulating LRP6 protein expression [49]. [score:8]
[1 to 20 of 1 sentences]
25
[+] score: 8
12 microRNAs passed the threshold of mean fold change > 1.3 and p-value < 0.05 between the lean and obese groups, with one microRNA significantly downregulated (miR-299-3p) and nine significantly upregulated (miR-202-3p, -15b-5p, -451, -24-2-5p, 1184, -187-5p, -486-5p, -10b-5p, and -223-3p). [score:7]
miR-187, miR-202, and miR-299-3p were not significantly correlated with any of the four markers. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 8
Interestingly, knockdown of DICER reduced the expression of all 10 members of the let-7 family including miR-98 and miR-202 (46) by >30% (Figure 3A, Supplemental Table S3). [score:4]
The expression of most members in the let-7 family including miR-98 in MRC5SV cells was above 1000 in a real count except miR-202 (Supplementary Table S3). [score:3]
The human let-7 family has 10 members including miR-98 and miR-202 (46). [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 7
The up-regulated miRNAs include let-7a and miR-99a and the down-regulated include miR-196a, miR-470, miR-21*, miR-208a, miR-683, miR-184, miR-693-3p, miR-202-3p, miR-429, miR-878-3p and miR-327. [score:7]
[1 to 20 of 1 sentences]
28
[+] score: 7
For example, mir-202, mir-17-3p, mir-517 targets are highly expressed in EMT tumors and lowly expressed in the more luminal tumors. [score:7]
[1 to 20 of 1 sentences]
29
[+] score: 7
Among these potential miRNA regulators, only 6 are actually expressed in CCs: MIR425, MIR744, MIR146b, Let-7d for the CC [youger]-CC [median] super group and MIR202, Let-7e for the CC [older]. [score:4]
Interestingly MIR202 is a potential regulator of the hyaluronan synthase-encoding gene HAS2 that is related to aging and angiogenesis [22] and MIR744 is a TGFB1 validated regulator [23]. [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 7
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-142
They conclude that miRNA (miR)-129-5p, miR-142-3p, miR-202, and miR-16 are targeting human GHR and inhibit its translation in the three cell lines. [score:7]
[1 to 20 of 1 sentences]
31
[+] score: 7
Some differentially expressed miRNAs had multiple predicted viral targets, such as gga-miR-202 which is predicted to target all nine AIV genes. [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 6
Seven miRNAs (mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p and mmu-miR-5119) were upregulated and the other five (mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p) were downregulated in the CCl [4] group compared with the control (Fig. 1a,b). [score:6]
[1 to 20 of 1 sentences]
33
[+] score: 5
Only two aberrantly expressed miRs (miR-17-3p and miR-202) overlapped among biological sources. [score:3]
Several other miRs considered as biomarkers for DLBCL (miR-17-5p, 145-5p and miR-15a, Figure 2A, 2e) and FL (miR-17-3p and miR-202, Figure 2A, 2f) showed opposite expression levels in different biological sources. [score:2]
[1 to 20 of 2 sentences]
34
[+] score: 5
In human gastric cancer, multiple miRNAs with aberrant expression have been identified, for example, miR-21, miR-22, miR-23, miR-127, miR-148, miR-202 and miR-433, which played oncogenic or suppressive role [20]– [25]. [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
It has been found that female aging alters the expression of variety of genes in human cumulus cells being essential for oocyte quality and potential targets of specific miRNAs previously identified in cumulus cells, such as miR-425, miR-744, miR-146b, and Let-7d for younger (<30 years) and middle-aged (31–34 years) women and miR-202 and Let-7e for elder (>37 years) women [41]. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
McBride et al. (2012) observed nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) with decreased expression and eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) with increased expression between the follicular and luteal stages in ovine ovarian tissues [21]. [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 5
Five miRs have one single target gene (miR-202: CBFA2T3, miR-500: NEBL, miR-378: KIF26A, miR-892b: BACH2, miR-1305:ID1), with a restricted impact on gene expression modulation. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
