sort by

36 publications mentioning hsa-mir-493

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-493. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 361
Other miRNAs from this paper: hsa-mir-28, hsa-mir-433
miR-493-3p targets the Mad2-3′UTR and downregulates Mad2 expression. [score:8]
miR-493-3p targets the 3′UTR of Mad2 mRNA and suppresses Mad2 gene expression directly. [score:8]
One of the most striking gene expression alterations induced by excess miR-493-3p was downregulation of Mad2, which was reduced by 1.78 fold in the miR-493-3p overexpressing cells in comparison to miR-control (p = 0.0002, Table S1). [score:8]
This suggests that miR-493-3p impairs Mad2 expression directly by targeting Mad2 mRNA while suppression of E2F1 does not contribute to Mad2 depletion. [score:8]
TCGA Cohort: 572 ovarian cancer primary tumor samples and 8 normal ovary tissue samples from the Cancer Genome Atlas Consortium with gene and miRNA expression data available were used in the validation of the association of MAD2 expression with tumor stage and the effects of miR-493-3p expression on patient survival. [score:7]
miR-493-3p impact on Mad2 expression is not due to E2F1 suppression or off-target effect. [score:7]
Next, we examined the relationship between miR-493-3p and Mad2 expressions in two HGSC cell lines, OVCAR-8 and CAOV-3. Analysis of the qRT-PCR and WB readouts indicated that OVCAR-8 cells exhibited low endogenous miR-493-3p expression and high amount of Mad2 mRNA in comparison to the CAOV-3 cells that showed much higher endogenous miR-493-3p expression and reduced Mad2 mRNA (Figure 6A-6B). [score:7]
Suppression of endogenous miR-493-3p upregulates Mad2 and induces mitotic anomalies. [score:6]
Oslo Cohort: Regarding the material for miR-493-3p and Mad2 expression in ovarian carcinomas and ovarian surface epithelium (OSE), women were enrolled prior to operations for gynecological diseases at Oslo University Hospital during 2003-2012. [score:5]
Overexpression of miR-493-3p made the cells almost completely insensitive to taxol; during the 24 hour drug incubation 78.7 +/− 7.2% (p = 0.005) and 81.0 +/− 2.6% (p = 0.003) of miR-493-3p overexpressing OVCAR-8 and CAOV-3 cells, respectively, escaped the taxol imposed M phase block in comparison to miR-controls (Figure 7B). [score:5]
To confirm the suppression of Mad2 in individual mitotic cells by excess miR-493-3p we accumulated miR-control or miR-493-3p overexpressing HeLa cells to pre-anaphase by a 4 h nocodazole treatment and then immunostained the cells with an anti-Mad2 and anti-Bub1 antibodies. [score:5]
Cell were transfected with Pre-miR™ miRNA Precursors for hsa-miR-493-3p and negative control #1 (Ambion, Thermo Fisher Scientific, Waltham, MA, USA), Anti-miR™ miRNA Inhibitor for hsa-miR-493-3p (Ambion) and with miRCURY LNA™ microRNA Target Site Blockers (Exiqon, Denmark) using Hiperfect (Qiagen, Valencia, CA, USA) according to the manufacturer's protocol for reverse transfection. [score:5]
Quantification of the readouts from qRT-PCR and Western blotting validated the suppression of Mad2 by excess miR-493-3p; both mRNA and protein levels of Mad2 were significantly reduced by an average of 68 +/−11% (p = 0.009) and 65 +/−5% (p = 0.002) in miR-493-3p overexpressing cells, respectively, in comparison to miR-controls (Figure 2C-2D). [score:5]
To identify new miR-493-3p target genes implicated in control of mitosis, we performed a global gene expression analysis using miRNA transfected HeLa cells. [score:5]
Next, using the in silico prediction software TargetScan and micTar we found that the mRNA of Mad2 harbors a predicted miR-493-3p targeting sequence in its 3′UTR (Figure 2A). [score:5]
To seek more experimental evidence for the notion that altered miR-493-3p expression contributes to microtubule drug response via influencing Mad2 expression, we tested the taxol response of OVCAR-8 and CAOV-3 cells. [score:5]
Moreover, retrospective analysis of a breast cancer cohort data (Bergen cohort) confirmed the significant association of high miR-493-3p expression with reduced survival in the primary stage III patient group (disease-specific survival, DSS, p = 0.0394, Figure 7D). [score:5]
This may denote a cell line specific difference where in MCF7 cells miR-493-3p induces translational inhibition of E2F1 mRNA without destabilization of the mRNA that instead occurs in HeLa and HCT-116 cells. [score:5]
We conclude that the most aggressive ovarian cancer type in vivo, HGSC, is marked by higher expression of Mad2 and lower expression of miR-493-3p in comparison to non-malignant tissue, and that miR-493-3p and Mad2 levels inversely correlate in ovarian cell lines. [score:5]
D. The Kaplan-Meier plots representing the disease specific survival of primary stage III breast cancer patients divided into high and low miR-493-3p expression and randomized to primary neoadjuvant therapy with either E. Paclitaxel or F. Epirubicin. [score:5]
We hypothesized that prevention of interaction between miR-493-3p and Mad2-3′UTR by a synthetic oligonucleotide would reverse the miR-493-3p mediated suppression of Mad2 expression and restore cells’ response to spindle poisons. [score:5]
Since miR-493-3p also targets E2F1 and MKK7 [25, 29], both of which are implicated in induction of cellular senescence [37- 39], we sought for further evidence of Mad2 contribution on the observed increased senescence in the miR-493-3p overexpressing cells. [score:5]
In the Oslo cohort an inverse expression of miR-493-3p and Mad2 was observed; miR-493-3p expression was significantly reduced in advanced high-grade serous ovarian carcinoma (HGSC) compared to ovarian surface epithelium (OSE, p = 4.79e-09) and clear cell carcinomas (CCC, p = 3.79e-06) while Mad2 was significantly elevated in the HGSC versus OSE (p = 0.02, Figure 5A). [score:4]
Based on the results from in-silico, luciferase reporter and cell -based assays we conclude that miR-493-3p targets Mad2 for suppression. [score:4]
To emphasize the effect of miRNA -mediated regulation of Mad2 expression, we transfected HeLa cells with miR-control or anti-miR-493-3p before analysis of the endogenous miR-493-3p and Mad2 levels. [score:4]
Earlier studies have shown that miR-493-3p participates in the regulation of cell motility and migration via targeting FZD4, RhoC, IGF1R and MKK7 [24- 26]. [score:4]
Especially compelling was the finding that survival of stage III breast cancer patients whose tumors showed upregulation of miR-493-3p was significantly reduced in the paclitaxel therapy arm but not in the epirubicin arm. [score:4]
To understand the functional significance of miR-493-3p dysregulation in cancer we focused on ovarian cancer, a disease often treated with taxane -based chemotherapy. [score:4]
The Mad2 mRNA levels were reduced in the OVCAR-8 cells to 53.9 +/− 15.8% by miR-493-3p overexpression in comparison to controls (p = 0.04) while in the CAOV-3 cells having already low amount of Mad2 mRNA no notable further reduction was observed (Figure 6D). [score:3]
