sort by

9 publications mentioning hsa-mir-514a-2

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-514a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 140
Identification and validation of PEG3 as a direct target of miR-514a-3pWe applied miRNA target prediction tools to identify candidate targets of miR-514a-3p. [score:8]
The paternally expressed gene 3 (PEG3) was ranked top as a predicted target of miR-514a-3p with three conserved and two poorly conserved sites using TargetScanHuman (release 6.2; http://www. [score:7]
Reduction of nuclear p50 expression was observed both in cells overexpressing miR-514a-3p and with silencing of PEG3 expression (Figure 4b). [score:7]
Given that miR-514a-3p promotes apoptosis and PEG3 is a direct target of miR-514a-3p, we tested whether ectopically expressed PEG3 could rescue the miR-514a-3p -mediated apoptotic effect. [score:6]
As shown in Figure 3d, ectopic expression of PEG3 significantly decreased the apoptotic effect caused by miR-514a-3p overexpression. [score:5]
Given that p50 translocates to the nucleus and activates target genes, we quantified p50 expression in the nuclear fractions of TCam-2 cells transfected with miR-514a-3p mimic or shPEG3-1 and their respective negative controls. [score:5]
Collectively, our findings suggest a mo del of PEG3 -mediated activation of NF- κB in TGCT: PEG3 overexpression, because of the loss of miR-514a-3p -mediated suppression, recruits TRAF2 to activate the NF- κB pathway that protects germ cells from apoptosis (Figure 5c). [score:5]
To determine the effect of miR-514a-3p on PEG3 expression, we quantified PEG3 expression by RT-qPCR and western blot analyses in TCam-2 and 2102Ep cells upon transfection of miR-514a-3p. [score:5]
Suppression of PEG3 and overexpression of miR-514a-3p significantly reduced luciferase activity (>30%, P=0.01; Figure 5a). [score:5]
For constructs with the PEG3 3’UTR, synthetic oligonucleotides containing WT or MUT sequences of the putative miR-514a-3p -binding sites of PEG3 were cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) at PmeI and XbaI sites according to the manufacturer’s protocol. [score:5]
We applied miRNA target prediction tools to identify candidate targets of miR-514a-3p. [score:5]
Furthermore, we demonstrate that ectopic expression of PEG3 rescues the apoptotic effect caused by miR-514a-3p overexpression. [score:5]
Identification and validation of PEG3 as a direct target of miR-514a-3p. [score:4]
In conclusion, we provide evidence to support a mo del of PEG3 -mediated activation of NF- κB in TGCT, in which loss of miR-514a-3p in TGCT increases PEG3 expression that recruits TRAF2 and activate the NF- κB pathway for protecting cells from apoptosis. [score:3]
Here, we demonstrate the pro-apoptotic function of miR-514a-3p in TGCT cells by targeting PEG3. [score:3]
Similar results were obtained in 2102Ep cells, in which ectopic expression of miR-514a-3p decreased the accumulation of p50 in the total cell lysate and in the nuclear lysate (Supplementary Figure 2). [score:3]
We co -transfected TCam-2 cells with miR-514a-3p mimic and an expression plasmid encoding the full-length coding sequence of PEG3 without the 3’UTR region (pCMV6-PEG3-CDS) or a vector control and examined the apoptotic effect by cleaved PARP. [score:3]
Four miR-514a-3p target sites (sites 1–4, Supplementary Figure 4) were inserted into the 3’UTR of a luciferase reporter vector. [score:3]
Second, we performed luciferase reporter assays to examine whether miR-514a-3p could directly target the 3’UTR of PEG3. [score:3]
The seed-MUT construct completely abolished the suppression of luciferase activity by miR-514a-3p (Figure 2k). [score:3]
Two different approaches were applied to determine whether PEG3 is directly regulated by miR-514a-3p. [score:3]
We observed dosage -dependent decreases of PEG3 mRNA and protein levels in TCam-2 cells overexpressing miR-514a-3p (Figures 2g and h). [score:3]
As a complementary strategy to assess the interaction between miR-514a-3p and PEG3 3’UTR, we included a seed-mutant (MUT) construct, which has two to three mismatches in the seed region of the target sites (Figure 2f). [score:3]
