sort by

34 publications mentioning hsa-mir-519a-2

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-519a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 269
Other miRNAs from this paper: hsa-mir-128-1, hsa-mir-128-2, hsa-mir-519a-1
Lentiviral expressing GFP empty vector (NC-LV), GFP vector overexpressing miR-519a (LV- miR-519a), or GFP vector inhibiting miR-519a expression (LV-anti- miR-519a) was constructed by Systems Biosciences Inc. [score:9]
The results of flow cytometry analysis revealed that miR-519a overexpression significantly increased GBM cell apoptosis caused by TMZ treatment, whereas downregulation of miR-519a inhibited TMZ -induced apoptosis in U87-MG cells (Fig.   1d, e). [score:8]
Meanwhile, downregulation of miR-519a expression by LV-anti-miR-519a suppressed the chemosensitivity of U87-MG cells to TMZ (Fig.   5a–c). [score:8]
Previously, we reported that miR-519a is downregulated in GBM cells, and overexpression of miR-519a may suppress GBM cell proliferation [21]. [score:8]
We previously demonstrated that miR-519a functions as a tumor suppressor in glioma by targeting STAT3 [21]; therefore, we hypothesized that miR-519a -mediated prodeath autophagy may occur via targeting of STAT3 to sensitize U87-MG/TMZ cells to TMZ. [score:7]
On the other hand, knockdown of miR-519a inhibited the expression of LC3-II and Beclin-1 in U87-MG cells. [score:6]
We identified downregulation of miR-519a and upregulation of STAT3 in recurrent GBM tissues compared to primary GBM tissues (Fig.   6a). [score:6]
These results were validated by using the overexpressing vector pCMV-MIR-519a or the inhibition vector miR-519a sponge (Additional file  5: Figure S3). [score:5]
In particular, 3-MA strongly inhibited the transformation of LC3-I into LC3-II and decreased the TMZ -induced activation of caspase-3 in miR-519a -overexpressing U87-MG/TMZ cells (Fig.   3f). [score:5]
We previously found that miR-519a functions as a tumor suppressor in glioma by targeting the signal transducer and activator of transcription 3 (STAT3) -mediated autophagy oncogenic pathway. [score:5]
Furthermore, we constructed STAT3 -expressing plasmids and siRNA to evaluate whether co-transfection with miR-519a mimic or inhibitor can counteract the effect of STAT3 -expressing plasmids or STAT3 siRNA in GBM cells. [score:5]
Ectopic expression of STAT3 significantly attenuated the effects of miR-519a on autophagy induction in U87-MG/TMZ cells, while suppression of STAT3 can stimulate anti- miR-519a -dependent autophagy in U87-MG cells. [score:5]
In order to detect the occurrence of autophagy after TMZ treatment in the presence or absence of miR-519a, we conducted Western blot analysis to examine the levels of two autophagy-related proteins: LC3B and Beclin-1. As shown in Fig.   2e, the expression levels of LC3-II and Beclin-1 proteins were increased in miR-519a -overexpressing U87-MG/TMZ cells. [score:5]
As compared with control cells, overexpression of miR-519a enhanced TMZ -induced GFP-LC3 puncta formation in U87-MG/TMZ cells, whereas knockdown of miR-519a in U87MG cells inhibited the formation of TMZ -induced GFP-LC3 puncta (Fig.   2c). [score:5]
U87-MG cells with stable expression of lentivirus miR-519a or U87-MG/TMZ cells with stable expression of miR-519a shRNA were injected into the left flank of the mice, while control cells were injected into the right flank of the mice. [score:5]
We previously demonstrated that miR-519a functions as a tumor suppressor in glioma by targeting STAT3 [21]. [score:5]
Additionally, overexpression of miR-519a can induce autophagy via the inhibition of STAT3/Bcl-2 signaling pathway. [score:5]
In addition, miR-519a overexpression can induce autophagy by inhibiting STAT3/Bcl-2 pathway. [score:5]
The results revealed that the number of autophagic vacuoles per cell was markedly increased in miR-519a -overexpressing U87-MG/TMZ cells and decreased in miR-519a-knockdown U87-MG cells after TMZ treatment (Fig.   2d). [score:4]
TEM results demonstrated that forced expression of miR-519a increased the numbers of autophagic vacuoles in GBM tissues, whereas knockdown of miR-519a decreased the numbers of autophagic vacuoles after TMZ treatment (Fig.   5f, g). [score:4]
TMZ treatment significantly upregulated miR-519a in U87-MG cells but not in U87-MG/TMZ cells. [score:4]
b TMZ induced miR-519a upregulation in a time -dependent manner. [score:4]
Stable knockdown and overexpression of miR-519a in GBM cells were established using lentivirus. [score:4]
In this study, we demonstrated that the expression of miR-519a was reduced in chemoresistant GBM tissues and TMZ-resistant cells, thus suggesting that low levels of miR-519a were associated with TMZ resistance. [score:3]
Moreover, TMZ may induce the expression of miR-519a in U87-MG cells but not in U87-MG/TMZ cells (Additional file  4: Figure S2). [score:3]
In this study, we demonstrated that the enhanced autophagy by forced miR-519a expression can sensitize GBM cells to TMZ. [score:3]
The miRNA overexpression vector pCMV-MIR519A (MI0003182) and the empty vector control were obtained from OriGene (Rockville, MD, USA). [score:3]