High miR-493-3p expression marks reduced taxol sensitivity in ovarian cancer cell lines and associates with reduced patient survival in ovarian HGSC and in breast cancer post-chemotherapy. [score:3]
Besides our current results on miR-493-3p, also miR-433-3p [17] and miR-28-5p [45, 46] have recently been reported to target Mad2 mRNA. [score:3]
A. Schematic illustration of the predicted targeting site of miR-493-3p in the Mad2 mRNA 3′UTR. [score:3]
miR-493-3p levels negatively associate with Mad2 gene expression in ovarian cancer cell lines. [score:3]
miR-493-3p and Mad2 are inversely expressed in ovarian carcinomas. [score:3]
Quantification of A. miR-493-3p expression, B. Mad2 mRNA and C. Mad2 protein in OVCAR-8 and CAOV-3 cell lines. [score:3]
On the other hand, demethylation and/or amplification of the 14q32 region can lead to overexpression of miR-493-3p and miR-433-3p, resulting in loss of Mad2 and insensitivity of tumor cells to taxol treatment. [score:3]
Moreover, image -based quantification of Mad2 signal intensities after immunostainings with anti-Mad2 antibodies indicated a significant increase in the amount of Mad2 protein in the individual early mitotic cells overexpressing anti-miR-493-3p in comparison to miR-controls (p = 0.009, n = 40 cell analyzed per a group, Figure 4C). [score:3]
C. The Kaplan-Meier plots representing overall survival of HGSC patients divided into high and low miR-493-3p expression groups. [score:3]
Figure 6Quantification of A. miR-493-3p expression, B. Mad2 mRNA and C. Mad2 protein in OVCAR-8 and CAOV-3 cell lines. [score:3]
Figure 7High levels of miR-493-3p confer resistance to taxol in vitro and associate with poor survival in ovarian and breast cancer patients with aggressive disease post-chemotherapy A. Quantification of mitotic slippage in OVCAR-8 and CAOV-3 cultured in the presence of taxol (n = 300 cells). [score:3]
C. Representative fluorescence images of DAPI stained nuclei of miR-control and miR-493-3p overexpressing HeLa cells fixed after overnight treatment with taxol or nocodazole. [score:3]
We conclude that a specific site within the Mad2-3′UTR facilitates the miR-493-3p targeting, and blockage of this site of interference restores the Mad2 protein levels to a amount that is sufficient to maintain SAC -mediated cell cycle arrest in response to spindle poisons. [score:3]
Moreover, the miR-493-3p seed sequence is predicted to target Mad2 mRNA at the nucleotides 1230 - 1223, which is not the site of interference of the aforementioned siRNAs. [score:3]
miR-493-3p overexpression leads to aberrant sister chromatid separation and aneuploidy in cells. [score:3]
Here we report the discovery of a novel post-transcriptional regulator of Mad2, miR-493-3p, and demonstrate how excess of the miRNA causes aneuploidy and development of microtubule drug resistance in cancer cells. [score:3]
First, to validate the efficacy of TSB-MAD2 we co -transfected HeLa cells with different pair-wise combinations of miR-control or miR-493-3p, and a non -targeting TSB-control or TSB-MAD2 followed by determination of the Mad2 protein levels 48 h post-transfection. [score:3]
Figure 2 A. Schematic illustration of the predicted targeting site of miR-493-3p in the Mad2 mRNA 3′UTR. [score:3]
Overexpression of miR-493-3p causes cellular senescence. [score:3]
Prevention of miR-493-3p targeting of Mad2-3′UTR restores the Mad2 protein levels and resensitizes cells to microtubule drugs. [score:3]
Analysis of the cell fates showed that the TSB-control did not alleviate the insensitivity of miR-493-3p transfected cells to taxol or nocodazole; 40.6 +/− 10.1% of the taxol treated and 40.6 +/− 8.5% of the nocodazole treated TSB-control and miR-493-3p co -overexpressing cells underwent a forced mitotic exit (Figure 2H, Figure S3). [score:3]
Functionally, overexpression of miR-493-3p significantly accelerated mitosis in both OVCAR-8 (p = 0.01) and CAOV-3 (p = 0.002) cells (Figure 6E). [score:3]
Based on these results we conclude that suppression of Mad2 protein levels by miR-493-3p increases induction of cellular senescence. [score:3]
In all the cell lines, changed miR-493-3p expression resulted in significant alterations in Mad2 mRNA and protein levels supporting our notion of an existence of a conserved miR-493-3p -mediated control mechanism of Mad2. [score:3]
Interestingly, in the patients with primary stage III tumors high miR-493-3p expression was found to significantly correlate with lowered DSS in the paclitaxel (p = 0.0377) but not in the epirubicin arm (0.4078, Figure 7E-7F). [score:3]
Figure 5 A. Box-plots showing the expression levels of miR-493-3p and Mad2 in ovarian surface epithelium (OSE), high-grade serous ovarian carcinomas (HGSC), and for miR-493-3p also in clear cell ovarian carcinomas (CCC), Oslo cohort. [score:3]
Based on the results we conclude that changed expression of miR-493-3p modulates taxol sensitivity in ovarian cancer cell lines via Mad2 depletion, and that high level of miR-493-3p links with poor patient survival in the aggressive forms of ovarian and breast cancer. [score:3]
High levels of miR-493-3p confer resistance to taxol in vitro and associate with poor survival in ovarian and breast cancer patients with aggressive disease post-chemotherapy. [score:3]
D. Representative still images of non-synchronized time-lapse filmed miR-control and miR-493-3p overexpressing HeLa cells treated with taxol or nocodazole (0 min = NEBD). [score:3]
Altered expression of endogenous miR-493-3p and Mad2 correlates with aggressive ovarian cancer subtype. [score:3]
Two separate ovarian cancer sample sets were analyzed retrospectively for miR-493-3p and Mad2 expressions (see materials and methods for the cohort descriptions). [score:3]
However, in this cohort no significant correlation between miR-493-3p expression and tumor grade was observed (p = 0.19, Figure 5B). [score:3]
Cells overexpressing miR-control or miR-493-3p were fixed 65 h post-transfection and hybridized with probes for chr12p13 and chr21q22 before enumeration of the chromosome-specific signals in individual interphase cells. [score:3]
B. Quantification of forced mitotic exit in taxol treated OVCAR-8 and CAOV-3 cells overexpressing miR-control or miR-493-3p. [score:3]
It should, however, be noted that Mad2 is not the only validated target gene of miR-493-3p implicated in senescence as also E2F1 and MKK7 are involved in the process [25, 29]. [score:3]
Nucleotide blast against the miR-493-3p mature sequence did not reveal any significant sequence similarities with ERCC6L or Taok1 targeting siRNA. [score:3]
F. Sites of interference for miR-493-3p and Mad2-target site blocker (TSB-MAD2) in the Mad2-3′UTR (bold letters indicate the seed sequence). [score:3]
B. Box-plots showing the expression levels of miR-493-3p and Mad2 in normal ovary tissue (normal), low-grade serous ovarian carcinomas (LGSC) and high-grade serous ovarian carcinomas (HGSC), TCGA cohort. [score:3]
