sort by

61 publications mentioning hsa-mir-506

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-506. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 283
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-152
Our research demonstrated that miR-124 and miR-506 directly down-regulate DNMT3B and indirectly down-regulate DNMT1 by targeting SP1; that is,. [score:11]
To understand the mechanism by which miR-124 and miR-506 suppress CRC growth and invasion, we used two algorithms (Targetscan and Miranda) to help identify miR-124 and miR-506 targets in CRC. [score:7]
Overexpression of miR-124 or miR-506 inhibits tumor cell proliferation and invasion in vivoThe above results prompted us to verify that miR-124 or miR-506 inhibit CRC tumor cell proliferation and invasion in vivo. [score:7]
Furthermore, the overexpression of miR-124 or miR-506 markedly inhibited the ability of SW620 cells to migrate (Figure 2B), and the overexpression of either miR-124 or miR-506 remarkably attenuated cell invasion in SW620 cells (Figure 2C, five fields were counted in the Matrigel-coated cell invasion experiments). [score:7]
We hypothesized that miR-124 and miR-506 may directly target DNMT3B and may indirectly target DNMT1. [score:7]
Overexpression of miR-124 or miR-506 inhibits tumor cell progression and increases sensitivity to chemotherapy in vitroThe ectopic expression of miR-124 or miR-506 has been reported to be associated with the progression in many tumors [18– 24]. [score:7]
miR-124 and miR-506 directly target DNMT3B and indirectly target DNMT1. [score:7]
The above results may preliminarily indicate that DNMT3B is a direct target and that DNMT1 is an indirect target of miR-124 and miR-506. [score:7]
Furthermore, miR-506 expression is reportedly downregulated in oral squamous cell carcinoma [47], nasopharyngeal carcinoma [48] and gastric cancer [49]. [score:6]
MiR-124 and miR-506 expression levels are frequently downregulated in human CRC. [score:6]
Specifically, the overexpression of miR-124 and miR-506 inhibits colorectal tumor cell proliferation, migration, and invasion while also increasing drug sensitivity in vitro. [score:5]
D. Representative images of lung metastasis of the miR-124 -overexpressing, miR-506 -overexpressing and scrambled control groups. [score:5]
Moreover, we found that miR-124 and miR-506 targeted DNMT3B and DNMT1 (SP1 is a transactivator of the DNMT1 gene), which markedly reduced the expression of DNMT3B, DNMT1 and SP1 at both the RNA and protein levels. [score:5]
A diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC is shown in Figure 6. Figure 5 A. SW480 (left) and SW680 (right) cell were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:5]
Furthermore, the overexpression of miR-124 or miR-506 results in global DNA hypomethylation and gene re -expression of the hypermethylated and silenced E-cadherin, MGMT and P16 genes in CRC. [score:5]
Overexpression of miR-124 or miR-506 inhibits tumor cell proliferation and invasion in vivo. [score:5]
Diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC. [score:5]
Overexpression of miR-124 or miR-506 inhibits tumor cell progression and increases sensitivity to chemotherapy in vitro. [score:5]
Figure 6 Diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC. [score:5]
Overexpression of miR-124 and miR-506 reduces global DNA methylation and restores the expression of E-cadherin, MGMT and P16. [score:5]
Therefore, restoring miR-124 and miR-506 expression in CRC inhibits tumor progression in vitro and in vivo. [score:5]
A diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC is shown in Figure 6. Figure 5 A. SW480 (left) and SW680 (right) cell were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:5]
Figure 2Overexpression of miR-124 or miR-50b inhibits tumor cell progression and increases sensitivity to chemotherapeutics in vitro A. SW620 (left) and SW480 (right) cells were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:5]
Figure 3Overexpression of miR-124 or miR-506 inhibits tumor cell proliferation and invasion in vivo A. SW620 cells infected with miR-124, miR-506 or scramble control were subcutaneously injected into the flanks of nude mice (n = 5 for each group). [score:5]
Representative images of lung metastases for the miR-124 -overexpressing, miR-506 -overexpressing and control groups are shown in Figure 3D. [score:5]
For example, miR-124 has been shown to inhibit cell proliferation and suppress tumor growth in breast cancer [50], and miR-506 has been shown to tumor proliferation and invasion in nasopharyngeal carcinoma [47]. [score:5]
In this study, we found that miR-124 and miR-506 were strongly down-regulated in CRC tissues and cell lines. [score:4]
miR-124 and miR-506 are downregulated in colorectal cancer. [score:4]
The down-regulation of DNMT3B and DNMT1 by miR-124 and miR-506 has important functional ramifications. [score:4]
These data indicate an overt downregulation of miR-124 and miR-506 in CRC. [score:4]
To assess whether overexpression of miR-124 or miR-506 leads to the re -expression of hypermethylated and silenced genes in CRC, we measured the mRNA and protein levels of E-cadherin, MGMT and P16 in SW480 and SW420 cells by qRT-PCR and western blotting after transfection with miR-124, miR-506 or scrambled control. [score:3]
The mean volume and weight of tumors were significantly lower in the miR-124- and miR-506 -overexpressing groups than in the control group (Figure 3A, 3B). [score:3]
The above results suggest that miR-124 or miR-506 inhibit CRC tumor cell proliferation and invasion in vivo. [score:3]
Our data showed that miR-124 and miR-506 target DNMTs (DNMT3B and DNMT1), thus leading to global DNA hypomethylation in CRC. [score:3]
A. Expression levels of miR-124 (top) and miR-506 (bottom) in 40 CRC patients were detected by qRT-PCR. [score:3]
The expression levels of miR-124 and miR-506 were detected by qRT-PCR in 40 pairs of CRC tissues and their matched adjacent tissues, as well as in CRC cell lines. [score:3]
Furthermore, we studied the biological effects of the overexpression of miR-124 and miR-506 in CRC. [score:3]
Figure 1 A. Expression levels of miR-124 (top) and miR-506 (bottom) in 40 CRC patients were detected by qRT-PCR. [score:3]
The ectopic expression of miR-124 or miR-506 dramatically decreased the number of lung metastases in mice (Figure 3C). [score:3]
C. Representative images of miR-124 and miR-506 expression by ISH. [score:3]
C. The effect of the miR-124 or miR-506 mimics on the protein expression of E-cadherin, MGMT and P16, determined by western blotting in SW480 and SW680 cells. [score:3]
The effects of miR-124 and miR-506 inhibitors on tumor cell proliferation were also tested. [score:3]
To assess the biological effects of overexpressing miR-124 or miR-506 in CRC cells, miR-124 or miR-506 mimic was transfected into SW620 and SW480 cells. [score:3]
Functional studies identified miR-124 and miR-506 acted as new tumor suppressors in CRC. [score:3]
The results showed that the expression levels of miR-124 and miR-506 were significantly lower in SW620 and SW480 cells than in NCM460 normal colonic epithelium cells (Figure 1B). [score:3]
C. The effect of miR-124 and miR-506 on the protein expression of DNMT3B, SP1 and DNMT1 by western blot. [score:3]
We found that the overexpression of miR-124 or miR-506 increased the sensitivity of CRC cells to these two agents (Figure 2D). [score:3]
Our study showed that miR-124 and miR-506 efficiently modulate DNA hypomethylation by targeting DNMT3B and DNMT1. [score:3]