After treatment with TMZ, tumors derived from miR-519a -overexpressing U87-MG/TMZ cells grew more slowly and had lower tumor weight than those derived from cells harboring empty vector. [score:3]
miR-519a dramatically enhanced TMZ -induced autophagy and apoptotic cell death in U87-MG/TMZ cells, while inhibition of miR-519a promoted TMZ resistance and reduced TMZ -induced autophagy in U87-MG cells. [score:3]
Our results, in agreement with previous findings [41– 43], showed that autophagy inhibition by 3-MA may reduce apoptosis during combined treatment of miR-519a and TMZ, whereas rapamycin -induced autophagy can enhance apoptosis following combined treatment of anti- miR-519a and TMZ. [score:3]
MRI results on day 24 revealed lower tumor volumes in miR-519a -overexpressing tumor cells than in control (Fig.   5h). [score:3]
Moreover, ectopic expression of STAT3 may decrease the number of GFP-LC3 dots (Fig.   4d, f) and autophagic vacuoles (Fig.   4e, g) induced by miR-519a. [score:3]
c Both U87-MG/TMZ and U87-MG cells were transfected with GFP-LC3 construct expressing either miR-519a or anti- miR-519a, followed by treatment with 400 μM TMZ. [score:3]
In human GBM tissues, we found an inverse correlation between miR-519a and STAT3 expression. [score:3]
The in vivo results showed that miR-519a can enhance apoptosis and sensitized GBM to TMZ treatment by promoting autophagy and targeting the STAT3/Bcl-2/Beclin-1 pathway. [score:3]
Fig. 4 miR-519a induced autophagy through the modification of STAT3 expression. [score:3]
b The expression of miR-519a was detected by qRT-PCR. [score:3]
Taken together, our data indicated that the inductive effects of miR-519a on autophagy can be resulted from the induction of early stages of autophagy, rather than from the suppression of autophagosome degradation. [score:3]
TMZ enhanced the expression of miR-519a in U87-MG cells but showed no effect on U87-MG/TMZ cells. [score:3]
A significant inverse correlation was found between miR-519a and STAT3 expression levels (Fig.   6b). [score:3]
miR-519a induced autophagy through modification of STAT3 expression. [score:3]
We have previously demonstrated that miR-519a can target STAT3 in GBM [21] and speculated that STAT3 may be involved in miR-519a-enhanced autophagy after TMZ treatment. [score:3]
To confirm whether autophagy is responsible for the cellular sensitization during TMZ chemotherapy enhanced by miR-519a, we assessed the cell apoptosis rate after the inhibition and induction of autophagic activity in both U87-MG/TMZ and U87-MG cells, respectively. [score:3]
a miR-519a expression was assessed in primary (n = 24) and recurrent GBM tissue samples (n = 24). [score:3]
Tumor tissue samples were collected from 48 patients with GBM and were used to assess the relationship between miR-519a and STAT3 expression. [score:3]
Twenty-four hours after TMZ treatment, the BafA1 -treated negative control cells displayed markedly increased accumulation of LC3II, and the ectopic expression of miR-519a may enhance these effects (Fig.   2f). [score:3]
Treatment with 3-MA significantly attenuated the anti-proliferative effects of miR-519a in miR-519a -overexpressing U87-MG/TMZ cells, whereas rapamycin treatment reversed the chemoresistance of TMZ in U87-MG cells transfected with anti- miR-519a, as indicated by MTT and colony formation assays, respectively (Fig.   3a, b, e). [score:2]
Meanwhile, rapamycin significantly promoted the LC3-II accumulation and increased the TMZ -induced activation of caspase-3 in miR-519a-knockdown U87-MG cells (Fig.   3f). [score:2]
in vivoTo investigate the effects of miR-519a in vivo, we established U87-MG/TMZ cells with stable overexpression of miR-519a and U87-MG cells with stable knockdown of miR-519a. [score:2]
U87-MG/TMZ cells transfected with miR-519a were treated with or without 400 μM TMZ after incubation with 3-MA (an inhibitor of autophagy) for 2 h. U87-MG cells transfected with anti- miR-519a were treated with or without 200 nM rapamycin for 2 h. The cells were then analyzed for the following: a assessment of proliferation by MTT assay; b, e assessment of colony formation; c, d assessment of apoptosis by FACS analysis of PI-stained cells; and f assessment of caspase-3 activity. [score:2]
As shown in Fig.   1b, the expression of miR-519a was lower in the resistant U87-MG/TMZ and G131212/TMZ cells compared to their respective parental sensitive cells. [score:2]
Moreover, the expression of miR-519a and baseline autophagy levels was lower in U87-MG/TMZ cells as compared to U87-MG cells. [score:2]
After transfecting U87-MG/TMZ and U87-MG cells with miR-519a mimic or inhibitor, a series of biochemical assays such as MTT, apoptosis, and colony formation were performed to determine the chemosensitive response to TMZ. [score:2]
To investigate the effects of miR-519a in vivo, we established U87-MG/TMZ cells with stable overexpression of miR-519a and U87-MG cells with stable knockdown of miR-519a. [score:2]
miR-519a sensitized GBM cells to TMZ treatment. [score:1]
We further improved our understanding of the molecular basis of miR-519a in GBM. [score:1]
d, e GBM cells transfected with miR-519a or anti- miR-519a were treated with 400 μM TMZ for 36 h. Cells were harvested and stained with PI and annexin V-FITC for apoptotic analysis (** p < 0.01 vs. [score:1]