It is worth noting that in the CAOV-3 cells only a trace amount of Mad2 protein was observed upon miR-493-3p overexpression. [score:3]
The majority of HeLa cervical cancer cells overexpressing miR-493-3p evaded mitotic block induced by a microtubule stabilizing drug taxol or microtubule depolymerizing agent nocodazole, and formed large progeny cells with a multilobed nuclear morphology (Figure 1C). [score:3]
Analysis of the pooled results indicated that the miR-493-3p overexpressing cells exhibited a significant increase in the frequency of aneuploidy in comparison to miR-controls; 12.00 +/− 1.80% vs. [score:3]
To better understand the relationship between miR-493-3p induced E2F1 suppression and Mad2 production, we examined the impact of E2F1 RNAi on Mad2. [score:3]
To test this, we used a target site blocker -oligonucleotide (TSB-MAD2) to compete with the miR-493-3p for the Mad2-3′UTR interference (Figure 2F). [score:3]
A. Box-plots showing the expression levels of miR-493-3p and Mad2 in ovarian surface epithelium (OSE), high-grade serous ovarian carcinomas (HGSC), and for miR-493-3p also in clear cell ovarian carcinomas (CCC), Oslo cohort. [score:3]
We conclude that miR-493-3p -mediated suppression of Mad2 leads to premature separation of sister chromatids and induction of numerical chromosome changes in cultured human cancer cells. [score:3]
To determine whether miR-493-3p and Mad2 mRNA interact, we performed targeting assays using a firefly luciferase reporter gene construct containing the Mad2-3′UTR sequence. [score:2]
Excess of miR-493-3p resulted in mitotic anomalies and aneuploidy in significant quantities, enabled cells to bypass taxol block, and caused cellular senescence, whereas knockdown of miR-493-3p induced mitotic delay and defective chromosome segregation. [score:2]
HeLa cells co -transfected with miR-493-3p and the Mad2-3′UTR luciferase reporter plasmid showed significantly reduced luciferase activity (p = 0.01) when compared to miR-control overexpressing cells (Figure 2B). [score:2]
Moreover, we showed that post-transcriptional regulation of Mad2 by miR-493-3p is physiologically relevant to faithful cell cycle progression, normal SAC signaling and maintenance of genomic balance. [score:2]
MiR-493-3p was recently reported to target E2F1 [29], which is a putative transcription factor of Mad2 [21]. [score:2]
Quantification of the time-lapse films indicated that in response to taxol, an average of 49.0 +/− 4.4% of the mitotic cells in the miR-493-3p overexpressing cell populations underwent the forced mitotic exit, which is significantly more compared to the average of 2.0 +/− 2.6% in the miR-control transfected controls (p = 0.002, Figure 1D). [score:2]
To examine if overexpression of miR-493-3p has an impact on the frequency of senescence we performed β-galactosidase assay for miRNA transfected HeLa and MCF7 cells. [score:2]
We establish, for the first time, miR-493-3p as a bona fide negative regulator of Mad2, a critical SAC gene involved in the maintenance of genomic stability. [score:2]
Also the timing of the precocious exit from taxol block was significantly faster compared to controls; the average time spend in taxol arrest by miR-493-3p overexpressing OVCAR-8 and CAOV-3 cells was 3.9 +/− 0.8 hour and 3.0 +/− 0.7 hour while the miR-control cells spend an average of 6.7 +/− 0.8 hour and 4.2 +/− 0.7 hour in taxol block, respectively. [score:2]
However, as in the HeLa, HCT-116, and MCF7 cell lines, excess of miR-493-3p significantly suppressed Mad2 protein levels also in OVCAR-8 and CAOV-3 cells by 65.0 +/− 5.4% (p = 0.002) and 55.4 +/− 12.7% (p = 0.02), respectively, compared to controls (Figure 6D). [score:2]
Excess of miR-493-3p weakens the SAC. [score:1]
The observed significant correlation between high miR-493-3p levels and reduced patient survival in both HGSC and advanced breast cancer strengthens our hypothesis that decline of Mad2 protein via miRNA -mediated mechanisms contributes to tumor recurrence and poor therapeutic outcome. [score:1]
In vitro we demonstrated that excess miR-493-3p impaired cancer cells’ normal response to taxol and nocodazole treatments and enabled them to evade SAC -dependent mitotic arrest and consequent apoptosis due to the reduced Mad2 protein. [score:1]
HeLa cells transfected with miR-control or miR-493-3p were synchronized with double thymidine block as follows. [score:1]
Quantification of the A. miR-493-3p and B. Mad2 protein levels in HeLa cells 48h after the transfection with miR-control or anti-miR-493-3p. [score:1]
Our in vitro data suggesting a role for miR-493-3p as one relevant cellular determinant of taxane sensitivity was supported by clinical data from patients with aggressive forms of ovarian or breast cancer. [score:1]
Moreover, microscopic examination of the DAPI-stained cells indicated a significant elevation in the frequency of cells with aberrant anaphase configurations; 14.3 +/− 1.1% of the anti-miR-493-3p transfected cells and 8.0 +/− 1.3% of the miR-control cells exhibited anaphase chromatin bridges (p = 0.03), and 5.7 +/− 0.4% of the anti-miR-493-3p transfected cells and 1.7 +/− 0.4% of the miR-control cells exhibited laggards (p = 0.001), respectively (Figure 4E). [score:1]
Importantly, both miR-493-3p and miR-433-3p locate to the same imprinted gene cluster on human chromosome 14q32 [47]. [score:1]
D. Quantification of mitotic duration in cells transfected with miR-control or anti-miR-493-3p (n = 300 mitotic cells per a group). [score:1]
Mir-493-3p (Figure 1A-1B) was one of the hits from our cell -based high-throughput screen (HTS) for miRNAs that antagonize microtubule drug induced mitotic block [23]. [score:1]
miR-493-3p and Mad2 levels are also important in terms of the tumor cells’ sensitivity to microtubule drugs. [score:1]
Based on these results we conclude that excess miR-493-3p enables cells to escape spindle poison induced M phase block and in drug-free culture conditions accelerates mitosis. [score:1]
We identified a significant association between high miR-493-3p levels and reduced overall survival (p = 0.0023, Figure 7C) in the HGSC patients of the TCGA cohort. [score:1]
F. Quantification of miR-493-3p and Mad2 protein levels 48 h after the transfection of OVCAR-8 and CAOV-3 cells with miR-control or anti-miR-493-3p. [score:1]
In contrast, many cells with excess miR-493-3p exhibited a forced mitotic exit within 100 minutes after entry to M phase despite the presence of taxol or nocodazole in the culture medium (Figure 1D). [score:1]
E. The graph shows the quantification of anaphase cells with chromatin bridges and lagging chromosomes/chromatin in miR-control and anti-miR-493 transfected HeLa cells (n = 300 anaphase cells per a group). [score:1]
B. Quantification of the miR-493-3p levels in HeLa cells 24 h after the transfection with miR-control or pre-miR-493. [score:1]