The Mann–Whitney U-test and Spearman's correlation analyses were used to analyze the relationship between miR-124 and miR-506 expression and the clinicopathological features of CRC. [score:3]
We found that miR-124 and miR-506 inhibitors decreased the sensitivity of CRC cells to these two agents (Supplementary Figure S1 and S2). [score:3]
The ectopic expression of miR-124 or miR-506 has been reported to be associated with the progression in many tumors [18– 24]. [score:3]
The above results prompted us to verify that miR-124 or miR-506 inhibit CRC tumor cell proliferation and invasion in vivo. [score:3]
B. Relative expression of miR-124 (left) and miR-506 (right) in 8 cell lines derived from CRC and a cell line derived from normal colonic epithelium was determined by qRT-PCR. [score:3]
These results suggested that the abnormal expression of miR-124 and miR-506 are associated with CRC. [score:3]
To generate the miR-124 and miR-506 expression vectors, a genomic fragment covering the region encoding pri-miR-124 or pri-miR-506 and its up-and downstream region were PCR-amplified and cloned into the pLvthm vector (Addgene Inc, USA). [score:3]
The in vitro data demonstrated that miR-124 and miR-506 function as tumor suppressors in CRC. [score:3]
In conclusion, miR-124 and miR-506 may be valuable markers of CRC prognosis and may play an important role in the development and progression of human CRC. [score:2]
miR-124 and miR-506 have also been reported to function as important regulators in many human cancers [18– 20]. [score:2]
Compared with the scrambled control transfection, the overexpression of either miR-124 or miR-506 significantly attenuated the proliferation of the two cell lines (Figure 2A). [score:2]
SW620 cells were used to stably over-express miR-124 and miR-506 using a lentiviral -based system (pLVTHM) for tumourigenesis assays. [score:2]
A. SW620 (left) and SW480 (right) cells were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:1]
A. The 3′UTRs of DNMT3B and SP1 contain putative binding sites for miR-124 and miR-506. [score:1]
The DNMT3B, SP1 and DNMT1 complementary sites were cloned downstream of the firefly luciferase gene and cotransfected with miR-124 mimic, miR-506 mimic or scrambled oligonucleotide. [score:1]
The miR-124 and miR-506 expression levels in eight CRC cell lines were measured by qRT-PCR. [score:1]
Moreover, mutating the putative miR-124 and miR-506 sites in the 3′-UTR of DNMT3B and SP1 abrogated the luciferase responsiveness to miR-124 and miR-506 (Figure 4B). [score:1]
However, transfecting miR-124 and miR-506 into SW620 cells also generated a marked decrease in DNMT1 protein levels (Figure 4C). [score:1]
SW620 cells infected with miR-124, miR-506 or scrambled control were subcutaneously injected into the flanks of nude mice (five in each group). [score:1]
The percentages of miR-124 and miR-506 cells in 3 representative high-power fields of individual samples were analyzed. [score:1]
B. SW480 (left) and SW680 (right) cells were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:1]
Among samples from 40 patients with CRC, approximately 82.5% (P = 0.000, 33 of 40 patients) and 75% (p = 0.000, 30 of 40 patients) of tumor tissues revealed notable reductions in the miR-124 and miR-506 levels, respectively (Figure 1A). [score:1]
miR-124 mimic, miR-506 mimic and scrambled oligonucleotides were purchased from Genecopoeia (China) and transfected into CRC cells using Lipofectamine 2000 reagent (Invitrogen, USA) according to the manufacturer's instructions. [score:1]
Figure 4 A. The 3′UTRs of DNMT3B and SP1 contain putative binding sites for miR-124 and miR-506. [score:1]
A. SW480 (left) and SW680 (right) cell were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:1]
Cells transfected with miR-124 mimic, miR-506 mimic and scrambled oligonucleotides (Ambion, USA) were plated in 12-well plates at the desired cell concentrations. [score:1]
To further verify the biological roles of miR-124 and miR-506 in human CRC, we performed in situ hybridization (Figure 1C) to evaluate the miR-124 and miR-506 levels in 40 CRC tissues and 40 normal colon tissues and found that miR-124 and miR-506 were strongly downregulated in CRC tissues compared with normal tissues. [score:1]
The intensities of miR-124 and miR-506 staining were scored on a scale from 0 to 4 as follows: 0–1 (no staining), 1–2 (weak staining), 2–3 (medium staining), and 3–4 (strong staining). [score:1]
Therefore, we over-expressed miR-124 and miR-506 in SW620 and SW480 cells to evaluate the possible role of miR-124 and miR-506 in CRC pathogenesis. [score:1]
Briefly, miR-124 and miR-506 miRCURY LNA custom detection probes (Exiqon, Denmark) were used for ISH. [score:1]
However, miR-124 and miR-506 have rarely been studied in the context of CRC. [score:1]
The transfections of miR-506 and miR-124 were successful (Supplement Figure S1). [score:1]
In contrast to DNMT3B and SP1, miR-124 and miR-506 are not predicted to hybridize with the DNMT1 3′UTR region. [score:1]
Xenograft tumors were generated via the subcutaneous injection of CRC cells (2 × 10 [6], SW620/scramble or SW620/miR-506) into the hind limbs of 4–6 week-old Balb/C athymic nude mice. [score:1]
Two concentrations of miR-124 mimic and miR-506 mimic (10 and 50 nM) were tested. [score:1]
In this study, we showed that the miR-124 and miR-506 levels were significantly lower in CRC tissues than in normal tissues, as indicated by qRT-PCR and in situ hybridization histochemistry (ISH). [score:1]
We also found that transfecting the miR-124 and miR-506 mimics into SW620 cells markedly decreased the protein levels of DNMT3B and SP1 (Figure 4C). [score:1]
Several reports have indicated that either miR-124 or miR-506 plays a significant role in growth, metastasis and proliferation [18– 20]. [score:1]
Forty-eight hours after transfection with miR-124 mimic, miR-506 mimic or scrambled control, SW620 cells were exposed to a range of CDDP or 5-FU concentrations for 24 h, and the cell viability was determined and recorded. [score:1]
Among samples from 40 patients with CRC, approximately 65% (P = 0.000, 26 of 40 patients) and 70% (P = 0.000, 28 of 40 patients) of tumors revealed notable reductions in the miR-124 and miR-506 levels, respectively. [score:1]
A. SW620 cells infected with miR-124, miR-506 or scramble control were subcutaneously injected into the flanks of nude mice (n = 5 for each group). [score:1]
[1 to 20 of 89 sentences]
2
[+] score: 173
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3
The expression levels of CD151, VIM, and SNAI2 were suppressed by miR-506, while CDH1 was upregulated at mRNA (Fig. 1B) and protein level (Fig. 1C). [score:8]
We overexpressed precursor miR-506 in MDA-MB-231 human breast cancer cell lines to monitor the expression of these target genes and CDH1 (an epithelial marker). [score:7]
The suppressive function of miR-506 in TGFβ -induced EMT was validated by the suppression of expression of EMT-related genes such as SNAI2, CD151, and CDH1 (Fig. 3B). [score:7]
In this study, we observed that miR-506 played a role as a master suppressor of EMT in breast cancer through the direct targeting CD151, VIM and SNAI2. [score:6]
The migration of MDA-MB-231 cells was also suppressed by the overexpression of miR-506 (Fig. 4C and 4D). [score:5]
There is an NF -κB binding site in the promoter region of miR-506, and we confirmed the suppressive function of NF -κB on miR-506 expression. [score:5]