Furthermore, it was the fourth highest-ranked target of miR-514a-3p by miRanda (http://www. [score:3]
miR-21 and miR-223 expression levels were increased in TGCTs, whereas the eight miRNAs in the miR-506~514 cluster (miR-506, miR-507, miR-508-5p, miR-510, miR-513a-5p, miR-513b, miR-513c and miR-514a-3p) were reduced in TGCTs as compared with NT. [score:2]
Overexpression of miR-510 or miR-514a-3p also induced apoptosis (13% and 17%, respectively), as demonstrated by the caspase-3 activity assay (Figure 2b). [score:2]
To investigate whether PEG3 could be a target of miR-514a-3p, we compared the gene and protein expression levels in TGCTs and NT. [score:2]
Significant reductions of luciferase activity were observed in the cells overexpressing miR-514a-3p compared with miRNA mimic negative controls (more than threefolds and P<0.01 for all three different concentrations of miR-514a-3p mimic; Figure 2k). [score:2]
Here, we describe the identification of a set of deregulated miRNAs in TGCT and the role of miR-514-3p and NF- κB in TGCT. [score:2]
We found that the PEG3 protein level, but not the mRNA level, was increased in TGCTs compared with NT (P=0.002; Figures 2c, d and Supplementary Figure 3) and inversely correlated with miR-514a-3p expression (r=−0.547, P=0.015; Figure 2e). [score:2]
Using the, we showed that overexpression of miR-510 or miR-514a-3p in TCam-2 cells reduced cell viability (15% and 24%, respectively; P<0.05) as compared with the NC -treated cells (Figure 2a). [score:2]
Collectively, our results indicate that miR-514a-3p -mediated regulation of PEG3 has an important role in cell survival of TGCT cells. [score:2]
Because of the more pronounced functional effects observed for miR-514a-3p, we further investigated its direct target and its role in the pathogenesis of TGCT. [score:2]
We observed an enrichment of PEG3 mRNA in the cells with miR-514a-3p overexpression compared with the control (Figure 2j). [score:2]
WST-1 colorimetric assay (11644807001; Roche Diagnostics, Indianapolis, IN, USA) was performed to determine the effects on cell viability from overexpression of miR-510 or miR-514a-3p. [score:2]
This cluster is conserved in primates, and consists of seven distinct miRNAs, that is, miR-506, miR-507, miR-508, miR-509, miR-510, miR-513 and miR-514. [score:1]
Functional studies of miR-510 and miR-514a-3p in TGCT cell lines. [score:1]
Cells were co -transfected with 80 ng of pGL2 vector (Promega) bearing NF- κB enhancer region and TATA box upstream of firefly luciferase gene, [43] Renilla vector (Promega) and shPEG3-1 vector or miR-514a-3p mimic using lipofectamine 2000 (Life Technologies). [score:1]
To further demonstrate the functional significance of PEG3 and miR-514a-3p in the activation of the NF- κB pathway, we tested their effects on NF- κB luciferase reporter activity. [score:1]
TCam-2 cells were co -transfected with the wild-type (WT) PEG3 3’UTR construct and miR-514a-3p mimic or negative control. [score:1]
First, we quantified PEG3 mRNA levels by RT-qPCR after argonaute 2 immunoprecipitation (AGO2-IP) of TCam-2 cells transfected with miR-514a-3p mimic or negative control. [score:1]
Activation of the NF- κB pathway by PEG3 in TGCT cell linesGiven that PEG3 has been shown to protect cells from apoptosis by activation of the NF- κB pathway via interaction with tumor necrosis factor receptor -associated factor 2 (TRAF2), [25] we evaluated the effects of PEG3 and miR-514a-3p expressions on NF- κB activation. [score:1]
For mature miRNAs, cDNA was synthesized from 150 ng of total RNA and used to quantitate miR-506 (ID 001050), miR-510 (ID 002241), miR-514a-3p (ID 242955_mat), miR-513c (ID 002756), miR-513b (ID 002757), miR-513a-5p (ID 002090), miR-507 (ID 001051), miR-508-5p (ID 002092), miR-21 (ID 000397), miR-223 (ID 002295), miR-372 (ID 000560) and miR-373 (ID 000561). [score:1]
Cells were co -transfected with 80 ng of pmirGLO reporter plasmid (WT or MUT) and miR-514a-3p mimic or NC using lipofectamine 2000 (Life Technologies). [score:1]