The results of this study suggested that miR-519a may hold a great potential to overcome TMZ chemoresistance in GBM. [score:1]
a TMZ enhanced the levels of miR-519a in U87-MG cells in a concentration -dependent manner. [score:1]
Both U87-MG/TMZ and U87-MG cells were infected with LV-miR-519a and LV-anti-miR-519a before they were applied to a subcutaneous xenograft mo del. [score:1]
Effects of STAT3 on miR-519a-enhanced autophagy and apoptosis were analyzed by immunoblotting in the indicated cells (h). [score:1]
These results significantly improved our understanding of the molecular basis of miR-519a in GBM cells with TMZ resistance. [score:1]
We found that miR-519a sensitized the U87-MG/TMZ cells to TMZ and confirmed that anti- miR-519a induced TMZ resistance in U87-MG cells (Fig.   1c). [score:1]
b Expression levels of miR-519a were inversely correlated with STAT3 mRNA in tissue samples, as measured by linear regression analysis. [score:1]
In the present study, we confirmed that miR-519a sensitized U87-MG/TMZ cells to TMZ and triggered autophagy -mediated apoptosis via STAT3 pathway. [score:1]
In addition, our results showed that miR-519a enhanced chemosensitivity in GBM cells, mainly through TMZ -induced autophagy and apoptosis. [score:1]
Indeed, we found that miR-519a promoted the autophagy of GBM cells via dissociation of Bcl-2/Beclin-1 complex. [score:1]
These in vivo results supported that miR-519a can sensitize GBM cells to TMZ. [score:1]
In vivo and in vitro analysis clearly indicated that miR-519a increased TMZ sensitivity by promoting GBM cell apoptosis through autophagy. [score:1]
Collectively, these findings suggested that STAT3 was critical for miR-519a-enhanced autophagy after TMZ treatment in GBM cells. [score:1]
b Colony formation in U87-MG/TMZ and U87-MG cells transfected with pCMV-miR-519a or miR-519a sponge and then treated with or without TMZ at various concentrations (or times). [score:1]
h Western blot analysis of cleaved caspase-3 in GBM cells transfected with miR-519a or anti- miR-519a and then treated with TMZ for 24 h. Data represent the mean (± standard deviations) and are representative of three independent experiments, each performed in triplicate. [score:1]
Therefore, these differences strongly suggested an apparent association between miR-519a, STAT3, and LC3B in GBM patients. [score:1]
Furthermore, the combination of miR-519a and TMZ induced prodeath autophagy, suggesting that the autophagic response of GBM cells to TMZ can be modified when administered in combination with other antitumor agents. [score:1]
However, the molecular mechanisms underlying the role of miR-519a in the chemoresistance of GBM remain unclear. [score:1]
Moreover, miR-519a can effectively sensitize GBM cells to irradiation treatment (Additional file  6: Figure S4). [score:1]
Indeed, in this study, we found that miR-519a promoted the autophagy of GBM cells by enhancing dissociation of the Bcl-2/Beclin-1 complex and enhanced therapeutic efficacy in vivo and in vitro. [score:1]
These findings strongly suggested that the enhanced apoptosis of GBM cells induced by the combination of miR-519a and TMZ is dependent on autophagy. [score:1]
d Schematic illustration of the mechanisms underlying miR-519a induced chemosensitivity to TMZ. [score:1]
miR-519a sensitized GBM cells to TMZ treatment by promoting autophagy. [score:1]
miR-519a, as a small molecule, may be a favorable candidate for analysis in clinical trials. [score:1]
miR-519a Signal transducer and activator of transcription 3 Glioblastoma Autophagy Chemoresistance Glioblastoma (GBM) is the most common primary malignant brain tumor in adults [1]. [score:1]
Therefore, miR-519a in combination with TMZ therapy could render a more effective therapeutic approach for GBM. [score:1]
A xenograft nude mouse mo del and in situ brain mo del were used to examine the in vivo effects of miR-519a. [score:1]
Fig. 2 miR-519a enhanced TMZ -induced autophagy in GBM cells. [score:1]
For survival analysis in the orthotopic xenograft mo del, nude mice were randomly divided into four groups: LV-anti- miR-519a group, LV-anti-NC group, LV-anti-NC+TMZ group, and LV-anti- miR-519a+TMZ group. [score:1]
Fig. 5 miR-519a enhanced the antitumor efficacy of TMZ in vivo. [score:1]
Therefore, a combination of miR-519a and TMZ may represent an effective therapeutic strategy in GBM. [score:1]
miR-519a promoted TMZ -induced autophagy in GBM cells. [score:1]
The expression of miR-519a was measured by qRT-PCR. [score:1]
a Cell viability of U87-MG/TMZ and U87-MG cells transfected with pCMV-miR-519a or miR-519a sponge and then treated with or without TMZ at various concentrations (or times). [score:1]
However, the pivotal role of miR-519a in the modulation of TMZ sensitivity is still not fully understood. [score:1]
miR-519a sensitized GBM cells to TMZ treatment in vivo. [score:1]
b Clonogenic survival of GBM cells transfected with miR-519a or anti- miR-519a. [score:1]
Further results from Kaplan-Meier survival analysis showed that miR-519a can improve the survival time after tumor cell implantation (Fig.   5i). [score:1]
These in vivo findings suggested that the chemosensitizing effect of miR-519a may be contributed to autophagy induction. [score:1]