We studied the functional relevance of miR-506 with respect to invasion, migration, and adhesion, and showed that overexpressed miR-506 acted as a tumor suppressor miRNA in breast cancer cells. [score:5]
Here, we used enrichment analysis to identify miR-506 as being a miRNA that targets the 3′ untranslated regions (UTRs) of EMT-related genes such as SNAI2, VIM, and CD151. [score:5]
When we overexpressed miR-506 in MDA-MB-231 cells, the expression of NF -κB was not changed (Fig. 2D). [score:5]
As shown in Fig. 2C, miR-506 expression was induced by the suppression of NF -κB. [score:5]
Figure S1 Expression of CD151, VIM, and SNAI2 in miR-506 -overexpressed MDA-MB-468 human breast cancer cell lines. [score:5]
We found that overexpression of miR-506 suppressed TGFβ -mediated induction of EMT marker. [score:5]
The overexpression of miR-506 in MDA-MB-231 cells was found to suppress invasive potential through Matrigel (Fig. 4B). [score:5]
We found that overexpression of miR-506 inhibited morphological changes in TGFβ -treated MCF10A cells (Fig. 3A), whereas in the absence of TGFβ treatment, overexpression of miR-506 did not affect epithelial characteristics. [score:5]
Mutations in the miR-506 target site in these UTRs were generated using the QuikChange Multi Site-directed Mutagenesis kit (Stratagene, La Jolla, CA). [score:5]
We therefore hypothesized that NF -κB binds upstream of the promoter region of miR-506, which further targets the 3′UTR of CD151 and other EMT markers such as VIM and SNAI2 to regulate EMT. [score:4]
Mutations in the miR-506 target sites in these UTRs were generated. [score:4]
Selection of miR-506 as a candidate EMT -regulating miRNA and suppression of EMT-related genes by miR-506. [score:4]
We wanted to know if miR-506 suppression was necessary for NF-κB to regulate EMT. [score:4]
To test whether NF -κB suppressed miR-506, we knocked down NF -κB in MDA-MB-231 cells using siNF -κB. [score:4]
Overexpression of miR-506 resulted in a significant decrease in luciferase activity with the wildtype 3′UTR of CD151, VIM, and SNAI2, but not with mutant 3′UTR sequences (Fig. 1D). [score:3]
Overexpression of miR-506 also induced morphological changes in MDA-MB-231 cells from long and elongated mesenchymal-like cell to round and circular epithelial-like cell (Fig. S2). [score:3]
In this sense, the suppression of miR-506 by NF -κB might be required for the progression of EMT. [score:3]
Figure S2 Morphological changes in miR-506 -overexpressed MDA-MB-231 human breast cancer cell lines. [score:3]
0064273.g004 Figure 4 (A) Overexpression of miR-506 in MDA-MB-231 cells may alter the binding to the various matrix components responsible for cell adhesion (extracellular matrix array) such as fibronectin, collagen 1, collagen 4, lamin 1, fibrogen (bovine serum albumin was used as a negative control). [score:3]
These experiments suggested that miR-506 inhibited TGFβ -induced EMT signaling. [score:3]
Interestingly, we found that miR-506 was predicted to target 16 EMT-related genes (Table S2). [score:3]
The overexpression of miR-506 decreased the adhesion of MDA-MB-231 cells to a range of extracellular matrix components such as fibronectin, collagen 1, collagen 4, laminin1, and fibrogen (Fig. 4A). [score:3]
Table S2 List of epithelial to mesenchymal transition-related target genes for miR-506. [score:3]
Our results indicated that NF-κB bound to the promoter region of miR-506, which itself targets several EMT markers in an inverse manner. [score:3]
In comparison to MCF10A, normal breast epithelial cells, the expression of NF -κB was consistently high and miR-506 level was low in the four cancer cell lines. [score:3]
Binding of NF-κB to upstream sequences of miR-506 to suppress transcription. [score:3]
The patient samples were divided into high and low miR-506 based on median expression levels (P<0.05, n = 206). [score:3]
On the other hand, the expression of NF -κB mRNA was low and the miR-506 level was high in MCF10A cells (Fig. 2B). [score:3]
miR-506 is predicted to target the 3′UTRs of CD151, VIM, and SNAI2. [score:3]
Regulation of epithelial to mesenchymal transition by miR-506. [score:2]
Regulation of EMT-related Genes by miR-506. [score:2]
NF-κB -mediated Regulation of miR-506. [score:2]
Regulation of Epithelial to Mesenchymal Transition by miR-506. [score:2]
Interestingly, the expression of NF-κB remained unaffected in miR-506 -transfected cells induced by TGFβ [27], and remained induced in TGFβ and miR-506 transfected cells as compared to control conditions. [score:2]
MDA-MB-231 cells were cotransfected with UTR (normal and mutant)-bearing psiCHECK2 vector and pcDNA3-cloned miR-506 for 48 hrs. [score:1]
In addition, we also observed the effects of miR-506 on EMT-related genes in another breast cancer cell line, MDA-MB-468 by real-time reverse transcription polymerase chain reaction (RT-PCR) (Fig. S1). [score:1]
Effects of miR-506 in cell adhesion, migration, and invasion. [score:1]
0064273.g002 Figure 2 (A) Chromatin immunoprecipitation showing the interaction between NF-κB and miR-506. [score:1]
We investigated the effect of miR-506 overexpression on TGFβ -induced EMT in MCF10A cells. [score:1]
Importantly, we found an NF -κB binding motif upstream of the promoter region of miR-506. [score:1]
0064273.g003 Figure 3(A) miR-506 could induce TGFβ -induced morphological changes in MCF10A cells. [score:1]
0064273.g001 Figure 1 (A) The clinical significance of miR-506 in patients with breast cancer. [score:1]
We also investigated the correlation between NF-κB mRNA expression and miR-506 in MDA-MB-436, MDA-MB-231, MDA-MB-468, and MDA-MB-157 cells. [score:1]
Effects of miR-506 in Cell Adhesion, Migration, and Invasion. [score:1]
Promoter sequence analysis revealed a putative NF -κB binding site at −1013 bp from precursor miR-506. [score:1]
Overexpression of miR-506 on the regulation of overall migratory properties were observed by (C) wound healing assay or (D) Boyden Chamber Assay (3D migration assay). [score:1]
miR-506 showed a significant association with DRFS (p = 0.0458) in more than 98% of patients (Fig. 1A), while miR-124, which targets the same seed sequences, showed no significant impact on DRFS in the same patients (data not shown), thereby leading us to further investigate miR-506. [score:1]
We performed a meta-analysis of a publically available human breast cancer miRNA expression database (GSE22216) [24] and investigated the effects of miR-506 on distant-relapse-free survival (DRFS) in breast cancer. [score:1]
These results strongly suggested that miR-506 acted downstream of NF-κB and that NF-κB could not induce EMT in the presence of miR-506 (Fig. 3B). [score:1]
[1 to 20 of 55 sentences]
3
[+] score: 126
Three miRNAs (miR-153, miR-506 and miR-200b) that target 3′-UTR of Snail1, Slug and ZEB1 mRNAs, respectively, were found to be induced by KLF4 overexpression, and suppressed by KLF4 depletion, in HCC cells. [score:7]
Targeting and inhibition of translation of Snail1 by miR-153, Slug by miR-506 and ZEB1 by miR-200b in HCC cells. [score:7]
The luciferase activities were quantified in these cells, suggesting that miR-506 targets 3′UTR of Slug mRNA to inhibit its translation (Figure 2E). [score:7]
Targeting inhibition of translation of Snail1 by miR-153, Slug by miR-506 and ZEB1 by miR-200b in HCC cells. [score:7]
For example, miR-200 family has been shown to inhibit ZEB1 and ZEB2 [19– 23], miR-506 has been shown to block Slug translation [24– 27], and miR-153 has been shown to suppress Snail1 and ZEB2 [28]. [score:7]