For miRNA mimics, cells were transfected with three different concentrations (5, 25 and 50 nM) of mirVana miR-510 mimic (MC12923), miR-514a-3p mimic (MC13114) or miRNA mimic Negative Control #1 (NC, ID_4464058) using siPORT NeoFX transfection agent (Life Technologies). [score:1]
Concordantly, reduced PEG3 mRNA and protein levels were also observed in 2102Ep cells transfected with miR-514a-3p mimic (Supplementary Figure 2). [score:1]
Given that PEG3 has been shown to protect cells from apoptosis by activation of the NF- κB pathway via interaction with tumor necrosis factor receptor -associated factor 2 (TRAF2), [25] we evaluated the effects of PEG3 and miR-514a-3p expressions on NF- κB activation. [score:1]
Cells were seeded into five 10-cm tissue culture plates at a density of 2 × 10 [6] cells per plate, and transfected with 50 nM of miR-514a-3p mimic or NC. [score:1]
[1 to 20 of 48 sentences]
2
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-199a-1, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-141, hsa-mir-144, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-146a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-29c, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-133b, hsa-mir-429, hsa-mir-487a, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-526b, hsa-mir-514a-1, hsa-mir-514a-3, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-542, hsa-mir-378d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-2114, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-514b, hsa-mir-378c, hsa-mir-4303, hsa-mir-4309, hsa-mir-4307, hsa-mir-4278, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The aberrantly expression miRNAs such as has-miR-214*, has-miR-105, has-miR-548n, and has-miR-514 which are upregulate in gastric cancerous tissues. [score:6]
The expression level of miR-214* is increased 3.79-fold (Figure 4(a)), miR-105 is increased 16.32-fold (Figure 4(b)), has-miR-548 is 4.21-fold (Figure 4(c)), and miR-514 is increased 11.76-fold (Figure 4(d)) in comparing with normal tissues. [score:3]
[1 to 20 of 2 sentences]
3
[+] score: 5
Among the differentially expressed miRNAs, 11 (miR-199a-5p, miR-218, miR-409a, miR-433, miR-511, miR-514, miR-551, miR-562, miR-556-3p, miR-1178 and miR-1205) were common to both doses (Figure 2D) and exhibited similar expression patterns (Tables 1A and C). [score:5]
[1 to 20 of 1 sentences]
4
[+] score: 5
9 cluster members (miR521, 520e, 373*, 373, 367) were not detected in both baboon liver and lymphocytes; however, miR514 cluster member on chr X was expressed in the liver and not detected in lymphocytes. [score:3]
Interestingly, miR-514 is known to have different copy numbers among primate species; three copies in human, four in chimpanzee and one in other primates [46], an indication that miRNA duplications may exhibit an evolutionary temporal pattern. [score:1]
Further, we noted that miR-514, a cluster member on the X chromosome was differentially detected in baboon liver and lymphocytes. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 4
Finally, our analysis identified a cluster of testis-enriched miRNAs located on chromosome X, including miR-506, miR-507, miR-508 and miR-514, that was previously reported as preferentially expressed in testis [32]. [score:3]
Our analysis also revealed a cluster conserved in horse on chromosome X, consisting of miR-514 and miR-8908n. [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 1
Zhang et al. showed that the duplications of another subfamily (miR-514) in this cluster occurred independently in humans and chimpanzees [6]. [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
One of the three bat miRNAs in this cluster (pal-can-103) returned a non-identical BLAST hit to dog miR-514, while the other two returned only low-quality hits. [score:1]
[1 to 20 of 1 sentences]
9
[+] score: 1
In particular six out of eight chrXq27.3 miRNAs (miR-506, miR-507, miR-508-3p, miR-509-3p, miR-509-5p and miR-514) showed Pearson’s correlation greater than 0.95 (Figure 4A). [score:1]
[1 to 20 of 1 sentences]