[1 to 20 of 1 sentences]
39
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
A panel of five circulating miRNAs was observed to be upregulated in serum samples from infected patients (miR-202, miR-342-5p, miR-206, miR-487b, and miR-576-5p), showing high sensitivity and specificity for differentiation of pertussis patients and HC. [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
It is already known that several miRNAs of this group (miR-21, -22, -24, 27a and -29a) target lipid metabolism genes and pathways (Supplementary Table S3), but there are no studies showing such an association with miR-202, -663a, -1260 and -3929. [score:3]
This confirms the previously reported roles of miR-21, -22, -24, 27a and -29a; and suggests novel roles for miR-202, -663a, -1260 and -3929 in lipid pathways. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 4
In contrast, seven of the apoptosis -associated miRNAs, including miR-153, miR-155, miR-182, miR-202, miR-204, miR-296 and miR-337, were obviously down-regulated. [score:4]
[1 to 20 of 1 sentences]
42
[+] score: 4
Furthermore, they experimentally validate miR-449, miR-19a/b, miR-29a/b/c, and miR-202 as direct MYCN -targeting miRNAs. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 4
Other miRNAs from this paper: hsa-mir-206
Long non-coding RNA metastasis -associated lung adenocarcinoma transcript 1 regulates the expression of Gli2 by miR-202 to strengthen gastric cancer progression. [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 3
For example, the three members of the let-7 family (let-7a, let-7f, let-7k) are broadly expressed across tissues [36] and tissue enrichment has been found for miR-499-5p and −3p in heart [37], miR-122-5p in liver [38], miR-202-5p in testis [39] and gga-miR-107-3p in brain tissues [40] (Table 2). [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
For example, four transporters genes were negatively correlated with rifampin -induced miRNA expression: SLC47A1/miR-95, SLC29A1/miR-30d#, SLC22A9/miR-202, and SLCO1B3/miR-92a (Table 3). [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Lee ST Altered Expression of miR-202 in Cerebellum of Multiple-System AtrophyMol Neurobiol. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
For instance, when compared to healthy controls, the levels of circulating miRNAs predicted to regulate the expression of pro- and anti-inflammatory cytokine genes (e. g., miR-125a, miR-181, miR-202, miR-374b and miR454) as well as genes involved in neuronal survival and central nervous system signalling have been shown to be increased or decreased in samples obtained post-polytrauma or TBI [36, 38]. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
In esophageal cancers cell line KYSE150, as shown in the up panel of Figure 2A, over -expression of MIR30e, MIR363, MIR498, MIR196, MIR422, MIR337 or MIR202 remarkably increase the LC3-I to LC3-II conversion whereas miR-20b modestly decrease. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Some of these tissue-specific expression patterns are evolutionary conserved, for instance, the testis-specific mir-202 was previously reported to be testis-specific in chicken as well [46]. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Sno miRNA-202 was used as endogenous controls for expression analysis (Choi et al., 2013). [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
For example, the miR-202/ miR-202* expression ratio changes from ∼0.5 to ∼0.9 during female gonadogenesis in chicken embryos [16], and mouse miR-194-5p is present at a higher level than miR-194-3p in kidney and stomach, but at a lower level in lung and uterus [17]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
Hsa-miR-202 and hsa-miR-132 were chosen upon FC > 2 expression in cell cycle phases. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 2
While some miRNAs were significant in many scenarios (including hsa-miR-106a (130 comparisons), hsa-miR-361-5p (130 comparisons), hsa-miR-17 (125 comparisons), hsa-miR-423-5p (125 comparisons), hsa-miR-320d (122 comparisons), and hsa-miR-20a (120 comparisons)), others were significantly dysregulated in just a few comparisons (including hsa-miR-506 (3 comparisons), hsa-miR-202* (5 comparisons), hsa-miR-361-3p (6 comparisons), hsa-miR-429 (7 comparisons), hsa-miR-548a-3p (9 comparisons), or hsa-miR-518e (9 comparisons)). [score:2]