KLF4 may suppress the HCC cell growth and invasion through miR-153, miR-506 and miR-200b -mediated suppression of Snail1, Slug and ZEB1, respectively. [score:5]
In a loss-of-function experiment, we suppressed the levels of miR-153, miR-506 and miR-200b in KLF4 -overexpressing HCC cells, which completely abolished the effects of KLF4 on cell growth and invasion. [score:5]
In order to confirm that these specific bindings (miR-153/Snail1, miR-506/Slug, miR-200b/ZEB1) are functional, we either overexpressed miR-153, miR-506 and miR-200b, or inhibited miR-153, miR-506 and miR-200b in both. [score:5]
MiR-153, miR-506 and miR-200b overexpression inhibits HCC cell growth. [score:5]
These data suggest that miR-153, miR-506 and miR-200b overexpression suppresses HCC cell invasion. [score:5]
Figure 7 KLF4 may suppress the HCC cell growth and invasion through miR-153, miR-506 and miR-200b -mediated suppression of Snail1, Slug and ZEB1, respectively. [score:5]
We found that miR-153, miR-506 and miR-200b depletion abolished the suppressive effects of KLF4 on HCC cell growth (Figure 6A) and invasion (Figure 6B), suggesting that KLF4 may inhibit the HCC cell growth and invasion through miR-153, miR-506 and miR-200b. [score:5]
These data suggest that miR-153, miR-506 and miR-200b overexpression inhibits HCC cell growth. [score:5]
By bioinformatics analyses, we found that miR-153 bound to 3′UTR of Snail1 mRNA at 440-448 base site (A), miR-506 bound to 3′UTR of Slug mRNA at both 439-446 and 843-849 base sites (B), and miR-200b bound to 3′UTR of ZEB1 mRNA at both 463-479 and 892-898 base sites (C) D. We either overexpressed miR-153, miR-506 and miR-200b, or inhibited miR-153, miR-506 and miR-200b in both. [score:5]
MiR-153, miR-506 and miR-200b overexpression suppresses HCC cell invasion. [score:5]
Further, miR-506 has been shown to block Slug translation [24– 27], and miR-153 has been shown to suppress Snail1 and ZEB2 [28]. [score:5]
In order to confirm that KLF4 may affect the HCC cell growth and invasion through miR-153, miR-506 and miR-200b, we overexpressed the antisense for miR-153, miR-506 and miR-200b in KLF4 -expressing HepG2 cells, and compared to HepG2-KLF4 cells and HepG2-scr cells. [score:4]
Figure 5In order to confirm that KLF4 may affect the HCC cell growth and invasion through miR-153, miR-506 and miR-200b, we overexpressed the antisense for miR-153, miR-506 and miR-200b in KLF4 -expressing HepG2 cells, and compared to HepG2-KLF4 cells and HepG2-scr cells. [score:4]
Preparation of miR-153, miR-506 and miR-200b overexpressing HepG2 cells. [score:3]
Target sequence was inserted into pGL3-Basic vector (Promega, Madison, WI, USA) to obtain pGL3-Snail1-3′UTR, pGL3-Slug-3′UTR or pGL3-ZEB1-3′UTR, which contain the miR-153, miR-506 or miR-200b binding sequence, respectively. [score:3]
MiR-153, miR-506 and miR-200b depletion abolishes the suppressive effects of KLF4 on HCC cell growth and invasion. [score:3]
In order to confirm that KLF4 may affect the HCC cell growth and invasion through miR-153, miR-506 and miR-200b, we overexpressed the antisense for miR-153, miR-506 and miR-200b in KLF4 -expressing HepG2 cells (Figure 5A– 5B), and compared to HepG2-KLF4 cells and HepG2-scr cells in both MTT and transwell cell migration assay. [score:3]
Transfection with either KLF4, scr, shKLF4, miR-153, as-miR-153, null, miR-506, as-miR-506, miR-200b, or as-miR-200b -expressing plasmids was performed with Lipofectamine-2000 (Invitrogen). [score:3]
From all the miRNA candidates, we specifically found that KLF4 overexpression increased the levels of miR-153, miR-506 and miR-200b in both, while KLF4 depletion decreased the levels of miR-153, miR-506 and miR-200b in both (Figure 1C). [score:3]
and C. The levels of miR-153, miR-506 and miR-200b were shown in KLF4-modifed. [score:1]
KLF4 increases levels of miR-153, miR-506 and miR-200b in HCC cells. [score:1]
The effects of modifications of miR-153, miR-506 and miR-200b on cell growth in an, in both HepG2 cells (A) and Huh7 cells (B) *p<0.05. [score:1]
Then we examined the effects of miR-153, miR-506 and miR-200b on HCC cell growth in an. [score:1]
By bioinformatics analyses, we found that miR-153 bound to 3′UTR of Snail1 mRNA at 440-448 base site (Figure 2A), miR-506 bound to 3′UTR of Slug mRNA at both 439-446 and 843-849 base sites (Figure 2B), and miR-200b bound to 3′UTR of ZEB1 mRNA at both 463-479 and 892-898 base sites (Figure 2C). [score:1]
The miR-506 -modified HCC cells were transfected with 1μg of Slug-3′UTR luciferase-reporter plasmid. [score:1]
Figure 6Depletion of miR-153, miR-506 and miR-200b abolished the effects of KLF4 on HCC cell growth in an. [score:1]
Depletion of miR-153, miR-506 and miR-200b abolishes the effects of KLF4 on HCC cell growth and invasion. [score:1]
The sequences encoding miR-153, antisense (as)-miR-153, miR-506, as-miR-506, miR-200b, or as-miR-200b were similarly cloned into pLVX-ZsGreen1-C1 vector. [score:1]
Depletion of miR-153, miR-506 and miR-200b abolished the effects of KLF4 on HCC cell growth in an. [score:1]
[1 to 20 of 34 sentences]
4
[+] score: 50
Through qPCR, we found that the expression levels of these three miRNAs were all significantly down-regulated in mutant type (rs5951785 near hsa-miR-506, P=4.47×10 [−2], Figure 1A; rs5951785 near hsa-miR-507, P=4.80×10 [−3], Figure 2A; rs1447393 near hsa-miR-510, P=3.00×10 [−4], Figure 3A). [score:6]
The miR-506 expression level was significant down-regulated in mutant type compared with the wild type. [score:5]
GLI3, a potential target of miR-506, has been reported highly expressed in spermatogonia cells (both type A and type B) [18]. [score:5]
Our results demonstrated that i) rs5951785 near hsa-miR-506/507 was associated with significantly increased risk of NOA, while rs1447393 near hsa-miR-510 decreased the risk of NOA; ii) rs5951785 significantly decreased binding affinity of hsa-miR-506, inhibited cell proliferation and promoted cell apoptosis. [score:3]
Besides, we also found hsa-miR-506 mutant-type significantly increased cell apoptosis (P=1.69×10 [−2], Figure 1D, 1E), while there was no difference in hsa-miR-507 nor hsa-miR-510 between the wild and mutant alleles (Figure 2D, 2E; Figure 3D, 3E), implicating that growth inhibition was accompanied with increased apoptosis population. [score:3]
To understand the impacts of these two SNPs (rs5951785 near hsa-miR-506/507; rs1447393 near hsa-miR-510) on the miRNA expression, we transfer the wild-type pre-miRNAs and mutant pre-miRNAs into HEK-293T cells. [score:3]
It suggested that rs5951785 near hsa-miR-506 exerted a growth-inhibiting function. [score:3]
Rs5951785 near miR-506 significantly inhibited the HEK-293T cell growth at 48h and 72h. [score:3]
It could inhibit cell proliferation and promote cell death [19], which was consistent with our functional analysis of rs5951785 near hsa-miR-506, suggesting that GLI3 might be associated with NOA. [score:3]
A. Quantitative real-time PCR was applied to detected mature miR-506 expression levels in transfected HEK-293T cells. [score:3]
Figure 1 A. Quantitative real-time PCR was applied to detected mature miR-506 expression levels in transfected HEK-293T cells. [score:3]
Functional analysis revealed that rs5951785 near miR-506 might contribute to the risk of NOA. [score:1]
As shown in Figure 1, cell growth was significantly decreased at 48h (P=1.00×10 [−2]) and 72h (P=9.30×10 [−3]) with hsa-miR-506 mutant type (Figure 1C). [score:1]