Figure 1 A. Schematic illustration of the miR-493 hairpin loop. [score:1]
To evaluate cellular consequences of anti-miR-493-3p induced overexpression of Mad2, we measured the mitotic duration and determined the frequency of anaphase anomalies in anti-miR-493-3p or miR-control overexpressing HeLa cells. [score:1]
Figure 4Quantification of the A. miR-493-3p and B. Mad2 protein levels in HeLa cells 48h after the transfection with miR-control or anti-miR-493-3p. [score:1]
Excess miR-493-3p compromises microtubule drug induced M phase arrest and in drug-free culture accelerates mitosis. [score:1]
Quantification of the β-gal staining indicated that the average staining intensity was reduced to the same level as in miR-controls; intensity was down by 58 +/− 11% (p = 0.004) in cells co -transfected with miR-493-3p and TSB-MAD2 in comparison to cells co -transfected with miR-493-3p and control-TSB (Figure 3D). [score:1]
Moreover, co-transfection of HCT-116 cells with TSB-MAD2 rescued the cells from aneuploidy induced by excess miR-493-3p. [score:1]
Excess miR-493-3p induces premature sister chromatid separation and aneuploidy in cells. [score:1]
Interestingly, loss of miR-493-3p appeared to occur more frequently in HGSC than benign epithelium or less aggressive ovarian cancer forms, which can provide one explanation for the elevated Mad2 levels found in disseminated cancers. [score:1]
D. Quantification of Mad2 mRNA and protein levels 48 h after the transfection of OVCAR-8 and CAOV-3 cells with miR-control or miR-493-3p. [score:1]
To confirm the result and visualize the timing of forced mitotic exit by miR-493-3p we monitored taxol or nocodazole treated miR-control or miR-493-3p transfected cell populations using time-lapse microscopy. [score:1]
Besides causing fatigue of SAC, excess miR-493-3p also induced cellular senescence, which as a self-protection mechanism can contribute to the impairment of drug response. [score:1]
In contrast, cells co -transfected with miR-493-3p and TSB-MAD2 had become more responsive to spindle poisons; only 10.7 +/− 3.2% and 17.0 +/− 1.7% of these mitotic cells exhibited a forced exit from M phase in the presence of taxol and nocodazole, respectively (Figures 2H, Figure S3). [score:1]
Here we investigated how ectopic modulation of the intracellular amount of miR-493-3p influenced Mad2 expression in a number of human cancer cell lines of different origin. [score:1]
qRT-PCR data indicated significant reduction in the endogenous miR-493-3p levels by the anti-miR-493-3p in comparison to miR-controls 48 h post-transfection (Figure 4A). [score:1]
Analysis revealed 3.4-fold average increase of β-gal staining in HeLa cells (p = 0.02, Figure 3D) and 4.0-fold in MCF7 cells (Figure S4) by excess miR-493-3p in comparison to the controls. [score:1]
This proposes existence of an intimate relationship between the endogenous miR-493-3p:Mad2 ratio and taxol efficacy; a cell with low miR-493-3p:Mad2 ratio can maintain taxol imposed mitotic arrest, while a high ratio leads to forced exit from M phase due to precocious inactivation of SAC upon miRNA -mediated Mad2 depletion. [score:1]
B. Representative bright field images of metaphase spreads from miR-control and miR-493-3p transfected HeLa and HCT-116 cells. [score:1]
Importantly, the amount of Bub1, which is required for the kinetochore location of Mad2 [27, 28] did not change significantly in the cells with excess miR-493-3p (elevated by 18.46 +/− 31.94%, p = 0.42, Figure 2E). [score:1]
Introduction of anti-miR-493-3p into cultured cancer cells increases Mad2 protein levels and causes mitotic anomalies. [score:1]
E. Quantification of mitotic duration (NEBD-to-anaphase) in OVCAR-8 and CAOV-3 cells transfected with miR-control or miR-493-3p (n = 300 cells per group). [score:1]
Modulation of the endogenous miR-493-3p and Mad2 protein levels in OVCAR-8 and CAOV-3 cells using anti-miR-493-3p resulted in expected changes; the endogenous miR-493-3p was significantly reduced by anti-miR-439-3p in OVCAR-8 (down by 77.4 +/− 10.7%, p = 0.006), and CAOV-3 cells (down by 76.3 +/− 2.0%, p = 0.01), and Mad2 protein was significantly elevated by 40.5 +/− 20.8% (OVCAR-8, p = 0.03) and 31.0 +/− 9.0% (CAOV-3, p = 0.03) in comparison to controls (Figure 6F). [score:1]
To test this in our cell mo dels, we investigated the impact of miR-493-3p overexpression on E2F1 mRNA and protein levels. [score:1]
We were able to validate this hypothesis in ovarian cancer cell mo dels, in which increased frequency of mitotic slippage was found to correlate with both high endogenous and ectopically modulated miR-493-3p:Mad2 ratio. [score:1]
When cycling non-drug treated miR-control or miR-493-3p transfected HeLa cells were time-lapse filmed we noted a significant difference in the time the cells spent in mitosis (Figure 1E); the average time from nuclear envelope breakdown (NEBD) to onset of anaphase for the miR-control and miR-493-3p transfected cells was 35.7 +/− 1.7 min and 22.3 +/− 2.0 min, respectively (p = 0.02). [score:1]
Quantification of Mad2 Western blots (Figure 2G) indicated that Mad2 protein levels were significantly elevated in cells co -transfected with miR-493-3p and TSB-MAD2 (0.67 +/− 0.19) in comparison to cells transfected with miR-493-3p and TSB-control (0.26 +/− 0.12, p = 0.04). [score:1]
To test if excess miR-493-3p leads to numerical chromosomal changes, we determined the frequency of aneuploidy in chromosomally stable and near-diploid HCT-116 cell line using Fluorescence In Situ Hybridization (FISH). [score:1]
Next, both cell lines were transfected with miR-control or miR-493-3p to assess the impact on taxol response. [score:1]
A. Schematic illustration of the miR-493 hairpin loop. [score:1]
In line with Gu et al. (2014), the E2F1 protein levels were significantly reduced in HeLa, HCT-116 and MCF7 cell lines cell lines upon transfection with miR-493-3p in comparison to miR-controls (Figure S2A). [score:1]
These cellular phenotypes are consistent with earlier reports on the consequences of gain- and loss-of-function of Mad2, and support our view of miR-493-3p as a new physiological factor capable of modulating Mad2 levels in human cells. [score:1]
In the miR-493-3p transfected cells, Mad2 signal was significantly diminished in comparison to miR-control (down by 50.76 +/− 9.64%, p = 0.01, Figure 2E). [score:1]
To this end, we analyzed to what extent the presence of TSB-MAD2 could reduce the elevated cellular senescence induced by excess miR-493-3p. [score:1]
Importantly, data from this breast cancer sub-cohort contained information from two therapeutic arms, having received paclitaxel and the DNA-damaging agent epirubicin, which enabled us to analyze miR-493-3p impact on survival in these chemotherapy groups. [score:1]
[1 to 20 of 134 sentences]
2
[+] score: 211