d Both U87-MG/TMZ and U87-MG cells were transfected with either miR-519a or anti- miR-519a for 24 h, followed by treatment with 400 μM TMZ. [score:1]
e U87-MG/TMZ cells transfected with miR-519a and parental U87-MG cells transfected with anti- miR-519a were exposed to 400 μM TMZ at different time points (0–24 h). [score:1]
Collectively, these data supported that miR-519a may enhance TMZ chemosensitivity in GBM cells. [score:1]
Our results suggested that miR-519a increased the sensitivity of GBM cells to TMZ therapy. [score:1]
c Cell viability of DMSO- or TMZ -treated GBM cells transfected with miR-519a or anti- miR-519a. [score:1]
miR-519a was associated with chemoresistance of GBM. [score:1]
Additionally, the antitumor efficacy of miR-519a was examined in an orthotopic G131212/TMZ xenograft mo del. [score:1]
The miR-519a sponge and empty vector control were purchased from GeneChem (China). [score:1]
miR-519a enhanced radiosensitivity in GBM cells. [score:1]
The results of analysis also revealed that STAT3 significantly attenuated the miR-519a-enhanced autophagy and apoptosis in GBM cells (Fig.   4h). [score:1]
Fig. 6 miR-519a was associated with chemoresistance. [score:1]
Furthermore, Western blot analysis showed that TMZ -induced cellular apoptosis was greatly enhanced by miR-519a compared to NC, while knockdown of endogenous miR-519a decreased TMZ -induced cell apoptosis (Fig.   1h). [score:1]
f U87-MG/TMZ cells transfected with or without miR-519a and treated with or without 400 μM TMZ after incubation with 20 nM bafilomycin A1 for 2 h. U87-MG cells transfected with or without anti- miR-519a were treated with 20 nM bafilomycin A1 for 2 h. Cell lysates were analyzed by. [score:1]
Previously, we demonstrated that miR-519a is closely related to improved prognosis of GBM patients [21]. [score:1]
The positive effects of miR-519a may be mediated through autophagy. [score:1]
[1 to 20 of 111 sentences]
2
[+] score: 85
miR-519, a microRNA that suppresses tumorigenesis and lowers expression of RNA -binding protein HuR, was upregulated in senescent cells. [score:8]
In conjunction with the finding that miR-519 reduced tumorigenesis in a xenograft mo del [32], we propose that the coordinated action of senescence -upregulated microRNAs can suppress tumor growth by reducing the levels of oncogenes or tumor promoters. [score:6]
Among the microRNAs showing increasing abundance with senescence, miR-519 was of particular interest because it was shown to inhibit translation of HuR and to diminish tumor growth [31, 32]. [score:5]
To test this possibility, we overexpressed miR-519a in young-HDFs (Figure 4B); western blot analysis confirmed that miR-519a overexpression repressed HuR (Figure 4C). [score:5]
In keeping with earlier results [31], miR-519a did not influence the levels of HuR mRNA (Figure 4D), in agreement with the view that miR-519a inhibited HuR mRNA translation without affecting HuR mRNA stability. [score:5]
miR-519 was recently found to inhibit translation of the RNA -binding protein HuR through its interaction with the HuR coding region [31]. [score:5]
miR-519a -overexpressing cells also showed increased SA-β-gal activity (Figure 4F) and elevated expression of the senescence marker p27 [35, 36] (Figure 4G, bottom). [score:5]
As indicated above, miR-519 was found to suppress tumor growth [32]. [score:3]
Overexpression of miR-519 induced senescence in WI-38 and HeLa cells. [score:3]
As shown here for miR-519, we postulate that these changes help to meet the needs of senescent cells in eliciting tumor suppression and growth arrest. [score:3]
Upon miR-519a overexpression (Figure 5A), HeLa cell numbers declined significantly (Figure 5B). [score:3]
Since HuR potently enhances the expression of cancer-promoting proteins, and reducing HuR levels promotes HDF senescence [11, 38], we propose that miR-519 represses tumor growth at least in part, by lowering HuR and thereby promoting senescence (Figs. 4 and 5). [score:3]
Additionally, miR-519 could further repress tumor growth by lowering the expression of other genes, such as ABCG2 or HIF-1α [46, 47]. [score:3]
We found that overexpression of miR-519a decreased HuR levels, lowered cell proliferation, and promoted replicative senescence in both WI-38 and HeLa cells. [score:3]
In a separate study, miR-519 suppressed the growth of tumor xenografts in an HuR -dependent manner [32]. [score:3]
Together, these data indicate that miR-519a induced cellular senescence and inhibited cell proliferation, resulting in accelerated senescence. [score:3]
Accordingly, we postulate that one of the mechanisms by which miR-519 suppress tumor growth is by inducing senescence, and further propose that miR-519 triggers senescence -at least in part- by reducing HuR levels. [score:3]
Given that HuR promotes cell proliferation and decreases senescence [33, 34], we hypothesized that the elevated miR-519 in senescent cells (Figure 4A) might lower HuR expression in WI-38 HDFs, and hence promote senescence. [score:3]
Moreover, sustained miR-519a overexpression for 4 weeks caused a marked reduction in cell number as compared to control transfection groups (Figure 4E). [score:2]