[1 to 20 of 1 sentences]
54
[+] score: 2
The Let-7 family has 10 members in the human genome (Let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i, miR-98, and miR-202 [38]), which are involved in gene regulation and cell adhesion. [score:2]
[1 to 20 of 1 sentences]
55
[+] score: 2
The promoter of the genes encoding seven of them (miR-29a-3p, miR-34a, miR-126, miR-141, miR-181c-5p, miR-202 and miR-517a-3p) contained CpG islands, whose methylation significantly decreased after treatment with 5′-AZA (see later). [score:1]
We focused our analysis on 12 miRNAs (miR-22, miR-29a-3p, miR-34a, miR-126, miR-140-3p, miR-141, miR-181c-5p, miR-202, miR-455-5p, miR-508-3p, miR-517a-3p and miR-576-3p). [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 2
Thirteen mRNA were specifically related to homozygous/heterozygous status of KIT mutation: miR-518f, miR-331, miR-628, miR-145, miR-139, miR-335, miR-526b, miR-190, miR-548c, miR-202, miR-339, miR-203, and miR-301b (Anova test p<0.05). [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 1
In mammals it comprises several let-7 species (let-7a to let-7i) and other miRNAs, such as miR-98 and miR-202 [101]. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-141, hsa-mir-449a
Two miRNAs (miR-34a, miR-141) existing wi dely in epithelial cells of male reproductive organs, two testis-specific miRNA (miR-202, miR-449a), and two piRNAs (piR-013423, piR-023386) were involved in this study. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
In humans, 13 let-7 family precursor miRNAs were described (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7e, let-7f, let-7g, let-7i, miR-98, and mir-202) which code for 10 different mature let-7 miRNA isoforms [25]. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
However, six miRNAs (miR-17, miR-202, miR-425, miR-493, miR-624 and miR-625) had a higher number of sequencing reads originating from the annotated miRNA* strand than the mature miRNA sequence across majority of the libraries (Additional File 3). [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Additionally, miR-202 miR-423-5p miR-503 miR-184 and miR-922 bind also to the conserved binding region chromosome 15 positions 58889443–5889473 and miR-330-5p (chr15:58889149–58889178), miR-671-5p (chr15:58889720–58889745) and miR-432 (chr15:58889688–58889718) bind to a region with good conservation also to the far related species zebra fish, but these eight miRNAs have no indication to be involved in AD (Table  1). [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Humans have 13 let-7 family members [8], including let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-98, and miR-202, which are located in nine different loci on chromosomes 3, 9-12, 19, 21, 22, and X. A total of ten mature let-7 -family sequences are produced from the 13 precursor sequences. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
MiR-186, miR-769, miR-95, miR-202 and let-7 g were also relevant to cancer pathways, but did not serve other functions. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
The remaining ten associations include six miR-SNPs associated with a risk role in overall survival in both gastric cancer and non-small cell lung cancer in Asian patients (rs11614913; hsa-mir-196a-2) [7], increased risk of recurrence and death in patients with colorectal cancer [8], increased risk of death in Caucasian colorectal cancer patients and decreased risk of death in colorectal cancer patients of African American origin [9], favorable overall and recurrence-free survival in Chinese patients with colorectal cancer [10] and decreased risk of recurrence of colorectal cancer in Caucasians (rs4919510, hsa-mir-608) [11], unfavorable overall and recurrence-free survival in Chinese patients with colorectal cancer (rs6505162, hsa-mir-423) [10], better response to chemotherapy in Chinese bladder cancer patients (rs11671784, hsa-mir-27a) [12], improved overall survival of Chinese patients with T-cell lymphoma (rs2292832, hsa-mir-149) [13], and protective role against breast cancer mortality (rs12355840, hsa-mir-202) [14]. [score:1]
[1 to 20 of 1 sentences]