Since the data had suggested that ITGB1 expression level was negatively correlated with miR-493-5p expression, and ITGB1 was a direct target of miR-493-5p, we further examined the prognostic value of ITGB1 expression together with miR-493-5p levels using multivariate analysis of OS by Kaplan-Meier survival analysis. [score:10]
Next, to identify the miRNA targeting to ITGB1 and potential molecular mechanism, we used three target genes prediction websites to forecast target genes and validated that ITGB1 was a direct target of miR-493-5p using luciferase reporter assays. [score:9]
miR-493-5p is significantly up-regulated after imatinib treatment in chronic myeloid leukemia cell line K562 and over -expression of miR-493-5p can significantly inhibit K562 cellular growth, suggesting that miR-493-5p, as a tumor supressor factor, has therapeutic potential. [score:8]
These results suggested that miR-493-5p upregulation inhibited NSCLC cell proliferative capacity and overexpression of ITGB1 promoted NSCLC cell proliferation in vitro. [score:8]
Furthermore, upregulated ITGB1 accompanied with downregulated miR-493-5p was associated with a shorter median OS. [score:7]
Taken together, these results suggested that miR-493-5p downregulation promoted the proliferation of NSCLC cells and knockdown of ITGB1 inhibited NSCLC cell proliferation in vitro. [score:7]
Total protein from HeLa cells on the condition of ITGB1 3′-UTR oligonucleotides containing the wild-type (Wt) or mutant (Mut) miR-493-5p mimics or inhibitor was extracted using cell lysis buffer to detect the expression levels of ITGB1 3′-UTR oligonucleotides containing the wild-type (Wt) or mutant (Mut) miR-493-5p and a reported target molecule FUT4. [score:7]
We downloaded a peripheral blood profiles data (GSE61741) from GEO database, which including 71 lung cancer patients and 94 healthy individuals and validated that the expression level of miR-493-5p was significantly down-regulated (FC = 0.49, P < 0.001) in peripheral blood samples of 71 lung cancer patients. [score:6]
However, ITGB1 over-expressed in NSCLC samples when compare with normal tissues, which imply that the expression level of miR-493-5p was negatively correlated with NSCLC samples in NSCLC. [score:5]
The result of cellular growth assay showed that overexpression of miR-493-5p significantly inhibited the growth rate of A549 cells compared with control cells and overexpression of ITGB1 significantly promoted the growth rate of A549 cells (Figure 5D). [score:5]
In this study, we confirmed for the first time that miR-493-5p expression in NSCLC samples was significantly lower compared to normal tissue, suggesting that down-regulation of miR-493-5p plays a crucial role in the progression of NSCLC. [score:5]
In this study, we profiled miRNAs and genes expression by microarray to identify their differentially expression in NSCLC and adjacent normal tissues, and then explore the correlation between miR-493-5p and ITGB1 in NSCLC, which will help to give further insight into the pathogenesis of the NSCLC. [score:5]
When compared to control group, the expression level of ITGB1 was lower in miR-493-5p mimics group (P < 0.01) and was higher in the miR-493-5p inhibitor group (P < 0.01) (Figure 4C), which suggested that ITGB1 were regulated by and negatively correlated with miR-493-5p. [score:5]
When compared with normal controls, the expression level of miR-493-5p was significantly down-regulated (FC = 0.49, P = 0.031) in peripheral blood samples of 28 lung cancer patients (Figure 3C). [score:5]
qRT-PCR (C) and (D) were used to measure the mRNA and protein level of ITGB1 after treatment of miR-493-5p mimics (overexpression) or inhibitor (knockdown) in HeLa cells. [score:4]
The remaining two miRNAs, miR-124-3p and miR-493-5p, had not been previously reported to target and regulate ITGB1 in NSCLC. [score:4]
Moreover, Kaplan-Meier analysis showed that patients with high miR-493-5p expression had longer OS compared to those with low miR-493-5p expression (P = 0.008) (Figure 5F). [score:4]
As shown in Figure 5B, suppression of miR-493-5p significantly enhanced the growth rate of A549 cells transfected with the miR-493-5p inhibitor compared with the negative control -transfected cells. [score:4]
Expression of miR-493-5p in NSCLC and normal samples. [score:3]
Then, to further test the regulation role of miR-493-5p on ITGB1 at the protein level, we used to measure the levels of ITGB1 protein and a reported downstream protein FUT4 [16] after miR-493-5p overexpression or knockdown. [score:3]
org/miRDB/) to forecast several potential target genes of miR-493-5p. [score:3]
As shown in Figure 4F, ectopic expression of miR-493-5p decreased the luciferase activity of the 3′-UTRs of ITGB1. [score:3]
However, there has no previous report that investigate the correlation between the expression level of miR-493-5p and target gene ITGB1 in NSCLC. [score:3]
Identification of ITGB1 as a target of miR-493-5p. [score:3]
Taken together, our findings firstly indicate that miR-493-5p levels may play an essential role in NSCLC progression by targeting oncogene ITGB1 suggesting that ITGB1 and miR-493-5p have potential prognostic value as tumor biomarkers in NSCLC patients. [score:3]
Next, we established the A549 cell line to stably express miR-493-5p, ITGB1, or vector (Figure 5C). [score:3]
However, miR-493-5p mutant containing three altered nucleotides in the seed sequence did not have an inhibitory effect on luciferase activity. [score:3]
In order to explore the potential prognostic value of miR-493-5p, we analyzed the relationship between the expression of miR-493-5p and OS in NSCLC patients. [score:3]
In 27 paired of NSCLC samples, miR-493-5p was lowly expressed in lung cancer relative to non tumor samples (FC = 0.44, P = 0.036; Figure 3D). [score:3]
Next we analyzed the correlation of miR-493-5p and ITGB1 in 134 NSCLC biopsies and found that the relative expression level between miR-493-5p and ITGB1 presented inverse correlation (R [2] = 0.55, = 0.002; Figure 4B). [score:3]
Thus, miR-493-5p and ITGB1 expression levels may be an optimal indicator and risk factor for reduced OS in NSCLC patients. [score:3]
There was no a dramatic change in cellular growth between among the A549 cells with miR-493-5p inhibitor and siITGB1 transfection and negative control -transfected cells. [score:3]
We performed a luciferase reporter assay to further verify whether miR-493-5p directly targeted ITGB1. [score:3]
To further confirm the relationship between miR-493-5p and ITGB1, we detected the ITGB1 mRNA and protein levels after treatment of miR-493-5p mimics or inhibitor in HeLa cells. [score:3]
Figure 4A showed that the expression level of miR-493-5p in 27 paired of NSCLC samples was lower than in normal lung tissues. [score:3]
The results suggested that the increase in miR-493-5p levels significantly decreased ITGB1 protein expression and had the same tendency in FUT4 and vice versa (Figure 4D). [score:3]
However, it remains ambiguous whether miR-493-5p and its target can predict the clinical decisions of NSCLC. [score:3]