We were particularly interested in the miR-519 family. [score:1]
Together, these data indicate that miR-519 reduced HeLa cell proliferation and promoted HeLa cell senescence. [score:1]
They further suggest that miR-519a -induced senescence may be mediated in part by repression of HuR. [score:1]
miR-519a (Ambion) or control siRNA (AATTCTCCGAACGTGTCACGT, Qiagen) were transfected at a final concentration of 100 nM using Lipofectamine 2000 (Invitrogen). [score:1]
miR-519 -induced senescence in HDFs. [score:1]
miR-519 -induced senescence in HeLa cells. [score:1]
We previously reported that miR-519 represses the production of HuR, an RNA -binding protein which is highly abundant in cancer cells and is low in untransformed cells [11, 38]. [score:1]
Moreover, while HuR levels are high in tumors and low in normal tissues, miR-519 levels are high in normal tissues and low in cancer tissues [32]. [score:1]
Influence of miR-519 on the senescent phenotype of HeLa cells. [score:1]
miR-519a -induced senescence by lowering HuR. [score:1]
Influence of miR-519 on WI-38 senescence. [score:1]
[1 to 20 of 30 sentences]
3
[+] score: 47
B) Enrichment plots for the gastric-derived mir-519a signature (left) Enrichment plot for genes upregulated in the gastric-derived mir-519a signature, queried against genes upregulated in miR-519a transfected cells. [score:7]
For mir-519a, we again found that several genes upregulated in the gastric-derived mir-519a signature were also found to be upregulated in hsa-mir-221 transfected STF-3a cells (positive Normalized Enrichment Score (NES) = 1.091). [score:7]
upregulated portion of the gastric-derived mir-519a signature in miR-519a overexpressing cells. [score:6]
To assess the effects of these four miRNAs on Wnt pathway activity, we transfected pri-microRNA sequences of hsa-miR-205, hsa-miR-221, hsa-miR-517c, and hsa-miR-519a into STF-3a cells, which are HEK293 embryonic kidney cells constitutively expressing a TOP-Flash reporter plasmid and overexpressing WNT-3a [24]. [score:5]
Similarly, GSEA of hsa-miR-519a -transfected STF-3a cells showed significant enrichment of the geneset LIN_WNT_UP, comprising Wnt target genes identified by expression of the Wnt antagonist APC in APC -deficient SW480 colon cancer cells [28] (bottom panel, Figure 3C). [score:5]
Only one gene was downregulated in the hsa-mir-519a signature, which is insufficient for GSEA analysis. [score:4]
Gene expression profiling using Affymetrix Human Genome U133 plus Genechips (HG-U133 Plus 2.0, Affymetrix) were also performed on pri-hsa-miR-221 and pri-hsa-miR-519a transfected STF-3A cells. [score:3]
Bottom panel, enrichment plot for the Wnt activation signature LIN_WNT_UP in miR-519a overexpressing cells. [score:3]
The observation that hsa-miR-221 and hsa-miR-519a transfections can activate two different Wnt-related genesets suggests that these two miRNAs may contribute to distinct Wnt-related regulatory cascades. [score:2]
Using these criteria, 4 miRNAs, hsa-miR-205, hsa-miR-221, hsa-miR-517c, and hsa-miR-519a (inside orange rectangle, Figure 3A) were nominated as candidate regulators of Wnt signaling. [score:2]
Table S14 GSEA report for mir-519a transfected STF-3a cells. [score:1]
These two Wnt-related gene sets (KENNY_WNT_UP and LIN_WNT_UP) were noted because they exhibited the highest GSEA enrichment scores among all Wnt-related genesets in the MSigDB C2 collection for hsa-mir-221 and hsa-miR-519a respectively (Tables S13 and S14). [score:1]
Using the miRNA–pathway network constructed in this study, we confirmed a host of previously reported miRNA pathway interactions, and identified four miRNAs as new candidate Wnt modulators (hsa-miR-205, hsa-miR-221, hsa-miR-517c, hsa-miR-519a). [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 33
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
However, construction of a Venn diagram showed that only 262 putative target genes are common between the miR-519 and miR-520 subfamilies in group I, indicating that the miR-519 and -520 subfamilies target different sets of genes. [score:5]
Genes targeted by either or both the miR-519 or -520 subfamilies are shown in different color boxes. [score:3]
Furthermore, one of the characteristics of target prediction, the sequence context surrounding the seed binding site of the target transcript [1], between the miR-519 and -520 subfamilies are also dissimilar (Fig.   2a). [score:3]
The group I miR-519 subfamily also shares 262 putative target genes with the miR-302/-372 families, far fewer than the miR-520 subfamily (Fig.   3a, red box). [score:3]
In this study, the putative target sets of the miR-519 and -520 subfamilies are overlapping gene sets predicted by two different prediction algorithms. [score:3]
The group I miRNAs are composed of the miR-519 and -520 subfamilies. [score:1]
Furthermore, it is noted that the AAGUGC seed position at 5’ end is variable among the C19MC-AAGUGC-miRNAs: subgroup I miRNAs, which includes eight miR-519 and -520 subfamilies, have the seed sequence located at the canonical and optimal 5’-nucleotide positions (nts) 2-7, as in the miR-302/-372 families; the seed sequence of the four subgroup IIa miRNAs is at location nts 1-6, and that of the remaining subgroup IIb miRNAs is at nts 3-8 and 4-9 (Fig.   2a). [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 19