The cell apoptosis population was markedly increased in HEK-293T cells transfected with miR-506 mutant type. [score:1]
Through conducting dual-luciferase reporter assay, we found that the luciferase activities of CDK4, GLI3, PIK3C2A, ADAM17, SFRP2 and PRDX1 were significantly decreased when compared to the vectors, suggesting that they were the potential targets of hsa-miR-506, hsa-miR-507 and hsa-miR-510, respectively (Figure 1B, 2B, 3B). [score:1]
There was no difference of cell cycle between miR-506 wild and miR-506 mutant type. [score:1]
In conclusion, rs5951785 near hsa-miR-506/507 and rs1447393 near hsa-miR-510 were identified to be potential modifier of NOA. [score:1]
Eventually, two SNPs (rs5951785 and rs1447393), located near the regions of hsa-miR-506/507 and hsa-miR-510, were found to be associated with NOA, and in vitro analysis was performed to clarify their potential functions in spermatogenesis. [score:1]
Only rs547043 near hsa-miR-4330, rs5951785 near hsa-mir-506/507, rs1447393 near hsa-mir-510, and rs5985440 near hsa-miR-652 were retained associated with NOA, among which rs547043 near hsa-miR-4330 was inconsistent with screening stage. [score:1]
F, G. Effects of rs5951785 near miR-506 on cell cycle were performed with flow cytometry. [score:1]
C. CCK8 was used to determine the influence of rs5951785 near miR-506 on cell growth. [score:1]
[1 to 20 of 21 sentences]
5
[+] score: 50
Indeed recent literature, in accordance with our observations, suggests a putative role as an anti-oncogenic miRNA in human bronchial epithelial cells where miR-506 expression regulates cell growth and proliferation [21] but also its over expression has been recently related to hydroxycamptothecin resistance in a colon cancer cell line by direct inhibiting expression of Peroxisome proliferator-activated receptors (PPARs) [22]. [score:11]
Thirty-nine samples belonging to training set and 24 samples belonging to test set were analyzed by qRT-PCR for expression of the mature form of miR-506 showing an intermediate fold-change expression in training and test set. [score:5]
A) Comparison of miR-506 expression obtained by miRNA expression profile and qRT-PCR on 39 samples (17 early and 22 late relapse) from training set (upper panels) and 24 samples (10 early and 14 late relapse) from test set (lower panels). [score:5]
Three miRNAs belonging to the chrXq27.3 cluster, miR-513b, miR-506 and miR-513a-5p, were selected according to their different fold change expression observed by microarray and class comparison analysis on EOC samples (see Table 2) and their expression was forced by transient transfection in two EOC cell lines, S KOV3 and OAW42. [score:5]
Figure 2A) Comparison of miR-506 expression obtained by miRNA expression profile and qRT-PCR on 39 samples (17 early and 22 late relapse) from training set (upper panels) and 24 samples (10 early and 14 late relapse) from test set (lower panels). [score:5]
Forced expression of miR-513b caused a higher accumulation of cells in G2-M phase as compared to miR-506 and miR-513a-5p whereas forced expression of miR513a induced a more consistent increase of cell debris as compared to the other two miRNAs. [score:3]
Forced expression of miR-506 induced a significant reduction of cell proliferation in both cell lines (39±3% and 57±7%, relative to control cells transfected with the scrambled miRNA, in S KOV3 and OAW42 respectively), whereas miR-513a-5p and miR-513b showed a less intense, albeit significant anti proliferative effect (37±5% and 17±6% of reduction respectively) on OAW42 cells only (Figure 5A). [score:3]
Ectopic expression of miR-506, miR-513a-5p and miR-513b was pursued by exposing EOC cell lines to 20 nM miRNA precursors, purchased as a pre-miR molecule (Ambion, Austin,TX). [score:3]
However, their forced expression only partially reflects the effects observed with miR-506. [score:3]
DDP sensitivity at concentration ranging from 10x10 [−6] to 0.03x10 [−6] M was significantly increased (P=0.001) as assessed by sulphorodamine-B (SRB) assay following forced expression of miR-506 (Figure 6B). [score:2]
A relevant increase of cells blocked in the G1 phase in both cell lines (increase range 16% - 30% compare to control in three independent experiments) was observed upon forced expression of miR-506, while increase of cell death, evaluated as cellular debris, was observed in OAW42 cells only (Figure 5B). [score:1]
The role of miR-506 in tumor cells has not yet clearly defined and probably, as already described for other miRNAs, its effect could be cell and tumor type dependent. [score:1]
In particular a role for miR-506 in favoring blockade of cell cycle in G1 phase and inducing cell death is suggested by our data. [score:1]
As in the case of miR-506, the microarray and qRT-PCR showed a significant correlation median (R [2] = 0.661; Figure 2A-B). [score:1]
In particular six out of eight chrXq27.3 miRNAs (miR-506, miR-507, miR-508-3p, miR-509-3p, miR-509-5p and miR-514) showed Pearson’s correlation greater than 0.95 (Figure 4A). [score:1]
[1 to 20 of 15 sentences]
6
[+] score: 40
There are further reports that downregulation of this cluster marks early relapse in advanced stage ovarian cancer patients [31] and expression of miR-506 inhibits NRAS expression and suppress growth and tumorigenesis in a lung cancer mo del [32]. [score:12]
Induction of miR-506 and miR-507 expression was greatly attenuated by low doses of α-amanitin (Figure 3A and B), which selectively targets RNA pol II -dependent transcription. [score:5]
Accordingly, miR-506 was readily inducible in the presence of high doses of cycloheximide, a potent inhibitor of translation (Figure 3C). [score:5]
Figure 4 Inhibition of phosphoinositol-3-kinase elevates the expression of miRNA-506. [score:5]
So far, we were unable to see such an elevated expression of miR-506 in several melanoma cell lines (RS, ESK, unpublished). [score:3]
FOXO1-AAA-ER expressing HEK-293T cells were treated with 4-hydoxitamoxifen for the indicated periods of time, and the levels of miR-506 were compared by quantitative PCR using RNU6B as an internal control. [score:2]
An apparent increase in miR-506 levels in cycloheximide -treated vs. [score:1]
We used miR-506 as a representative member of the miRNA cluster. [score:1]
In both cases, LY294002 treatment was accompanied by an increase in miR-506 expression, as measured by quantitative RT-PCR (Figure 4). [score:1]
analysis confirmed that activation of FOXO1 caused prominent induction of miR-506 in as little as 4 hours (Figure 2). [score:1]
The functions of the molecules from the miR-506 cluster are still unknown. [score:1]
Figure 2 Time-course of miR-506 induction upon activation of FOXO1-AAA-ER. [score:1]
The miRNAs included miR-506, miR-507, miR-508, miR-513a-1, miR-513a-2 (highly homologous miR-513a-1 and miR-513a-2 were indistinguishable by array hybridization. [score:1]
In fact, the apparent level of miR-506 was even higher in the presence of cycloheximide due to slightly decreased levels of the internal control (RNU6B) in these conditions. [score:1]
[1 to 20 of 14 sentences]
7
[+] score: 32
A plethora of miRNAs, including miR-200 family members and miR-506, have been found to directly regulate the expression of the target genes that are known to play critical roles in EMT regulation (Figure  4). [score:8]
MiR-506 augmented E-cadherin expression, inhibited cell migration and invasion, and prevented TGFβ -induced EMT by targeting SNAI2. [score:6]