Validation of miR-493-5p/ITGB1 expression and correlation using qRT-PCR. [score:3]
Moreover, the level of miR-493-5p expression was also lower in all NSCLC tumor biopsies (0.78 ± 0.19) than those in normal lung tissues (2.69 ± 0.21). [score:3]
Therefore, we sought to further analyze the expression of miR-124-3p and miR-493-5p in NSCLC patients. [score:3]
Kaplan-Meier survival analysis showed that patients with low miR-493-5p expression levels had decreased OS. [score:3]
Expressionof miR-493-5p in NSCLC and normal samples. [score:3]
The results showed that NSCLC patients with high ITGB1 expression and low miR-493-5p levels had significantly decreased OS (P < 0.001) (Figure 5G), which suggested that ITGB1 and miR-493-5p might have potential prognostic value and could be useful as tumor biomarkers for the diagnosis of NSCLC patients. [score:3]
Spearman's correlation coefficient was used to test the relationship of expression level between miR-493-5p and ITGB1. [score:3]
There was no a dramatic change in cellular growth between A549 cells with miR-493-5p- and ITGB1-overexpression and A549 cells transfected with vector control. [score:3]
Figure 4(A) The relationship of ITGB1 levels with the expression of miR-493-5p in cancer vs. [score:3]
We further validated the expression levels of miR-493-5p in NSCLC tissue samples using qRT-PCR assay in 134 NSCLC biopsies, 27 of which were pairs of tissue from para-carcinoma tissues. [score:2]
To further verify the correlation between miR-493-5p and ITGB1, we analyzed the expression levels of miR-493-5p and ITGB1 in 134 NSCLC biopsies using qRT-PCR assay. [score:2]
The 3′-UTR binding site and mutation site of miR-493-5p of ITGB1 gene are shown in Figure 4E. [score:2]
Clinical significance of miR-493-5p and ITGB1. [score:1]
miR-493-5p was reported to can attenuate the invasiveness and tumorigenicity in human breast cancer. [score:1]
To investigate the biological roles of miR-493-5p and ITGB1 in NSCLC progression, we performed loss-of-function studies using a miR-493-5p inhibitor and siITGB1 on the NSCLC cell line A549 (Figure 5A). [score:1]
Biological role and clinical significance of miR-493-5p and ITGB1 in NSCLC. [score:1]
Biological role of miR-493-5p and ITGB1 in NSCLC progression. [score:1]
Kaplan-Meier survival curves were plotted and log rank analysis was performed to evaluate the prognostic value of miR-493-5p and ITGB1 expression for patients with NSCLC. [score:1]
The result showed that there were 7 common predicted miRNAs, including miR-455-3p, miR-183-5p, miR-29c-3p, miR-29b-3p, miR-29a-3p miR-124-3p, and miR-493-5p. [score:1]
GAPDH and RNU6B were used as the internal control for ITGB1 and miR-493-5p, respectively. [score:1]
Figure 5(A) qRT-PCR measurement of the levels of ITGB1 mRNA in A549 cells treated with negative control, miR-493-5p inhibitor and/or siITGB1. [score:1]
The human ITGB1 3′-UTR oligonucleotides containing the wild-type (Wt) or mutant (Mut) miR-493-5p binding site were sub-cloned into the XhoI and NotI sites of the pGL3 luciferase reporter plasmid vector (Promega, Madison, WI). [score:1]
Kaplan-Meier survival analysis was used to evaluate the prognostic value of ITGB1 (E) and miR-493-5p (F) expression in 134 NSCLC biopsies for OS analysis. [score:1]
Using bioinformatics analysis, we found that miR-493-5p contained specific binding sequence of the 3′-UTR region of ITGB1 gene. [score:1]
MiR-493-5p mimic and inhibitor were purchased from Life Technologies (TaqMan MicroRNA Assay). [score:1]
[1 to 20 of 62 sentences]
3
[+] score: 27
org) we identified nine miRNAs that regulate these three genes: miR-368 targeting MINT31, miR-181d, miR-30a-3p, miR-30c, miR-30d, miR-30e-3p, miR-370, miR-493-5p and miR-532-5p targeting CDH13, and miR-181d targeting RASSF1. [score:8]
Wyman et al. showed that miR-30c, miR-30d and miR-30e were upregulated, while miR-493 was downregulated in ovarian carcinomas when compared to normal, and expression of miR-30a was specific to the clear cell histological type [19]. [score:8]
In addition, expressions of miR-181d (P = 0.07), miR-30a-3p (P = 0.12), miR-493-5p (P = 0.06) and miR-368 (P = 0.08) were downregulated in Her2/neu -positive ovarian carcinomas (data not shown). [score:6]
All miRNAs except for three (miR-368, miR-370, and miR-493-5p) had hazard ratios less than one for every one unit increase in log [10] miRNA expression for both overall and disease-free survival. [score:5]
[1 to 20 of 4 sentences]
4
[+] score: 27
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
miR-376a, miR-379 and miR-493 are encoded in a large cluster of maternally expressed imprinted microRNAs found only in eutherian mammals [27]. [score:3]
The Mono delphis and Xenopus sequences also have a predicted binding site for miR-379-5p adjacent to the miR-493 binding site (Fig.  4a). [score:1]
This ‘extended VCR’ contains a remarkable concentration of predicted binding sites for microRNAs, including miR-335-3p [38], miR-376a [26] and miR-493 [39]. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 26
Tumor suppressor QKI (the common target of miR-493-3p, miR-129 and miR-765) is expressed at significantly low levels in most of the gastric cancer tissues [46]. [score:7]
• In the module of miR-493-3p and miR-214, the sole target mRNA WDR33 of miR-493-3p has been found to result in increased viral infection with two or more siRNAs [33]. [score:3]
miRNAs Targeted mRNAs modules miR-557ADRA1D, ACVR1C, DNAJA3, FAM120A HCV+ miR-214ASB16, GALNTL4, CBX5, BNC2, PDLIM2, RAB43, SPCS2, NKTR, ASXL1, ACLY,C6orf192, ING4, GLG1, SHOC2 HCV+ miR-34aCPLX2, FNDC5 HCV+ miR-493-3p WDR33 HCV+ miR-184EPB41L5, ALDH4A1 HCV+ miR-129 CBLB, OCRL, COMT, DENND2C HCV- miR-765ABCC5, BRD3, ANKRD12, AUTS2, PCID2, NMD3, NUP43 HCV-/+ miR-210FGD4, HDAC4, CACNA2D2, OAZ2, ADAMTS5, AK3, CDKN1B, EPM2AIP1, PPP1R12B, PRPF4B, STAM2, EZ6L, SAMD4A, PISD, KCTD9, FAM118A, CHD2, KIT, TCF4 HCV- miR-452 ARMC1, ZNF462, EFNA3, SMG5, FAM73B HCV- miR-17-3pBNC2, DICER1, GFRA1, KIAA1804, ENPP1, ZNF558, ERO1L, SNX27, ZNF718 HCV- The numbers of mRNAs in these significant modules are shown in the last column of Table 2. Figure 4 and 5 show two examples of these significant modules, and all the miRNAs in bold and the mRNAs with underline and italics can be confirmed by the literature. [score:3]
We also closely examined a strong negative regulatory relationship, shown in Figure 6. This regulatory relationship is between QKI mRNA and multiple miRNAs miR-493-3p, miR-129 and miR-765 (see Figure 9). [score:3]