The 3’-UTR regions of the 2 Smyd2 human transcripts were predicted to be bind by miR-519a-3p and miR-519b-3p, 2 highly down-regulated miRNAs in LA (S3 Table). [score:4]
0196666.g007 Fig 7A) HEK293T cells were transfected with reporter plasmid containing the 3’-UTR region of Smyd2 associated with luciferase/renilla and with either a plasmid expressing random miRNAs, or pre-miR-519a-3p or pre-miR-519b-3p. [score:3]
MiR-519a-3p or miR-519b-3p precursors were cloned in pEZX-MR04 vector also expressing GFP (#Hmi R0453; #Hmi R0320, GeneCopoeia [™], Inc. [score:3]
A) HEK293T cells were transfected with reporter plasmid containing the 3’-UTR region of Smyd2 associated with luciferase/renilla and with either a plasmid expressing random miRNAs, or pre-miR-519a-3p or pre-miR-519b-3p. [score:3]
E) Quantification of SMYD2 protein level in HEK293T transfected with either pre-miR-519-3p or random miRNA sequences. [score:1]
D) Quantification of Smyd2 mRNA level in HEK293T transfected a plasmid containing either pre-miR-519-3p or random miRNA sequences. [score:1]
F) Western-blot of HEK293T protein extract, transfected either with pre-miR-519-3p or random miRNA sequences. [score:1]
In order to validate these predictions, a reporter plasmid containing the 3’-UTR region of Smyd2 associated with luciferase/renilla was co -transfected with either pre-miR-519a-3p or pre-miR-519b-3p. [score:1]
Validation of Smyd2 mRNA interaction with miR-519. [score:1]
Two days later, cells were transfected in quadruplicate with Smyd2 3'-UTR sequence concomitantly with either miR-519a-3p or miR-519b-3p precursors or an empty pEZX vector used as control, by using ExGen500 transfection reagent (EUROMEDEX). [score:1]
[1 to 20 of 10 sentences]
6
[+] score: 19
Briefly, by using three different prediction algorithms, as well as the TarBase database for experimentally validated miRNA targets, we identified putative target genes for the miRNAs mir-517a, mir-517c and mir-519a (Fig.   5). [score:5]
Following miRNA array analysis, four miRNAs were selected based on changes in expression; mir-517c, mir-517a, mir-519a and mir-210. [score:3]
Of special interest were the three C19MC miRNAs mir-517c, mir-517a and mir-519a, which were expressed in a majority of the samples but not in the controls, i. e. untreated cells. [score:3]
org) [57], we identified potential miRNA target genes for the C19MC miRNAs mir-517a, mir-517c and mir-519a. [score:3]
Based on the array results, four miRNAs (mir-517a, mir-517c, mir-519a and mir-210) were selected for further analysis using RTqPCR. [score:1]
By combining the gene lists from the three prediction algorithms, we found 33 genes for mir-517a and mir-517c as well as 872 genes for mir-519a. [score:1]
After treatment with normal STBEVs, the levels of mir-517a, mir-517c and mir-519a increased significantly (p = 0.00164, p = 0.0002 and p = 0.00164 respectively). [score:1]
The three placental C19MC miRNAs, mir-517a (a), mir-517c (b) and mir-519a (c), were analysed using RTqPCR. [score:1]
Tarbase provided one (1) experimentally supported gene for mir-517a, no genes for mir-517c and four (4) genes for mir-519a. [score:1]
[1 to 20 of 9 sentences]
7
[+] score: 17
The mechanism underlying selective upregulation of the ORAI1 subunit is not known, but the post-transcriptional expression of the ORAI1 gene has been shown to be regulated by miR-519 using TargetScan/complementarity studies in HELA cells (Ab delmohsen et al., 2012). [score:9]
Whether similar regulation by MIR-519 occurs in hVF-HF is not known, but in our studies we were unable to detect MIR-519 expression in fibroblasts from non-failing or failing hearts, which is suggestive that other possible regulatory mechanisms are involved (Sauc et al., 2015). [score:5]
Growth inhibition by miR-519 via multiple p21-inducing pathways. [score:3]
[1 to 20 of 3 sentences]
8
[+] score: 14
Other miRNAs from this paper: hsa-mir-21, hsa-mir-205, hsa-mir-221, hsa-mir-141, hsa-mir-519a-1
68 Recently, miR-519a has been identified as a novel breast cancer oncomir, which co-suppresses several tumour suppressor genes, is associated with in vitro resistance to tamoxifen -induced apoptosis and higher miR-519a expression has been associated with poorer disease-free survival in oestrogen receptor positive breast cancer patients. [score:9]
31  MicroRNA ↑ miR-519a expression ↓ tamoxifen -induced apoptosis; ↓ disease-free survival in oestrogen receptor positive breast cancerRef. [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Significant expression of miRNAs within this cluster (miR-512-3p, miR-512-5p, mir-515-5p, miR-516b, miR-517a, miR-517c, miR-518b, miR-518f, miR-519a and miR-519d) was observed in the MaSC/basal population (Fig.   3b), whereas no highly expressed luminal-specific primate miRNAs were identified. [score:5]
Furthermore, the primate-specific, basal-restricted miR-516a and miR-519a were most highly expressed in this subtype of breast cancer (Fig.   4b). [score:3]