MiR-506 expression is downregulated in an integrated mesenchymal subtype of serous ovarian cancer through methylation of CpG sites on the miR-506 promoter (Figure  3A). [score:6]
MiR-506 was reported to inhibit TGFβ -induced EMT by directly targeting vimentin in a human breast cancer cell line [86]. [score:5]
The results of a recent report suggest that miR-506 is a novel microRNA that inhibits EMT [72]. [score:3]
The genomic position of miR-506 and five candidate methylation-regulated positions are also shown. [score:2]
The nanoparticle delivery of miR-506 in orthotopic ovarian cancer mouse mo dels led to E-cadherin induction and reduced tumor growth [72]. [score:1]
Figure 3 MiR-200 and miR-506 DNA methylation genomic loci and promoters of E- and N-cadherin. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 29
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-297
Bioinformatic analysis identified circHIPK2, which has two complementary residues with miR-506-3p; a conserved miR-506-3p binding site within the σ-1R 3’-untranslated region was defined as the putative target of miR-506-3p (Fig.   6a), indicating that circHIPK2 may regulate σ-1R expression by acting as a ceRNA. [score:8]
Moreover, circHIPK2-siRNA also inhibited the upregulation of BiP (Fig.   6h–i), collagen I and III (Fig.   6j–k) induced by SiO [2], indicating that circHIPK2 was upstream of functional changes in HPF-a (Fig.   7) Fig. 6 circHIPK2 is involved in regulating σ-1R after SiO [2] exposure in HPF-a a Bioinformatics analysis showing that circHIPK2 contains one site complementary to miR-506-3p and two miR-506-3p binding sites in σ-1R. [score:7]
In current study found that circHIPK2 expression increased, whereas miR-506-3p remained stable, which matches the predicted ceRNA mechanism. [score:3]
d qRT-PCR assay showing SiO [2] had no effect on miR-506 expression in six independent experiments; * p < 0.05 vs the control group. [score:2]
Bioinformatic analysis suggests that circHIPK2 and miR-506-3p may be involved in σ-1R regulation via ceRNA. [score:2]
circHIPK2 showed a slight increase, whereas miR-506-3p remained stable with the time exposure of SiO [2], indicating that ceRNA may be involved in σ-1R regulation. [score:2]
Study indicates that long non-coding RNA NEAT1 facilitates pancreatic cancer progression through negative modulation of miR-506-3p [62]. [score:1]
Recent study suggest that circRNA-homeodomain-interacting protein kinase-2 (circHIPK2) may act as an endogenous miR-506-3p sponge, leading to an increase in σ-1R [27], whereas its host gene-HIPK2 is involved in cell growth modulation, apoptosis, proliferation and tumor progression 28– 31. [score:1]
a Bioinformatics analysis showing that circHIPK2 contains one site complementary to miR-506-3p and two miR-506-3p binding sites in σ-1R. [score:1]
Huang B Long non-coding RNA NEAT1 facilitates pancreatic cancer progression through negative modulation of miR-506-3pBiochem. [score:1]
Moreover, circHIPK2 and miR-506-3p levels were then detected by qRT-PCR (Fig.   6c–d). [score:1]
[1 to 20 of 11 sentences]
9
[+] score: 25
In follow-up functional experiments, overexpression of miR-506 in ovarian cancer cells augmented E-cadherin expression, inhibited cell migration and invasion, and prevented TGF- β -induced EMT by targeting SNAI2, a transcriptional repressor of E-cadherin. [score:9]
Liu et al. reported that miR-506 also suppressed ovarian cancer cell proliferation and induced senescence by directly targeting the CDK4/6-FOXM1 axis [73]. [score:6]
Eight key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were identified and predicted to regulate 89% of the targets in this network. [score:4]
From integrated genomic analysis, 8 key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were predicted to regulate 89% of the miR targets in the network [26]. [score:4]
In an orthotopic ovarian cancer mouse mo del, nanoparticle delivery of miR-506 significantly reduced tumor growth. [score:1]
6.4. miR-506. [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 23
The expression of miR-410 was significantly up-regulated (p < 0.05), miR-491 displayed no expression change, miR-384 and miR-506 were both down-regulated respectively (p < 0.05) in A549 cells (Figure 1B). [score:11]
A. Four miRNAs (miR-410, miR-491-5P, miR-384 and miR-506-3P) were predicted by both algorithms (TargetScan, miRanda). [score:3]
B. The expression of miR-410, miR-491-5P, miR-384 and miR-506-3P in A549 cells was determined by qRT-PCR. [score:3]
Figure 1 A. Four miRNAs (miR-410, miR-491-5P, miR-384 and miR-506-3P) were predicted by both algorithms (TargetScan, miRanda). [score:3]
22 miRNAs were preliminarily filtered (data not shown) and then four of them (miR-410, miR-506, miR-491, miR-384) were selected because of their lower free binding energy which meant more possibility that miRNA might bind to its target gene (Figure 1A). [score:3]
[1 to 20 of 5 sentences]
11
[+] score: 14
However, miR-506 was shown to be upregulated in early melanoma progression and downregulated later in metastatic melanoma [30] and may therefore play an important role in this cell type. [score:7]
The effects of miR-506, that binds to the same target site, were not tested. [score:3]
ND (1/9) ND (0/9) 34.69 (7/9) 37.39 (1/3) miR-124 34.37 (9/9) 34.73 (5/9) 35.09 (2/9) 32.68 (3/3) miR-506 35.19 (2/9) 34.73 (3/9) 32.87 (9/9) ND (0/9) miR-148a 27.90 (9/9) 28.29 (9/9) 28.82 (9/9) 33.12 (3/3) miR-148b 28.37 (9/9) 28.65 (9/9) 29.37 (9/9) 35.19 (1/3) miR-152 34.08 (9/9) 35.12 (9/9) 34.26 (9/9) 35.05 (2/3) miR-16 contr. [score:1]
It has not been shown previously that miR-124 and/or miR-506 can affect Mitf mRNA. [score:1]
miR-506 was detected in 501mel and MeWo cells. [score:1]
miR-124 and miR-506. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 12
Meanwhile, miR-124 and miR-506 function as a tumor-suppressive genes in nasopharyngeal carcinoma and their suppressive effects are mediated chiefly by repressing FOXQ1 expression [177, 178]. [score:7]
Previous study has demonstrated that miR-506 inhibits proliferation and EMT of cervical cancer cells by targeting FOXQ1, suggesting that the miR-506/FOXQ1 axis plays an important role in the pathogenesis of cervical cancer [176]. [score:5]
[1 to 20 of 2 sentences]
13
[+] score: 12
[21] Downregulation of miR-506~514 cluster was also previously reported in seminomas and embryonal carcinomas as compared to CIS and NT, [29] suggesting its important role in TGCT development. [score:4]
A striking observation is the loss of miR-506~514 cluster expression in TGCT. [score:3]
miR-21 and miR-223 expression levels were increased in TGCTs, whereas the eight miRNAs in the miR-506~514 cluster (miR-506, miR-507, miR-508-5p, miR-510, miR-513a-5p, miR-513b, miR-513c and miR-514a-3p) were reduced in TGCTs as compared with NT. [score:2]
For mature miRNAs, cDNA was synthesized from 150 ng of total RNA and used to quantitate miR-506 (ID 001050), miR-510 (ID 002241), miR-514a-3p (ID 242955_mat), miR-513c (ID 002756), miR-513b (ID 002757), miR-513a-5p (ID 002090), miR-507 (ID 001051), miR-508-5p (ID 002092), miR-21 (ID 000397), miR-223 (ID 002295), miR-372 (ID 000560) and miR-373 (ID 000561). [score:1]
This cluster is conserved in primates, and consists of seven distinct miRNAs, that is, miR-506, miR-507, miR-508, miR-509, miR-510, miR-513 and miR-514. [score:1]