miRNAs Targeted mRNAs modules miR-557ADRA1D, ACVR1C, DNAJA3, FAM120A HCV+ miR-214ASB16, GALNTL4, CBX5, BNC2, PDLIM2, RAB43, SPCS2, NKTR, ASXL1, ACLY,C6orf192, ING4, GLG1, SHOC2 HCV+ miR-34aCPLX2, FNDC5 HCV+ miR-493-3p WDR33 HCV+ miR-184EPB41L5, ALDH4A1 HCV+ miR-129 CBLB, OCRL, COMT, DENND2C HCV- miR-765ABCC5, BRD3, ANKRD12, AUTS2, PCID2, NMD3, NUP43 HCV-/+ miR-210FGD4, HDAC4, CACNA2D2, OAZ2, ADAMTS5, AK3, CDKN1B, EPM2AIP1, PPP1R12B, PRPF4B, STAM2, EZ6L, SAMD4A, PISD, KCTD9, FAM118A, CHD2, KIT, TCF4 HCV- miR-452 ARMC1, ZNF462, EFNA3, SMG5, FAM73B HCV- miR-17-3pBNC2, DICER1, GFRA1, KIAA1804, ENPP1, ZNF558, ERO1L, SNX27, ZNF718 HCV-The numbers of mRNAs in these significant modules are shown in the last column of Table 2. Figure 4 and 5 show two examples of these significant modules, and all the miRNAs in bold and the mRNAs with underline and italics can be confirmed by the literature. [score:3]
We also report another mRNA QKI which has a strong inverse expression relationship with miR-129 and miR-493-3p which may bind at the 3' UTR of QKI with a perfect sequence match. [score:3]
FRMPD4 is also negatively correlated with their regulators except for miR-493-3p. [score:2]
GFRA2 QKI MAP2 FRMPD4 BNC2 CAMK2D miR-493-3p - -0.68 - 0.12 - - miR-184 - - - -0.05 - - miR-129 - -0.71 - - - 0.01 miR-214 - - -0.15 - -0.01 0.03 miR-557 0.18 - -0.01 - - - miR-765 0.21 -0.44 -0.02 -0.04 -0.10 - miR-17-3p 0.26 - - - -0.13 -0.13 miR-34a - - -0.05 - - - (Figure 8). [score:1]
An negative relationship between the QKI mRNA and miR-493-3p, miR-129, and miR-765. [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 25
miR-21, miR519d, miR-183, miR-197, and miR-493-5p were identified as most prominently up-regulated, miR-145 and miR-497 as most prominently down-regulated in male breast cancer. [score:7]
However, the identification of target genes specific for miR-519d is especially challenging because it shares target sequence specificity with miR-17-5p, miR-20 A and B, as well as miR-106 A and B. Other microRNAs overexpressed more than twofold in human male breast cancer, but not yet described in female breast cancer are miR-183, miR-197, miR-493-5p, and 519d. [score:7]
[23]), miR-197 targets the tumor-suppressor FUS1 [15], whereas for miR-493-5p convincing experimental data for a validated target gene are still missing. [score:7]
Up-regulation of miR-519d, miR-183, miR197, and miR-493-5p (more than twofold in comparison to gynecomastia, see Table 2) has not been reported so far in female breast cancer. [score:4]
[1 to 20 of 4 sentences]
7
[+] score: 24
a High level of six hsa-miRNAs randomly selected for the validation of expression level by qRT-PCR is consistent with the result from miRNA microarray; b Low level of six hsa-miRNAs randomly selected for the validation of expression level by real-time RT-PCR is consistent with the result from miRNA microarray Fig.  3Validation of 12 hsa-miRNAs using qRT PCR shows hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples from narcolepsy patients. [score:11]
Consistent with the results from the microRNA microarray (Fig.   2a, b), hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples (Fig.   3). [score:7]
Among these miRNAs with significant change, 12 hsa-miRNAs were validated by qRT PCR which showed that hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p had significantly high expression and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p had significantly low expression in each of the peripheral blood samples. [score:5]
In conclusion, we have identified 12 aberrant miRNAs (hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p, hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p) in plasma from patients with sleep disorder. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 14
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
[1 to 20 of 3 sentences]
9
[+] score: 13
MiR126, miR146a, miR34a, and miR493 were published as down-regulated (Lodygin et al., 2008; Saito et al., 2009; Veerla et al., 2009; Ueno et al., 2012), and miR199b and miR26b were published as up-regulated in BC (Gottardo et al., 2007; Veerla et al., 2009). [score:7]
Tumor suppressor microRNA-493 decreases cell motility and migration ability in human bladder cancer cells by downregulating RhoC and FZD4. [score:6]
[1 to 20 of 2 sentences]
10
[+] score: 12
As shown in Figure 2A, the respective level of downregulated miR-27a-3p, miR-424-5p, and miR-493-5p in qRT-PCR results largely reflected the altered patterns of these selected miRNAs observed in the microarray profiles. [score:4]
The expression level of seven miRNAs (miR-424-5p, miR-493-5p, miR-296-5p, miR-27b-3p, miR-377-5p, miR-3680-5p, miR-191-5p) were validated by qRT-PCR. [score:3]
As shown in Figure 3, the results of four miRNAs (miR-424-5p, miR-27a-3p, miR-377-5p, miR-3680-5p) recapitulated the microarray data, and the other two miRNAs (miR-493-5p and miR-296-5p) were not significant differentially expressed. [score:3]
The miR-424-5p (previous ID: miR-424), miR-493-5p (previous ID: miR-493*), and miR-296-5p were reported as potential to discriminate between latent TB and healthy by the previous study [12], the other four miRNAs (miR-27b-3p, miR-377-5p, miR-3680-5p, miR-191-5p) were randomly selected. [score:1]
0074916hsa-miR-16-5p0.0890.0071513hsa-miR-44540.3420.001154hsa-miR-181a-5p0.1060.041029hsa-miR-46440.3580.004136hsa-miR-25-3p0.1290.000127hsa-miR-197-3p0.3590.005471hsa-miR-4653-3p0.1290.000547hsa-miR-15a-5p0.3620.0302713hsa-miR-146a-5p0.1400.002395hsa-miR-2115-3p0.3640.000163hsa-miR-339-5p0.1460.002487hsa-miR-9370.3650.008018hsa-miR-50890.1560.0017917hsa-miR-331-3p0.3740.0010912hsa-miR-493-5p0.1630.0061914hsa-miR-374b-5p0.3800. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 9
For example, downregulation of miRNAs, such as miR-145, -195, -383 and miR-378, was found in CRC relative to their expressions in normal mucosa, whereas, some upregulated miRNAs, like miR-96, -135b, miR-493 and miR-133a, have also been found associated with CRC [19], [20]. [score:9]
[1 to 20 of 1 sentences]
12
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
The identity, fold-change variation, direction of alteration, and biological function of these miRNAs are reported in Table 2. In mice bearing adenomas, 5 miRNAs (miR-34b, miR-106a, miR-499, miR-466, and miR-493) were altered in the blood serum but not in lung. [score:2]
[1 to 20 of 3 sentences]
13
[+] score: 7
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 7
We confirmed that miR-99b* and miR-493 were significantly upregulated in IAs, while miR-340* was downregulated (Figure  3). [score:7]
[1 to 20 of 1 sentences]
15
[+] score: 6
Other upregulated HRMs and their targets include Sushi, von Willebrand factor type A, EGF and pentraxin domain-containing protein 1 or SVEP1 (miR-493-5p, -497-5p, -339-5p and miR-27a-3p), TGF-β/BMP signalling or Smads (miR-23b/24 cluster-miR-23b, -27b, -24-1)), and PR domain zinc finger protein 1 or PRDM1 (miR-30a-5p, -30c-5p and miR-30d-5p) [54]. [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 6
In contrast, hsa-miR-221-3p, hsa-miR-409-5p, hsa-miR-1290, hsa-miR-155-5p, hsa-miR-31-3p, hsa-miR-7-5p, hsa-miR-362-5p, hsa-miR-493-5p, hsa-miR-296-5p, and hsa-miR-199b-5p were statistically downregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3B). [score:3]