Interrogation of the TCGA database for expression of DE primate-specific miRNAs (listed in Fig.   3c) revealed considerable enrichment of miR-516a and miR-519a in basal-like tumors (Fig.   4b; P < 1.9 × 10 [–5] and P < 5.3 × 10 [–9], respectively), in contrast to the other miRNAs, which did not demonstrate enrichment (data not shown). [score:3]
Boxplots are shown for miRNA-516a and miR-519a, where significant enrichment was observed in the basal-like subtype. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 12
Other miRNAs from this paper: hsa-mir-93, hsa-mir-34a, hsa-mir-34c, hsa-mir-520b, hsa-mir-519a-1
The downregulation of ULBP2 and MICA expression by miR-519a-3p has been implicated in the inhibition of NK cell -mediated cytotoxicity of breast cancer cells (35), whereas miR-93 mimics decreased cell surface expression of MICA, MICB, and ULBP3 by translational repression, thus contributing to the immune evasion of glioma cells (36). [score:12]
[1 to 20 of 1 sentences]
11
[+] score: 12
Mir-520e is involved in the NIK/p-ERK1/2/NF-κB signaling in hepatocarcinogenesis having as direct target NIK gene [27], while mir-519a acts in STAT3 pathways and is correlated with poor outcome in glioblastoma [28]. [score:4]
Li H. Liu Y. W. Wang H. Zhou Q. Li J. -J. Huang A. Qi S. T. Lu Y. -T. MiR-519a functions as a tumor suppressor in glioma by targeting the oncogenic STAT3 pathway J. Neurooncol. [score:4]
In particular, hsa-mir-520e, hsa-mir-518c-5p, and all six miRNA precursors were, resultingly, downmodulated in the high risk group, while hsa-mir-329-3p, hsa-mir-302d-3p, hsa-mir-520f, hsa-mir-511-5p, hsa-mir-509-3p, hsa-mir-519a-3p, hsa-mir-521, hsa-mir-520h, and hsa-mir-499a-5p were overexpressed. [score:3]
In particular, hsa-mir-302d-3p, hsa-mir-329-3p, hsa-mir-519a-3p, and hsa-mir-520e-f were associated with multiple pathways. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 10
Akin to the results obtained for the other members of that cluster high expression was noted only in the same four cell lines with 19q13 rearrangements expressing miR-512-5p, miR-517a, and miR-519a (Figure 3a) whereas a significantly lower expression was seen in the remaining cell lines (p = 0.001659; for details see Table 2). [score:7]
To evaluate the role of either of the two miRNA clusters located in close proximity to the breakpoint region as possible targets of the 19q13 translocations in thyroid adenomas, we have first used to compare the expression of three members of the C19MC cluster, i. e. miR-512-5p, miR-517a, and miR-519a in five cell lines established from thyroid adenomas with 19q13 rearrangements and three cell lines from adenomas with other clonal abnormalities (Table 1). [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 8
Similarly, Hromadnikova et al. [17] detected a downregulation of 6 miRNAs (miR-517-5p, miR-518f-5p, miR-519a, miR-519d, miR-520a-5p, and miR-525) in placental tissues of 36 FGR pregnancies: compared to the previous studies, these results seem more robust since that authors investigated more types of miRNAs and used those that were previously demonstrated to be exclusively expressed or highly expressed in placental tissues. [score:5]
Nevertheless, other experiments found that the expression of miR-518b was decreased, whereas miR-519a was significantly increased, in 30 FGR placentas [16]. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 8
Moderate correlation was reported between expression level of miRNA and type of isomiRs [15], but unexpectedly, we herein found some exceptions: miR-519a was found fewer type of isomiRs although it had higher expression levels than miR-451 (Figure 6). [score:5]
Similar expression distributions could be detected across the three samples, especially some of them indicated consensus distributions (for example, hsa-miR-519a and hsa-miR-521). [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 7
Mir-519 and -519E were also upregulated in cKit+ ILCs; these microRNAs have been shown to inhibit cell growth and thus promote cell survival [25]whereas mir-423 promotes cell growth by regulating the G(1)/S transition in the cell cycle in hepatocellular carcinoma cell lines [26]. [score:7]
[1 to 20 of 1 sentences]
16
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Small RNA regulation of some of the splicing control proteins has previously been reported; for example, the ELAV transcript, which encodes the HuR protein, a major modulator of mRNA stability and translation in addition to mRNA splicing [58], is subject to regulation by miRNAs miR-519, miR-16 and miR-125a in a variety of cell types including cervical, ovarian and colon cancer cell lines [59, 60, 61]. [score:5]
Ab delmohsen K. Srikantan S. Kuwano Y. Gorospe M. miR-519 reduces cell proliferation by lowering RNA -binding protein HuR levels Proc. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 5
Also, miR-519a promotes proliferation and inhibits apoptosis of HCC cells by targeting FOXF2 [158]. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 4
Furthermore, several microRNAs (miRNAs) directly target STAT3 mRNA, including Let-7a [20], miR-17-5p [21], miR-29b [22], miR-124 [23], and miR-519a [24]. [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 4