The finding of decreased expression for the miR-506~514 cluster in TGCTs prompted us to investigate their functional consequences in TGCT cell lines. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 11
Similar results were observed in p53 [+/+] and p53 [−/−] cells (Figure 2c): the expression levels of miR-3151 and miR-663b were upregulated in p53 [−/−] cells, while the expression levels of miR-140, miR-30b, miR-506, miR-124 and miR-30c were downregulated in p53 [−/−] cells compared with that in p53 [+/+] cells. [score:10]
Several miRNAs were proposed, among which seven of them were reported to be related to p53: miR-140, miR-30b, miR-3151, miR-506, miR-124, miR-30c, and miR-663b 19, 20, 21, 22, 23, 24 (Figure 2a). [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 11
Other miRNAs from this paper: hsa-let-7b, hsa-mir-26a-1, hsa-mir-31, hsa-mir-26a-2
Recent studies that used colon cancer cell lines have reported that EZH2 expression was inversely associated with microRNA-506 [38], microRNA-26a, and let-7b [39]; these microRNAs downregulated EZH2 expression by directly targeting 3′-UTR. [score:11]
[1 to 20 of 1 sentences]
16
[+] score: 10
MicroRNA-506 inhibits gastric cancer proliferation and invasion by directly targeting Yap1 [28]. [score:5]
Deng J, Lei W, Xiang X, Zhang L, Yu F, Chen J et al. MicroRNA-506 inhibits gastric cancer proliferation and invasion by directly targeting Yap1. [score:5]
[1 to 20 of 2 sentences]
17
[+] score: 9
In GC, oncogenic miRNAs such as miR-21 [12], miR-362 [13] and miR-296-5p [14] are abnormally upregulated, and tumor suppressing miRNAs such as miR-506 [15], miR-129-5p [16] and miR-361-5p [17] are significantly downregulated. [score:9]
[1 to 20 of 1 sentences]
18
[+] score: 9
miR-506 had been demonstrated to target peroxisome proliferator-activated receptor alpha (PPAR-α) and administration of PPAR-α agonist suppresses the oxidative damage and inflammation during cerebral ischemia [28, 29]. [score:5]
Since miR-506 was up-regulated in all ischemic stroke samples, this may be a cause for oxidative damage and inflammation during ischemic stroke. [score:4]
[1 to 20 of 2 sentences]
19
[+] score: 9
Elucidation of the molecular mechanism demonstrated that miR-506 promotes G1/S phase arrest, apoptosis and the chemosensitivity of human cervical cancer cells by directly targeting Gli3, revealing that the miR-506/Gli3 axis is a new potential therapeutic drug target for the clinical therapy of human cervical cancer [58]. [score:6]
miR-506 suppresses the growth and viability of cervical cancer cells and in animal mo dels. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 8
From 245 miRNAs expressed in both sALS and controls but at statistically different levels, 6 were expressed in sALS at higher levels than controls [miR-373*, miR-551a (p < 0.01); miR-506, miR-518a-5p, miR-518e*, and miR-890 (p < 0.05)] (Table  3) and all the remaining (239) were down-regulated in the sALS SC tissue (Additional file 1: Table S1). [score:8]
[1 to 20 of 1 sentences]
21
[+] score: 8
Tumor suppressor CASP1_HUMAN and CFLAR_HUMAN was connected with oncogene CASP9_HUMAN, and several miRNAs, for example hsa-miR-124, hsa-miR-182, hsa-miR-504, hsa-miR-506 and has-miR-96 negatively regulated CASP9_HUMAN. [score:4]
There are five miRNAs, including (Homo sapiens) hsa-miR-124, hsa-miR-182, hsa-miR-504, hsa -miR-506 and hsa-miR-96, and these five miRNAs may negatively regulate caspase-9 -mediated signaling pathways. [score:2]
Gene Name Protein Name Consensus Results CASP9 Caspase-9 hsa-miR-124 hsa-miR-182 hsa-miR-504 hsa-miR-506 hsa-miR-96 RIPK2 Receptor-interacting serine/threonine-protein kinase 2 hsa-miR-200b hsa-miR-200c GRB2 Growth factor receptor-bound protein 2 hsa-miR-182 CDK2 Cyclin -dependent kinase 2 hsa-miR-200b hsa-miR-200c hsa-miR-429 CASP8 Caspase-8 hsa-miR-17 hsa-miR-20b hsa-miR-495 hsa-miR-519d hsa-miR-93 RAF1 Rapidly Accelerated Fibrosarcoma (RAF) proto-oncogene serine/threonine-protein kinase hsa-miR-15a hsa-miR-15b hsa-miR-16 hsa-miR-195 hsa-miR-424 hsa-miR-497 With the development of systems biology, carcinogenesis could be interpreted as the malfunction of perturbed protein functional interaction networks in a cell, and therefore, analyses of apoptosis-related network from a systems-level perspective is of great significance [29, 30, 31]. [score:2]
[1 to 20 of 3 sentences]
22
[+] score: 8
In humans, miR-513 is located within a cluster (miR-506:514) that is overexpressed in melanoma [32]. [score:3]
Figure 4 Proposed clustering of P. alecto miRNAs corresponding to the human ChrX miR-506:514 cluster. [score:1]
In the human genome, FMR1 and AFF2 are located on the X chromosome, adjacent to two recognised miRNA clusters (miR-888:892 and miR-506:514). [score:1]
Fifteen P. alecto miRNAs shown to be probable members of a cluster homologous to the human ChrX miR-506:514 cluster (Figure  4) were aligned using MEGA. [score:1]
A proposed arrangement is shown in Figure  4. Overall, 15 bat miRNAs may represent members of a cluster homologous to the human X-chromosomal miR-506:514 cluster. [score:1]
One of these (pal-can-303) returned a BLAST hit to miR-506, while the other two returned only low-quality BLAST hits (however these included miR-465, which is also located on the X chromosome in humans and a member of an equivalent miRNA cluster in rodents). [score:1]
[1 to 20 of 6 sentences]
23
[+] score: 8
Over -expression of miR-506 and miR-103/107 decreased Rad51 expression and subsequently reduced HR-directed repair of DNA damage induced by cisplatin, leading to an augmented response to cisplatin [33, 34]. [score:6]
Liu G, Yang D, Rupaimoole R, Pecot CV, Sun Y, Mangala LS, et al. Augmentation of response to chemotherapy by microRNA-506 through regulation of RAD51 in serous ovarian cancers. [score:2]
[1 to 20 of 2 sentences]
24
[+] score: 7
Sun Y. Hu L. Zheng H. Bagnoli M. Guo Y. Rupaimoole R. Rodriguez-Aguayo C. Lopez-Berestein G. Ji P. Chen K. MiR-506 inhibits multiple targets in the epithelial-to-mesenchymal transition network and is associated with good prognosis in epithelial ovarian cancerJ. [score:4]
As a result, miR-506 sensitized EOC (epithelial ovarian cancer cells) to chemotherapy and inhibited EMT -mediated metastasis [58]. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Moreover, miR-361-5p, miR-1184 and miR-218-1* were the top among the upregulated miRNAs while miR-1265, miR-20b*, miR-520d-5p and miR-506 were the top among the downregulated miRNAs in the SE animals. [score:7]
[1 to 20 of 1 sentences]
26
[+] score: 7
Many of the miRNAs that regulate the cell cycle protein levels and that are predicted to target the mRNA of these proteins share identical seed sequence (e. g. miR-124 and miR-506 have identical seed sequence and both downregulate p21). [score:7]
[1 to 20 of 1 sentences]
27
[+] score: 6
miR-506 suppresses EMT, cell proliferation, migration and invasion by upregulating E-cadherin [73]. [score:6]
[1 to 20 of 1 sentences]
28
[+] score: 6
miR-21 and miR-10b downregulate PPAR α in liver, while miR-506 targets this receptor in human CRC cell lines [88– 91]. [score:6]
[1 to 20 of 1 sentences]
29
[+] score: 6
Furthermore, Lei et al. observed MALAT1 upregulation in OC cell lines and specimens, and identified a novel mechanism by which MALAT1 enhanced tumor cell growth by targeting miR-506 in the context of a negative feed-back loop. [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 6
Deng et al. delineated that miR-506 inhibits gastric cancer proliferation and invasion by directly targeting YAP1 [31]. [score:6]