B. Real-time PCR further revealed that human miR-221-3p, miR-409-5p, miR-1290, miR-155-5p, miR-31-3p, miR-7-5p, miR-362-5p, miR-493-5p, miR-296-5p, and miR-199b-5p were statistically expressed at lower levels in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 6
Five miRNAs (hsa-miR-130a*, hsa-miR-296-5p, hsa-miR-493*, hsa-miR-520d-3p, hsa-miR-661) had different expression levels between latent TB and healthy controls; all of them except hsa-miR-296-5p were up-regulated in healthy controls. [score:6]
[1 to 20 of 1 sentences]
18
[+] score: 6
In regards to age, we discovered that the expression levels of 14 miRNAs (miR-654-5p, miR-493*, miR-410, miR-376a*, miR-758, miR-381, miR-543, miR-539, miR-487b, miR-337-5p, miR-136*, miR-154*, miR-330-3p, and miR-421) were significantly higher in HCC up to 66 years old than in HCC over 67 years old. [score:3]
o.   fold changep-valuehsa-miR-654-5p3.880.00014hsa-miR-493*3.100.00016hsa-miR-4102.930.00029hsa-miR-376a*2.660.00072hsa-miR-7582.870.00073hsa-miR-3812.390.00094hsa-miR-5432.070.00119hsa-miR-5393.060.00124hsa-miR-487b2.020.00186hsa-miR-337-5p2.540.00195hsa-miR-136*2.790.00246hsa-miR-154*2.270.00337hsa-miR-330-3p2.440.00759 hsa-miR-421 2.45 0.01282We also identified miRNAs with expression levels that varied according to gender and age. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 5
Recently, mir-493 (curiously also located on chromosome 14q32) was shown to be capable of inhibiting liver metastasis in a colon cancer mo del by targeting IGF1R [39]. [score:5]
[1 to 20 of 1 sentences]
20
[+] score: 5
Other miRNAs from this paper: hsa-mir-221, hsa-mir-222
The under-expressed genes UGT2B7, Let7, and miR-493 are primarily involved with steroid metabolism and cell cycle regulation, which may contribute directly to the formation and progression of prolactinomas [23]. [score:5]
[1 to 20 of 1 sentences]
21
[+] score: 5
In pituitary carcinomas compared to ACTH adenomas, miR-122 and miR-493 were upregulated, and, in all three metastatic sites of ACTH carcinomas, miR-122 expression was markedly increased. [score:5]
[1 to 20 of 1 sentences]
22
[+] score: 5
We did not observe any statistically significant variation in the expression levels of miR-329, miR-422a, miR-493 during development whereas these miRNAs have been described to be modulated during porcine muscle development [35]. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
Ssc-miR-493-5p and ssc-miR-493-3p had lower expression levels in mpiPSCs compared with pEFs (Fig 5D). [score:2]
The sequencing studies only detected reads for ssc-miR-493-3p, ssc-miR-493-5p and ssc-miR-136. [score:1]
Of the miRNAs in the porcine Dik1-Dio3 region, there were four annotated miRNAs: ssc-miR-127, ssc-miR-495, ssc-miR-493 and ssc-miR-136. [score:1]
[1 to 20 of 3 sentences]
24
[+] score: 3
In some cases, arm switching appeared to be tissue specific, such as miR-378, whose dominant form was 5p in the ovary and 3p in all other tissues, and miR-493 and miR-140, whose dominant product was 5p in all tissues except skin, where the 3p form was expressed at a higher level. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
RhoC is also a validated target of miR-493 and miR-138, which reduce the migration of cancer cells [129, 130]. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Our data adds support for an islet-enriched expression pattern of six miRNAs previously highlighted by microarray studies (miR-184, miR-183-5p, miR-7-5p, miR-127-3p, miR-375, and miR-493-5p) [17], [20]. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
The presence of such a SAGE tag in two mouse SAGE libraries strongly supports the existence of mouse mir-493. [score:1]
LongSAGE data also suggest the existence of a mouse homolog of human and rat mir-493. [score:1]
One mouse miRNA candidate, cand202-MM, predicted by both Berezikov et al. [7] and Sewer et al. [9], is highly homologous to human and rat mir-493. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 2
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
The cow, dolphin and horse genomes, which are phylogentically close to the pig genome, all harbors near complete mir-493 clusters, so this is likely an assembly issue in pig. [score:1]
The mir-493 cluster appear to be broken in pig. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 2
Twenty out of 23 miRNAs with a significant deregulation in PC tissues were linked to others vertices of the network by a number of edges varying from one to five (degree: from 8.88 to 1.92); for only 3 miRNAs (i. e. miR-30d*, miR-1280 and miR-493*) no significant correlation was observed (degree: 0), (Figure 5, panel B). [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 2
Other miRNAs from this paper: hsa-mir-483
Thus, we could suggest that both the IGF2 gene and the precursor mir-493 are essential genes (in fetal tissue development and cancer growth) which might be controlled by genetic and epigenetic mechanisms driven by natural TTSs-TFO complexes. [score:2]
[1 to 20 of 1 sentences]
32
[+] score: 1
For miR-493 and the miR-214 cluster we observed cell-cycle genes to be enriched in the negatively correlated genes. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
For the pre-miRNAs originally annotated to encode miRNAs at both arms, the major arms of hsa-mir-374a, hsa-mir-500a, hsa-mir-625 and hsa-mir-136 are their 5p arms; while, the major arms of hsa-mir-664, hsa-mir-144, hsa-mir-493 and hsa-mir-376a-1 are their 3p arms. [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
org/microrna/) Meg3mmu-miR-770 # Bmp1, Bmp15, Capn3, Casq2, Fosb, Lmna, Mb, Obscn, Peg10, Ppp1ca, Sspn, Tmod1, Trp53 Unidentified mmu-miR-673 Camk2a, Camk2b, Camk2d, Camk2g, Dnmt1, Mtpn, Myh6, Ndn, Pax3, Rbl1, Sln, Tnnt1, Wnt1 Unidentifiedmmu-miR-493 # Cacng5, Camk2g, Cdkn1c, Ctcf, Dag1, Fhl1, Fos, Hras1, Jun, Mib2, Mtap, Peg10, Shh, Tmod1 Unidentifiedmmu-miR-337 # Capza2, Des, Dmd, Dnmt3a, Myh8, Mypn, Nfatc1, Plagl2, Pvalb, Sgcb, Snta1, Tpm3, Trp53 Unidentified mmu-miR-540 Akt3, Bmp2, Bmp7, Capzb, Emd, Itga7, Itgb1, Msc, Myog, Nkx2-5, Pten, Rhoa, Sln, Tlx1, Vim Unidentifiedmmu-miR-665 # Casq2, Igf2, Junb, Ldb3, Peg10, Magel2, Nnat, Pax3, Ryr1, Sntb2, Tln1, Tpm2, Trp53, TtnAnti-Peg11 $ mmu-miR-431 # d Camk2b, Casq1, Dtna, E2f1, Fgf4, Gata3, Igf1, Kit, Max, Peg10, Plagl2, Ppp3r1, Sgcd, Tcf21Anti-Peg11 $ mmu-miR-433 # Bmpr1b, Capza1, Creb1, Ctcf, E2f3, Gata6, Isl1, Jak2, Myh9, Peg10, Plagl2, Ppp3r1, Sntg1Anti-Peg11 $ mmu-miR-127 # d e Auts2, Bcl6, Camk2d, Cdc42, Creb5, E2f3, Igf2, Myo1c, Otx1, Plagl2, Pitx2. [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
001 miR-493 92.40058 <0.001 miR-515-3p 97.85771 <0.001ER = estrogen receptor. [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
However, six miRNAs (miR-17, miR-202, miR-425, miR-493, miR-624 and miR-625) had a higher number of sequencing reads originating from the annotated miRNA* strand than the mature miRNA sequence across majority of the libraries (Additional File 3). [score:1]
[1 to 20 of 1 sentences]