Recently identified miRNAs, such as miR-9, miR-34a, miR-16, miR-125a, miR-29a, miR-200c, and miR-519, play crucial roles in regulating HuR expression through interaction of miRNAs with specific sites in the 3′UTR and 5′UTR of the HuR mRNA. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 4
Nine miRNAs (miR-519a, miR-212, miR-320b, miR-27a [∗], miR-30d [∗], miR-23a [∗], miR-30d [∗], miR-23a [∗], and miR-10a [∗]) and 5 miRNAs (miR-375, miR-485-3p, miR-23b, miR-485-3p, miR-23b, miR-627, and miR-1197) were up- or downregulated by glucose, respectively (Figure 2). [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 4
MiR-519 represses the production of HuR, an RNA -binding protein very abundantly found in tumor cells and less expressed in untransformed cells, while the overexpression of HuR delays the senescent phenotype (83). [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 3
Other miRNAs found differentially expressed in both tissues and cell lines are miR-146b, miR-508, miR-106b, miR-134, miR-155, miR-346, miR-422a, miR-424, miR-519a, miR-648, miR-662. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
“ Altered expression of miR-518b and miR-519a in the placenta is associated with low fetal birth weight. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Following that, miR-19b, miR-19a, miR-520d-5p, miR-524-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-495, miR-944 and miR-664 regulate 121, 119, 130, 130, 109, 109, 109, 102, 138, 123 genes, respectively. [score:2]
, miR-19b, miR-19a, miR-520d-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-944 and miR-664) are partially known (i. e., known to only human, but still unknown to rhesus). [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 3
In the context of squamous cell carcinoma, specific miRNAs, including miR-181a, miR-519a, miR-374a and miR-630, were identified as downstream targets of p-ΔNp63α [16]. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
[37] For example, ULK1 (unc-51 like autophagy activating kinase 1) is targeted by MIR20A and MIR106; [85] BECN1/beclin 1 by MIR30A, MIR376B and MIR519A; [86-89] RAB5A (RAB5A, member RAS oncogene family) by MIR101 and MIR630; [89,90] RB1CC1/FIP200 (RB1 inducible coiled-coil 1) by MIR224; [91] and ATGs by MIR30A, MIR181A, MIR374A, MIR630, MIR376B, MIR204, MIR224, MIR375, MIR519A, MIR885, and MIR-101. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
For example, miR-144, miR-937, miR-376, miR-519, and miR-548A-3P are shown to regulate a number of mRNAs, and HCK, NFKBIE, IL6, SHMT2, and MCM4 are regulated by several miRNAs. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
Our analysis shows a possible involvement of several members of the miR-515 family (such as miR-515-5p, miR-519 and miR-520a-3p/b/c-3p/d-3p/e/g/h), located at 19q13.4, in POF, since they are predicted to target FMR1 and FOXL2, two genes which are associated to POF [47], [48]. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 2
05544) 16533422 Kim TH Kim YK Kwon Y Heo JH Kang H Kim G An HJ 2010 Deregulation of miR-519a, 153, and 485-5p and its clinicopathological relevance in ovarian epithelial tumours. [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 2
Deregulation of miR-519a, 153, and 485-5p and its clinicopathological relevance in ovarian epithelial tumours. [score:2]
[1 to 20 of 1 sentences]
31
[+] score: 1
The miR-659-3p cluster also included miR-219-3p and miR-519-5p (Fig.   1b), which had less significant or no association with PFS (p = 0.036 and p = 0.12, respectively). [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-101-1, hsa-mir-139, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-142, hsa-mir-144, hsa-mir-127, hsa-mir-154, hsa-mir-185, hsa-mir-195, hsa-mir-29c, hsa-mir-101-2, hsa-mir-380, hsa-mir-381, hsa-mir-323a, hsa-mir-520e, hsa-mir-520a, hsa-mir-518c, hsa-mir-520d, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-519a-1, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-509-1, hsa-mir-576, hsa-mir-548a-1, hsa-mir-586, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-599, hsa-mir-548a-3, hsa-mir-607, hsa-mir-613, hsa-mir-548c, hsa-mir-625, hsa-mir-634, hsa-mir-642a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-1208, hsa-mir-548e, hsa-mir-548j, hsa-mir-1290, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1247, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1324, hsa-mir-1825, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-323b, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-642b, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Seven miRNAs are included in the C19MC cluster, which is a primate-specific cluster on chromosome 19 (miR-518a-5p, miR-518c, miR-518d-3p, miR-519a, miR-520a-5p, miR-520d-3p, miR-520e). [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
Other miRNAs from this paper: hsa-mir-495, hsa-mir-519a-1
Of note, a test for “hits” that also have activity against the recent pandemic strain Cal/04/09 identified two miRNA mimics that impair Cal/04/09 protein production in A549 cells (hsa-miR-495 and hsa-miR-519a, Figure 6D). [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
2010.00683. x 20649821 8. Ab delmohsen K. Srikantan S. Kuwano Y. Gorospe M. miR-519 reduces cell proliferation by lowering RNA -binding protein HuR levels Proc. [score:1]
[1 to 20 of 1 sentences]