[1 to 20 of 1 sentences]
31
[+] score: 5
Other miRNAs from this paper: mmu-mir-200b, hsa-mir-200b
MicroRNA-506 suppresses tumor proliferation and metastasis in colon cancer by directly targeting the oncogene EZH2. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 5
A virus inhibitory effect is mediated also by miR-506, which suppresses the mRNA encoding CD151, an important receptor of PRRSV (170). [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 5
Out of 12 miRNA families that were predicted to target the PRKAG1 sense promoter in both human and mouse, nine (miR-718, miR-1224, miR-188, miR-346, miR-296, miR-671, miR-221, miR-1306, miR-506) can form highly stable duplex structures with their target sites (MFE ≤ −30 kcal/mol) in both organisms. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-497
In addition, recently miR-497 and miR-506 were reported to inhibit cell proliferation and induce apoptosis by targeting YAP1 in HCC [31, 32]. [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 4
In contrast, miR-506, a new class of miRNA, suppresses EMT and metastasis in ovarian cancer by regulating both E-cadherin and Vimentin/N-cadherin [32]. [score:4]
[1 to 20 of 1 sentences]
36
[+] score: 4
Bioinformatics analyses revealed that miR-29, miR-124, miR-183 and miR-506 might regulate the expression of ITGB1. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 3
Also, Sun at al. [87], documented that MIR506 exerted a tumor suppression effect in pancreatic ductal adenocarcinoma by inducing autophagy-related cell death. [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
In human colon cancer, miR-506 inhibits cell proliferation and metastasis by binding the 3′UTR of EZH2 [15]. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
Finally, our analysis identified a cluster of testis-enriched miRNAs located on chromosome X, including miR-506, miR-507, miR-508 and miR-514, that was previously reported as preferentially expressed in testis [32]. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
IGGAP1 is targeted by miR-124 [18] in hepatocellular carcinoma and by miR-506 in breast cancer [19]. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
Four of these families are reported to be oncogene or tumour suppressors in breast cancer, while two of them, miR-99 and miR-506, have a role in prostate/head-and-neck cancer and melanoma, respectively. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Likewise, a RBP -induced structural switch modulating miRNA -mediated gene expression by PUM proteins has also been described on mRNAs coding for oncogene E2F transcription factor 3 (E2F3), which is strongly repressed by the cooperative action of miR-506 and PUM1 in bladder carcinoma cells [42]. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Recent studies have shown that many miRs play suppressive or oncogenic roles in gastric cancer including miR-126 [9], miR-145 [10], miR-326 [4], miR-506 [11], and miR-29 [12]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 2
While some miRNAs were significant in many scenarios (including hsa-miR-106a (130 comparisons), hsa-miR-361-5p (130 comparisons), hsa-miR-17 (125 comparisons), hsa-miR-423-5p (125 comparisons), hsa-miR-320d (122 comparisons), and hsa-miR-20a (120 comparisons)), others were significantly dysregulated in just a few comparisons (including hsa-miR-506 (3 comparisons), hsa-miR-202* (5 comparisons), hsa-miR-361-3p (6 comparisons), hsa-miR-429 (7 comparisons), hsa-miR-548a-3p (9 comparisons), or hsa-miR-518e (9 comparisons)). [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 2
Liu G. Yang D. Rupaimoole R. Pecot C. V. Sun Y. Mangala L. S. Li X. Ji P. Cog dell D. Hu L. Augmentation of response to chemotherapy by microRNA-506 through regulation of RAD51 in serous ovarian cancers J. Natl. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
The analyses highlights the important role of a miRNA regulatory network consisting of eight key miRNAs for the mesenchymal subtype including miR-141 and miR-200, miR-29c, miR-101, miR-506, and miR-128. [score:2]
[1 to 20 of 1 sentences]
47
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Patients with alcoholic cardiomyopathy showed changes in several microRNAs (miR-138, miR-485-5p, miR-506, miR-512-5p, miR-548-3p, and miR-4262) and suggested to be involved in the development of cardiac dysfunction [171]. [score:2]
[1 to 20 of 1 sentences]
48
[+] score: 2
We discovered pro-proliferative miRNAs (miR-9 [*], miR-93, miR-130a, miR-130b, miR-301, miR-302b, miR-302d, miR-363, miR-372, miR-373), and anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506, miR-517c) in A2780 cells. [score:1]
To further evaluate miRNA mimics on the inhibition of cell proliferation in A2780, we selected top 10 anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506 and miR-517c) from the first screen, and examined the cell viability in A2780 cells transfected with different concentrations of miRNAs (5, 25, 50 nM). [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 2
Other miRNA families (such as the miR-199, miR-17 and miR-506 families) that have not received previous annotation in cancer studies were also observed to be deregulated either consistently or inconsistently in two or three tumor types in this study (Table 1). [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 2
UCA1 acted as an oncogenic role in NSCLC and it was proved that the expression of UCA1 in NSCLC samples was significantly higher compared with adjacent tissues partly through competitively ‘sponging’ miR-506-3p [83]. [score:2]
[1 to 20 of 1 sentences]
51
[+] score: 1
miR-124 and miR-506 were particularly noteworthy. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
So far, a variety of miRNAs have been shown to be involved in the pathogenesis of colon cancer, such as miR-34a [33], miR-506 [34], miR-675 [35] and miR-200 [36]. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
Three miRNAs are observed in the miRDeep analysis of these clusters, which may be assigned as mir-506, mir-508 and likely mir-509. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
In breast cancer cells, recent data demonstrate that YAP depletion by miR-506 disrupts the cell cycle through a G0/G1 phase arrest and reduction of S-phase and G2-M phase cells [32]. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
We chose the best predictions for each SNP: for rs1047383, hsa-miR-124-1, hsa-miR-139, hsa-miR-140, hsa-miR-144, hsa-miR-377, hsa-miR-506, has-miR-548h, hsa-miR-1324 and hsa-mir-3148; and for rs708910, hsa-miR-582 and hsa-miR-140. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
The miR-513 subfamily belongs to the miR-506–514 cluster. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
We also noticed that a significant number of miRNAs (such as miR-516-3p, miR-744 and miR-506) that had not been previously annotated in male infertility studies were enriched in these gene sets. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
Finally we validated two miRNAs (miR-506 and miR-889) that were not detected in any sample by sequencing. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
While we were writing this manuscript, Zhang et al. reported rhesus miR-506, 507, 508, 509-1, 509-2, 510 and 514 sequences [41]. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
Some larg families, the mir-506, mir-1972, mir-3118 and mir-3179 families are primate-specific. [score:1]
[1 to 20 of 1 sentences]